Indian Journal of Biotechnology Vol 14, October 2015, pp 489-494

Isolation of moderately halophilic from Tunisian soil samples and transformation by electroporation using Escherichia coli- sp. shuttle vector

Toru Matsui School of Bioscience and Biotechnology, Tokyo University of Technology, Katakura-cho, Hachioji, Tokyo, 192-0982, Japan Received 19 December 2014; revised 17 July 2015; accepted 3 August 2015

Halophilic and salt-resistant bacteria were isolated from soil samples collected from Tunisia. Among them, strain 21a grew at NaCl concentration ranging 1-15%, optimum at 3%, showing that it is moderately halophilic bacteria. Phylogenetic analysis based on the 16S rRNA gene sequence showed that strain 21a was closely related to Halomonas aquamarina and H. venusta with sequence similarities of 99.7, and 97.1%, respectively, suggesting that the strain belongs to the genus Halomonas. It was transformed by electroporation either with a plasmid vector pCCMR1, constructed with a replication region fragment from a cryptic plasmid of Chromohalobacter marismortui, or a transposon-complex. Segregational plasmid stability of strain 21a harboring pCCMR1 was higher when cultivated in low NaCl concentrations under non-selective pressure.

Keywords: Electroporation, Halomonas aquamarina, halophytic, salt-resistant

Introduction conjugation6,7 and transformation by electroporation are organisms that require salt for growth has not been reported to date, thus limiting genetic and survival. Among halophilic microorganisms, studies of these species. The use of electroporation halobacteria (extremely halophilic aerobic Archaea) procedures has recently gained popularity, mainly to and moderately halophilic bacteria (which grow best in introduce exogenous DNA into cells. This technique media with 0.5-2.5 M NaCl) predominate and have an facilitates the transformation of various organisms, important ecological role in hypersaline environments1. which otherwise failed using other methods like those Although moderate halophiles have recently gained a employed calcium chloride for Escherichia coli and considerable biotechnological interest2, biochemical/ polyethylene glycol for Bacillus subtilis. genetic characterization has been limited to specific Electroporation can increase the efficiency of enzymes and compatible solutes, such as, ectoine and transformation (it is possible to obtain a higher glycine betaine3,4. number of transformants per microgram of DNA), The isolation and physiological and biochemical and the technique is simple and rapid. Transposon- processes of halophilic bacteria have been extensively directed mutagenesis has emerged as a powerful tool studied5, but our knowledge of cellular properties at for the localization of genes in specific chromosomal the molecular level lags far behind those of other locations. Recently, EZ::Tn transposome systems . Moreover, in view of the widespread were constructed to create random transposon industrial and medical applications of halophiles, libraries for both Gram-positive8 and Gram-negative there has been considerable interest in strain bacteria9. However, the genetic analyses of halophiles improvement and genetic transfer systems for have so far been hindered by the lack of an efficient halophilic bacteria, especially for Halomonas or gene transfer system for generating defined mutants. Chromohalobacter2. One of the reasons for this Very recently, application of electroporation for situation is the lack of rapid gene transformation Halomonas sp. was reported but the detailed procedures. The members of the family information was not available10. Halomonadeceae, such as, Halomonas or Here, we report the successful transformation of Chromohalobacter species, mainly undergo moderately halophilic bacteria, Halomonas sp. strain 21a by electroporation with either a plasmid or transposon ______Tel/Fax: +81-42-637-2302/2129 vector and characterization of the recombinant strain [email protected] harboring a plasmid-type shuttle vector. 490 INDIAN J BIOTECHNOL, OCTOBER 2015

Materials and Methods samples in Tunisia (30 samples), aliquots of samples Bacterial Strains and Growth Conditions spread on 0.1 times concentration of LB medium The bacterial strains and plasmids employed in the containing 1.5% agar were incubated at 30°C for present study are listed in Table 1. C. marismortui 1 to 2 wk, followed by isolation of the colony for NBRC 103155T was used for isolation of its cryptic growing under the same conditions. Growth of plasmid, pCM1. E. coli JM109 was grown in bacterial cells was estimated spectrophotometrically Luria-Bertani (LB) medium at 37°C11. The medium by measuring the optical density (OD) at 660 nm. was supplemented with antibiotics (kanamycin or Maximum specific growth rate (1/h) was estimated by ampicillin) to a final concentration of 100 µg/L plotting the cell concentration against time in a whenever found necessary. Minimal medium (MM) log-linear plot, as described elsewhere13. was prepared as previously described12 and supplemented with 1% glucose as the sole carbon and DNA Manipulations and Molecular Genetic Protocols energy source and designated as MMG. For the PCRs of 16S rRNA, ectB and repA in pCM1 were performed using Ex-Taq (Takara-bio, Shiga, Japan) screening of isolates from soils and pond-water under the following conditions: initial denaturation at Table 1—Bacterial strains and plasmids used in this study 95°C for 5 min, followed by 35 cycles of denaturation

Strain or plasmid Description Source of reference at 95°C for 30 sec, annealing at 53°C for 1 min, extension at 72°C for 1 min and a final extension at Bacterial strains E. coli JM109 recA1, endA1, gyrA96, Takara-bio Co. 72°C for 5 min using a thermal cycler type-PC818 - + (Astec Co., Fukuoka, Japan). Primers used for the thi-1, hsdR17(r m ), K K - - PCR are listed in Table 2. Transformation of e14 (mcrA ), supE44, pCCMR1 or EZ::TN Tnp into halophilic relA1, ∆ (lac-proAB)/F‘ + bacteria was carried out by electroporation as 〔 traD36, proAB , lac I, described by Choi et al15. Competent cells (100 µL) lacZ∆M15〕 and 1 µL of DNA were mixed and electroporated at C. beijerinckii Type strain NBRC* NBRC 103041 2.5 kV, 25 µF, 200 Ω and 0.2-cm cuvette using a C. marismortui Type strain NBRC MicroPulser electroporator (Bio-Rad, Hercules, CA, NBRC 103155T USA). After electroporation, aliquots mixed with Halomonas sp. 21a Isolate from soil in Present study 1 mL LB broth were incubated at 30°C for 3 h, Chebika, Tunisia followed by spreading the broth on LB plates H. pacifica Type strain NBRC NBRC102220 containing 100 mg/L of kanamycin (Km). H. halodenitrificans Type strain NBRC Transposition efficiency was expressed as NBRC14912 Km-resistant colony forming units (CFU) H. halodurans Type strain NBRC per microliter of the transposome used. Other NBRC15607 techniques for DNA manipulations were performed as H. halophila Type strain NBRC 11 NBRC 102604 described by Sambrook and Russell . H. meridiana Type strain NBRC NBRC 15608 Construction of E. coli-Halomonas sp. Shuttle Vector Plasmids The E. coli-Halomonas sp. shuttle vector was pCM1 Cryptic plasmid from C. Mellado et al7 constructed to examine the transformation efficiency of marismortui the pCM1 replicon as previously described7. Plasmid pHSG298 r Takara-bio Co. E. coli cloning vector; Km pCM1 was isolated from C. marismortui NBRC pCCMR1 E. coli-Halomonas sp. Present study 103155T. The replicon was amplified using the primer shuttle vector harboring 1.6 kb fragment from set MR239 and MR240, based on the sequence of the plasmid pCM1 repA gene (X86092), and ligated with pCR2.1 r pT7 (blue) E. coli cloning vector; Ap Takara-bio Co. (Invitrogen Co., CA) resulting in the construction of pCR2.1 E. coli cloning vector; Life Technologies the E. coli-Halomonas sp. shuttle vector, pCCMR1. r r Co. Ap , Km DNA Sequencing EZ-Tnp Transposon complex Epicentre Co. r Genomic DNA of bacterial strains was isolated vector; Km using ISOPLANT (Nippon-gene, Tokyo, Japan) and *National Bioresource Research Center, Japan used for PCR of the 16S rRNA, and ectB gene locus. MATSUI: HALOPHILIC BACTERIA FROM TUNISIA 491

The BLAST program (http://ncbi.nlm.nih.gov/ 15% NaCl. As shown in Table 3, the isolates BLAST/; NCBI, Bethesda, MD) was used for gene consisted of not only Gram-positive but also Gram- homology search using the standard program default. negative bacteria, based on the 16S rRNA sequence A phylogenetic tree based on the 16S rRNA gene analyses. Growth characteristics of these isolates in sequence was constructed using the neighbor-joining high NaCl concentration revealed that 7 of the 11 method16 with the Kimura two-parameter model as a isolates were halophilic, whereas the other isolates distance corrector17 after alignment of sequences with were salt-resistant. Strain 21a, belonging to family the CLUSTALX multiple sequence alignment , class γ-proteobacteria based on the program18. 16S rRNA sequence was selected for further examinations using a plasmid from Nucleotide Sequences Accession Numbers Chromohalobacter sp. (Fig. 1a). It grew in the Sequences of a fragment of the 16S rRNA gene, presence of NaCl, ranging 1-15%, with a maximum from the isolates examined in the present study, had specific growth rate at 5% NaCl in MMG medium been assigned DDBJ/EMBL/GenBank accession (Fig. 2). PCR analysis using degenerate primers numbers as shown in Table 3. Sequence of the DNA showed the existence of homologue ectB, a gene that fragment of ectB from strain 21a has been assigned encodes for diaminobutyrate 2-oxoglutarate DDBJ/EMBL/GenBank acc. no. AB760233. transaminase, a key enzyme in the biosynthesis of ectoine, which is a compatible solute that acts as a Results protective osmolyte for halophilic bacteria. Identity of Characterization of Moderately Halophilic Bacterial Strain 21a the gene and the deduced primary sequence to the From soil and water samples collected from the closest gene locus (ectB from Halomonas sp. TD01) Chebika forest and the Chat El jerid, a salt lake with was 79.1% and 94.8%, respectively. Phylogenetic low nutrient sand area in Tunisia, 11 types of bacteria analysis of the primary sequence with related genes were grown in low-nutrient plates (0.1 times the revealed that it could be categorized in the group of concentration of that in the LB medium) containing Halomonas spp. (Fig. 2). Table 2—Primers used in the present study

Name Target gene Sequence Reference (5′-3′) EUB11f 16S rRNA TGRGTTTGATCMTGGCTYAG 14 EUB1511r 16S rRNA TGGHTACCTTGTTACGACTT 14 MR239 repA AATTCGCCGGTGCCGGGCCG present study MR240 repA GATATCCTAGTTCAACTTCT present study ectB-SN ectB GAACGCATGGAATCYRA present study ectB-AN ectB ATACCGCCCTCGCC present study

*R=(A,G), M=(A,C), W=(A,T), S=(C,G), Y=(C,T), D=(G,A,T), H=(A,T,C)

Table 3—List of the isolates from Tunisian samples

Isolates Source Top match strain NCBI Identity* (acc. no.) acc. no. (%) Salt resistant 13C El Jerid Bacillus sp. PBCC24 (JQ342242) AB743803 99.3 16B El Jerid Paenibacillus polymyxa (EF634026) AB743804 99.9 21A Chebika Marinobacter sp. SeaH-As6w (FJ607356) AB743805 99.6 22B Chebika Kangiella aquimarina SW154 (NR025801) AB743807 99.6 21B Chebika Citreicella thiooxidans (EU440958 ) AB743811 99.9 21C Chebika Vibrio alginolyticus HN08801 (FJ906750) AB743806 99.9 21a Chebika Halomonas sp. Ezam1 (GQ181205 ) AB743802 99.7 22c Chebika Halobacillus trueperi XJSL8-9 (GQ903458) AB743812 99.8 22d Chebika Halobacillus sp. Q-sH1 (JQ305105) AB743809 100 22e Chebika Halobacillus sp. G-12 (FJ386525 ) AB743810 99.6 22S Chebika Vibrio alginolyticus HN08801 (FJ906750) AB743808 96.8

*Identity ratio of the16S rRNA sequence and the strain with the highest homology 492 INDIAN J BIOTECHNOL, OCTOBER 2015

Electroporation Transformation of Strain 21a Genetic transformation by electroporation was examined using the plasmid shuttle vector, pCCMR1 in E. coli and Halomonas. Preliminary optimization of electroporation conditions (Fig. 3) showed that a field strength of 12.5 kV/cm-cuvette resulted in the transformation efficiency of 20 CFU/µg DNA. This protocol could also be applied for other Halomonas spp. as shown in Table 1. Segregational stability of the plasmid in strain 21a was further examined in different media compositions under non-selective pressure. Plasmid stability of pCCMR1 in strain 21a was significantly affected by the medium composition, resulting in the highest stability when grown in LB medium for prolonged generations, as shown in Fig. 4. Bacterial growth in a complex medium and low NaCl concentration showed higher stability compared to that in synthetic medium and high NaCl concentration. LB medium supplemented with 1% NaCl gave the highest stability in the cultured bacteria. Fig. 1—Phylogenetic analysis of strain 21a based on the 16S rRNA sequence. [The sequence of Pseudomonas putida HKT554 (AB543806) was used to root the phylogenetic tree. Bootstrap probabilities are indicated at the branch points. The accession numbers are shown in parentheses.]

Fig. 3—Effect of NaCl concentration on the growth of strain 21a in complete LB; (△) and MMG (○) medium. [Data of non- halophilic bacteria, Pseudomonas putida HKT554, in complete (▲) and MMG medium (●) is also shown as a reference.]

Fig. 2—Phylogenetic analysis of the predicted amino acid sequence of ectB of strain 21a. [The primary sequence of ectB from Flexistipes sinusarabici DSM 4947 (F8E4K5) was used to Fig. 4—Effect of medium composition (LB & MMG)) and NaCl root the phylogenetic tree. Bootstrap probabilities are indicated at concentration on segregational plasmid stability of pCCMR1- the branch points. The accession numbers are shown in harboring strain 21a. [●: LB+1% NaCl, ○: LB+5% NaCl, ▲: parentheses.] MMG+1% NaCl, △: MMG+5% NaCl.] MATSUI: HALOPHILIC BACTERIA FROM TUNISIA 493

Discussion Table 4—Transformation of halophilic bacteria with various Halophilic bacteria mainly thrive in conditions with vectors high salinity and value-added compounds, such as, Vector DNA Host Efficiency compatible solutes, ectoine or enzymes. Based on (cfu/ug-DNA) these growth features, the method for its genetic pHSG298(Tn903-Km*) 21a 0 transformation has been limited to conjugation. pCCMR1(Tn5-Km*) 21a 2.0×10 EZ-Tnp 21a 1.1×104 Electroporation offers an excellent alternative to most (Tn903-Km*) time-consuming transformation methods. The aim of pCCMR1 H.pacifica NBRC102220 7.1×102 the present study was to utilize the electroporation pCCMR1 H.halodenitrificans 6.7 technique in transforming halophilic bacteria, NBRC14912 especially as no information on the transformation of pCCMR1 H.halodurans NBRC15607 0 pCCMR1 H.halophila NBRC102604 0 this specific bacterial group was available. pCCMR1 H.meridiana NBRC 15608 0 Electroporation with plasmid pCCMR1, which was pCCMR1 C.beijerinckii NBRC103041 0 constructed to carry a replicative region as previously *Genetic marker of the vector described, resulted in the transformation of some cells of Halomonas spp. (Table 4). Our preliminary stability measured at 70% and 40% after 30 and 80 experiments using H. cupida NBRC 102219 (formerly generations, respectively. These results suggest that Deleya cupida) resulted in several transformants, medium composition serves as an important factor for although we were unable to evaluate the plasmid stability, similar to that observed in E. coli 20. transformation efficiency because it was originally In the present study, we report the Km-resistant. The use of a better genetic marker could electrotransformation of halophilic bacteria and eventually result in successful transformation. characterization of plasmid stability with E.coli- Transformation by electroporation with strain 21a and Halomonas sp. shuttle vector in our isolate Halomonas H. pacifica showed a good efficiency. Successful sp. strain 21a. Based on its ease, speed and efficiency transformation with EZ-Tnp as well with in comparison to alternative techniques, electroporation pCCMR1 in strain 21a also indicated Km-resistant for Halomonas spp. should serve as a useful tool for genes either from Tn903 or Tn5 could be used as the the genetic analysis and manipulation of halophilic genetic marker in this strain. In contrast, we were bacteria. We are currently applying this protocol in the unable to transform pCCMR1 into H. halophila expression of heterologous proteins and for genetic NBRC102604 (identical to Deleya halophila CCM analysis of gene disruptant libraries. 3662, as reported by Mellado et al7), although 10-4 to 10-5 exconjugants/donor were obtained by Acknowledgement conjugation, as previously described. This work was supported in part by the Ministry of Segregational plasmid stability of pCCMR1- Education, Culture, Sports, Science and Technology, harboring strain 21a was further examined in various Government of Japan, Japan (JSPS Grant No. medium compositions under non-selective pressure 23580117). The author thanks Professor H Isoda based on the need to identify specific systems with (University of Tsukuba, Japan) and Dr Leila El Bassi potential industrial application19. As reported for Ben Moussa (Borj-Cedria Science and Technology recombinant plasmid-harboring E. coli, complete Park, Tunisia) for valuable discussions and helpful medium (LB) showed better stability compared to the advices. Technical assistance of Ms N Nugara and synthetic medium (MMG)20). Unfortunately, Ms N Agarie is also acknowledged. segregational plasmid stability in the strain 21a was relatively low even at around 10 generations when References growing in MMG medium without selective pressure, 1 Le Borgne S, Paniagua D & Vazquez-Duhalt R, Biodegradation of organic pollutants by halophilic bacteria although at least 20 generations are necessary in and Archaea, J Mol Microbiol Biotechnol, 15 (2008) 74-92. 21 actual industrial settings . Interestingly, the use of 2 Oren A, Industrial and environmental applications of higher salt concentrations exhibited lower stability in halophilic microorganisms, Environ Technol, 31 (2010) both types of media. This was further examined for 825-834. 3 Canovas D, Vargas C, Calderon M I, Ventosa A & Nieto J J, prolonged generations, as shown in Fig. 4. LB Characterization of the genes for the biosynthesis of the medium (containing 1% NaCl) showed the highest compatible solute ectoine in the moderately halophilic 494 INDIAN J BIOTECHNOL, OCTOBER 2015

bacterium Halomonas elongata DSM 3043, Syst Appl Rhodococcus sp. 11B, Biosci Biotechnol Biochem, 59 (1995) Microbiol, 21 (1998) 487-497. 1342-1344. 4 Canovas D, Vargas C, Kneip S, Moron M J, Ventosa A et al, 13 Murarka A, Dharmadi Y, Yazdani S S & Gonzalez R, Genes for the synthesis of the osmoprotectant glycine betaine Fermentative utilization of glycerol by Escherichia coli and from choline in the moderately halophilic bacterium its implications for the production of fuels and chemicals, Halomonas elongata DSM 3043, USA, Microbiology, 146 Appl Environ Microbiol, 74 (2008) 1124-1135. (2000) 455-463. 14 Matsui T, Kato K, Namihira T, Shinzato N & Semba H, 5 Ventosa A, Nieto J J & Oren A, Biology of moderately Stereospecific degradation of phenylsuccinate by halophilic aerobic bacteria, Microbiol Mol Biol Rev, 62 actinomycetes, Chemosphere, 76 (2009) 1278-1282. (1998) 504-544. 15 Choi K H, Kumar A & Schweizer H P, A 10-min method for 6 Llamas I, Argandona M, Quesada E & Del Moral A, preparation of highly electrocompetent Pseudomonas Transposon mutagenesis in Halomonas eurihalina, Res aeruginosa cells: Application for DNA fragment transfer Microbiol, 151 (2000) 13-18. between chromosomes and plasmid transformation, 7 Mellado E, Asturias J A, Nieto J J, Timmis K N & Ventosa J Microbiol Methods, 64 (2006) 391-397. A, Characterization of the basic replicon of pCM1, a narrow- 16 Saitou N & Nei M, The neighbor-joining method: A new host-range plasmid from the moderate halophile method for reconstructing phylogenetic trees, Mol Biol Evol, Chromohalobacter marismortui, J Bacteriol, 177 (1995) 4 (1987) 406-425. 3443-3450. 17 Kimura M, A simple method for estimating evolutionary 8 Matsui T & Maruhashi K, Isolation of carotenoid-deficient rates of base substitutions through comparative studies of mutant from alkylated dibenzothiophene desulfurizing nucleotide sequences, J Mol Evol, 16 (1980) 111-120. nocardioform bacteria, Gordonia sp. TM414, Curr 18 Thompson J D, Gibson T J, Plewniak F, Jeanmougin F & Microbiol, 48 (2004) 130-134. Higgins D G, The CLUSTAL_X windows interface: Flexible 9 El-Bassi L, Iwasaki H, Oku H, Shinzato N & Matsui T, strategies for multiple sequence alignment aided by quality Biotransformation of benzothiazole derivatives by the analysis tools, Nucleic Acids Res, 25 (1997) 4876-4882. Pseudomonas putida strain HKT554, Chemosphere, 81 19 Silva F, Queiroz J A & Domingues F C, Evaluating (2010) 109-113. metabolic stress and plasmid stability in plasmid DNA 10 Burch AY, Finkel O M, Cho JK, Belkin S & Lindow S E, production by Escherichia coli, Biotechnol Adv, 30 (2012) Diverse microhabitats experienced by Halomonas variabilis 691-708. on salt-secreting leaves, Appl Environ Microbiol, 79 (2013) 20 Matsui T, Sato H, Sato S, Mukataka S & Takahashi J, Effects 845-852. of nutritional conditions on plasmid stability and production 11 Sambrook J & Russell D W, Molecular cloning: A of tryptophan synthase by a recombinant Escherichia coli, laboratory manual, 3rd edn (Cold Spring Harbor Laboratory Agric Biol Chem, 54 (1990) 619-624. Press, NY, USA) 2001. 21 Imanaka, T & Aiba S, A perspective on the application of 12 Matsui T & Furuhashi K, Asymmetric oxidation of isopropyl genetic engineering: Stability of recombinant plasmid, moieties of aliphatic and aromatic hydrocarbons by Ann N Y Acad Sci, 369 (1981) 1-14.