The Selective Advantage of Mitochondrial DNA: Mitotype by Diet Interactions

The selective advantage of mitochondrial DNA: Mitotype by diet interactions

influence organismal fitness and longevity

Samuel Geoffrey Towarnicki

A thesis submitted for the degree of Doctor of Philosophy in the

Faculty of Science

School of Biotechnology and Biomolecular Sciences

The University of New South Wales, Sydney, Australia

2019

PLEASE TYPE

THE UNIVERSITY OF NEW SOUTH WALES

Thesis/Dissertation Sheet

Surname or Family name: Towarnicki

First name: Samuel Other name/s: Geoffrey

Abbreviation for degree as given in the University calendar: PhD

School: School of Biotechnology and Biomolecular Sciences Faculty: Science

Title: The selective advantage of mitochondrial DNA: Mitotype by diet interactions influence organismal fitness and longevity

Abstract 350 words maximum: (PLEASE TYPE)

Mutations in mitochondrial DNA (mtDNA) were long thought to range from neutral to deleterious, but not beneficial.

However, the maintenance of mitochondrial variation within species indicates a possible selective advantage conferred by favourable mtDNA mutations. I hypothesised that mtDNA variation may be maintained through interactions of mtDNA with environmental factors, including diet, temperature and the presence of stressors. I further hypothesised that experimentally manipulating the interactions of mtDNA and environmental factors may allow context specific favourable mutations in mtDNA to be discovered. Diet provides a strong environmental factor to identify favourable mtDNA mutations as the macronutrients of diet provide substrate to the mitochondria at different stages of the electron transport system to produce cellular energy. Thus modulating diet and other environmental factors may elucidate favourable mutations as these mutations may be context dependent, being favourable in one context, but deleterious in another. The overall goal of this thesis is to determine whether a single mtDNA mutation can have favourable effects on organismal fitness and health through interactions with environmental factors.

I utilise the model organism Drosophila melanogaster to investigate the selective advantage of mtDNA and attempt to identify a favourable mutation. The D. melanogaster lines I utilise have a constant nuclear DNA background but differ by known mtDNA mutations. This thesis is composed of five experimental chapters. Chapters 2, 3 and 4 focus on identifying a selective advantage of an mtDNA haplotype primarily through diet by mitotype interactions and determining a specific mutation that drives a selective advantage. Chapters 5 and 6 then utilise the knowledge gained in the previous chapters to generalise the response to adult longevity and response to environmental stressors. My work here has resulted in two major conclusions. First a single mtDNA mutation can provide a selective fitness advantage and benefit organismal health and second, mitotype specific favourable responses are context dependent.

Declaration relating to disposition of project thesis/dissertation

I hereby grant to the University of New South Wales or its agents the right to archive and to make available my thesis or dissertation in whole or in part in the University libraries in all forms of media, now or here after known, subject to the provisions of the Copyright Act

1968. I retain all property rights, such as patent rights. I also retain the right to use in future works (such as articles or books) all or part of this thesis or dissertation.

I also authorise University Microfilms to use the 350 word abstract of my thesis in Dissertation Abstracts International (this is applicable to doctoral theses only).

…………………………………. …………………………………. ……….……………………...…….…

Signature Witness Signature Date

The University recognises that there may be exceptional circumstances requiring restrictions on copying or conditions on use. Requests for restriction for a period of up to 2 years must be made in writing. Requests for a longer period of restriction may be considered in exceptional circumstances and require the approval of the Dean of Graduate Research.

FOR OFFICE USE ONLY Date of completion of requirements for

Award:

ORIGINALITY STATEMENT

‘I hereby declare that this submission is my own work and to the best of my knowledge it contains no materials previously published or written by another person, or substantial proportions of material which have been accepted for the award of any other degree or diploma at UNSW or any other educational institution, except where due acknowledgement is made in the thesis. Any contribution made to the research by others, with whom I have worked at UNSW or elsewhere, is explicitly acknowledged in the thesis. I also declare that the intellectual content of this thesis is the product of my own work, except to the extent that assistance from others in the project's design and conception or in style, presentation and linguistic expression is acknowledged.’

Samuel Geoffrey Towarnicki

……………………..

Signature

……………………..

Date

‘I hereby grant the University of New South Wales or its agents the right to

archive and to make available my thesis or dissertation in whole or part in the

University libraries in all forms of media, now or here after known, subject to

the provisions of Copyright Act 1968. I retain all proprietary rights, such as

patent rights. I also retain the right to use in future works (such as articles or

books) all or part of this thesis or dissertation. I also authorize University

Microfilms to use the 350 word abstract of my thesis in Dissertation Abstract

International (this is applicable to doctoral theses only). I have either used no

substantial portions of copyright material in my thesis or I have obtained

permission to use copyright material; where permission has not been granted I

have applied/will apply for a partial restriction of the digital copy of my thesis or

dissertation.’

Samuel Geoffrey Towarnicki

……………………..

Signature

……………………..

Date

Authenticity Statement

‘I certify that the library deposit digital copy is a direct equivalent of the final officially approved version of my thesis. No emendation of content has occurred and if there are any minor variations in formatting, they are the result of the conversion to digital format.’

Samuel Geoffrey Towarnicki

……………………..

Signature

……………………..

Date

INCLUSION OF PUBLICATIONS STATEMENT

UNSW is supportive of candidates publishing their research results during their candidature as detailed in the UNSW Thesis Examination Procedure.

Publications can be used in their thesis in lieu of a Chapter if: • The student contributed greater than 50% of the content in the publication and is the “primary author”, ie. the student was responsible primarily for the planning, execution and preparation of the work for publication • The student has approval to include the publication in their thesis in lieu of a Chapter from their supervisor and Postgraduate Coordinator. • The publication is not subject to any obligations or contractual agreements with a third party that would constrain its inclusion in the thesis

Please indicate whether this thesis contains published material or not. ☐ This thesis contains no publications, either published or submitted for publication

Some of the work described in this thesis has been published and it has been ☒ documented in the relevant Chapters with acknowledgement

This thesis has publications (either published or submitted for publication) ☐ incorporated into it in lieu of a chapter and the details are presented below

CANDIDATE’S DECLARATION I declare that: • I have complied with the Thesis Examination Procedure

Name Signature Date (dd/mm/yy) Samuel Geoffrey Towarnicki

Abstract

Mutations in mitochondrial DNA (mtDNA) were long thought to range from neutral to deleterious, but not beneficial. However, the maintenance of mitochondrial variation within species indicates a possible selective advantage conferred by favourable mtDNA mutations. I hypothesised that mtDNA variation may be maintained through interactions of mtDNA with environmental factors, including diet, temperature and the presence of stressors. I further hypothesised that experimentally manipulating the interactions of mtDNA and environmental factors may allow context specific favourable mutations in mtDNA to be discovered. Diet provides a strong environmental factor to identify favourable mtDNA mutations as the macronutrients of diet provide substrate to the mitochondria at different stages of the electron transport system to produce cellular energy. Thus modulating diet and other environmental factors may elucidate favourable mutations as these mutations may be context dependent, being favourable in one context, but deleterious in another. The overall goal of this thesis is to determine whether a single mtDNA mutation can have favourable effects on organismal fitness and health through interactions with environmental factors.

Chapters 2, 3 and 4 focus on identifying a selective advantage of an mtDNA haplotype primarily through diet by mitotype interactions and determining a specific mutation that drives a selective advantage. Chapters 5 and 6 then utilise the knowledge gained in the previous chapters to generalise the response to adult longevity and response to

I environmental stressors. My work here has resulted in two major conclusions. First a single mtDNA mutation can provide a selective fitness advantage and benefit organismal health and second, mitotype specific favourable responses are context dependent.

Acknowledgements

First and most certainly foremost I thank Professor Bill Ballard for his guidance, supervision and support throughout the course of my PhD. The pursuit of rigorous

Science has been the cornerstone of Bill’s lab, and I am so grateful for the opportunity to be a part of his lab. Our weekly meetings where we discussed my work, the lab’s work and the field more broadly challenged and inspired me. I truly and sincerely appreciate the investment in me that Bill has provided.

Thank you to my co-supervisor Paul Waters, and review panel members Vladimir

Sytnyk and Torsten Thomas for ensuring my PhD was on track.

Wen Aw and Rijan Bajracharya, you guys made my time in the lab as enjoyable and interesting as it could be. You both helped me to learn all the equipment and techniques

I utilised in this thesis, and instigated my addiction to caffeine.

Rich Melvin and Neil Youngson, thank you so much for your advice and assistance with my work, and guidance in the world of academia.

Anton Vila-Sanjurjo, Shaun Nielsen, Mike Garvin, Yifang Hu, Russ Pickford, Sonia

Bustamante, and Gordon Smyth thank you for your work and assistance on “The Big

Paper”.

Thanks to Leanne Kok for her assistance with the ethanol assays, and all the students and volunteers who have passed through the lab.

Finally, my parents Steve Towarnicki, Elizabeth Towarnicki, my nana Valda Johnson, my Aunts, Uncles, Cousins, and my brother David Towarnicki thank you for your love and support throughout the years.

III

Overview of thesis chapters

The overall goal of this thesis is to determine whether a single mitochondrial DNA

(mtDNA) mutation can have a favourable effect on organismal fitness and health. The null hypothesis is that naturally occurring mtDNA mutations have no detectable influence on the phenotype of organisms and such mutations may be neutral or nearly neutral. One alternate hypothesis is that specific mtDNA mutations can have favourable phenotypic effects on an organism. The second alternate hypothesis is that naturally occurring mtDNA mutations can only have deleterious effects on an organism. I define

‘favourable’ as resulting in a significant positive response of a fitness related trait. I define deleterious effects as those that result in a significantly negative response of a fitness related trait and/or organismal health.

To investigate my overall goal, I utilise the model organism Drosophila melanogaster. I focus on two specific D. melanogaster lines, ‘Alstonville’ and

‘Dahomey’, in each experimental chapter. The Alstonville line was originally collected in Northern NSW, Australia in 2002. The Dahomey line was collected in West Africa

(now Benin) in 1970. The two lines included in this thesis have been genetically manipulated such that they differ in their mtDNA haplotypes (mitotypes) but share the same nuclear genetic background. In reference to the Alstonville and Dahomey mitotypes I describe an ‘mtDNA mutation’ as variation between the two mitotypes.

These lines were chosen because concurrent work in our laboratory strongly suggested that an mtDNA mutation in the ND4 subunit of mitochondrial Complex I was functionally significant in Dahomey. This non-synonymous mutation results in the

Valine at position 161 of ND4 in Alstonville coding for Leucine in Dahomey. I refer to

IV this mutation as V161L. Quaternary structural modelling has determined no interaction of this mutation with any nuclear encoded genes (Aw et al. 2018).

Throughout my thesis I employ the nutritional geometric framework to construct diets that differ in their Protein to Carbohydrate ratio, which I refer to as P:C ratio. The two diets I utilise are either a high protein diet with a 1:2 P:C ratio, or a high carbohydrate diet with a 1:16 P:C ratio. These two P:C ratios are biologically relevant as they span the macronutrient range encountered by D. melanogaster in nature and reflect the approximate ratios found in passionfruit (1:2 P:C) and banana (1:16 P:C). I use diet as an environmental factor that interacts with mtDNA, as each of the macronutrients of diet are broken down through separate biochemical pathways and provide substrate at different stages of the electron transport system. As such, diet is a strong variable to test for the influence of an mtDNA mutation. Other environmental factors that may influence mitochondrial function include temperature and stressors such as iron contamination.

This thesis is comprised of 7 chapters. Chapter 1 is a literature review that places the following experimental chapters in a theoretical framework. Chapters 2 through 6 are experimental chapters. At the time of submission, Chapters 1 and 6 are manuscripts in preparation for submission, Chapters 2 and 5 are published papers, and Chapters 3 and 4 are comprised of my contributions to Aw et al., (2018). Chapter 7 is a discussion of my thesis, with ideas for future experiments.

Chapter 1: The selective advantage of mitochondrial DNA

In Chapter 1, I provide an overview of the current literature to provide context for my thesis. I first cover the structure and function of mtDNA, with an overview of energy

V production in the mitochondria, and the implications of mitochondrial DNA-nuclear interactions. I proceed to review the maintenance of mtDNA variation and how a favourable mtDNA mutation may be identified through the use of quaternary structural modelling. Last, I investigate the interaction of mitochondria with the macronutrients of diet, and the use of D. melanogaster as a model organism to test for favourable mutations. I suggest that mtDNA variation identified within species may result from a form of balancing selection, where a mutation is favourable in one context, but neutral or slightly deleterious in another.

Chapter 2: Drosophila mitotypes determine developmental time in a diet and temperature dependent manner

This chapter is modified slightly from Towarnicki and Ballard (2017). Here, I utilised the nutritional geometric framework to construct the 1:2 P:C and 1:16 P:C diets. I raised the two D. melanogaster mitotypes, Alstonville and Dahomey, on these diets and varied temperature to assay development time as larvae. I identified a mitotype by diet interaction that influenced development time. This interaction resulted in the Dahomey mitotype developing slower than Alstonville on the high protein 1:2 P:C diet, but faster on the high carbohydrate 1:16 P:C diet. I then utilised physiological assays to determine the underlying energetic consequences that influenced development time. On both diets, temperature influenced the phenotypic response to each assay. On the 1:2 P:C diet the mitotypes did not differ in weight, feeding rate or movement as larvae. On the 1:16 P:C diet however, Dahomey had greater weight and feeding rate, but lower movement as larvae. This chapter identified a possible fitness advantage provided by mtDNA variation, which was influenced by temperature and diet. It did not determine whether a single mtDNA mutation was solely responsible for the differences observed.

Chapters 3 & 4: My contributions to the larger paper “Genotype to phenotype:

Diet-by-mitochondrial DNA haplotype interactions drive metabolic flexibility and organismal fitness”

Chapters 3 and 4 include the studies I contributed to Aw et al. (2018), my role was to identify the specific biochemical mechanisms that resulted in faster development of

Dahomey fed the 1:16 P:C diet. In Chapter 3 (Study 7 of Aw et al., (2018)), I identified metabolic rewiring occurred in Dahomey fed the 1:16 P:C diet as larvae that resulted in increased levels of lipogenesis to fuel β-oxidation of fatty acids. In Chapter 4 (study 8 of Aw et al., (2018)), I found that in Alstonville, the pentose phosphate, and insulin signalling pathways were upregulated resulting in increased larval movement. The work in these chapters identified possible implications for mitotype by diet interactions including obesity and diabetes in humans, and further elucidated the interaction of mitotype with diet, demonstrating a favourable effect of the V161L mutation.

From the paper to which these chapters contributed, I identified two avenues of interest: First, is the identified mitotype by diet interaction only a larval effect, or does it also influence adults? Second, is the slower development of Dahomey on the 1:2 P:C diet advantageous in some way. I investigated these two avenues in the following chapters.

Chapter 5: Mitotype interacts with diet to influence longevity, fitness, and mitochondrial functions in adult female Drosophila

This chapter is modified slightly from Towarnicki and Ballard (2018). Here, I identified that a mitotype by diet interaction influences longevity of the two mitotypes. I hypothesized that a possible trade-off occurred, where the diet that provides faster larval

VII growth, would result in reduced longevity. My findings supported this hypothesis.

While Alstonville developed faster on the 1:2 P:C diet (Chapter 2) it died faster when fed a 1:2 P:C diet as an adult. Further, Dahomey fed a 1:16 P:C diet died faster than

Alstonville. I found that on each diet the longer lived flies had lower walking speed, greater climbing ability, and greater mitochondrial health.

Chapter 6: Yin and Yang of Mitochondrial ROS in Drosophila

This chapter is modified from Towarnicki and Ballard (2020). Aw et al. (2018) found that when fed the 1:2 P:C diet, Dahomey showed increased basal reactive oxygen species production, and an upregulation of antioxidant genes. The work suggested that the slightly higher levels of mitochondrial reactive oxygen species produced by

Dahomey on the 1:2 P:C diet, due to the V161L mtDNA mutation, are can be beneficial. I hypothesised that cellular and biochemical responses to the 1:2 P:C diet would allow Dahomey to better respond to exogenous oxidative stressors. When low concentrations of ethanol or hydrogen peroxide were added to the 1:2 P:C diet,

Dahomey developed faster than Alstonville. I identified the higher antioxidant capacity of Dahomey as protective of the mitochondrial membrane, allowing greater, and more efficient energy production than Alstonville. This chapter may provide insight into the maintenance of mtDNA variation within species in nature.

Chapter 7: Discussion

In Chapter 7, I discuss how my findings address the aim of this thesis and how this work contributes to our current understanding of the selective advantage of mtDNA. I present a few ideas for future research, including the possibilities of gene editing and further exploration of the identified mitotype by diet interaction in nature. I finish by

VIII exploring possible societal implications of positive selection of mtDNA in the context of the mitochondrial replacement therapy.

Abstract I

Acknowledgements III

Overview of thesis chapters IV

Table of contents X

References XX

List of appendices XXI

List of figures XXII

List of tables XXV

Abbreviations XXVI

Chapter 1: The selective advantage of mitochondrial DNA 1

1.1 Introduction 2

1.2 Structure and function of the mitochondrial genome 3

1.3 Mitochondrial DNA-nuclear interactions 6

1.3.1 Complex I modelling 7

1.4 mtDNA variation 9

1.4.1 Temporal and spatial fitness variation 12

1.5 Interaction of mitochondria with the macronutrients of diet 13

1.5.1 Dietary protein 16

1.5.2 Dietary carbohydrates 17

1.5.3 Dietary lipids 17

1.6 Drosophila melanogaster as a model organism to test for

favourable mutations 18

1.7 Conclusion 20

Chapter 2: Drosophila mitotypes determine developmental time in a diet and

temperature dependent manner 21

Abstract 22

2.1 Introduction 23

3.2 Materials and methods 25

2.2.1 Fly lines 25

2.2.2 Fly maintenance and sex determination 27

2.2.3 Time to pupation 28

2.2.4 Larval weight 28

2.2.5 Larval feeding 29

2.2.6 Larval movement 30

2.2.7 Statistical analyses of organismal data 30

2.3 Results 31

2.3.1 Time to pupation 31

2.3.2 Larval weight 33

2.3.3 Larval feeding 35

2.3.4 Larval movement 36

2.4 Discussion 37

XII

Chapter 3: Mitohormetic responses in Dahomey larvae fed 1:16 P:C food 42

Abstract 43

3.1 Introduction 44

3.2 Study 7: Materials and methods 45

3.2.1 Fly lines 45

3.2.2 Fly diets 46

3.2.3 Mitohormetic responses in Dahomey larvae fed 1:16 P:C

food 47

3.2.3.1 Upregulation of the polyol pathway in Dahomey 47

3.2.3.2 Increased β-oxidation of fatty acids in Dahomey 48

3.2.4 Gene expression 49

3.2.5 Statistical analyses 49

3.3 Results 50

3.3.1 Upregulation of the polyol pathway in Dahomey 50

3.3.2 Increased β-oxidation of fatty acids in Dahomey 54

3.4 Study 7: Discussion 57

XIII

3.3 Chapter 4: Mitohormetic responses in Alstonville larvae fed

1:16 P:C food 60

Abstract 61

4.1 Introduction 62

4.2 Materials and methods 63

4.2.1 Fly lines and diets 63

4.2.2 Increased glycogen metabolism 63

4.2.3 Upregulation of the pentose phosphate pathway in

Alstonville 64

4.2.4 Gene expression 64

4.2.5 Statistics 64

4.3 Results 64

4.3.1 Increased glycogen metabolism 64

4.3.2 Upregulation of the pentose phosphate pathway in

Alstonville 66

4.4 Discussion 67

XIV

Chapter 5: Mitotype Interacts With Diet to Influence Longevity, Fitness, and

Mitochondrial Functions in Adult Female Drosophila 71

Abstract 72

5.1 Introduction 73

5.2 Materials and methods 77

5.2.1 Fly lines and maintenance 77

5.2.2 Experimental diets 78

5.2.3 Longevity 78

5.2.4 CAFÉ assay 79

5.2.4.1 Early fecundity 79

5.2.4.2 Feeding 80

5.2.5 Physical activity 80

5.2.5.1 Walking speed 80

5.2.5.2 Climbing assay 81

5.2.6 Mitochondrial functions 81

5.2.6.1 RCR, copy number and mTerf3 expression 81

5.2.6.2 Basal ROS and antioxidant response 82

5.2.7 Statistics 82

5.3 Results 83

5.3.1 Longevity 83

5.3.2 CAFÉ assay 85

5.3.2.1 Early fecundity 85

5.3.2.2 Feeding 86

5.3.3 Physical activity 89

5.3.3.1 Walking speed 89

5.3.3.2 Climbing Assay 90

5.3.4 Mitochondrial functions 91

5.3.4.1 RCR, copy number and mTerf3 expression 91

5.3.4.2 Basal ROS and antioxidant response 93

5.4 Discussion 95

XVI

Chapter 6: Yin and Yang of Mitochondrial ROS in Drosophila 100

Abstract 101

6.1 Introduction 103

6.2 Materials and methods 106

6.2.1 Experimental conditions 106

6.2.1.1 Strains and maintenance 106

6.2.2.1 Experimental diets 108

6.2.2 Physiological assays 109

6.2.2.1 Time to pupation 109

6.2.2.2 Pupal dry weight 110

6.2.3 H2O2 levels and antioxidant responses 110

6.2.3.1 H2O2 levels 110

6.2.3.2 Superoxide dismutase (SOD) activity 111

6.2.3.3 Expression of antioxidant genes 111

6.2.4 Mitochondrial functions 112

6.2.4.1 Membrane potential 112

6.2.4.2 Respiratory control ratio (RCR) 112

6.2.4.3 Microbial challenge 112

6.2.5 Data analysis 113

6.3 Results 113

6.3.1 Physiological assays 113

6.3.1.1 Time to pupation 113

6.3.1.2 Pupal dry weight 115

6.3.2 Hydrogen peroxide levels and antioxidant responses 117

6.3.2.1 H2O2 levels 117

XVII

6.3.2.2 Superoxide dismutase (SOD) activity 117

6.3.2.3 Expression of antioxidant genes 118

6.3.3 Mitochondrial functions 121

6.3.3.1 Membrane potential 121

6.3.3.2 Respiratory control ratio (RCR) 121

6.3.3.3 Microbial challenge 122

6.4 Discussion 123

XVIII

Chapter 7: Discussion 129

7.1 Introduction 130

7.2 A single mtDNA mutations can provide a selective fitness

advantage 130

7.3 Mitotype specific favourable responses are context dependent 131

7.4 Future directions 131

7.4.1 Gene modification of the Alstonville mitotype 132

7.4.2 Mitochondria under selection? 133

7.4.2.1 Are the Alstonville and Dahomey mitotypes maintained

in nature? 134

7.4.2.2 Population cage studies in nature 135

7.4.1 Mitotype responses in larvae are not in adults 135

7.5 Societal implications 136

7.6 Conclusion 137

XIX

References 138

Overview references 139

Chapter 1 references 140

Chapter 2 references 148

Chapter 3 references 154

Chapter 4 reference 156

Chapter 5 references 158

Chapter 6 references 163

Chapter 7 references 170

List of appendices

Chapter 2 supplementary material 172

App. 2-1 Feeding rate of D.melanogaster lines Alst;w1118 and

Dah;w1118 fed 1:12 P:C diet at three temperatures

(19 °C, 23 °C, and 27 °C). 172

App. 3-2 mtDNA differences between Alstonville

and Dahomey 173

Chapter 4 supplementary material 175

App. 4-1 Glucose-6-phosphate dehydrogenase (G6PD)

activity 175

Chapter 6 supplementary material 176

App. 6-1 Time to pupation of Alst;w1118 and Dah;w1118 fed diets

containing ethanol and H2O2 176

App. 6-2 Ethanol and H2O2 levels in larval haemolymph. 177

XXI

List of figures

Chapter 1

Fig. 1-1: Assembly of Complex I 8

Fig. 1-2: ETS mutations interact with mitochondrial and nuclear

encoded subunits. 12

Fig. 1-3: Pathways through which dietary macronutrients provide

substrate for the ETS. 15

Chapter 2

Fig. 2-1. Development time of D. melanogaster lines harbouring

Alstonville (Alst) and Dahomey (Dah) mtDNA in the w1118

and Oregon R (OreR) genetic backgrounds fed two Protein:

Carbohydrate (P:C) diets and raised at three distinct

temperatures (19 °C, 23 °C, and 27 °C). 32

Fig. 2-2. Weight of D. melanogaster lines Alst;w1118 and Dah;w1118 fed

two Protein: Carbohydrate (P:C) diets at three distinct

temperatures (19 °C, 23 °C, and 27 °C). 35

Fig. 2-3: Feeding rate of D. melanogaster lines Alst;w1118 and Dah;w1118

fed 1:16 P:C diet at three distinct temperatures

(19 °C, 23 °C, and 27 °C). 36

Fig. 2-4: Movement of D. melanogaster lines Alst;w1118 and Dah;w1118

fed two Protein: Carbohydrate (P:C) diets at three distinct

temperatures (19 °C, 23 °C, and 27 °C). 37

XXII

Chapter 3

Fig. 3-1. Tests of hypotheses using other sugars and inhibitors. 52

Fig. 3-2. The polyol pathway is upregulated in Dahomey larvae fed the

1:16 P:C diet. 53

Fig. 3-3. β-oxidation of fatty acids is upregulated in Dahomey larvae

fed the 1:16 P:C diet. 55

Fig. 3-4. Proposed mitohormetic responses in Drosophila larvae fed the

1:16 P:C food 57

Chapter 4

Fig. 4-1. Glycogen metabolism is increased and the pentose phosphate

pathway is upregulated in Alstonville larvae fed the 1:16

P:C diet. 65

Fig. 4-2. Proposed mitohormetic responses in Drosophila larvae fed the 1:16 P:C food 68

Chapter 5

Fig. 5-1. Survival curves of Alstonville and Dahomey mitotypes. 84

Fig. -2. Number of eggs laid by the Alstonville and Dahomey mitotypes

fed either the 1:2 or 1:16 P:C diets. 85

Fig. 5-3. Volume of food consumed by the Alstonville and Dahomey

mitotypes fed either the 1:2 or 1:16 P:C diets. 87

Fig. 5-4. Expression of N in the Alstonville and Dahomey mitotypes fed

either the 1:2 or 1:16 P:C diets. 88

XXIII

Fig. 5-5. Walking speed of the Alstonville and Dahomey mitotypes fed

either the 1:2 P:C or 1:16 P:C diets. 89

Fig. 5-6. Climbing index of the Alstonville and Dahomey mitotypes fed

either the 1:2 or 1:16 P:C diets. 90

Fig. 5-7. RCR of isolated mitochondria of the Alstonville and Dahomey

mitotypes fed either the 1:2 P:C or 1:16 P:C diets. 91

Fig. 5-8. Mitochondrial DNA copy number of the Alstonville and

Dahomey mitotypes fed either the 1:2 or 1:16 P:C diets. 92

Fig. 5-9. Expression of mTerF3 in the Alstonville and Dahomey

mitotypes fed either the 1:2 or 1:16 P:C diets. 93

Fig. 5-10. Basal ROS production of the Alstonville and Dahomey

mitotypes fed either the 1:2 or 1:16 P:C diets. 94

Fig. 5-11. Expression of GstE1 in the Alstonville and Dahomey

mitotypes fed either the 1:2 or 1:16 P:C diets. 95

Chapter 6

Fig. 6-1. Physiological assays show that larvae harbouring the V161L

ND4 mutation in complex I influence time to pupation and

pupal weight. 116

Fig. 6-2. H2O2 levels and antioxidant responses 120

Fig. 6-3. Mitochondrial functions and microbial challenge 123

XXIV

List of tables

Chapter 2

Table 2-1. Analysis of variance results 33

XXV

Abbreviations

ADP Adenosine diphosphate

ANOVA Analysis of variance

ATP Adenosine triphosphate bmm Brummer

CrebB cAMP responsive element binding protein d Days

DNA Deoxyribonucleic acid eloF Elongase factor F

ETS Electron transport system

FADH2 Flavin adenine dinucleotide g Grams

G6PD Glucose-6-phosphate dehydrogenase

GC/MS Gas chromatography-Mass spectrometry

GstE1 Glutathione-S transferase E1

H2O2 Hydrogen peroxide

IMM Inner mitochondrial membrane

IMS Intermembrane space mg Milligrams min Minute mitotype Mitochondrial DNA haplotype ml Mililitres mM Milimolar

MtDNA Mitochondrial deoxyribonucleic acid

XXVI

N Notch

NADH Nicotinamide adenine dinucleotide nm Nanometers

OMM Outer mitochondrial membrane

O2 Oxygen

OXA1 Mitochondrial oxidase assembly protein 1

OXPHOS Oxidative phosphorylation

P:C Protein: Carbohydrate

PCR Polymerase chain reaction

RIRR Reactive oxygen species induced reactive oxygen

species release

ROS Reactive oxygen species

RP49 Ribosomal protein 49

RT-qPCR Reverse transcription polymerase chain reaction s Seconds

SE Standard error

SOD Superoxide dismutase

TCA Tricarboxylic acid cycle

TFAM Mitochondrial transcription factor A

U Unit oC Degree Celsius

µg Microgram

µM Micromolar

µl Microliter

XXVII

Chapter 1

The selective advantage of mitochondrial DNA

Introduction

1.1 Introduction

Historically the mitochondrion was considered a simple organelle with limited function and organismal influence. Mitochondria were thought to merely be an energy producing organelle responsible for the majority of adenosine triphosphate (ATP) generation through the process of oxidative phosphorylation (OXPHOS). They were also seen as simple organelles due to their rod-shaped form in the selected electron micrographs presented for publication. Further, in comparison to nuclear DNA, mitochondria contain relatively short length DNA molecules (ranging from ~16,000 bp in humans to ~19,000 bp in Drosophila melanogaster). More recently, mitochondrial DNA (mtDNA) mutations were shown to cause human disease, and so there has been renewed interest in the structure and function of the organelle. Still, much more needs to be discovered and it could be argued that we know less about mitochondrial functions in 2019 than we thought we didn’t know in 2001.

Our view of mtDNA has also changed over time. Beyond energy production mitochondria have further cellular roles through pathways such as innate immunity

(Wang et al., 2011), calcium signalling (Rizzuto et al., 2012), reactive oxygen species

(ROS) signalling (Li et al., 2013), apoptosis (Green, 1998), steroid biosynthesis

(Rossier, 2006) and estrogen signalling (Klinge, 2008). Combined, these multiple functions paint a picture of a complex organelle intricately involved in cellular functions. Further, it suggests that the mitochondria has never been a static organelle – rather it is highly dynamic and may provide rapid cellular responses to environmental changes.

Traditionally, mutations in mtDNA were assumed to only range from neutral to slightly-deleterious, and this assumption was used to develop the molecular clock

2 hypothesis (reviewed by Dos Reis et al. (2016)) which has been extensively used to determine the geological age of populations. This view of mtDNA has been challenged.

Along with others, Ballard and Whitlock (2004) proposed that mtDNA may contain favourable mutations that provide a selective advantage through the interaction with environmental factors such as diet and temperature. Understanding the possible selective advantage of mitochondria would involve identifying favourable mutations in mtDNA and this is a goal of my thesis.

In this Chapter I outline the structure of mtDNA and the role of the mitochondria in energy production. I discuss the importance of mito-nuclear interactions and consider the assembly and possible dysfunction of mitochondrial

Complex I. I look at Complex I in particular as it is the primary entry point for electrons into the Electron Transport System (ETS), is the largest ETS Complex, and is the

Complex influenced by the V161L mutation that distinguishes the Alstonville and

Dahomey mtDNA haplotypes (mitotypes). I review the challenges in identifying favourable mtDNA mutations and then focus on the interactions of mtDNA with the macronutrients of diet. Finally, I discuss the utility of Drosophila as the model organism

I chose to study.

1.2. Structure and function of the mitochondrial genome

The mitochondrial genome is 16,000~20,000 bp in size and circular, likely a remnant of its theorized endosymbiotic history (de Duve, 2007). mtDNA is typically maternally inherited, and is biased towards Adenine and Thymine. In D. melanogaster mtDNA has

~82% A+T content (Garesse, 1988). The two strands of the mitochondrial DNA are distinguished as the heavy strand and the light strand. In metazoans, the genome 3 encompasses 13 protein coding genes that contribute to four of the ETS Complexes, two genes for the mitochondrial ribosome, 22 transfer RNAs, and the A+T-rich region

(Boore, 1999; Falkenberg et al., 2007; Garvin et al., 2011; Montooth et al., 2009).

The 13 protein coding genes code for 4 of the 5 ETS subunits. There are 7 mtDNA encoded subunits of Complex I, 1 of Complex III, 3 of Complex IV and 2 for

Complex V. The mutation focused upon in this thesis occurs in mtDNA encoded ND4 and is a non-synonymous Complex I mutation.

The function of the ETS is to produce ATP through the proton motive force of

ATP synthase (Complex V). To produce this force, mitochondrial Complexes I, II, III, and IV reduce O2 to H2O, and in doing so produce protons and electrons. The

Complexes pump protons from the mitochondrial matrix to the intermembrane space, while the electrons move ‘down’ the Complexes towards ATP synthase (Complex V).

This generates an electrochemical potential between the intermembrane space and the matrix which is utilized by Complex V to convert adenosine diphosphate (ADP) into

ATP by moving protons back into the matrix. Mitochondrial dysfunction can arise from a deficiency or inhibition of mitochondrial Complexes (Gorman et al., 2016), leading to reduced ATP production, and can vary from embryonically lethal, to only being mildly deleterious (Burman et al., 2014; Gonzalez-Franquesa and Patti, 2017; Wang et al.,

2017). Reduced ATP production will in most cases reduce fitness. Many of these deleterious mutations are non-synonymous, but synonymous mutations may subtly influence mitochondrial bioenergetics through reduced efficiency of transcription

(Knöppel et al., 2016).

Mutations in ribosomal subunits can influence translation efficiency and efficacy

(Amunts et al., 2015) and can have their disruptive potential predicted through

4 heterologous inferential analysis (Elson et al., 2015). tRNA mutations have been associated with a range of mitochondrial diseases including diabetes and deafness (Van den Ouweland et al., 1992; Yarham et al., 2010).

The large noncoding region of mtDNA known as the A+T-rich region in D. melanogaster (designated the control, non-coding, or D-loop region in other organisms), has Guanine and Cytosine content as low as 5.8% (Ciesielski et al., 2018). While the coding region of D. melanogaster mtDNA was 90% complete by 1988 (Garesse, 1988), it was not until 1994 that the entire A+T-rich region was first sequenced (Lewis et al.,

1994). Difficulty arose from the large number of tandem repeats in this region (Tsujino et al., 2002) which made de novo sequencing difficult. In D. melanogaster these repeats form two groups; type I that have high variability (Monnerot et al., 1990), and type II repeats that are conserved among species (Lewis et al., 1994). The functions of these repeats are not known. The A+T-rich region contains two ‘t-stretches’ which denote the origin of replication for each strand (Sugihara et al., 2006). Mutations that affect the efficiency of replication may reduce DNA integrity, and result in hastened ageing

(Alexeyev et al., 2013). The amount of variability within the A+T-rich region differs between species, being highly conserved in canids (Adeola et al., 2017), but highly variable in humans (Stoneking, 2000). Within D. melanogaster the A+T-rich region displays a high number of nucleotide polymorphisms and displays variable lengths

(Chen et al., 2012; Wolff et al., 2016).

Within a mitochondrion, mtDNA occurs within nucleoids. A nucleoid can stabilize between 1- 8 genome copies (Youle and Van Der Bliek, 2012) and allow transmission of ETS components in heteroplasmic cells (Schon and Gilkerson, 2010). In heteroplasmic organisms mitochondria compete for transmission from mother to child

5 with competition between mitochondrial populations being non-random (De Stordeur,

1997) and this may raise ethical issue in mitochondrial replacement therapy, such as the three-person baby (Dimond and Stephens, 2018). In humans, three-parent babies are produced from the genetic material of one man and two women through the use of assisted reproductive technologies, specifically mitochondrial manipulation (or replacement) technologies If a heteroplasmic population of mitochondria is introduced through mitochondrial replacement therapy, competition may allow tissue specific populations to arise. Ma and O'Farrell (2016) found in closely related mitotypes that

OXPHOS capacity was favoured; however in distantly related mitotypes the favoured genome had disadvantageous or lethal OXPHOS deficiencies, known as selfish drive, and was localized to the A+T-rich region (Ma and O'Farrell, 2016). Thus, tissue specific selection may have impactful consequences at the level of the organism.

1.3 Mitochondrial DNA-nuclear interactions

Mitochondria are reliant on the nuclear genome to encode the majority of necessary proteins. Indeed, over 500 proteins encoded by the nuclear genome are required for the

ETS to function (Gregersen et al., 2012; Lotz et al., 2013; Wolff et al., 2014).

Importantly, mutations in either genome that affect the ETS may generate compensatory mechanisms and result in coevolution from the other genome (Rand et al., 2004), and this is thought to have contributed to speciation through incompatibility of distantly related mtDNA (Allio et al., 2017; Hénault and Landry, 2017; Hill, 2016).

In D. melanogaster mitonuclear interactions have been shown to influence a wide range of organismal fitness and health traits, including egg to adult viability

(Mossman et al., 2016; Mossman et al., 2019), hypoxia response (Mossman et al., 2017) 6 and mitochondrial disease (Holmbeck et al., 2015). To control mitonuclear interactions, and generalise any observed phenotypic response, mitotypes must be placed in the same and in different nuclear backgrounds. Clancy (2008) observed that mitotypes influenced longevity of D. melanogaster and that the response was modified by the nuclear background.

Quaternary structural models of Complexes I and V, and the supramolecular super-complexes (Dudkina et al., 2008) have only recently been available (Baradaran et al., 2013; Guo et al., 2017; Zhou et al., 2015). In contrast, models of Complexes II, III, and IV have been accessible for some time (Ballard and Melvin, 2010). Here I focus on

Complex I because the V161L mutation considered throughout this thesis occurs in this

Complex.

1.3.1 Complex I modelling

Complex I is the largest Complex of the ETS. As a consequence, there are more opportunities for mutations to arise that lead to dysfunction. Furthermore, mutations may affect assembly factors that influence the structure of an individual subunit (Basit et al., 2017). In D.melanogaster, Complex I is comprised of 44 subunits (seven of which are mitochondrially encoded) that form 6 modules (ND1, ND2, ND4, ND5, N and Q) with one subunit (NDUFAB1) that is not associated with a single module

(Fiedorczuk et al., 2016; Guerrero-Castillo et al., 2017; Stroud et al., 2016; Zhu et al.,

2016). Assembly of the final Complex involves a stepwise assembly of the modules into two ‘halves’ and utilizes 15 assembly factors (Fig. 1-1).

Incorrect assembly of Complex I can negatively affect function of Complexes III and IV as they rely on the structure of Complex I modules for their own assembly

(Guerrero-Castillo et al., 2017). Non-synonymous mutations in Complex I subunits may 7 reduce the efficiency of the Complex through steric hindrance as the Quinone reaction chamber of Complex I maintains steric restrictions (Baradaran et al., 2013) and so conformational changes to the subunits may inhibit proton pumping.

Fig. 1-1. Assembly of Complex I. The protein subunits required to assemble Complex I are produced either by the mitoribosome or the cytosolic ribosome. Mitochondrially encoded subunits are transported to mitochondrial oxidase assembly protein1 (OXA1) to be inserted into the inner mitochondrial membrane (IMM). Nuclear encoded subunits must travel through the outer mitochondrial membrane (OMM) by transport to the translocase of the outer membrane (TOM). Subunits located in the matrix or IMM are inserted into the translocase of the inner membrane (TIM), with those in the matrix undergoing protein folding. Nuclear encoded subunits that are located in the

8 intermembrane space (IMS) undergo oxidative folding. The protein subunits are then assembled into their individual modules (ND1, ND2, ND4, ND5, Q and N) and combined to form the Complex through the activity of 15 assembly factors. The modules then combine together in groups, forming two ‘halves’ of the final Complex. The ND1 and Q modules bind together, then form the first halve after binding with ND2. The assembly factors involved in this step are NDUFAF’s 1, 3, 4, 5, 6 and 7, TIMMDCI,

ECSIT, ACAD9 and TMEM126B. The ND4 and ND5 modules combine to form the second half and utilize the assembly factors DMAC1, FOXRED1 and ATPSSL. The two halves join, and then module N attaches using the assembly factor NDUFAF2 to finalize the assembly of Complex I.

1.4 MtDNA variation

The process of natural selection tends to result in alleles that increase fitness moving to fixation, while deleterious alleles are removed from populations through the process of purifying selection (Charlesworth, 2010; Ruiz-Pesini et al., 2004; Soares et al., 2009).

Through this process, genetic variation should remain low (Arnqvist et al., 2016;

Kazancioglu and Arnqvist, 2014). Empirical evidence suggests however that mtDNA genetic variation is maintained within species (Leffler et al., 2012; Zheng et al., 2011).

The factors and processes that maintain this variation are still unknown, and so remains an outstanding question for evolutionary biologists.

The evolution of mitochondrial DNA is dominated by slightly deleterious mutations (Ballard and Kreitman, 1994; Nabholz et al., 2008), with the use of

McDonald-Kreitman tests identifying high levels of non-synonymous, slightly deleterious mutations in mtDNA (Rand and Kann, 1996, 1998). Slightly deleterious 9 mutations are those with negative selection coefficients that are approximately the reciprocal of the effective population size for mtDNA and their effect is too weak to move to elimination (Rand and Kann, 1996). Recent studies, however, suggest that mitochondria undergo a significant amount of adaptive evolution. James et al. (2016) found that possibly up to 45% of non-synonymous mtDNA mutations in their data set moved to fixation via positive selection (over 60% in invertebrates), and this positive selection was correlated with population size. They concluded that observed mtDNA variation will most likely reflect the time since the last selective sweep (James et al.,

2016).

Determining the context in which mutations are favourable would contribute towards identifying the possible selective advantages provided by mtDNA. Identifying specific mtDNA mutations that are favourable has been challenging for several reasons.

Mitochondrial genomes shows very low levels of recombination in humans (Perera et al., 2018) and D. melanogaster (Ma and O'Farrell, 2015). This makes it difficult to unambiguously determine that specific mutations in mtDNA are favourable. Xu et al.

(2008) utilised mitochondrially targeted restriction enzymes to generate D. melanogaster lines with mutations in mitochondrial encoded ND2, and COXI. These mutations resulted from insertions and deletions, and not from any single nucleotide polymorphisms, and so their technique does not allow specific editing of mtDNA.

Testing specific hypotheses of mtDNA mutations can be derived from quaternary structural modelling, the use of phenocopies, and identifying independent naturally occurring mutations. High resolution quaternary modelling allows insight into specific structural implications, through the position of amino acids in the final configuration of the Complex and through interactions with mitochondrial and nuclear

10 encoded amino acids (Fig. 1-2). A considerable advantage of quaternary structural modelling is that mtDNA mutations that do not interact with nuclear encoded subunits can be identified, limiting the possibilities of mitonuclear interactions. Phenocopies are produced by stress induced during development that results in a phenotype representative of a genotype other than its own. A phenocopy can involve chemical blocking of an ETS Complex (Tegelberg et al., 2017) to copy the predicted function of a mutation. In doing so an experimental genotype may be phenocopied in the control to identify specific mechanisms of the mutation and to assay circumstances under which the mutation may be favourable. This is necessary for mimicking mtDNA mutations as gene editing technology is not yet able to produce targeted editing of mtDNA genes as no endogenous RNA import mechanisms have been identified for the import of primers for CRISPR gene editing (Gammage et al., 2018). A third possibility to determine the specific consequences of an mtDNA mutation is to identify the mutation in another mitotype to determine the generality of the mutation.

Fig. 1-2. ETS mutations interact with mitochondrial and nuclear encoded subunits.

Rendition of mutations altering structure of ETS proton pumps. Boxes are amino acid subunits of each pump. Blue boxes are mitochondrial encoded units. Red boxes are nuclear encoded units. Direction of proton movement is indicated by dotted arrow. (A)

A normal functioning proton pump allows movement of protons from the matrix through the inner mitochondrial membrane (IMM) to the intermembrane space (IMS) generating the electrochemical gradient required for ATP synthesis. (B) Non-synonymous mutation in mitochondrial encoded subunit (marked with a red star) induces structural alteration, blocking movement of protons. (C) Mitochondrial encoded mutation interacting with nuclear encoded subunits forming a mitonuclear interaction.

1.4.1 Temporal and spatial fitness variation

A hypothesis to explain the maintenance of mtDNA variation is through balancing selection as described by Dobzhansky (1955) in the form of temporal and spatial fitness 12 variation (Charlesworth, 2006; Dobzhansky, 1943; Eanes, 1999; Gillespie and Turelli,

1989). Under this hypothesis, variation in mtDNA maintains mutations that, while deleterious in one circumstance, are favourable in another. The environmental factors that an organism encounters will vary over time, and as such will impose varied selective pressures. Experimental evidence has shown that mitotypes influence life history and fitness traits, including thermal sensitivity (Pichaud et al., 2013a), longevity

(Zhu et al., 2014), and fecundity (Aw et al., 2017).

In Drosophila an example of both temporal and spatial environmental heterogeneity is the availability of fruit. Climate and humidity vary seasonally and geographically. As different types of fruit vary in their macronutrient content specific selective pressures may be exerted, such as bananas with a low ratio of protein to carbohydrates (P:C ratio) preferring tropical climates, while cherry tomatoes with a high

P:C ratio prefer more moderate climate. Temperature is also an environmental factor that can differ in time and space and induce selective pressure (Peng et al., 1991).

Plausibly, balancing selection may provide a mechanism for the possible selective advantage of mtDNA.

1.5 Interaction of mitochondria with the macronutrients of diet

In this section I discuss our current knowledge in regards to the cellular role of each macronutrient and their interaction with mitochondria. While the diet encountered by

D.melanogaster in nature can vary in its macronutrient ratio (Matavelli et al., 2015), in a laboratory setting these ratios can be set (Alferink et al., 2018; Le Couteur et al., 2016;

Simpson et al., 2017; Solon-Biet et al., 2014; Solon-Biet et al., 2015; Soultoukis and

Partridge, 2016). Differences in the ratios of these macronutrients have been found to alter mitochondrial function, as well as organismal fitness and health.

The macronutrients of diet (protein, carbohydrates and lipids) are broken down within the cell to produce ATP through distinct pathways. Proteins are catabolised into their constituent amino acids which are then deaminated, and feed into the tricarboxylic acid (TCA) cycle via glutamate (Fig. 1-3). Carbohydrates are broken down through the glycolysis pathway to form pyruvate which is shuttled into the mitochondria (Fig 1-3).

This pyruvate is subsequently converted to Acetyl-CoA. Acetyl-CoA provides the acetyl group to the TCA cycle. D. melanogaster do not require dietary lipids (Geer and

Perille, 1977), but stored lipids are used as an energy source through β-oxidation (Fig 1-

3), which produces Acetyl-CoA and also Nicotinamide adenine dinucleotide (NADH) and Flavin adenine dinucleotide (FADH2), which are the primary outputs of the TCA cycle. NADH and FADH2 are the required substrates of the ETS, and multiple cellular pathways.

Fig. 1-3. Pathways through which dietary macronutrients provide substrate for the ETS.

The macronutrients of diet provide substrate for the ETS through different means. ETS

Complex I, Complex II, Complex III, Complex IV, and ATP Synthase (Complex V) are denoted by I, II, III, IV, and V respectively. IMS is intermembrane space, TCA is tricarboxylic acid, NAD+ and NADH are Nicotinamide adenine dinucleotide, and

FADH2 is Flavin adenine dinucleotide. In D. melanogaster diet provides protein and carbohydrates to the cell, while lipids must be generated endogenously. Through protein metabolism, amino acids are stripped from the carbon skeleton of an individual protein molecule, deaminated, and enter the TCA cycle via conversion to glutamate.

Carbohydrates undergo glycolysis to form pyruvate. Pyruvate is shuttled into the mitochondria, converted to acetyl-CoA to enter the TCA cycle. Lipids undergo β- oxidation to form acetyl-CoA and FADH2. NADH is the required substrate of Complex

I, while FADH2 is the required substrate of Complex II.

1.5.1 Dietary protein

Protein in diet is a major determinant of growth, fecundity and ageing in invertebrates

(Bruce et al., 2013; Lee et al., 2008). Dietary protein is made up of many different combinations of amino acids. The amino acid Methionine has been identified as a key amino acid for a trade-off between fecundity and longevity in D. melanogaster through regulation of mitochondrial aerobic capacity (Caro et al., 2009). Lee et al. (2014) observed that low Protein: Carbohydrate (P:C) ratio diet without Methionine increased lifespan at the cost of fecundity; however, this effect was not shown on high P:C ratio diet, regardless of the presence of Methionine. Restriction of Methionine shows reduced generation of mitochondrial reactive oxygen species (ROS) which can damage DNA, proteins, and lipids (Sanz et al., 2006).

Dietary protein in general may interact with the mitochondria to generate ROS.

Protein can only be utilized to produce ATP through the ETS, as it contributes solely to the TCA cycle. It has been observed that high protein diet increases ROS production in

D. melanogaster (Bajracharya and Ballard, 2016), rats (Kolodziej et al., 2017) and humans (Mohanty et al., 2002). Additionally the antioxidant response to ROS generation and repair of damage is energetically expensive (Mockett et al., 2001). Complex I of the

ETS has been shown to be the primary source of ROS (Hirst et al., 2008; Zhu et al.,

2016), and in D. melanogaster fed high protein diet show higher Complex I activity than those fed high carbohydrate diet (Pichaud et al., 2013b).

1.5.2 Dietary carbohydrates

Carbohydrates in fruit that are consumed by D. melanogaster are primarily sucrose, glucose and fructose (Vimolmangkang et al., 2016). Many diets provided to D. melanogaster contain only sucrose as a dietary carbohydrate, which has been shown to reduce longevity and fecundity in adults in comparison to diets where glucose or fructose are the dietary sugar (Lushchak et al., 2014). Specific dietary sugars feed into distinct biochemical signalling pathways, such as the Notch signalling pathway where fructose is an intermediary (Lee et al., 2013) and may lead to upregulation of these pathways. Notch signalling regulates feeding response in D. melanogaster (Iijima et al.,

2009), directly influencing energy intake.

Unlike the catabolism of protein, which may only produce ATP through

OXPHOS, carbohydrates can utilize anaerobic glycolysis to produce ATP, but at lower levels than utilizing OXPHOS. This may be favourable in organism with ETS deficiencies to partially bypassing OXPHOS may reduce the production of ROS and be a ‘gentler’ way of producing energy, which would be favoured for longevity. However, due to its lower energy production it is not evolutionarily selected upon in D. melanogaster due to negative consequences for growth and adult fecundity.

1.5.3. Dietary lipids

Lipids are not naturally consumed by D. melanogaster as they can be synthesized in vivo

(Geer and Perille, 1977). From an evolutionary viewpoint, D. melanogaster are not adapted to lipids in the same way that humans are not adapted to the ‘Vending machine of life’, where high fat food is readily available. Addition of dietary lipid has, however, provided biological incite.

The addition of specific dietary lipids can cause remarkably different outcomes.

The addition of palmitic acid to diet increased cardiovascular and cancer risk (Siri-

Tarino et al., 2010), while stearic acid promotes mitochondrial health through mitochondrial fission in humans (Senyilmaz-Tiebe et al., 2018), removing damaged or dysfunctional mitochondria. When added to high protein diet, stearic acid has been shown to increase mitochondrial membrane potential of D. melanogaster parkin null mutants (Bajracharya et al., 2017). Diet supplemented with dietary lipids has also been shown to alter mitochondrial fusion (Rambold et al., 2015; Zhang et al., 2011), which can increase mitochondrial function by maintaining morphology and membrane potential. Through β-oxidation of fatty acids, FADH2 is generated and provides electrons to Complex II of the ETS. Aw et al. (2018) suggested that flexible utilization of lipids may enable bypass of Complex I, allowing greater energy production for growth and fecundity, which may possibly alleviate Complex I associated diseases.

1.6. Drosophila melanogaster as a model organism to test for favourable mutations

D. melanogaster have been used for a variety of evolutionary studies modelling the influence the mitochondrial genome has on fitness (Ballard and James, 2004; James and

Ballard, 2003; Rand et al., 2001). D. melanogaster are also commonly used to model human health and diseases as they contain homologues of ~75% of human disease- causing genes (Lloyd and Taylor, 2010; Pandey and Nichols, 2011) and share cellular signalling pathways with humans (Ammeux et al., 2016). D. melanogaster provides a strong model for identifying favourable mtDNA mutations. In comparison to vertebrate models, Drosophila are useful due to their rapid rate of development, allowing

18 generation of large number of genetically identical offspring, within weeks, unlike months required in mouse models. The entire genome (and mitochondrial genome) of

D. melanogaster is sequenced and annotated, and is available in online databases

(Thurmond et al., 2019).

The ease of genetic modification of D. melanogaster is a significant advantage.

The generation of lines with the same nuclear background, but harbouring distinct mitotypes is a strong genetic tool, as it allows the comparison of mitochondrial responses to stimuli, without varying responses from nuclear DNA (Aw et al., 2011;

Ballard et al., 2007a; Burman et al., 2014; Clancy, 2008; Correa et al., 2012; Zhu et al.,

2014). The generation of these lines is particularly simple in Drosophila as they have only four pairs of chromosomes, which reduces the possible complexity of crossing schemes, and phenotypic markers on balancer chromosomes are visually apparent, ensuring crossings are successful (Zhu et al., 2014).

Unfortunately, genetic editing of the mitochondrial genome has been unsuccessful (Gammage et al., 2018), and so we must currently rely on naturally occurring mtDNA variants. Historically, favourable mutations were attempted to be identified from Drosophila simulans lines that displayed mtDNA variation, forming three groups (siI, siII, and siIII) (Ballard et al., 2007b). These mitotypes influence important life-history and fitness related traits and observations from introgressing

Drosophila simulans mitochondria into D. melanogaster displayed strong mitonuclear interactions that influenced ageing and fitness (Mossman et al., 2019; Rand et al., 2006;

Zhu et al., 2014). Alas, the large amount of variability between these mitotypes did not allow the identification of any one mutation as causative. Lines constructed by Clancy

(2008), provide a strong model for identifying favourable mutations due to the lower levels of variability between each line.

1.7 Conclusion

Understanding the evolutionary dynamics of mtDNA is a model system that can provide insight into the processes that influence nuclear genes. The molecule is, however subject to its own particular constraints and idiosyncrasies that must be unravelled before a complete picture can be developed. The studies presented in this thesis are a step towards understanding the evolutionary dynamics of mtDNA in the laboratory. As I discuss in my final chapter a next step is to develop a more complete picture of the forces that operate in nature.

Chapter 2

Drosophila mitotypes determine developmental time in a diet and temperature

dependent manner

This chapter is modified slightly from Towarnicki & Ballard (2017).

Towarnicki, S.G., Ballard, J.W.O., 2017. Drosophila mitotypes determine

developmental time in a diet and temperature dependent manner. J Insect Physiol

100, 133-139.

Abstract

It is well known that specific mitochondrial DNA (mtDNA) mutations can reduce organismal fitness and influence mitochondrial-nuclear interactions. However, determining specific mtDNA mutations that are favourable has been elusive. In this study, I vary the diet and environmental temperature to study larval development time of two Drosophila melanogaster mitotypes (Alstonville and Dahomey), in two nuclear genetic backgrounds, and investigate developmental differences through weight, feeding rate, and movement. To manipulate the diet, I utilise the nutritional geometric framework to manipulate isocaloric diets of differing macronutrient ratios (1:2 and 1:16 protein: carbohydrate (P:C) ratios) and raise flies at three temperatures (19 °C, 23 °C, and 27 °C). Larvae with Dahomey mtDNA develop more slowly than Alstonville when fed the 1:2 P:C diet at all temperatures and developed more quickly when fed the 1:16

P:C diet at 23 °C and 27 °C. I determined that Dahomey larvae eat more, move less, and weigh more than Alstonville larvae when raised on the 1:16 P:C diet and that these physiological responses are modified by temperature. I suggest that 1 (or more) of 4 mtDNA changes is likely responsible for the observed effects and posit the mtDNA changes moderate a physiological trade-off between consumption and foraging.

2.1 Introduction

Despite statistical predictions that mitochondria undergo adaptive evolution (James et al., 2016), identification of mtDNA mutations that are favourable has been difficult

(Finch et al., 2014, Garvin et al., 2011, Kazancioglu and Arnqvist, 2014, Rollins et al.,

2016) while those that are slightly deleterious are well known (Blier et al., 2001,

Burman et al., 2014, Elson et al., 2015). The difficulty of identifying favourable mutations is due in large part to, the maternal mode of inheritance, lack of physical markers, and low levels of recombination in mtDNA. The objective of this study is to test the hypothesis that diet and temperature have the potential to differentially influence mitochondrial bioenergetics and the organismal fitness of Drosophila larvae harbouring distinct mitotypes (Ballard and Youngson, 2015). The influence of macronutrient ratios on a range of adult traits including fecundity has been investigated (Le Couteur et al.,

2014, Lee et al., 2008, Simpson and Raubenheimer, 2009, Solon-Biet et al., 2014) but the physiological significance of mtDNA mutations on immature development and fitness is underexplored (Dowling et al., 2008, Kazancioglu and Arnqvist, 2014).

Immature development time is an indicator of organismal fitness as reaching sexual maturity early can provide an advantage over slower developing competitors if there is no cost.

The nutritional geometric framework is a method of modelling nutrient needs of animals with a particular focus on physiologically relevant traits of individuals. Animals live within a complex nutritional framework where each necessary nutrient provides an axis, and within the framework constructed by theses axes, there is an optimal point termed the nutritional target (Behmer, 2009). As there can be over 40 nutrients required by insects (Raubenheimer and Simpson, 1997) the geometric framework can be

23 complex. The macronutrients of proteins and carbohydrates have the largest influence over lifespan and ageing in adult insects (Lee et al., 2008) and a wide range of species

(Solon-Biet et al., 2014). I use the axes of protein and carbohydrates to produce a two- dimensional geometric framework by controlling all other required nutrients to be present at optimal values. Using this framework I constructed diets comprising protein: carbohydrate ratios (P:C) of 1:2 P:C and 1:16 P:C as these diets span the P:C range of foods available to Drosophila in nature.

Temperature affects physiologically relevant traits of ectothermic organisms

(Stevenson, 1985) and may explain evolutionary diversity through adaptive radiation

(Schluter, 2000). It is well documented that ambient temperature has a large influence on the metabolic rate of insects (Azevedo et al., 2002, James et al., 1997, Loeb and

Northrop, 1916, Santos et al., 1994), with a strong effect on the development rate of

Drosophila melanogaster larvae and pupae (Berrigan and Partridge, 1997, French et al.,

1998). Here, I raised D. melanogaster at three temperatures: 19 °C, 23 °C, and 27 °C.

Previous laboratory studies with these mitotypes were conducted at 23 °C (Correa et al.,

2012) and I wished to maximize the range with two additional temperatures. Within this range of temperatures, 90% of D. melanogaster survive to adulthood under laboratory conditions (David and Clavel, 1967).

I study immature development, weight, feeding rate and movement as measures of organismal fitness (Godoy-Herrera et al., 1984, Shen, 2012, Stabell et al., 2007). I quantify larval weight and food consumption as an indication of cost (De Moed et al.,

1999). In D. melanogaster, feeding can be modulated through olfactory and gustatory systems (Isono and Morita, 2010, Wu et al., 2005a), including energy sensors (Burke and Waddell, 2011, Fujita and Tanimura, 2011) and protein/essential amino acid

24 sensors (Lee et al., 2008, Vargas et al., 2010). Increased movement tends to indicate higher energy consumption and has a strong relationship with temperature (Berrigan and Partridge, 1997, Goda et al., 2014).

The fly mitotypes included in this study were originally collected from

Alstonville (Australia) and Dahomey (West Africa). I test these mitochondrial haplotypes in two nuclear backgrounds. Alstonville and Dahomey mtDNA have been fully sequenced and compared with multiple other Drosophila mtDNA genomes (Aw et al., 2011, Clancy, 2008, Wolff et al., 2015).

In this study, I found evidence for a physiological trade-off between food consumption and foraging behaviour that influenced development time. Dahomey larvae fed the 1:2 P:C diet took longer to pupate than Alstonville larvae. Unexpectedly on the 1:16 P:C diet this effect was reversed, with Dahomey larvae pupating faster than

Alstonville larvae at 23 °C and 27 °C. I propose that this trend reversal on the 1:16 P:C diet is due to a physiological trade-off with Dahomey larvae obtaining energy by eating more and moving less than Alstonville. This trade-off results in Dahomey larvae pupating faster and having higher energy reserves on the 1:16 P:C diet.

2.2 Materials and Methods

2.2.1 Fly lines

Dahomey mtDNA harbors four unique mutations that I predict may be functionally significant (App. 2-2). These include nonsynonymous mutations in ND4 (Val161Leu),

COIII (Asp40Asn) and ATP6 (Met185Ile)) as well as one 16S rRNA (G499A) mutation. I consider two unique 12S rRNA (A79U and A241G) mutations that occur in

Alstonville mtDNA as unlikely to influence mitochondrial function. Mapping the 12S

25 rRNA sites on the human mitoribosome (Amunts et al., 2015) argues against an important role for either position (App. 2-2, Vila-Sanjurjo pers com). Aside from these mutations there are five synonymous changes in protein coding genes and 52 A+T-rich region mutations. Within the A+T-rich region, 50 mutations occurred in repeat regions, and 2 flanked the central T-stretch (App. 2-1). Synonymous mutations may influence codon usage but my initial prediction is that they are less likely to influence organismal function. None of the A+T mutations occurred in identified secondary structures, and so were considered less likely to influence the observed phenotype (App. 2-2).

The fly lines were originally constructed by chromosome replacement into the w1118 genetic background using balancers and differed in chromosome 4 and their mitochondrial genomes (Clancy, 2008). The lines have subsequently been backcrossed to w1118 for more than 20 generations to introgress chromosome 4. Multiple representatives of each line are independently maintained and used to test for experimental block effects. Further, prior to the commencement of the study all lines were backcrossed to w1118 for five generations to purge accumulating nuclear mutations.

I hereafter refer to these lines as (Mitochondria;Nuclear): Alst; w1118, Dah; w1118.

Mito-nuclear interactions have been shown to influence mitochondrial physiology and bioenergetics (Dowling et al., 2007, Meiklejohn et al., 2013, Rawson and Burton, 2002). To control for this interaction, I introgressed the Alstonville and

Dahomey mitotypes into an Oregon R genetic background using balancer chromosomes. The w1118 nuclear genome diverged from the wild caught Oregon R line in 1984 (Hazelrigg et al., 1984) and have been separated for at least 800 generations.

My introgression protocol followed Zhu et al. (2014) with the minor modification that I included first chromosome balancer FM7 and not FM6. These lines were then

26 backcrossed to Oregon R for five generations to introgress chromosome 4. Hereafter I refer to these lines as Alst;OreR, Dah;OreR.

2.2.2 Fly maintenance, and sex determination

Flies were maintained at constant density of around 200 adults in 250 ml glass bottles on instant Drosophila media (Formula 4-24 Instant Drosophila Medium, Plain, Carolina

Biological Supply Company) at 23 °C at 50% relative humidity with 12:12 light: dark cycles. To produce experimental larvae, adults were released into cages containing treacle/agar plates (4% agar, 10% treacle and 0.5 cm layer of yeast paste). Females were allowed to oviposit for 4 h, eggs were collected, washed and deposited on the study diets at an average density of 200 eggs per bottle (Clancy and Kennington, 2001), or 10 eggs per vial, and placed at 19 °C, 23 °C or 27 °C. Each assay was carried out at the temperature in which the larvae were raised.

Study diets were manipulated to have P:C ratios of 1:2 or 1:16, while remaining isocaloric. The 1:2 P:C diet consisted of 0.22 g sucrose, 73.21 g semolina, 79.38 g yeast and 27.19 g treacle per litre. The 1:16 P:C diet consisted of 9.34 g sucrose, 11.85 g semolina, 12.85 g yeast and 145.96 g treacle per litre.

To maintain a standardized intestinal microbiome, 4 male adult flies raised on

Drosophila instant media from each line (Alst; w1118 and Dah; w1118) were homogenized in a microcentrifuge tube containing 1.4 ml ddH2O. Two days after the eggs were deposited, 130/13 µl of the resulting mixture was added to each study bottle/vial.

Males and females were included in all assays. Three means of sexing immatures were utilized. First, second instar larvae were sexed using PCR with a y- linked primer pair. The PCR primers mst77Y_F1 and mst77_R1 were used to amplify a

27 region of the Mst77F gene on the Y chromosome (Krsticevic et al., 2010).

Simultaneously, PCR using the mtDNA encoded 8156+(sequence: forward 5′-

TAAACAAACTAATCTAACTAATA 3′) and 9132-(sequence: forward 5′-

GGTTGTGATATATTATCTTATGG 3′) showed that each extraction had amplifiable

DNA (primer numbering refer to GenBank: KP843845). Two bands on an agarose gel indicated males while a single band denoted a female. In the second method, third instar larvae were sexed visually. Male third instar larvae have readily visible gonads, appearing as transparent vesicular oval structures imbedded in the fat bodies of the fifth abdominal section (Maimon and Gilboa, 2011). Third, pupae were viewed under a dissection microscope, and the presence of sex-combs used to identify males.

2.2.3 Time to pupation

Reduced time to pupation is expected to increase lifetime fitness if it does not come with the cost of reduced weight and reduced adult fecundity (Yadav and Sharma, 2014).

Midpoint of egg laying plus larval development time determined time to pupation. Time to pupation is expressed in degree days calculated from a base of 13 °C, as this is the estimated development threshold temperature (Gu and Novak, 2006). For each diet, temperature, and mitotype-by-nuclear line, 10 replicates were established with 10 eggs/vial. Pupae were individually time stamped on the side of each vial every 6 h and then examined under microscope to determine sex. Further physiological assays were offset by the development time differences so that larvae were assayed at the same life history stage.

2.2.4 Larval weight

Greater larval weight indicates increased energy reserves and can lead to increased adult fecundity. Fresh, sexed, third instar wandering larvae were collected from each study 28 diet at each temperature from both mitotypes and weighed in groups of 10 using a

Sartorius Microbalance (AG Gottingen, Germany). Average wet weight of 6 replicates was recorded for both mitotypes from each diet from all temperatures. To corroborate this result, dry weight was recorded from larvae raised at one temperature.

2.2.5 Larval feeding

Increased food consumption may raise energy reserves and decrease development time.

I quantified second instar larval feeding as third instar larvae cease feeding and begin to wander (Godoy-Herrera et al., 1984). Larvae were manually collected, washed in 70% ethanol and then twice in ddH2O. A total of 50 larvae from each diet and temperature from both mitotypes were transferred to a petri dish containing the corresponding dye labelled or a non-dye-labelled diet. Absorbance values from control larvae fed non-dye- labelled diet were subtracted from all samples. The dye labelled diets were produced by combining 72 ml of each experimental diet with 8 ml FD&C blue 1 dye (0.5% (w/v)) at

60 °C.

Larvae were allowed to feed for 60 min. and individual larvae with dye visible in their intestines were collected. Preliminary analysis indicated that measured absorption of the dye reached saturation at 90 min. and there is no bias in the results from selecting larvae with food visible in their intestines, or selecting all larvae. Larvae were washed with 70% ethanol followed by two washes in ddH2O and transferred to

1.5 ml microcentrifuge tubes containing 50 μl cell lysis buffer (Qiagen) and 0.5 μl

Proteinase K (Sigma Aldrich). Ten larvae from non-dye-labelled diets were also transferred to individual tubes and used as controls. Larvae were homogenized using pestles and 50 µl added to a 96 well microtiter plate. Absorbance of samples was measured at 630 nm and a standard curve was produced from a series of dilutions of dye

29 labelled food with cell lysis buffer containing 1% proteinase K. Data were recorded as mg of food consumed per larvae. Preliminary studies established that dye is evenly distributed through the food. Larvae were then sexed using the y-linked primer pair.

2.2.6 Larval movement

Larval movement is energetically expensive but can provide a benefit in certain circumstances if it enables larvae to move to an optimal substrate. A total of 12 males and 12 females from each study diet at each temperature from both mitotypes were collected, washed in 70% ethanol and two washes of ddH2O. Individual larvae were placed in quadrants of 0.5% agar petri dishes. Agar plates were used to allow comparison between the two diets without the influence of food. Larvae were allowed to acclimate for 30 s while a clear petri dish cover was placed on each plate. Larvae were then observed for 60 s and trails left by the larvae in the agar were immediately traced onto the lid. The distance moved by each larva was measured independently by two investigators and mean movement/larvae was determined. The intraclass correlation between investigators was 0.96 which shows high repeatability of measurement

(Bartko, 1966).

2.2.7 Statistical analyses of organismal data

All statistical analyses were conducted using JMP 12 (SAS Institute). Mixed-model

ANOVA analyses included the main effects of diet, temperature, mitotype, sex and all two way interactions. Experimental block was included as a random factor (Sokal and

Rohlf, 1995) with p-values determined using log likelihood ratio with χ2 and the d.f. based on the difference on the number of parameters in the complete vs. the reduced model (Gałecki and Burzykowski, 2013). Mitotype by genotype interactions were analyzed by mixed model ANOVA including the main effects of mitotype, genotype 30 and their interaction. Diet had a significant main effect in all analyses and there were complex interactions between temperature and mitotype. As a consequence, I analyzed the 1:2 P:C and 1:16 P:C diets separately. In no case was sex or experimental block significant and they were removed from the reported analyses. Power analyses were conducted in JMP with a significance threshold of 0.05 to determine the Least

Significant Number (LSN) of samples needed to reach significance.

2.3 Results

2.3.1 Time to pupation

Larvae with Dahomey mtDNA developed slower on the 1:2 P:C diet but faster on the

1:16 P:C diet (Fig. 2-1). As expected, larval development time in degree days, was significantly shorter on the 1:2 P:C diet than on the 1:16 P:C diet (Fig. 2-1, Table 2-1).

On the 1:2 P:C diet, Alst;w1118 reached pupation significantly faster than Dah; w1118, with the fewest degree days needed to pupate occurring at 27 °C (Fig. 2-1A,Table 2-1 ).

An opposite trend was observed on the 1:16 P:C diet with Dah; w1118 pupating significantly faster than Alst;w1118 with the fewest degree days needed to pupate occurring at 23 °C (Fig. 2-1B, Table 2-1).

The Oregon R nuclear genetic background lines showed the same trend as the w1118 but development was 6% faster. When fed 1:2 P:C food, Alst;OreR immatures reached pupation significantly faster than Dah;OreR (Fig. 2-1C, Table 2-1). Again, when fed the 1:16 P:C diet Dah;OreR pupated significantly earlier than Alst;OreR (Fig.

2-1D, Table 2-1).

To determine whether the results were due to mito-nuclear interactions I conducted post hoc ANOVA of individuals with w1118 and Oregon R nuclear

31 backgrounds at 23 °C. ANOVA with main effects of mitotype (M) and nuclear background (N) indicated there was no mito-nuclear interaction on either the 1:2 P:C diet (M × N: F1, 447 = 0.7632, p = 0.39) or the 1:16 P:C diet (M × N: F1, 477 = 1.12, p =

0.29). As a consequence I focus upon the w1118 nuclear genetic background in subsequent assays.

Fig. 2-1. Development time of D. melanogaster lines harbouring Alstonville (Alst) and

Dahomey (Dah) mtDNA in the w1118 and Oregon R (OreR) genetic backgrounds fed two

Protein: Carbohydrate (P:C) diets and raised at three distinct temperatures (19 °C, 23

°C, and 27 °C). Bars indicate mean degree days to pupation ± SE. (A) 1:2 P:C Alst;w1118 and Dah;w1118 and (B) 1:16 P:C Alst;w1118 and Dah;w1118. Bars not connected by the same letter differ significantly according to post hoc Tukey’s HSD test: (A) α = 0.05 Q

= 2.86, (B) α = 0.5 Q = 2.86). (C) 1:2 P:C Alst;OreR and Dah;OreR (D) 1:16 P:C

Alst;OreR and Dah;OreR. *denotes P < 0.05.

Table 2-1. Analysis of variance results

Degrees of Temperature Mitotype T X M Diet freedom (T) (M) Nuclear Genome P:C Error df = 2 df = 1 df = 2

1:2 553 8385.06*** 54.42*** 2.58 w1118

Time to 1:16 564 3885.8*** 21.08*** 0.18 pupation 1:2 258 – 15.11*** – OreR

1:16 285 – 13.49** –

1:2 30 74.91*** 1.06 0.01 Weight w1118

1:16 30 91.95*** 45.34*** 0.39

Feeding 1:2 126 2.2 0.04 0.27 w1118 Rate 1:16 183 16.16*** 30.50*** 0.45

1:2 135 65.61*** 0.07 0.02 Movement w1118

1:16 130 106.86*** 28.33*** 9.85**

Data given as F-Value. ** P < 0.001. *** P < 0.0001. 2.3.2 Larval weight

Larvae fed the 1:2 P:C diet weighed most when raised at 23 °C (Fig. 2-2A). Larvae harbouring Dahomey mtDNA weighed significantly more than those with the Alstonville mitotype when raised on the 1:16 P:C diet at higher temperatures. On the 1:16 P:C diet, there

33 was no difference in larval weight when they were raised at 19 °C. However, Dah;w1118 larvae were significantly heavier than Alst;w1118 larvae at 23 °C and 27 °C (Fig. 2-2AB, Table

2-1). Desiccated weight showed the same trend as wet weight at 23 °C on both diets. On the

1:2 P:C diet there was no difference in desiccated weight (t10 = 0.05, p = 0.96). On the 1:16

1118 P:C diet Dah;w weighed more (t10 = 3.85, p = 0.003).

To investigate the non-significant 1:16 P:C and 19 °C result further I conducted a post hoc power analysis. Power analysis indicates that a sample size of 210 would be required to show a significant difference (p < 0.05) between the mitotypes of 0.05, if one existed (Σ =

0.092, Δ = 0.015), which is almost six times my sample size (n = 36). I conclude there is no biologically significant difference in weight of mitotypes fed the 1:16 P:C diet raised at 19

°C.

Fig. 2-2. Weight of D. melanogaster lines Alst;w1118 and Dah;w1118 fed two Protein:

Carbohydrate (P:C) diets at three distinct temperatures (19 °C, 23 °C, and 27 °C). (A) 1:2 P:C and (B) 1:16 P:C. Bars indicate wet weight ±SE. Bars not connected by the same letter differ significantly according to post hoc Tukey’s HSD: (a) α = 0.05 Q = 3.0, (b) α = 0.05 Q = 3.0.

2.3.3 Larval feeding

On the 1:2 P:C diet, there were no differences in food consumption between the mitotypes or between temperatures (App. 2-1, Table 2-1). In contrast, when fed the 1:16 P:C diet,

Dah;w1118 consumed significantly more food than Alst;w1118 larvae at all experimental temperatures (Fig. 2-3, Table 2-1).

To determine whether the non-significant 1:2 P:C result was simply due to low statistical power, I conducted a post hoc power analysis. This analysis indicates that a sample size of 1471 would be required to show a significant difference (p < 0.05) between the mitotypes of 0.05, if one existed (Σ = 0.077, Δ = 0.005), which is almost 11 times my sample

size (n = 132). I conclude there is no biological difference between food consumption on the

1:2 P:C diet between the mitotypes.

Fig. 2-3: Feeding rate of D. melanogaster lines Alst;w1118 and Dah;w1118 fed 1:16 P:C diet at three distinct temperatures (19 °C, 23 °C, and 27 °C). Bars indicate amount of dye labelled food consumed in 1 h ± SE. Bars not connected by the same letter differ significantly according to post hoc Tukey’s HSD: α = 0.05 Q = 2.8.

2.3.4 Larval movement

On the 1:2 P:C diet, there was no obvious difference in larval movement between the mitotypes and, as expected, movement increased with temperature (Fig. 2-4A, Table 2-1). On the 1:16 P:C diet, larvae harbouring the distinct mitotypes moved similar distances at 19 °C, but Dah;w1118 larvae moved significantly less than Alst;w1118 larvae at 23 °C and 27 °C (Fig.

2-4B). ANOVA showed significant effects of temperature, mitotype and a temperature × mitotype interaction (Table 2-1).

To investigate the non-significant 1:16 P:C and 19 °C result further I conducted a post hoc power analysis. Power analysis indicates that 3482 samples would be required to show a significant difference (p < 0.05) between the mitotypes of 0.05, if one existed (Σ = 1.63, Δ =

0.054) which is almost 25 times my sample size (n = 136). I conclude there is no biologically significant difference in movement between mitotypes fed the 1:16 P:C diet raised at 19 °C.

Fig. 2-4: Movement of D. melanogaster lines Alst;w1118 and Dah;w1118 fed two Protein:

Carbohydrate (P:C) diets at three distinct temperatures (19 °C, 23 °C, and 27 °C). (A) 1:2 P:C and (B) 1:16 P:C. Bars indicate distance moved per minute ± SE. Bars not connected by the

same letter differ significantly according to post hoc Tukey’s HSD: (A) α = 0.05 Q = 2.8, (B)

α = 0.05 Q = 2.9.

2.4 Discussion

Identification of mtDNA mutations that increase the fitness of an organism under any situation have been elusive (Finch et al., 2014, Garvin et al., 2011, Immonen et al., 2016,

Kurbalija Novicic et al., 2015, Rollins et al., 2016). Here, I suggest that 1–4 mtDNA mutations in Dahomey mtDNA are favourable when larvae are fed the 1:16 P:C diet and raised at 23 °C or 27 °C, but slightly deleterious when fed the 1:2 P:C diet.

On the 1:16 P:C diet Dahomey larvae consumed more food and at higher temperatures developed more quickly, weighed more and moved less (Fig. 2-1B, D, 2-2, 3-

2B, 2-4B). Larvae must make a strategic choice; eat enough food to reach their protein target, but have excess carbohydrates, or eat enough food to reach their carbohydrate target and forgo protein (Lee et al., 2008, Simpson et al., 2003, Simpson and Raubenheimer, 1997).

Plausibly, Dahomey larvae are employing the first strategy and overeating to meet their nutritional target of protein on the 1:16 P:C diet. This would result in the overconsumption of carbohydrates. Alstonville larvae, however, may be employing an alternate strategy as they eat less potentially forgoing their protein target to reduce the amount of carbohydrates they consume. Both strategies lead to increased food consumption and third instar weight in larvae harbouring Dahomey mtDNA, relative to those with the Alstonville mitotype. Likely,

Dahomey larvae are storing excess energy as triacylglycerides (Na et al., 2013), the main

constituents of stored fat in animals. Triacylglycerides can then be broken down into glycerol and fatty acids and provide energy through beta-oxidation (Liu and Huang, 2013).

On the 1:16 P:C diet, at higher temperatures, movement was lower in larvae harbouring Dahomey mtDNA compared to those with the Alstonville mitotype (Fig. 2-3B).

This suggests the food is sufficient for the growth and energy needs of Dahomey. In contrast,

Alstonville larvae eat less of the 1:16 P:C diet and move more, likely expending energy to find higher quality food. These hypotheses are supported by Troncoso (1987), who found a complex relationship exists between movement and feeding rate in Drosophila, where larvae that eat less will move more. Increased movement is also known on agar medium where larvae burrow further or move across the medium to find higher quality food (Farzin et al.,

2014, Wu et al., 2005b) and has been shown in choice assays where larvae target consumption to minimize development time (Rodrigues et al., 2015).

On the 1:2 P:C diet larvae with Dahomey mtDNA developed more slowly than those with Alstonville mtDNA but weight, feeding rate and movement did not differ. This strongly suggests that the mutations in Dahomey mtDNA are slightly deleterious when larvae are raised on the high protein diet. Slightly deleterious mtDNA mutations have previously been reported in flies (Burman et al., 2014, Celotto et al., 2011, Kemppainen et al., 2016, Ross et al., 2014) and deleterious mtDNA mutations are known to cause disease in humans (reviewed in Wallace 2010).

Temperature significantly influenced the results of seven of the eight assays but its effect was complex. Development required the fewest degree days at 27 °C when larvae were fed the 1:2 P:C diet but fewest at 23 °C when fed the 1:16 P:C diet (Fig. 2-1AB). Mossman et al. (2016) shows that mito-nuclear epistasis is context dependent; suggesting the selective pressure acting on mito-nuclear genotypes may vary with a food environment in a context 39

dependent manner. At 19 °C, on the 1:16 P:C diet, there was a significant difference in feeding rate but not in development time, movement or weight. One potential explanation for this result is that Dahomey larvae are losing energy through heat loss as a result of mitochondrial uncoupling. In much debated papers, it was hypothesized that certain human mtDNA haplogroups were able to colonize colder regions due to decreases in coupling efficiency, which increased mitochondrial heat production and permitted people to survive the cold of the more northern latitudes (Gnaiger et al., 2015, Ruiz-Pesini et al., 2004, Teulier et al., 2010, Wallace, 2005). More recently it has been suggested that the frequencies of the

T3394C and G7697A variants on human haplogroup M9a1a1c1b may be the primary cause of adaptation to hypoxia in Tibetans (Li et al., 2016) but it is also possible that there could also be adaptation to cold.

There are two major limitations of the study. First, there may be unaccounted differences in repeats within the A+T-rich region due to Mi-Seq strategy employed (Wolff et al., 2015) and these differences may be functionally significant (Salminen et al., 2017). J.

Wolff (pers. comm) reports they did not detect any notable size differences using Mi-Seq or

Bioanalyzer but it is possible that small differences escaped detection. Future studies may consider using long-read sequencing to corroborate the published sequences. Second, the diets differed in micronutrient concentrations due to the differences in yeast concentrations.

Possible solutions to this limitation would be to raise the flies on a holidic medium (Piper et al., 2014) or natural fruit that exhibits P:C ratios similar to those used in this study.

This study shows 1–4 mutations in larvae with Dahomey mtDNA have a fitness benefit on the1:16 P:C diet, but are slightly disadvantaged when fed the 1:2 P:C diet, relative to larvae with the Alstonville mitotype. How can this be? At the most basic level one or more of the mtDNA mutations must differentially influence energy production or mitochondrial

biogenesis. Likely this is orchestrated through metabolic flexibility (Kelley and Mandarino,

2000) of retrograde (nuclear response to mitochondria) and/or anterograde (nuclear to mitochondria) signaling (Galgani et al., 2008). On the high carbohydrate diet excess energy will be stored as lipids and a higher proportion of energy in the form of NAD+ and FADH will be obtained through beta-oxidation of fatty acids. In contrast, when larvae are fed the high protein diet a higher proportion of ATP will come from glycolysis and oxidative phosphorylation (Ballard and Youngson, 2015). Mitochondrial biogenesis may be influenced by differential production of reactive oxygen species by larvae harbouring the distinct mitotypes (Lee and Wei, 2005). The next step will involve determining which mutation (or mutations) is/are involved in causing the observed fitness differences. This will likely include structural, cellular and biochemical analyses (Burman et al., 2014, Correa et al., 2012, Fields et al., 2015, Rahman et al., 2014).

Chapter 3

Mitohormetic responses in Dahomey larvae fed 1:16 P:C food

This Chapter comprises Study 7 of Aw et al., (2018)

Reference

Aw1, W. C.; Towarnicki1, S. G.; Melvin, R. G.; Youngson, N. A.; Garvin, M. R.; Hu, Y.;

Nielsen, S.; Thomas, T.; Pickford, R.; Bustamante, S.; Vila-Sanjurjo, A.; Smyth, G. K.;

Ballard, J. W. O., Genotype to phenotype: diet-by-mitochondrial DNA haplotype

interactions drive metabolic flexibility and organismal fitness. PLoS Genet 2018, 14,

(11), e1007735.

1 Joint first author.

Abstract

Our 2018 PloS Genetics paper was five years in the making and included multiple individuals

(Aw et al., 2018). In this single article, we presented eight studies. We showed that the interactions between a single mtDNA mutation and diet caused significant physiological, cellular and biochemical effects that resulted in the frequencies of flies harbouring specific mtDNA types to change in population cages. Statistically, the strength of diet-induced selection that we observe is stronger than the classic example of pollutants changing the bark colour of trees, which resulted in an increase in the frequencies of dark moths during the industrial revolution in England.

The studies were designed to experimentally test the interaction between diet and mitotype in D. melanogaster flies and provide a mechanism by which selection occurs. The study started with population cages that include four laboratory diets and four mitotypes (all in a standardised nuclear genetic background) that were initially identified with high- throughput DNA sequencing. We then directly competed two of the mitotypes (Alstonville and Dahomey) and found the former mitotype increased in frequency when fed the 1:2 P:C diet while Dahomey increased in frequency when fed the 1:16 P:C diet. This result was corroborated when these mtDNA’s were genetically placed into three distinct nuclear genomes. We used quaternary 3D structural modelling to identify a single naturally-occurring point mutation, which drove the cage results. I was involved in all studies but responsible for

Studies 7 and 8 of this paper. Here I reformat study 7 as Chapters 3 of my thesis.

3.1 Introduction

In Study 2 of Aw et al., (2018), we observed a mitohormetic response whereby the Dahomey mitotype reached high frequency in dietary perturbation population cages when fed the 1:16 diet. A mitohormetic response is a genotype specific mitochondrial response that may trigger cytosolic and nuclear reactions.

I posited that the polyol pathway was mechanistically involved in a mitohometic response in Dahomey larvae due to the elevation of sorbitol levels in the metabolomics data

(Aw et al., 2018) and predicted that including dietary sugars in the pathway would be beneficial. If true, I hypothesised that the addition of the polyol pathway inhibitor Epalrestat would mitigate the net benefit. In the non-disease context the polyol pathway is essential for cellular osmoregulation but, in the context of diabetes, it is associated with tissue-damage during hyperglycaemia (Santos et al., 2017). In the pathway, glucose is reduced to sorbitol, via the action of the enzyme aldose reductase, and then oxidized to fructose. O-fucose and O- glucose are essential for normal Notch signalling (Okajima and Irvine, 2002) and their levels are regulated by derivatives of the polyol pathway including fructose, sorbitol and mannose, while xylose negatively regulates signalling (Lee et al., 2013; Sharma et al., 2014). Notch (N) regulates the cAMP responsive element binding protein (CrebB) (Tubon et al., 2013; Zhang et al., 2013), and experientially blocking CrebB activity in Drosophila fat body has been shown to increase food intake (Iijima et al., 2009).

The polyol pathway does not produce ATP so could not adequately account for the similarities in ATP levels between the mitotypes fed the 1:16 P:C diet. Here, I test the hypothesis that rates of β-oxidation differed between the mitotypes and add Etomoxir to the diet. β-oxidation of fatty acids generates NADH and FADH2 and thereby partially by-passes

Complex I of the electron transport system (Aw et al., 2016). Etomoxir inhibits entry of long- 44

chain fatty acids into the mitochondrion via the carnitine shuttle and I predicted its addition would result in loss of the selective advantage to Dahomey.

Metabolomic data in Study 3 of Aw et al., (2018) showed high levels of stearic and palmitic acid in Dahomey larvae so I assayed triglycerides. To test for increased lipogenesis,

I assayed the expression of Elongase factor F (eloF) and Brummer (bmm). elofF is a female- biased elongase involved in long-chain hydrocarbon biosynthesis (Chertemps et al., 2007). bmm is a lipase which promotes fat mobilisation and is responsible for channelling fatty acids toward β-oxidation (Grönke et al., 2005). Both, elofF and bmm were differentially expressed in the transcriptomics data (Aw et al., 2018). I then assayed β-oxidation directly using 14C- labelled palmitic acid. Acetyl-CoA was measured because the breakdown of carbohydrate influences its levels. NAD+ is required for fatty acid metabolism and the NAD+/NADH ratio was assayed.

Starvation resistance was then tested as a significant organismal trait (Hoffmann and

Harshman, 1999). When a larva is not feeding, energy can only come from the metabolism of existing resources (Gutierrez et al., 2007), which occurs when fruits are small, when food quality declines and also in a fluctuating environment (Schwasinger-Schmidt et al., 2012).

3.2 Materials and methods

3.2.1 Fly lines

Two D. melanogaster lines harbouring distinct mitotypes were initially collected in nature

(Alstonville, Dahomey). For this study, isogenic lines were constructed by chromosome replacement using balancers and differed in their mitochondrial genomes and chromosome 4

(Clancy, 2008). Mitochondrial DNA encoded amino acid, tRNA, rRNA and A+T rich region differences in these fly lines were previously reported (Aw et al., 2011; Clancy, 2008; Wolff 45

et al., 2016). Since arrival in the lab, the Alstonville and Dahomey mitotypes they have been subject to over 25 generations of backcrossing to w1118 thereby reducing chromosome 4 variation. Six generations of backcrossing occurred immediately before the commencement of all studies. The mitotype of all lines was checked every six months by Sanger sequencing

(Aw et al., 2011). Lines did not harbour Wolbachia infection or p-elements (Aw et al., 2011) and no evidence of heteroplasmy was detected. Samples in the study were randomised, but investigators were not blinded to the sample group.

3.2.2 Fly diets

The isocaloric 1:16 P:C diet contained 12.9 g of yeast, 11.9 g of semolina, 145.9 g of treacle and 9.3 g sucrose per litre (so dietary sucrose comprised ~5% of the 1:16 P:C diet). The autolysed yeast (MP Biomedicals, catalogue no. 103304), contains 45% protein, 24% carbohydrate, 21% indigestible fibre, 8% water and 2% acids, minerals and vitamins. The treacle (CSR, Vic, Australia) contains 0.4% protein, 71% carbohydrate and 0.17% of sodium.

The semolina (Quality Food Services, Qld, Australia) contains 11.8% protein, 68.8% carbohydrate, 1.6% fat, 3.2% dietary fibre and 0.0037% sodium.

Unless otherwise stated for all studies, flies from each of the mitotypes were raised for at least two generations on instant Drosophila food (Carolina Biological Supply

Company, NC, USA). Flies were placed in individual egg collection containers, and eggs manually added to either the 1:16 P:C diet with ~200 eggs per bottle. Microbiome was added after 48 hours. The microbiome was established by adding 130 µL of a homogenate from four males of each mitotype ground in 1.5 mL of distilled water.

3.2.3 Mitohormetic responses in Dahomey larvae fed 1:16 P:C food

To test specific hypotheses, I replaced sucrose as the dietary sugar. The 1:16 P:C diet was prepared without the addition of sucrose. Then, 200 ml of food was combined with 1.87 g of either sucrose (Sigma S0389) as the control, sorbitol (Sigma S1876), fructose (Sigma F0127), mannose (Sigma M6020), fucose (Sigma F2252) or xylose (Sigma X3877). Each new diet was poured into 8 bottles. Equal amounts of eggs harbouring Alstonville or Dahomey mtDNA were added to each food and microbiome was added after 2 d. Flies were kept at 23°

C, 50% humidity on a 12 h light/dark cycle. Emerging adult female flies were counted over 3 d, and percentage eclosion of each mitotype was calculated.

For inhibitors, freshly prepared aldose reductase (polyol pathway) inhibitor

(Epalrestat, Sigma SML0527) and carnitine palmitoyltransferase-1 inhibitor (Etomoxir,

Sigma E1905) were solubilised in water to make a 5 mM stock. The stock solutions were added to the 1:16 P:C diet to final concentrations of 25 µM Epalrestat, 12.5 µM Etomoxir.

Females that eclosed in a 3 d window were collected and counted, and eclosion percentage was determined by dividing the number of eclosed flies from each mitotype by the sum of both mitotypes.

3.2.3.1 Upregulation of the polyol pathway in Dahomey

Fructose levels were quantified using a photometric kit following the manufacturer’s instructions (Abacm AB83380).

To quantify larval feeding, 50 second instar female larvae from each mitotype were transferred to a petri dish containing the corresponding dye-labelled food. Dye-labelled foods were produced by combining 72 ml of the food while at 60° C, with 8 ml FD&C blue 1 dye

(0.5% w/v). Larvae were allowed to feed for 60 min, and 48 larvae with dye visible in their guts were collected, homogenized and absorbance measured.

3.2.3.2 Increased β-oxidation of fatty acids in Dahomey

Triglyceride levels were quantified using a photometric kit following the manufacturer’s instructions (Abcam AB65336).

The ß-oxidation assay was modified from adults for larvae (Bland, 2016). Briefly, larvae were collected 36 h after egg collection and fed with 1 µCi of 14C-labelled palmitic acid (prepared in 1:16 P:C diet) for 9 d. Groups of 10 were transferred to glass vials (20 ml), and KOH-saturated (100 µl of 5% KOH) filter paper (2.1 cm diameter circle, 1 µm pore) suspended above the larvae. The radiolabelled CO2 from larval respiration was trapped as potassium bicarbonate with KOH-saturated filter paper. After 5 h, this KOH-saturated filter paper was transferred to a 6 ml plastic scintillation vial containing 4 ml of scintillation cocktail (Ecoscint A) and radioactivity was measured using a scintillation counter. The

-1 -1 amount of CO2 generated from ß-oxidation was expressed as DPM. larva . h .

Acetyl-CoA from both mitochondrial and cytosolic extractions were quantified using a photometric kit (Abcam AB87546) following the manufacturer’s instructions.

NAD+ and NADH metabolites were extracted from female third instar wandering larvae harbouring Alstonville and Dahomey mtDNA raised on the 1:16 P:C diet (7 replicates/mitotype/diet) (Noack et al., 1992). The extracted metabolites were analysed using liquid chromatography (LC) electrospray ionisation tandem mass spectrometry (ESI-MS/MS)

(Bajad et al., 2006). The NAD+/NADH ratio was calculated as relative differences in peak areas between NAD+ and NADH metabolites.

To quantify larvae starvation survival, 12 early third instar female larvae from each mitotype were put into 6 vials. Each vial contained a 6 x 3 cm piece of filter paper, wetted with ddH2O twice daily. Larvae were observed 4 times daily by gentle prodding to determine if they were alive. Larvae that died within the first 24 h were excluded as death was due to handling. Mean time to death was recorded.

3.2.4 Gene expression

I employed RT-qPCR to validate the RNA seq data and quantify select genes for pathway analyses. For RNA extraction, 6 female third instar wandering larvae were homogenised in

TRI reagent (Sigma) in a Precellys 24 homogeniser (Bertin Technologies, île-de-France,

France). RNA was extracted with the standard TRI reagent protocol. 1.5 µg of total RNA was treated with DNase I Amplification Grade (Sigma). cDNA was prepared from 1.5 µg RNA template in 20 µl reaction mixture using a ProtoScript cDNA synthesis kit (New England

Biolabs, MA, USA). The comparative cycle threshold (Ct) method was used to analyse the

RT-qPCR studies.

Primers used were: bmm forward 5’-AAGTATGCACCGCATCTGTTG-3’, reverse

3’-CAAATCGCAGAGGAGACAGC-5’; CrebB forward 5’-

ATGGACAACAGCATCGTCGA-3’, reverse 3’-ACGACATCGACCACGTCATT-5’; eloF forward 5’-GCACATTGATTGGCTATCTGCT-3’, reverse 3’-

GATTTGGTAGGCTTTCAGGACA-5’; and N forward 5’-

GTCGGCGACTACTGTGAACAC-3’, reverse 3’-GTTGCGAAAGGTCACCTGACA-5’.

3.2.5 Statistical analyses

Unless otherwise stated, all data are biological replicates and statistically analysed by

ANOVA followed by Student’s t-tests to determine difference (JMP software 12, SAS 49

Institute, NC, USA). Biological replicates are parallel measurements of biologically distinct samples. Where the numbers of Dahomey larvae eclosing in 3 d was compared between dietary sugars (sorbitol, fructose, mannose, fucose, xylose and gluconate) and the control diet with the diets supplemented with an inhibitor (Epalrestat, and Etomoxir) I conducted

Dunnett’s tests. Data were checked for normality using a Shapiro-Wilks W test and outliers removed before statistical analyses using box plots. Values that were greater than  1.5 interquartile range were categorised as an outlier and excluded from the data set. No statistical methods were used to predetermine sample size.

3.3 Results

3.3.1 Upregulation of the polyol pathway in Dahomey

The polyol pathway converts glucose to fructose, however, fructose was not recorded as differentially present in the metabolomics data (Aw et al., 2018) because glucose interferes with its detection in GC/MS (Wahjudi et al., 2010). Here, I assayed fructose with an enzymatic kit. As predicted from an increase in the activity of the polyol pathway, Dahomey larvae had significantly elevated levels of fructose (t30= 3.40, p= 0.002).

My predictions that including dietary sugars in the polyol pathway would be beneficial, while addition of the inhibitor Epalrestat would mitigate the net benefit to

Dahomey larvae was observed. Replacing sucrose (control) with sorbitol, fructose, mannose, and fucose caused more Dahomey than Alstonville to eclose in a 3 d window (t6 = 2.64, p =

0.038, t6 = 11.7, p < 0.0001, t6 = 4.42, p < 0.005, t6 = 11.60, p < 0.0001 for sorbitol, fructose, mannose and fucose, respectively; Fig.3-1). Differences in development time were lost when xylose was the dietary sugar (t6= 1.23, p= 0.27; Fig. 3-1). Dunnett’s test demonstrated that similar numbers of Dahomey females eclosed in 3 d when fed the control diet and when

sucrose was replaced with sorbitol, fructose, mannose, fucose and xylose (Q = 2.80, p > 0.05 in all cases; Fig. 3-1). Addition of the inhibitor Epalrestat to the diet caused the repeatable differences in numbers of flies eclosing in 3 d to be lost (t8= 0.475, p = 0.647; Fig. 3-1).

Dunnett’s test showed a significant difference between numbers of Dahomey larvae eclosing in 3 d when fed the control diet and the diet supplemented with the inhibitor (Q = 2.59, p =

0.001; Fig. 3-1).

Fig. 3-1. Tests of hypotheses using other sugars and inhibitors. Dietary modification of the

1:16 P:C diet with replacement of sugars (sucrose was the dietary sugar for the Control) and inhibitors. Replacement sugars were sorbitol, fructose, mannose, fucose, xylose, and gluconate (n= 4 rep/mitotype).The inhibitors were Epalrestat (Polyol pathway) (n= 5 rep/mitotype), and Etomoxir (β-oxidation) (n= 5 rep/mitotype). More Dahomey than

Alstonville flies eclosed in a 3 d window when fed the control diet, as well as diets containing sorbitol, fructose, mannose, and fucose. Fewer Dahomey flies eclosed in a 3 d window when fed gluconate. There was no difference in the number of flies eclosing in 3 days between mitotypes when xylose was the dietary sugar or when Epalrestat or Etomoxir was added to the diet. * p < 0.05; ** p < 0.01, *** p <0.001 as determined by t-tests (see text). Dunnett’s tests compared Dahomey females fed the control diet to diets supplemented with inhibitors or the control diet compared with other sugars • p < 0.05 (see text).

As expected, increasing activity of the polyol pathway with the dietary addition of sorbitol increased N and decreased CrebB expression. Blocking the pathway with Epalrestat had the opposite effect. N expression increased 18% in Dahomey when the dietary sugar was sorbitol and decreased to the same level as Alstonville when Epalrestat was added (t10 = 4.36, p = 0.001, t10 = 3.90, p = 0.003, t12 = 0.06, p = 0.95 for control, sorbitol and Epalrestat, respectively; Fig.3-2A). CrebB expression was <5% higher in Dahomey larvae fed sorbitol compared to sucrose, but increased by 41% with the addition of Epalrestat (t10= 2.23, p=

0.046; t10= 2.72, p= 0.022, t12= 0.38, p= 0.711 for sucrose, sorbitol and Epalrestat, respectively; Fig. 3-2A).

Fig. 3-2. The polyol pathway is upregulated in Dahomey larvae fed the 1:16 P:C diet. (A)

Expression of N and CrebB differed when larvae were fed the control (sucrose) diet, or 53

sorbitol was the dietary sugar, but differences were lost when Epalrestat was added to the diet

(n= 6 rep/mitotype, with n= 8 for Epalrestat fed Dahomey). (B) Food eaten was higher in

Dahomey larvae than in Alstonville larvae. Food consumption increased when sorbitol was the dietary sugar and decreased when Epalrestat was added to the diet (n= 12 larvae/mitotype/diet were added to dye labelled food. Larvae with food visible in guts were collected and analysed: control-Alstonville= 7 larvae, control-Dahomey= 9 larvae, sorbitol-

Alstonville= 8 larvae, sorbitol-Dahomey= 11 larvae, Epalrestat-both mitotypes= 10 larvae.

Bars show mean ± s.e.m. * p< 0.05 and ** p< 0.01, as calculated by t-tests (see text).

For food consumption, larvae with Dahomey mtDNA ate 57% more when sucrose was the dietary sugar and 156% more when sorbitol was the dietary sugar (t14= 4.58, p=

0.0004, t17= 23.31, p< 0.0001; Fig. 3-2B). This distinct difference in food consumption was lost when Epalrestat was added to the diet (t18= 0.48, p= 0.64; Fig. 3-B). Therefore, I conclude that increased activity of the polyol pathway resulted in increased food consumption.

3.3.2 Increased β-oxidation of fatty acids in Dahomey

β-oxidation activity was highest in Dahomey larvae and this enabled the partial by-pass of the

Complex I mutation. As predicted, the dietary addition of Etomoxir removed Dahomey’s advantage. For development, Etomoxir caused the repeatable differences in numbers of flies eclosing in 3 d to be lost (t8= 0.10, p= 0.92; Fig. 3-1). There was a significant difference between numbers of Dahomey eclosing in 3 d when fed the control diet and the food supplemented with inhibitor (Q= 2.59, p< 0.02; Fig. 3-1). For triglycerides, levels were 76% higher in Dahomey when fed the control diet, but this clear difference was lost when

Etomoxir was added to the diet (t25= 5.52, p< 0.0001, t21= 1.07, p= 0.30, for control and

Etomoxir, respectively; Fig. 3-3A).

Fig. 3-3. β-oxidation of fatty acids is upregulated in Dahomey larvae fed the 1:16 P:C diet.

(A) Triglyceride levels were higher in Dahomey larvae fed the control diet. When Etomoxir

(Eto) was added to the control diet, triglyceride levels increased, and differences between the mitotypes was lost (n= 14 rep/mitotype/treatment with 6 failed reactions). (B) Expression of eloF and bmm were higher in Dahomey larvae fed the control diet. Differences were lost when Etomoxir (Eto) was added to the control diet (n= 6 rep/mitotype). (C) β-oxidation activity was highest in Dahomey larvae (n= 10 biological rep/mitotype – with one outlier removed). (D) Acetyl-coA enzyme activity in the cytosol and extracted mitochondria was 55

higher in Dahomey larvae. (n= 9 biological rep/mitotype – with four outliers removed from the cytosol data). (E). NAD+/NADH ratio was higher in Dahomey larvae (n= 7 rep/mitotype).

(F) Starvation survival was greatest in Dahomey larvae (n= 56 for Alstonville and 91 for

Dahomey). Bars (mean ± s.e.m). * p< 0.05 and ** p< 0.01, as calculated by t-tests (see text).

Lipogenesis was higher in Dahomey larvae. There was a 140% higher expression of eloF in Dahomey larvae fed the control diet (t10= 3.02, p= 0.013; Fig. 3-3B), but no difference when Etomoxir was added to the diet (t10= 0.26, p= 0.803; Fig. 3-3B). For bmm,

Dahomey larvae showed 100% higher expression on the control 1:16 P:C diet (t10= 3.65, p=

0.004; Fig. 3-3B). Again, this difference was lost when Etomoxir was added to the diet (t9=

0.51, p= 0.62; Fig. 3-3B).

Increased rates of β-oxidation in Dahomey are consistent with the higher ATP levels

(Aw et al., 2018) on the 1:16 P:C food than the 1:2 P:C diet. The rate of β-oxidation in

Dahomey larvae was almost double that observed in Alstonville larvae (t17= 5.98, p< 0.0001;

Fig. 3-3C). Further, the levels of cytosolic and mitochondrial acetyl-CoA were also markedly elevated being 181% and 584% higher, respectively (t12= 3.87, p= 0.002, t16= 8.84, p<

0.0001, for cytosolic and mitochondrial, respectively Fig. 3-3D). The NAD+/NADH ratio in

Dahomey larvae was 131% higher than that observed in Alstonville suggesting that the rate of β-oxidation was not limited by NAD+ availability (t12= 2.79, p= 0.016; Fig. 3-3E).

As expected, starvation resistance was higher in Dahomey than Alstonville larvae

(t145= 2.82, p= 0.005; Fig. 3-3F). Likely, starved larvae released lipids from the fat body and lipid droplets accumulated in oenocytes (Gutierrez et al., 2007). Oenocytes are secretory cells that express an extensive battery of lipid-synthesizing and -catabolizing enzymes including

fatty acid elongases and fatty acid β-oxidation enzymes (Makki et al., 2014). Plausibly, this could provide an advantage to Dahomey larvae in nature.

3.4 Discussion

I posit that mitohormetic responses resulted in higher levels of ATP in Dahomey larvae fed the 1:16 P:C diet as compared to those raised on the 1:2 P:C food (Fig. 3-4). Here, I have shown increased activity of the polyol pathway, corroborated differences in the expression of

N and CrebB and revealed increased food consumption. I used an activator (sorbitol) and an inhibitor (Epalrestat) of this pathway and observed the expected gene expression changes with RT-qPCR and the expected changes to feeding behaviour.

Fig. 3-4. Proposed mitohormetic responses in Drosophila larvae fed the 1:16 P:C food (red indicates elevated in Dahomey, blue higher in Alstonville). The mitohormetic response, involving at least two separate pathways, enabled Dahomey to develop faster than Alstonville larvae. First, larvae with Dahomey mtDNA ate more, which caused third instar larvae to weigh more. Backup of sugars produced increased activity of the polyol pathway and increased N expression. Increased N expression blocked CrebB and fed back to increase food consumption. Second, pyruvate was metabolised to acetyl-CoA and exported from the mitochondrion for fatty acid synthesis and palmitic acid and stearic acid levels increased. The 57

long-chain fatty acids were catabolised by β oxidation, resulting in the formation of NADH and FADH2. FADH2 shuttled electrons to the quinone pool and partially by-passed ETC

Complex I where the V161L mutation occurred.

The increased food consumption in Dahomey, fuelled an increase in lipogenesis and fat storage, which caused larvae to weigh more (Aw et al., 2018) and develop more quickly than Alstonville larvae (Fig. 3-4). Increased β-oxidation of fatty acids generated acetyl-coA,

NADH, and FADH2, which partially by-passed Complex I harbouring the V161L ND4 mutation. As expected, blocking long-chain fatty acid entry into the mitochondrion via the carnitine shuttle with Etomoxir caused the transcriptomic and RT-qPCR differences in eloF and bmm expression to be lost (Fig. 3-4B), resulting in loss of the selective advantage (Fig. 3-

1).

The mitohormesis response in Dahomey is diet dependent and not dependent on the

LKB1-SIK3 pathway or differential expression of Sirtuin 2 (Sirt2). To explicitly test whether metabolic rewiring in these mitotypes was fixed or dependent on the diet, I assayed eloF and bmm expression on the 1:2 P:C diet. Expression levels were not statistically different supporting the hypothesis that the rewiring was diet dependent (t10= 0.85, p= 0.42 and t10=

1.00, p= 0.34 for eloF and bmm, respectively). To investigate the potential for the LKB1-

SIK3 pathway to regulate lipid metabolism (Choi et al., 2015) I mined the transcriptomic data. The RNA-seq data did not show differential expression of the serine/threonine kinase

Lkb1, Salt inducible kinase 3 (Sik3) or CREB-regulated transcription coactivator (Crtc) (S2

Table). I did note, however, that Salt inducible kinase 2 (Sik2) was significantly overexpressed in Dahomey larvae (Aw et al., 2018). Sik2 is reported to have an important role in nutrient-dependent signalling homeostasis and to be a negative regulator of the 58

conserved Hippo pathway (Wehr et al., 2013). I also checked for the differential expression

Sirt2, as a buoyancy-based screen of Drosophila larvae revealed that it played a role in coupling fat storage to nutrient availability (Reis et al., 2010). Transcriptomic data did not suggest that Sirt2 was differentially expressed between mitotypes (Aw et al., 2018).

Overall, these data show that multiple pathways are involved in the Dahomey mitohormetic response. One potential explanation for the mitotype specific differences in development is disparities in fat metabolism. Triglyceride deposition increases throughout the larval stage in Drosophila before reducing three-fold during metamorphosis (Church and

Robertson, 1966). Consequently, differences in triglyceride content, particularly within the fat body, may alter the antagonistic relationship between insulin and ecdysone and affect developmental timing (Colombani et al., 2005). In support of this hypothesis, development rates were similar between mitotypes when Etomoxir was added to the diet (Fig. 3-1).

Differences in fat metabolism do not, however, provide an overarching explanation for developmental differences on both diets. An alternative explanation may be differential

Notch and/or FOXO signalling (D'Souza et al., 2010; Zeng et al., 2017). Neither hypothesis, however, fully explains the previous result that mitotype specific differences in development are lost at 19 C when food consumption but not movement differed (Towarnicki and

Ballard, 2017).

Chapter 4

Mitohormetic responses in Alstonville larvae fed 1:16 P:C food

This Chapter comprises Study 8 of Aw et al., (2018).

Reference

Aw1, W. C.; Towarnicki1, S. G.; Melvin, R. G.; Youngson, N. A.; Garvin, M. R.; Hu, Y.;

Nielsen, S.; Thomas, T.; Pickford, R.; Bustamante, S.; Vila-Sanjurjo, A.; Smyth, G. K.;

Ballard, J. W. O., Genotype to phenotype: diet-by-mitochondrial DNA haplotype

interactions drive metabolic flexibility and organismal fitness. PLoS Genet 2018, 14,

(11), e1007735.

1 Joint first author.

Abstract

Metabolic rewiring is a tool available to the cell to enable flexible utilisation of the macronutrients of diet. Observations of the Alstonville and Dahomey mitotypes fed the 1:16

P:C diet showed that Alstonville moved more than Dahomey and ate less. I hypothesised that high levels of gluconate in Alstonville may affect the pentose phosphate pathway and the utilisation of glycogen. I assayed glycogen levels, movement when fed the control diet and a diet with a pentose phosphate pathway intermediary sugar, and expression of genes associated with the pentose phosphate pathway and glycogen metabolism. I identified that

Alstonville utilises glycogen and the pentose phosphate pathway to redirect energy from growth to movement, likely to forage for a more protein rich diet.

4.1 Introduction

The transcriptomic data from Aw et al., (2018) actively supported the result that a general increase in mitochondrial gene expression is part of rewiring in Alstonville on the 1:16 P:C diet. Furthermore, I hypothesised that glucose-6-phosphate was differentially metabolized in

Alstonville due to the observed elevation in gluconate (Aw et al., 2018). Glucose 6-phosphate can be converted to store glycogen through the action of glycogen synthase and so I assayed levels of glycogen. Glycogen synthase and insulin-like receptor (Inr) are elevated in

Alstonville (Aw et al., 2018). Glycogen is a primary source of energy for adult muscle function (Greenberg et al., 2006; Ruaud et al., 2011) and the ubiquitous activation of Inr has previously been shown to cause larvae to feed less and to wander off the food (Britton et al.,

2002). Therefore, I assay development time and movement. I did not include a pentose phosphate pathway blocker because I considered this to be the wild-type pathway on the 1:16

P:C diet.

Glucose 6-phosphate is also metabolized by the pentose phosphate pathway and D-

Gluconate can be phosphorylated to 6-phospho-D-gluconate to enter the oxidative phase of the pathway (Rezzi et al., 2009). Here, I quantified the expression of Zwischenferment (Zw) and assayed glucose-6-phosphate dehydrogenase (G6PD) activity. Zw was differentially expressed in the transcriptomics data (Aw et al., 2018). Zw catalyses the oxidation of glucose-6-phosphate (G6P) to 6-phosphogluconate. G6PD is the rate-limiting enzyme of the pentose phosphate pathway (Stanton, 2012; Tian et al., 1998). I then assayed one aspect of insulin signalling. The insulin/insulin-like growth factor signalling pathway controls a wide variety of biological processes in metazoans (Taguchi and White, 2008) and stimulates glucose metabolism via the pentose phosphate pathway in Drosophila cells (Ceddia et al.,

2003). The most upstream central players in this pathway are members of the insulin-like

peptide (ILP) family, which includes insulin and insulin-like growth factors in mammals

(Nakae et al., 2001), as well as multiple ILPs in worms and insects (Murphy and Hu, 2013).

ILPs are regulated by nutritional status and Insulin-like peptide 2 (Ilp2) is essential for maintaining normoglycemia (Gronke et al., 2010). I assayed Ilp2 to corroborate the results from the transcriptomics data (Aw et al., 2018).

4.2 Material and Methods

4.2.1 Fly lines and diets

Fly lines and diets followed Chapter 3 (3.2.1 and 3.2.2).

4.2.2 Increased glycogen metabolism

Glycogen levels were quantified using a photometric kit (AB169558) following the manufacturer’s instructions.

To quantify larval movement, 48 third instar female larvae were placed in 0.5% agar in Petri dishes. Individual larvae placed in quadrants of the petri dish were observed for 60 s, and larvae trails were immediately traced onto the lid. The distance moved by each larva was measured independently by two investigators and the mean movement/larvae determined.

The intraclass correlation between investigators was 0.96 showing high repeatability of the measurement.

To test specific hypotheses, I replaced sucrose as the dietary sugar as described above with 1.868 g of gluconate (Sigma G1951) in 200 ml of food.

4.2.3 Upregulation of the pentose phosphate pathway in Alstonville

Glucose 6-phosphate-dehydrogenase (G6PD) activity was quantified in 96-well microplates at 23° C (Brinster, 1966). Enzyme activity was expressed as nmol. min−1. mg−1of protein.

4.2.4 Gene expression

RNA was isolated and RT-qPCR performed as per Chapter 3 (3.2.5).

Primers used were: Ilp2 forward 5’-ATGAGCAAGCCTTTGTCCTTC-3’, reverse 3’-

ACCTCGTTGAGCTTTTCACTG-5’; and Zw forward 5’- TTTGACGGCAAGATTCCGCA-

3’, reverse 3’- CACCAGAGCGTGGGGTAGA-5’.

4.2.5 Statistics

Statistical analysis of data obtained was performed as per Chapter 3 (3.2.6).

4.3 Results

4.3.1 Increased glycogen metabolism

Glycogen is a multi-branched polysaccharide of glucose and is too large to detect by GC-MS.

It serves as a form of energy storage in insects (Arrese and Soulages, 2010). As predicted,

glycogen levels were 72% higher in Alstonville than in Dahomey larvae (t18= 2.59, p= 0.02;

Fig. 4-1A).

Fig. 4-1. Glycogen metabolism is increased and the pentose phosphate pathway is upregulated in Alstonville larvae fed the 1:16 P:C diet. (A) Glycogen level was highest in

Alstonville larvae (n= 10 biological rep/mitotype). (B) Physical activity was highest in

Alstonville larvae fed the control (sucrose) diet and when gluconate was the dietary sugar (n=

16 larvae/mitotype with 3 outliers removed when fed sucrose and 12 larvae/mitotype when fed gluconate). (C) Expression of Zw and the Ilp2 on control (sucrose) and gluconate diets were higher in Alstonville larvae (n= 6 rep/mitotype with 1 failed reaction). Bars (mean ± s.e.m). * p< 0.05 and ** p< 0.01, as calculated by t-tests (see text).

Dietary addition of gluconate delayed development in both mitotypes but the developmental delay was greater in Dahomey (Fig. 3-1). Gluconate caused 54% more

Alstonville than Dahomey to eclose in 3 d (t6= 3.87, p= 0.008). Dunnett’s test demonstrated that more Dahomey females eclosed in 3 d when fed the control diet than when gluconate was the dietary sugar (Q= 2.59, p= 0.001; Fig. 3-1).

Increasing gluconate levels increased larval physical activity. Alstonville larvae exhibited greater physical activity than Dahomey larvae and movement increased with the dietary addition of gluconate (Fig. 4-1B). Physical activity was 72% greater in Alstonville larvae fed sucrose (t27= 3.54, p= 0.002). When gluconate was the dietary sugar physical activity increased by 52% and remained higher in Alstonville (t22= 2.81, p= 0.01; Fig. 4-1B).

4.3.2 Upregulation of the pentose phosphate pathway in Alstonville

Alstonville had higher Zw expression than Dahomey and the relative difference in expression increased with the dietary addition of gluconate. Expression of Zw differed on the 1:16 P:C diet with Alstonville showing a 56% higher expression of Zw than Dahomey, while

Alstonville larvae fed gluconate showed 75% higher expression than Dahomey (t10= 2.46, p=

0.034, t10= 2.66, p= 0.024, respectively; Fig. 4-1C). Consistent with these results, G6PD activity was 109% higher in Alstonville larvae (t14= 2.70, p= 0.02, App. 4-1)

Insulin signalling, suggested by increased Ilp2 expression, was also higher in

Alstonville. Ilp2 expression was more than twice as high in Alstonville than in Dahomey larvae (t9= 2.77, p= 0.02, t10= 2.38, p= 0.04, for control and gluconate, respectively (Fig. 4-

1C). It has been convincingly argued that insulin signalling influences food consumption and locomotion in adults flies and feeding in Drosophila larvae (Erion and Sehgal, 2013; Zhao 66

and Campos, 2012) . Future studies may consider including western blotting to assess insulin signalling.

4.4. Discussion

Alstonville fed the 1:16 P:C diet had elevated mitochondrial gene expression, produced more glycogen, were more active and had increased activity of the pentose phosphate pathway with greater insulin signalling. I postulate that the greater physical activity caused Alstonville larvae to redirect the resource away from development (Fig. 4-2). Physical movement requires ATP (Egan and Zierath, 2013) and is critical for dispersal behaviour seen upon nutrient deprivation (Wu et al., 2005). The cost of increased physical activity is the diversion of energy away from cell growth and division resulting in slowed development (Chowdhary et al., 2017; Kohane, 1994; Salin et al., 2015). Towarnicki and Ballard (2017) raised larvae at

19 C, 23 C and 27 C and measured development time, food consumption and movement.

At the two higher temperatures, Alstonville larvae developed more slowly, ate less and moved more. When larvae were raised at 19 C movement, and development time of these mitotypes did not differ, but differences in food consumption remained. Thus, temperature may have an indirect affect causing a reduction in movement of the poikilotherm. Further supporting this hypothesis, Wieser (1994) presented evidence to suggest that the cost of growth decreases with rate of growth in ectotherms.

Fig. 4-2. Proposed mitohormetic responses in Drosophila larvae fed the 1:16 P:C food (red indicates elevated in Dahomey, blue higher in Alstonville). I considered the response in

Alstonville to be the wildtype. Alstonville larvae upregulated glycogen metabolism and activity of the pentose phosphate pathway increased. Increased glycogen metabolism increased wandering, which diverted energy away from development. Additionally, increased insulin signalling resulted in decreased larval food consumption.

As observed in the transcriptomic data (Aw et al., 2018) mitochondrial transcription factor A (TFAM), a key regulator of mitochondrial gene expression, is not differentially expressed (t10= 0.14, p= 0.89). This is not surprising, as the levels of TFAM are known to be directly proportional to mtDNA copy number (Ekstrand et al., 2004) and the latter is lower in

Alstonville larvae on the 1:16 diet (Aw et al., 2018). I conclude that the difference in mitochondrial gene expression is not due to TFAM.

Increased glycogen levels in Alstonville larvae predicted that I would see an elevation in HR38 (Ruaud et al., 2011), the single fly orthologue of the mammalian nuclear receptor

4A family of nuclear receptors. Mining of the transcriptomic database did not suggest that was the case (Aw et al., 2018). There was, however, evidence for increased expression of the

Drosophila p70/S6 kinase (S6K), which is reported to be a key organizer of hunger-driven feeding behaviours in Drosophila larvae (Wu et al., 2005).

When fed the 1:16 P:C diet, Dahomey larvae had the relative advantage with multiple linked pathways working in a synergistic mitohormetic response that enabled larvae to eat more and develop more quickly. The remodelled pathways in Dahomey included upregulation of the polyol pathway, which fed back to increase food consumption and fuelled increased β-oxidation of fatty acids. Each cycle of β-oxidation results in the donation of electrons to the quinone pool downstream of Complex I in the electron transport system, thereby bypassing the V161L, ND4 subunit mutation (Aw et al., 2016). This process maintains levels of the quinone pool, which has been shown to be functionally important

(Ernster & Dallner., 1995). In Alstonville, mitochondrial gene expression was higher, glycogen metabolism increased and larvae were more active. I postulate that the greater physical movement in Alstonville larvae on the 1:16 P:C diet caused a reallocation of ATP away from cell division and growth, thereby slowing development. ATP drives many cellular processes and constrains development rates (Salin et al., 2015, Kohane., 1994). An alternative explanation is that upregulation of Notch and/or FOXO signalling in Dahomey may be responsible for driving mitotype-specific differences in development (D’Souza et al., 2010,

Zeng et al., 2017).

These data further question whether mtDNA can be assumed to accurately reflect species or population-level demographic processes when the dietary protein to carbohydrate ratio varies over time or space. It is now well documented that purifying selection affects the variability of mtDNA encoded genes, and the purging of deleterious variants will result in the

removal of linked variants through background selection. In humans, deleterious mtDNA mutations are well-known (Tuppen et al., 2010; Swalwell et al., 2011), and evidence for a profound effect of accumulated mutations on men’s health has been reported (Milot et al.,

2017). Purifying selection has been demonstrated in the female mouse germline (Fan et al.,

2008; Stewart et al., 2008) and in Drosophila slightly deleterious mutations have been reported (Celotto et al., 2011; Patel et al., 2016). These data provide an advantage of perceived deleterious mutation and supports possibly matching diet to an individual’s mitotype to optimise health.

Chapter 5

Mitotype interacts with diet to influence longevity, fitness, and mitochondrial

functions in adult female Drosophila

This Chapter is modified slightly from Towarnicki and Ballard (2018).

Towarnicki, S.G., Ballard, J.W.O., 2018. Mitotype interacts with diet to influence longevity,

fitness, and mitochondrial functions in adult female Drosophila. Front Genet 9, 593.

Abstract

Mitochondrial DNA (mtDNA) and the dietary macronutrient ratio are known to influence a wide range of phenotypic traits including longevity, fitness and energy production.

Commonly mtDNA mutations are posited to be selectively neutral or reduce fitness and, to date, no selectively advantageous mtDNA mutations have been experimentally demonstrated in adult female Drosophila. Here I propose that a ND4 V161L mutation interacted with diets differing in their macronutrient ratios to influence organismal physiology and mitochondrial traits, but further studies are required to definitively show no linked mtDNA mutations are functionally significant. I utilised two mtDNA types (mitotypes) fed either a 1:2 Protein:

Carbohydrate (P:C) or 1:16 P:C diet. When fed the former diet, Dahomey females harbouring the V161L mitotype lived longer than those with the Alstonville mitotype and had higher climbing, basal reactive oxygen species (ROS) and elevated glutathione S-transferase

E1expression. The short lived Alstonville females ate more, had higher walking speed and elevated mitochondrial functions as suggested by respiratory control ratio (RCR), mtDNA copy number and expression of mitochondrial transcription termination factor 3. In contrast,

Dahomey females fed 1:16 P:C were shorter lived, had higher fecundity, walking speed and mitochondrial functions. They had reduced climbing. This result suggests that mtDNA cannot be assumed to be a strictly neutral evolutionary marker when the dietary macronutrient ratio of a species varies over time and space and supports the hypothesis that mtDNA diversity may reflect the amount of time since the last selective sweep rather than strictly demographic processes.

5.1 Introduction

“It’s better to burn out than fade away” - Neil Young

Evolutionary biologists have long sought to understand the evolutionary forces that influence genetic variation within and among populations. At the molecular level polymorphisms might be evolving neutrally, could be transient variants on their way to elimination because they are deleterious, on their way to fixation because they are favourable, or they are actively maintained by balancing selection. It is now well documented that strong purifying selection affects variability of mitochondrial DNA (mtDNA) encoded genes and the purging of deleterious variants will result in the removal of linked variants through background selection. Evidence of positive selection on mitogenomes has been reported (James et al.,

2016; Rollins et al., 2016), but no specific mutation has been experimentally shown to have an evolutionary advantage in nature. In Pacific salmon, it has been proposed that changes in the mtDNA-encoded proton-pumping piston arm of Complex I influences organismal fitness

(Garvin et al., 2015). In humans, the frequencies of mtDNA-encoded T3394C and G7697A are higher in a Tibetan high-altitude group compared with a low-altitude group and it is suggested that the mitochondrial genome might be under selection from the high-altitude hypoxic environment (Li et al., 2016).

In this study, I explore how diet affects the physiology and the mitochondrial functions of adult female Drosophila melanogaster harbouring distinct mtDNA haplotypes

(mitotypes). Historically, caloric restriction was thought to reduce mitochondrial energy output and cellular damage which slowed the aging process (Partridge et al., 2005). More recent studies have shown that it is the macronutrient source of the calories rather than the total amount that leads to differential longevity (Lee et al., 2008; Solon-Biet et al., 2014; Zhu et al., 2014; Solon-Biet et al., 2015). Diets high in protein are correlated with reduced 73

longevity compared to diets high in carbohydrates (Lee et al., 2008). Specifically, the ratio of macronutrients in diet was found to be the causative factor that increased risk of death.

Protein: carbohydrate ratios (P:C) higher than 1:2 P:C (such as 1:1 or 2:1) had the greatest risk of death, while diets with a low P:C ratio (such as 1:16 P:C) had the lowest risk of death.

Here, I investigate physiological traits and mitochondrial functions of flies fed macronutrient ratios of 1:2 P:C and 1:16 P:C. These ratio span the macronutrient range fed upon by

Drosophila in nature.

I measured fecundity and feeding using the CAFÉ assay (Lee et al., 2008). Fecundity is energetically expensive (Melvin and Ballard, 2011) and there is a trade-off with longevity

(Westendorp and Kirkwood, 1998; Lee et al., 2008; Correa et al., 2012; Solon-Biet et al.,

2014) that is modified by an organism’s genes and the environment (Beaulieu et al., 2015).

While this trade-off is seen to be important in longer lived organisms such as humans

(Kaptijn et al., 2015) it has also been shown to occur in comparatively shorter lived organisms including insects (Haeler et al., 2014; Zhu et al., 2014). CAFÉ feeding rate was measured as it provides a robust measure of food consumption. Feeding rate has been shown to differ between mitotypes in adult males and in female larvae (Pichaud et al., 2013;

Towarnicki and Ballard, 2017). I measure the expression of Notch (N) to gain a cellular link with feeding rate. Upregulation of N has been shown to block CrebB (Zhang et al., 2013), and lead to an increased feeding response in Drosophila (Iijima et al., 2009).

I hypothesized that there may be physiological trade-offs between lifespan and other energetically expensive process such as physical activity. Walking speed and climbing ability were assayed as measures of physical activity as these provide different measures of energy expenditure. I employ average walking speed as a measure of basal physical activity. In contrast, I include the climbing assay as a measure of short-term explosive energy that

follows physical disturbance. Walking speed has been shown to correlate with lower survival in insects (Ragland and Sohal, 1975; Melvin and Ballard, 2011). Climbing tends to decreases with age in Drosophila (Goddeeris et al., 2003; Gargano et al., 2005).

As measures of mitochondrial function, I assayed the respiratory control ratio (RCR), mtDNA copy number and mitochondrial transcription termination factor 3 (mTerf3) expression. RCR indicates the ability to generate adenosine triphosphate. A high RCR occurs when mitochondria respond to the addition of adenosine diphosphate (ADP), followed by a fast return to basal levels when coupled (Brand and Nicholls, 2011). In healthy individuals, copy number is an indirect measurement of the oxidative phosphorylation (OXPHOS) capability of an organism, and may indicate maintenance of mitochondrial health (Dickinson et al., 2013). mTerf3 is the primary regulator of mitochondrial biogenesis and I hypothesized its expression may be correlated with copy number (Nam and Kang, 2005; Roberti et al.,

2006, 2009).

I assayed reactive oxygen species (ROS) production and an aspect of the antioxidant response as potential indicators of mitohormesis. Mitohormesis is defined as a non-linear response to ROS, where low levels of ROS benefit lifespan, but high levels are detrimental

(Ristow, 2014). Here I assayed basal ROS levels from extracted mitochondria. Mitochondria are the main source of ROS production and their function is strongly influenced by mitotype and diet (Ballard, 2005; Bellizzi et al., 2012; Sun et al., 2012; Yu et al., 2015; Aw et al.,

2017). Under mitohormesis, low levels of ROS act as signaling molecules that provides a fitness advantage through higher antioxidant capacity (Tapia, 2006; Ristow and Schmeisser,

2014). However, high ROS levels are predicted to reduce longevity primarily through DNA damage, but also through damage of proteins and fats. I assay expression of Glutathione S- transferase E1 (GstE1) as a measure of the antioxidant response (Sharma et al., 2004).

GSTE’s are a family of enzymes that detoxify lipids hyperoxides resulting from ROS damage

(Sheehan et al., 2001).

I included two Drosophila mitotypes throughout this study, Alstonville and Dahomey.

Each of these mitotypes was genetically placed into two standard nuclear genetic backgrounds to test the generality of the mtDNA effects. Mitonuclear interactions have previously been shown to influence longevity and fitness (Clancy, 2008; Parmakelis et al.,

2013; Wolff et al., 2014; Zhu et al., 2014). The Alstonville and Dahomey mitotypes differ by non-synonymous mutations in ND4 (V161L), ATP6 (M185I), and COXIII (D40N). They also differed by silent mutations in the lrRNA (G498A), the srRNA (A78U and A240G) and have 52 differences in the A+T rich region. Aw et al. (2018) studied these same mitotypes and observed a diet specific flip in larval development time that they argued was caused by the ND4 (V161L) mutation in Dahomey. When fed the 1:2 P:C food Dahomey larvae developed slower. However, when larvae were fed 1:16 P:C food, metabolism was extensively remodeled and larval development time was shorter in Dahomey than Alstonville.

Quaternary structural modeling posited that the ND4 (V161L) mutation reduced proton pumping and did not interact with any nuclear encoded subunits. Given this same suite of mutations occurs in all life history stages my prediction was that ND4 (V161L) mutation is also functional in adults. I hypothesize that reduced proton pumping in Dahomey females will decrease OXPHOS and increase longevity at the expense of reduced fecundity and basal physical activity (Copeland et al., 2009).

In this study I show that diet interacts with the host mitotype to influence longevity. I provide experimental evidence showing that adult females harbouring the Dahomey mitotype are longer lived than Alstonville flies on a high protein 1:2 P:C diet but shorter lived on a high carbohydrate 1:16 P:C diet. This flip in longevity is inversely correlated with

mitochondrial functions and is independent of the nuclear genetic background. This result has important implications in the field of molecular ecology as it supports the hypothesis that mtDNA diversity may reflect the amount of time since the last selective sweep (fixation of one haplotype as a result of the fitness advantage of one or more of its component nucleotides) rather than strictly demographic processes affecting the population (Ballard and

Whitlock, 2004; James et al., 2016).

5.2 Materials and Methods

5.2.1 Fly lines and maintenance

The five fly lines were used in this study were constructed from three mitotypes and two nuclear DNA backgrounds. I refer to the three mitotypes as Alstonville, Dahomey and w1118.

The former two were introgressed into the w1118 and Oregon R nuclear genetic backgrounds using balancer chromosomes followed by at least five generations of backcrossing (Clancy,

2008; Towarnicki and Ballard, 2017). To reduce the incidence of accumulated nuclear mutations, females from all fly lines were backcrossed to males of their corresponding nuclear genome for a minimum of five generations before all assays. In the coding region, the w1118 mitotype differs from Alstonville and Dahomey mtDNA by six and nine non- synonymous mutations, respectively (Clancy, 2008). To verify the correct lines were used, flies were genotyped at the beginning and end of each assay using allele specific PCR (Aw et al., 2018). Amplicons were run on a 1% agarose gel, with a band indicating Alstonville mtDNA, and no band Dahomey mtDNA.

Stock flies were maintained at constant density of 200 ± 25 adults in 250 ml glass bottles on instant Drosophila media (Formula 4-24 Instant Drosophila Medium, Plain,

Carolina Biological Supply Company) at 23°C, 50% relative humidity with 12:12 light: dark

cycles. To produce experimental flies, eggs were collected from stock flies using 5% agar,

10% treacle plates with 5 mm thick yeast paste. Eggs were collected, cleaned and placed on instant Drosophila medium following Clancy and Kennington (2001). After 2 days, four adult males of each mitotype were homogenized in 1.4 ml of ddH2O and 130 μl of the resulting solution was added to each bottle to standardize the microbiome of the larvae.

Mated adult female flies were included throughout the study. Females were sorted on ice 48 h after eclosion and then either placed into 500 ml demography cages, 5 ml CAFÉ assay vials or 25 ml vials, such that the density of flies in each container were similar. Male flies were not used in this study because I were interested in the trade-offs with egg production. Food vials were replaced every 2 days for each assay. Assays were carried out on flies that spent 12 days on either the 1:2 or 1:16 P:C diets. Previous studies have shown that bioenergetic and physiological assays of young flies were a good predictor of longevity

(Melvin and Ballard, 2011). Assaying flies at 14 days of age ensured that no larval fat reserves remained (Aguila et al., 2013) and was before flies started dying in the longevity studies conducted here.

5.2.2 Experimental diets

Yeast-sugar diets were used in this study and were manipulated to have P:C ratios of 1:2 or

1:16, whilst remaining isocaloric. The 1:2 P:C diet was comprised of 71.55 g of sucrose and

108.45 g of yeast per L at a final concentration of 180 g/L. The 1:16 P:C diet was comprised of 157.4 g of sucrose and 22.6 g of yeast per L at a final concentration of 180 g/L.

5.2.3 Longevity

In this study, 2 days old female Drosophila were added to 500 ml demography cages. Each cage contained 40 flies. Cages were randomly assigned to positions within the incubator and 78

were moved every 2–3 days. Dead flies were counted and removed every 2–3 days when food was replaced. Flies that died in the first 6 days were not counted as these were considered to be related to handling. Two independent longevity assays were conducted with each mitotype in the w1118 and the Oregon R genetic backgrounds fed each macronutrient ratio. Each study had 120 flies/mitotype/genetic background/diet. No significant block effects were detected and the studies were pooled such that 240 flies/mitotype/genetic background/diet were included. I did not determine longevity using the CAFÉ assay because of the shorter survival period when Drosophila are fed capillaries (Bajracharya and Ballard,

2016).

5.2.4 CAFÉ assay

The CAFÉ assay was used to measure fecundity and feeding simultaneously. In this study, females mated to males with same mitotype were individually transferred to 5 ml vials containing 500 μl of 1% agar. Capillary feeding tubes containing 5 μl of food were added to each vial and a no-fly control. Flies were transferred to new vials with new capillary feeding tubes daily. No flies died during the 14 days assay period.

5.2.4.1 Early fecundity

Egg production is energetically expensive in Drosophila and early fecundity has been shown to reduce lifespan (Khazaeli and Curtsinger, 2013). Here, number of eggs laid by each female mated to a male of the same mitotype was counted daily until 14 days of age when the physiological and biochemical assays were conducted. To test the influence of male mitotype on female fecundity I also mated virgin females of each mitotype to w1118 males and calculated egg production. Egg production for each female was averaged because I were interested in the overall production/female. A total of 10 flies/mitotype/diet were assayed.

5.2.4.2 Feeding

Capillary feeding was assayed as a measure of food consumption. The volume of food eaten by each fly was recorded daily until 14 d of age and consumption averaged for each individual. Over this period there was a slight decline in daily food consumption that was not mitotype or diet specific. A total of 10 flies/mitotype/diet were assayed.

N expression was assayed as it is linked with a feeding response (Iijima et al., 2009) using N forward 5′-CGCTTCCTGCACAAGTGTC-3′, reverse 3′-

GCGCAGTAGGTTTTGCCATT-5′ (Hu et al., 2013). Qualitative real-time PCR was conducted using Sybr-Green chemistry following (Correa et al., 2012). RNA was extracted from 5 flies per sample. Following Aw et al. (2018) data for all gene expression assays was normalized to nuclear housekeeping genes, Actin and RP49, and expressed as relative expression to Alstonville within each diet. A total of 6 replicates/mitotype/diet were assayed for each treatment.

5.2.5 Physical activity

Two assays of physical activity were conducted. Walking speed was measured as an indicator of basal energy expenditure (Melvin and Ballard, 2011). Climbing ability is a rapid movement response and is a known indicator of senescence (Gargano et al., 2005).

5.2.5.1 Walking speed

Activity was measured with the Trikinetics activity monitor following Melvin and Ballard

(2011). Briefly, experimental diet was poured in a beaker to a depth of 2–2.5 cm. Glass tubes were positioned vertically in the beaker and the end of the vial containing food was covered with a cap. One female was added to each activity tube and the vials were plugged with cotton wool to confine the fly to a distance of 4.5 cm in the tube and added to the holders of 80

the activity monitor. Flies were allowed 12 h to acclimate before recording began at the flies

“dawn.” The number of times a fly crossed the infrared beam at the midpoint of the tube was recorded by the DAM software (Trikinetics, Waltham, MA). Walking speed was calculated as: (number of light beam crossings × 4.5 cm)/12 h. When a fly was reported to cross the light beam more than 30 times in 5 min, the data point was excluded. A total of 16 flies/mitotype/diet were assayed.

5.2.5.2 Climbing assay

I assayed climbing ability following Bajracharya and Ballard (2016). Flies were transferred to vials without food and allowed to recover for 1 h. Vials were randomly grouped in lots of six, tapped three times to knock flies to the base of the vial and then photographed after 4 s by a camera 50 cm away. The number of flies that climbed above the 80 mm mark of the vial was recorded. A total of six vials of 10 adult flies/treatment were assayed.

5.2.6 Mitochondrial functions

To test whether changes in longevity involved differences in mitochondrial energy metabolism I assayed RCR, mtDNA copy number, mTerf3 expression, basal ROS and one aspect of the antioxidant response.

5.2.6.1 RCR, copy number and mTerf3 expression

I quantified RCR as an estimate of mitochondrial health. Mitochondria were isolated from 10 flies per mitotype. Following Aw et al. (2016), RCR was measured by Seahorse XF 24 as state III respiration in the presence of ADP and substrate, over basal state IVo respiration.

The XF sensor cartridge was loaded with 4 injection compounds

(ADP/oligomycin/BAM15/rotenone and antimycin A). Each plate was visualized under the

microscope to ensure a monolayer of adhered mitochondria to the well bottom. A total of 6 replicates/mitotype/diet were assayed.

MtDNA copy number was measured as an indicator of OXPHOS capacity. Copy number was determined following Aw et al. (2018). A total of 6 replicates/mitotype/diet were assayed for each treatment.

mTerf3 was assayed as a measure of mitochondrial transcription that I hypothesized may be linked with copy number. Primer pair: mTerf3 forward 5′-

TAACATCACCGGGTATAACCACC-3′, reverse 3′-CACTTCTTTGGAGCCTTCACAT-5′

(Hu et al., 2013). mTerf3 expression was calculated as relative expression to Alstonville within each diet (Aw et al., 2018). A total of 6 replicates/mitotype/diet were assayed.

5.2.6.2 Basal ROS and antioxidant response

Low levels of basal ROS can increase longevity but above a threshold the benefit is lost and longevity declines (Ristow and Schmeisser, 2014). Mitochondria were isolated from 10 flies per mitotype and Amplex Red assay was undertaken following Melvin and Ballard (2006). A total of 6 replicate s/mitotype/diet were assayed.

I measured one aspect of the antioxidant response by quantifying the expression of

GstE1 (Vontas et al., 2001) following Aw et al. (2018). Again, expression of GstE1 was calculated as relative to Alstonville within each diet (Aw et al., 2018). A total of 6 replicates/mitotype/diet were assayed for each treatment.

5.2.7 Statistics

I describe differences between the mitotypes relative to Dahomey because the ND4 (V161L) mutation, which is predicted to be functionally important, occurs in this mtDNA (Aw et al.,

2018). Longevity was calculated by the Log-Rank test using PRISM 7 (GraphPad Software).

All other data were analyzed for normality using Shapiro-Wilks W test, with outliers removed before analyses through the use of box plots. Values were categorized as outliers if their value was greater than 1.5 times the interquartile range, and were then excluded from their data set. Mixed-model ANOVA analyses including the main effects of mitotype, diet, and their interaction were conducted using JMP 13 (SAS institute). Following Aw et al.

(2018) if significant main effects were found a post hoc two-tailed Student’s t-test was conducted. In the case of fecundity, the data were Ln(X+1) transformed prior to analysis. For

N expression, I conducted a power analyses in JMP to determine the least significant number of samples required for significance, with significance set at 0.05. Unless otherwise stated, all data are biological replicates, which are measurements of biologically distinct samples.

Samples size was not predetermined by statistical tests and researchers were not blinded to the studies.

5.3 Results

5.3.1 Longevity

There was a diet dependent flip in the longevity of the two mitotypes in both the w1118 and

Oregon R nuclear genetic backgrounds (Fig. 5-1). Furthermore, as expected, the longevity of

Dahomey and Alstonville in both genetic backgrounds was shorter when fed the 1:2 P:C food. Considering the mitotypes in the w1118 genetic background and fed the 1:2 P:C diet,

Dahomey flies reached 50% survival at 63 days, while Alstonville females reached the same mark at 50 days (Fig. 5-1A). Overall, Dahomey flies lived significantly longer than

Alstonville flies (χ2 = 16.34, p < 0.0001). On the 1:16 P:C diet, Dahomey reached 50% survival at 64 days compared to the 75 days for Alstonville (χ2 = 8.69, p = 0.003) (Fig. 5-

1B). 83

Fig. 5-1. Survival curves of Alstonville and Dahomey mitotypes. (A) 1:2 P:C and (B) 1:16

P:C diets showing longevity of the Alstonville and Dahomey mitotypes in the w1118 nuclear background (n = 240 flies/mitotype/diet). (C) 1:2 P:C and (D) 1:16 P:C diets showing longevity of the Alstonville and Dahomey mitotypes in the Oregon R nuclear background (n

= 240 flies/mitotype/diet).

Longevity of the mitotypes in the Oregon R background showed the same trends as observed in the w1118 nuclear genetic background, but females tended to be ∼20% shorter lived (Fig. 5-1C&D). On the 1:2 P:C diet, Dahomey flies reached 50% survival at 46 days, while those with the Alstonville mitotype reached it at 33 days (Fig. 5-1C). Overall,

Dahomey flies lived significantly longer than Alstonville flies (χ2 = 61.55, p < 0.001). On the

1:16 P:C diet, Dahomey reached 50% survival at 54 days compared to 68 days for Alstonville

(χ2 = 33.3, p < 0.001) (Fig. 5-1D).

5.3.2 CAFÉ assay

5.3.2.1 Early fecundity

When fed the 1:2 P:C diet Dahomey laid 8% fewer eggs than Alstonville, but 88% more on the 1:16 P:C diet (Fig. 5-2AB). ANOVA showed no significant effect of mitotype (F1, 36 =

3.82, p = 0.06), but the effect of diet was significant (F1, 36 = 785.55, p < 0.0001) and the mitotype by diet interaction was significant (F1, 36 = 20.29, p < 0.0001). The mitotypes did not significantly differ in number of eggs laid on the 1:2 P:C diet (t18 = 0.91, p = 0.37) but

Dahomey laid significantly more eggs on the 1:16 P:C diet (t18 = 7.60, p < 0.0001) (Fig. 5-

2A).

Fig. 5-2. Number of eggs laid by the Alstonville and Dahomey mitotypes fed either the 1:2 or

1:16 P:C diets. (A) Females mated with males harbouring the same mtDNA type (n = 10 flies/mitotype/diet). (B) Females mated with males harbouring the w1118 mitotype (n = 10

flies/mitotype/diet). Bars indicate average number of eggs laid over 12 days ± s.e.m. ∗∗∗p <

0.001 (see text for details).

Early fecundity showed similar trends when w1118 was the male mitotype. Dahomey produced 9% fewer eggs on the 1:2 P:C diet but produced 78% more eggs on the 1:16 P:C diet (Fig. 5-2B). ANOVA showed significant main effects of mitotype (F1, 36 = 4.96, p =

0.03), diet (F1, 36 = 378.68, p < 0.0001) and the mitotype by diet interaction (F1, 36 = 8.87, p =

0.005). The mitotypes did not significantly differ in number of eggs laid on the 1:2 P:C diet

(t18 = 0.44, p = 0.67) but Dahomey laid significantly more eggs on the 1:16 P:C diet (t18 =

5.09, p < 0.0001) (Fig. 5-2B).

5.3.2.2 Feeding

When fed the 1:2 P:C diet Dahomey ate 12% less food than Alstonville, but <3% more on the

1:16 P:C diet (Fig. 5-3). ANOVA showed no significant effect of mitotype (F1, 36 = 3.46, p =

0.07), but did show significant effects of diet (F1, 36 = 372.80, p < 0.0001) and a mitotype by diet interaction (F1, 36 = 5.67, p = 0.02). Dahomey females consumed significantly less than

Alstonville adults on the 1:2 P:C diet (t18 = 2.53, p = 0.02), but there was no significant difference between mitotypes fed the 1:16 P:C diet (t18 = 0.48, p = 0.64) (Fig. 5-3).

Fig. 5-3. Volume of food consumed by the Alstonville and Dahomey mitotypes fed either the

1:2 or 1:16 P:C diets (n = 10 flies/mitotype/diet). Bars indicate average volume of food eaten over 12 days ± s.e.m. ∗p < 0.05 (see text for details).

N expression showed a similar pattern to food consumption. In comparison to

Alstonville, Dahomey had 60% lower expression of N on the 1:2 P:C diet and 40% lower on the 1:16 P:C diet (Fig.5-4). ANOVA showed a significant effect of mitotype (F1, 19 = 8.55, p

= 0.01), but no significant effect of diet (F1, 19 = 1.10, p = 0.31) or mitotype by diet interaction

(F1, 19 = 1.69, p = 0.21). Dahomey had significantly lower expression of N on the 1:2 P:C diet

(t10 = 2.7, p = 0.02), but the difference was not significant when fed the 1:16 P:C diet (t9 =

1.35, p = 0.21). To further investigate the 1:16 P:C result I conducted a power analysis.

Power analysis indicates that a sample size of 26 would be required to show a significant difference (p < 0.05) between the mitotypes, if one existed (Σ = 0.64, Δ = 0.26). Therefore, I conclude that there is no biologically distinct difference between N expression of flies harbouring the two mitotypes when fed the 1:16 P:C diet.

Fig. 5-4. Expression of N in the Alstonville and Dahomey mitotypes fed either the 1:2 or 1:16

P:C diets (n = 6 replicates/mitotype/diet with one outlier removed). Bars indicate relative expression ± s.e.m. ∗p < 0.05 (see text for details).

5.3.3 Physical activity

5.3.3.1Walking speed

On both diets, walking speed was highest in the shorter-lived females suggesting an evolutionary trade-off. Dahomey flies fed the 1:2 P:C diet moved 29% less than Alstonville but moved 44% more on the 1:16 P:C diet (Fig. 5-5). ANOVA of activity showed no significant effect of mitotype (F1, 52 = 0.43, p = 0.52) or diet (F1, 52 = 0.02, p = 0.90), but showed a significant mitotype by diet interaction (F1, 52 = 20.70, p < 0.0001). Dahomey

moved significantly less on the 1:2 P:C (t28 = 3.28, p = 0.003), but significantly more on the

1:16 P:C diet (t24 = 3.46, p = 0.002).

Fig. 5-5. Walking speed of the Alstonville and Dahomey mitotypes fed either the 1:2 P:C or

1:16 P:C diets (n = 16 flies/mitotype/diet). Eight flies died during the study: two Alstonville on the 1:2 P:C, three Alstonville on the 1:16 P:C and three Dahomey on the 1:16 P:C diet.

Bars indicate distance traveled in m/h ± s.e.m. ∗∗∗p < 0.001 (see text for details).

5.3.3.2 Climbing ability

Climbing ability showed the same trend as the longevity data. When fed the 1:2 P:C diet 34% more Dahomey flies climbed above the 80 mm line on the wall of their tubes after negative geotaxis, but 27% fewer climbed to this level on the 1:16 P:C diet (Fig. 5-6). ANOVA of climbing ability did not show a significant main effect of mitotype (F1, 20 = 0.32, p = 0.58) or diet (F1, 20 = 1.47, p = 0.24), but there was a significant mitotype by diet interaction (F1, 20 =

8.95, p = 0.007). Dahomey had significantly greater climbing ability on the 1:2 P:C diet (t10 =

3.28, p = 0.008), but lower ability on the 1:16 P:C diet (t10 = 2.48, p = 0.03).

Fig. 5-6. Climbing index of the Alstonville and Dahomey mitotypes fed either the 1:2 or 1:16

P:C diets (n = 6 replicates/mitotype/diet). Bars indicate climbing index ± s.e.m. ∗p < 0.05,

∗∗∗p < 0.001 (see text for details).

5.3.4 Mitochondrial functions

5.3.4.1 RCR, mtDNA copy number and mTerF3 expression

RCR showed the same trend as walking-speed. In comparison to Alstonville, RCR was 31% lower in Dahomey flies fed the 1:2 P:C diet but 75% higher when fed the 1:16 P:C food (Fig.

5-7). ANOVA of RCR showed no significant main effect of mitotype (F1, 20 = 2.18, p = 0.16) but diet was significant (F1, 20 = 17.76, p = 0.0004). There was a significant interaction between mitotype and diet (F1, 20 = 101.50, p < 0.0001). Dahomey had significantly lower

RCR on the 1:2 P:C diet (t10 = 6.78, p < 0.0001), but significantly higher RCR on the 1:16

P:C diet (t10 = 7.47, p < 0.0001) (Fig. 5-7).

Fig. 5-7. RCR of isolated mitochondria of the Alstonville and Dahomey mitotypes fed either the 1:2 P:C or 1:16 P:C diets (n = 6 replicates/mitotype/diet). Bars indicate RCR ± s.e.m.

∗∗∗p < 0.001 (see text for details).

Copy number exhibited the same trend as walking-speed and RCR. Dahomey had

50% lower copy number than Alstonville on the 1:2 P:C diet but had 30% higher copy number on the 1:16 P:C diet (Fig. 5-8). ANOVA of mtDNA copy number showed no effect of mitotype (F1, 20 = 1.98, p = 0.18), but showed a significant effect of diet (F1, 20 = 9.76, p =

0.01), and a mitotype by diet interaction (F1, 20 = 40.36, p < 0.0001). Dahomey had significantly lower copy number on the 1:2 P:C diet (t10 = 6.37, p < 0.0001), but had significantly higher copy number on the 1:16 P:C diet (t10 = 3.12, p = 0.01) (Fig. 5-8).

Fig. 5-8. Mitochondrial DNA copy number of the Alstonville and Dahomey mitotypes fed either the 1:2 or 1:16 P:C diets (n = 6 replicates/mitotype/diet). Bars indicate relative expression ± s.e.m. ∗p < 0.05, ∗∗∗p < 0.001 (see text for details).

As predicted, the expression of mTerf3 correlated with copy number and was positively correlated with walking-speed and RCR. Dahomey had 55% lower expression of mTerf3 than did Alstonville on the 1:2 P:C diet, but 52% higher expression on the 1:16 P:C diet (Fig. 5-9). ANOVA of mTerf3 expression showed no significant main effect of mitotype

(F1, 20 = 1.34, p = 0.26), or diet (F1, 20 = 0.05, p = 0.82), but showed a significant mitotype by diet interaction (F1, 20 = 10.32, p = 0.004). Dahomey had significantly lower mTerf3 expression on the 1:2 P:C diet (t10 = 2.41, p = 0.04), and significantly higher expression on the 1:16 P:C diet (t10 = 2.36, p = 0.04] (Fig. 5-9).

Fig. 5-9. Expression of mTerF3 in the Alstonville and Dahomey mitotypes fed either the 1:2 or 1:16 P:C diets (n = 6 replicates/diet/mitotype). Bars indicate relative expression ± s.e.m. ∗p

< 0.05 (see text for details).

5.3.4.2 Basal ROS and the antioxidant response

Basal ROS levels were 45% higher in the longer lived Dahomey flies than the shorted lived

Alstonville flies when the mitotypes were fed the 1:2 P:C diet (Fig. 5-10). There was no obvious difference in ROS levels between mitotypes when they were fed the 1:16 P:C diet

(Fig. 5-10). ANOVA of basal ROS showed significant effects of mitotype (F1, 20 = 21.65, p =

0.0002), diet (F1, 20 = 130.09, p < 0.0001) and mitotype by diet interaction (F1, 20 = 12.59, p =

0.002). Dahomey had significantly higher basal ROS on the 1:2 P:C diet (t10 = 5.85, p =

0.002), but showed no difference on the 1:16 P:C diet (t10 = 0.7742, p = 0.46).

Fig. 5-10. Basal ROS production of the Alstonville and Dahomey mitotypes fed either the 1:2 or 1:16 P:C diets (n = 6 replicates/mitotype/diet). Bars indicate average basal ROS production in nmol/min/unit of citrate synthase ± standard error. ∗∗p < 0.01 (see text for details).

As expected, GstE1 expression showed the same trend as basal ROS. Dahomey has

180% higher expression of GstE1 than Alstonville on the 1:2 P:C diet (Fig. 5-11). There was no obvious difference in expression in flies fed the 1:16 P:C diet (Fig. 5-11). ANOVA of

GstE1 expression showed significant main effects of mitotype (F1, 20 = 5.92, p = 0.02) and diet (F1, 20 = 7.30, p = 0.01), and a significant mitotype by diet interaction (F1, 20 = 5.83, p =

0.03). Expression of GstE1 was significantly higher in Dahomey on the 1:2 P:C diet (t10 =

2.64, p = 0.02), but showed no difference on the 1:16 P:C diet (t10 = 0.02, p = 0.98).

Fig. 5-11. Expression of GstE1 in the Alstonville and Dahomey mitotypes fed either the 1:2 or 1:16 P:C diets (n = 6 replicates/mitotype/diet). Bars indicate relative expression ± s.e.m. ∗p

< 0.05 (see text for details).

5.4 Discussion

MtDNA has been used extensively as a tool for inferring the evolutionary and demographic past of populations and species and is often presumed to evolve in a manner consistent with a strictly neutral equilibrium model without testing this assumption (Ballard and Kreitman,

1995; Ballard and Whitlock, 2004). This assumption can no longer be supported (Bazin et al.,

2006; Galtier et al., 2009; James et al., 2016; Teske et al., 2018). Here I show that an interaction between dietary macronutrient ratio and mitotype influences a wide variety of life history traits and mitochondrial functions. Currently, it is not clear how common such events may be in nature but the results of James et al. (2016) suggest they may be quite pervasive.

James et al. (2016) results indicate that up to 60% of non-synonymous substitutions could be

fixed by positive selection in invertebrates and may therefore have a non-trivial impact on mitochondrial diversity. The important consequence of their results is that mtDNA diversity may reflect the amount of time since the last selective sweep, rather than strictly demographic processes that affect the population, which may then affect tests of isolation by distance

(Teske et al., 2018).

To examine the data gathered I first consider the differences in longevity between the mitotypes fed the 1:2 P:C and 1:16 P:C diets. Remarkably, when both nuclear genetic backgrounds are considered, Dahomey lived, on average, 21% longer on the 1:2 P:C diet, but perished 10% earlier on the 1:16 P:C diet. Further, as previously reported, females lived longer on the 1:16 P:C food than the 1:2 P:C diet (Lee et al., 2008). Clancy (2008) previously assayed the longevity of these mitotypes in the w1118 genetic background and found that the

Dahomey mitotype had a 4% reduction in lifespan on an unknown diet. Aw et al. (2017) studied the longevity of Alstonville females in vials and observed similar results to those obtained here. They found 50% survival increased from 48 days on a 1:2 P:C diet to 75 days on a 1:16 P:C diet.

Here, I observed that climbing ability was correlated with longevity. Bazzell et al.

(2013) measured climbing ability of the Canton S and Berlin K lines through automated negative geotaxis. They found that the Berlin K line had 3 times lower climbing ability on a

1:4 P:C diet, but had greater climbing ability on a 1:2 P:C diet. Mawhinney and Staveley

(2011) studied the climbing ability and longevity of Drosophila that differed in expression of green fluorescent protein. They demonstrated a positive correlation between 50% survival and climbing ability.

Showing the same trend as longevity and climbing, levels of ROS and expression of

GstE1 were higher in Dahomey flies on the 1:2 P:C diet. There were, however, no obvious 96

differences between mitotypes when flies were fed the 1:16 P:C diet. Aw et al. (2017) assayed maximum ROS production from 11 days old Alstonville females and females with the Japan mitotype (in the w1118 nuclear background) that were fed a range of P:C diets. They found maximum ROS was highest when fed the 1:2 P:C and 1:16 P:C diets, and lowest when fed a 1:8 P:C diet. Mitotypes did not significantly differ in maximal ROS production, and basal ROS was not measured. GstE1 expression was measured as an indicator of antioxidant capacity. High antioxidant capacity is indicative of high longevity (Ng et al., 2014) by minimizing cytotoxic damage (Luceri et al., 2018). Expression of GstE1 has been shown to have increased twofold in yw Drosophila under expressing peroxiredoxins compared to the control at 13 days of age (Odnokoz et al., 2017) and in lines that show differential expression of antimicrobial peptides (Zhao et al., 2011). I hypothesize that the difference in basal levels of ROS that I observed in flies fed the 1:2 P:C diet resulted in mitohormetic responses from the nuclear genome. These responses include an upregulation of GstE1 expression may have provided an advantage through mitohormesis (Ristow and Schmeisser, 2014; Schaar et al.,

2015). Mitohormesis has been shown promote longevity in Drosophila through microbiome remodeling (Obata et al., 2018) and repression of insulin signaling (Owusu-Ansah et al.,

2013).

Here I observed that walking-speed was inversely correlated with longevity. Further, walking-speed was positively correlated with the mitochondrial functions of RCR, mtDNA copy number and mTerF3 expression. Differences in walking speed between females harbouring different mitotypes have not been reported, however, macronutrient ratio of diet has been found to influence walking speed in Drosophila (Catterson et al., 2010). Their data showed consistently higher movement on diet that contained only sucrose, in comparison to diet with sucrose and yeast, in w1118 females. In terms of mitochondrial functions, Pichaud et

al. (2010) found that male Drosophila simulans harbouring distinct mitotypes (siII and siIII) differed significantly in RCR due to temperature but they did not test the influence of diet.

For copy number, Aw et al. (2017) did not detect any significant difference in mtDNA copy number between 11 days old Japan or Alstonville females when they were fed any of the P:C diets tested. The Japan mitotype differs from Alstonville by a single non-synonymous mutation, whereas Dahomey differs from Alstonville by three non-synonymous substitutions.

Zhu et al. (2014) saw that the w501 mitotype had 50% higher mtDNA copy number than sm21 in the Oregon R nuclear background. As predicted mTerF3 expression was positively correlated with mtDNA copy number. The mitoribosome synthesizes all mitochondrial encoded proteins (Richman et al., 2014) and mutations in the mitoribosome have been linked to specific diseases (Elson et al., 2015). Plausibly, differential function of the mitoribosome influenced the number of mitochondrial Complexes, which resulted in the observed difference in OXPHOS efficiency.

Consistent with the walking speed result on the 1:2 P:C diet, feeding and expression of N are downregulated in Dahomey. This suggests that the observed decrease in mitochondrial function in Dahomey is signalling to reduce feeding. Feeding rate is a direct measure of energy intake of an organism and is influenced by a range of factors in

Drosophila including gustatory systems, energy sensors and protein sensors (Wu et al., 2005;

Vargas et al., 2010; Fujita and Tanimura, 2011). An alternate explanation for the reduced feeding rate in Dahomey flies fed the 1:2 P:C diet is that their ability to feed from capillaries reduced over time. Bajracharya and Ballard (2016) found that flies with Parkinson’s phenotype had reduced walking speed and could not easily feed during CAFÉ assay.

Dahomey had 78% higher fecundity than Alstonville when fed the 1:16 P:C diet, but fecundity did not differ between flies fed the 1:2 P:C food. As previously reported fecundity

in both mitotypes was higher when fed the 1:2 P:C food than fed the 1:16 P:C diet (Lee et al.,

2008). This result implies a trade-off with longevity on the 1:16 P:C but not the 1:2 P:C diet as fecundity as a trade-off has been shown to occur under stressful conditions (Beaulieu et al.,

2015). Further studies investigating the mechanism underlying this evolutionary trade-off between these mitotypes are warranted. It has already been shown that Dahomey has higher fecundity than several wild-caught lines including flies sourced from France, Germany, and

Greece when fed diet that differed in yeast concentration (Metaxakis and Partridge, 2013).

Aw et al. (2018) studied these same lines in larvae and provided compelling evidence to suggest that the ND4 (V161L) mutation in Dahomey is driving differences in larval development time. Here I hypothesize that the same ND4 (V161L) mutation also drives the observed differences in adults. However, additional studies are required to definitively show no linked mtDNA mutations are functionally significant and determine whether the same metabolic pathways operate in larvae and adults.

In this study, I have identified significant differences in organismal physiology and mitochondrial functions in Dahomey and Alstonville females. Notably, Dahomey females live longer than Alstonville flies on a high protein diet but are shorter lived on a high carbohydrate diet. This flip in longevity is inversely correlated with a battery of mitochondrial functions suggesting an evolutionary-trade off. I did not see a trade-off between longevity and fecundity within each diet. Rather, fecundity only differed on the high carbohydrate 1:16 P:C diet. These results suggest that diet may be an important driver of mtDNA dynamics and I suggest future studies explore the genetic variation within and among populations feeding on divergent foods.

Chapter 6

Yin and Yang of mitochondrial ROS in Drosophila

100

Abstract

In this Chapter, I test the hypothesis that Drosophila larvae producing mildly elevated levels of endogenous mitochondrial reactive oxygen species (ROS) benefit in stressful environmental conditions due to the priming of antioxidant responses. Reactive oxygen species (ROS) are produced as a by-product of oxidative phosphorylation and may be elevated when mutations decrease the efficiency of ATP production. In moderation, ROS are necessary for cell signalling and organismal health, but in excess can damage DNA, proteins, and lipids. I utilise two Drosophila melanogaster lines (Dahomey and Alstonville) that share the same nuclear genetic background but differ in their mitochondrial DNA haplotypes.

Previously, in Chapter 3 reported that Dahomey larvae harbouring the V161L ND4 mtDNA mutation have reduced proton pumping and higher levels of mitochondrial ROS than

Alstonville larvae when they are fed a 1:2 protein: carbohydrate (P:C) diet. In this Chapter I explore the potential for mitochondrial ROS to provide resistance to dietary stressors by feeding larvae 1:2 P:C food supplemented with ethanol or hydrogen peroxide (H2O2). When fed a diet supplemented with ethanol or H2O2, Dahomey develop more quickly than

Alstonville into larger pupae, while Alstonville developed faster on the control. Dahomey larvae displayed higher antioxidant capacity than Alstonville on all diets, with mitochondrial

H2O2 levels unchanged after the addition of stressors. Addition of stressors to the diet did not affect the mitochondrial functions of Dahomey larvae as measured by mitochondrial membrane potential, respiratory control ratio, or larval survival after bacterial challenge. In contrast, Alstonville larvae developed slower, had lower pupal weight, higher cytosolic H2O2, and had reduced mitochondrial functions. Further, Alstonville larvae fed the ethanol treated diet had lower survival after bacterial infection than those fed the control diet. Surprisingly, they had greater survival when fed diet with H2O2 indicating a mitotype by stressor

101

interaction that influences the immune response. Overall, these data suggest that elevated mitochondrial ROS in Dahomey can result in greater antioxidant capacity that prevents oxidative damage from exogenous stressors and may be a conserved response to high ethanol found in rotting fruit.

102

6.1 Introduction

Physiological stressors present strong selective pressures on insect populations, primarily through dysregulation of cell homeostasis. Determination of the physiological responses to chemical stressors is important, as exposure to these exogenous stressors is known to influence development time of insects (Bednarova et al., 2015) as the responses are energetically taxing (reviewed in Kodrik et al., 2015). The addition of industrial pollutants to diet has shown wide range of effects on insects including a reduction in pupal weight of

Panolis flammea and Bupalus piniarius (Heliovaara et al., 1989), and increased larval mortality of Lymantria monacha (Mitterbock and Fuhrer, 1988). Interestingly, positive responses to environmental stressors have also been identified in insects. For example,

Acyrthosiphon pisum displays faster growth and increased adult weight when exposed to low levels of sulfur dioxide (Warrington, 1987). Adult weight is positively correlated with larval weight, reproduction and longevity (Kingsolver and Huey, 2008) in a variety of insects including Drosophila (Yadav and Sharma, 2014), longicorn beetles (Wang et al., 2002), moths (Calvo and Molina, 2005), and leaf miners (Quiring and McNeil, 1984).

Specific genotypes of insects have been shown to differentially respond to environmental stressors (Clarke et al., 2009; Duan et al., 2001; Mpho et al., 2002; Polak et al., 2004; Ringwood et al., 2009), however response to exogenous stressors is not only influenced by the nuclear genotype. It has been demonstrated that mitochondrial DNA

(mtDNA) haplotypes (mitotypes) respond differently to environmental stress including naphthalene, traffic pollution and pesticides (Chung et al., 2013; Colicino et al., 2014;

Schizas et al., 2001; Wittkopp et al., 2013). While these studies have identified mitotype specific responses to environmental stressors, they have not identified a possible mechanism.

In this Chapter I investigate the responses of the Dahomey and Alstonville D. melanogaster

103

mitotypes to dietary stress. Dahomey harbors a mtDNA encoded non-synonymous V161L

ND4 mutation (Clancy, 2008) that is predicted to reduce proton pumping and has been shown to reduce ATP production and produce higher levels of reactive oxygen species (ROS) on a

1:2 protein: carbohydrate (P:C) diet (Aw et al., 2018).

Excess ethanol is a natural exogenous stressor (Chauhan and Chauhan, 2016; Logan-

Garbisch et al., 2015; Service et al., 1985) and specific evolutionary response mechanisms may be conserved (Kong et al., 2010). Adult female Drosophila flies are known to follow ethanol plumes to locate ripe fruit suitable for oviposition (Hoffmann and Parsons, 1984).

Larvae feed on rotting fruit that are in the process of fermenting and can face ethanol levels up to 7% (Gibson et al., 1981) before its eventual conversion to acetic acid. Exposure to ethanol has been shown to increase ROS levels in D. melanogaster (Niveditha et al., 2017), rats (Chen et al., 1997; Hamby-Mason et al., 1997) and yeast (Jing et al., 2018).

I predict that organisms will benefit from a flexible network of responses to reduce

ROS levels below a detrimental level. Endogenous ROS is produced endogenously as a by- product of oxidative phosphorylation (OXPHOS) and may be elevated when mutations decrease the efficiency of ATP production (Aw et al., 2018; Vives-Bauza et al., 2006).

Moderate levels of mitochondrial ROS are necessary for cell signaling and organismal health

(Ristow and Schmeisser, 2014; Tal et al., 2009; Zarse et al., 2012). In excess, however, ROS can damage DNA (Biancini et al., 2015; Scott et al., 2014; Yan et al., 2014), proteins

(Fedorova et al., 2014; Grimm et al., 2012), and lipids (Jaeschke and Ramachandran, 2018).

High levels of mitochondrial ROS result in increased leak into the cytosol through the process termed “ROS induced ROS release” (RIRR) (Zorov et al., 2000; 2014). Such RIRR may maintain mildly elevated cytosolic ROS levels, prime the antioxidant response, and provide increased resistance to dietary stressors (Zarse et al., 2012). Differences in the

104

response to elevated cytosolic ROS may occur between genotypes, generations, and sexes

(Clark and Fucito, 1998; Hoffmann et al., 2001; Neckameyer and Nieto-Romero, 2015).

Antioxidants respond to increasing ROS levels. The antioxidant response is multifaceted, varying from detoxification of superoxide’s, to repair of damaged tissue and lipids. SOD constitutes the first line of defense in the antioxidant enzyme network and is the primary scavenger of the ROS superoxide. The two main forms of SOD in eukaryotic organisms are manganese SOD, which is localized in the mitochondria, and copper – zinc

SOD, which operates in the cytosol (Filograna et al., 2016; Phillips et al., 1989). Two antioxidant genes were assayed in this study, superoxide dismutase 2 (Mn) (Sod2) and glutathione S transferase E1 (GstE1). Sod2 acts in the mitochondria (Duttaroy et al., 2003), while GstE1 is localized to the cytosol and acts to detoxify lipids damaged by ROS (Sheehan et al., 2001).

I investigate mitochondrial membrane potential, respiratory control ratio (RCR) and response of two Drosophila mitotypes to bacterial challenge in response to exogenous stress.

The mitochondrial membrane potential generated by proton pumps (Complexes I, III and IV) is an essential component in the process of energy storage during OXPHOS. Together with the proton gradient, membrane potential forms the transmembrane potential of hydrogen ions which is harnessed to produce ATP (Zorova et al., 2018). High membrane potential leads to high capacity for OXPHOS (Sakamuru et al., 2016). Low membrane potential may result from ROS damage produced as a by-product of decreasing OXPHOS efficiency (Suski et al.,

2012). RCR measures the ability of mitochondria to return from maximal ATP generation to basal levels when coupled (Brand and Nicholls, 2011). High RCR indicates healthy

OXPHOS capacity, while low RCR can indicate proton leak (Cheng et al., 2017). A bacterial challenge was undertaken as mitochondria are heavily involved in the innate immune

105

response (West et al., 2015; West et al., 2011b). Innate immunity in Drosophila includes humoral and cellular factors. The humoral factors induce hemolymph coagulation, melanization and the synthesis of antimicrobial peptides (Cherry and Silverman, 2006). The cellular responses by blood cells (hemocytes) include the recognition, phagocytosis and encapsulation of microbes (Williams, 2007). It has been shown that chronic ethanol exposure can reduce the immune response in mice (Jerrells et al., 1990).

The goal of this Chapter is to test the hypothesis that Drosophila larvae which produce mildly elevated levels of endogenous mitochondrial H2O2 develop faster under stressful environmental conditions. I identified that larvae harboring the Dahomey mitotype were better able to respond to exogenous stress than those with the Alstonville mitotype due to priming of their antioxidant responses. When fed diet treated with stressors, larvae harboring the Dahomey mitotype developed faster into larger pupae and had an increase in antioxidant capacity, with no reduction in membrane potential or RCR. In contrast,

Alstonville larvae fed ethanol treated diet had reduced survival after bacterial infection suggesting a complex interaction with the mitotype influences the fly immune response. This study indicates that the primed antioxidant response in Dahomey has potential to provide a benefit in hot climates where fruits rot quickly.

6.2 Materials and Methods

6.2.1 Experimental conditions

6.2.1.1 Strains and maintenance

The six fly strains used in this study were studied in pairs and constructed from four mitotypes and two nuclear DNA backgrounds. I refer to these pairs in the form mitotype;

106

nuclear type. The first pair is Dahomey (Dah); w1118 and Alstonville (Alst); w1118 (Clancy,

2008). The second pair is Madang (Mad); w1118 and Victoria Falls (VF); w1118 and the third is

Dah; CS with Alst; CS (Aw et al., 2018). Dahomey and Alstonville mtDNA have three nonsynonymous differences. In addition to the V161L change in the ND4 subunit of

Complex I in Dahomey, there is also a D40N change in the COIII subunit of Complex IV, and an M185I change in the ATP6 subunit of Complex V. The mitotypes also differ by three rRNA differences (two srRNA changes and one lrRNA change) and 52 A+T-rich region differences (Aw et al., 2018). Madang and Victoria Falls mtDNA have three nonsynonymous changes: V161L in ND4, F148Y in ND2, and M170L in COIII. The Madang and Victoria

Falls mitotypes share the same lrRNA bases as Dahomey and Alstonville, respectively.

Further, they differ by 41 A+T-rich region differences (Aw et al., 2018). The nuclear backgrounds of w1118 and Canton S standardized the nuclear background and tested for possible mitotype by nuclear interactions. w1118 was derived from the wild caught Oregon R strain in 1984 (Lindsley, 1968). The Canton S strain was caught in Canton, Ohio around 1916

(Qiu et al., 2017). All fly strains were introduced to a laboratory environment by 2002

(Camus et al., 2012) and are outside the three year timespan in which resistance to stress is rapidly lost under laboratory adaptation (Hoffmann et al., 2001).

To reduce the possibility of accumulated nuclear mutations, females from each of the six strains were crossed to males of their corresponding nuclear DNA background for a minimum of five generations before all assays. To ensure the correct flies were used, flies were genotyped at the beginning and end of all assays. Flies harboring the Dahomey and

Alstonville mitotypes were assayed using allele specific PCR (Aw et al., 2018), while those with the Madang and Victoria Falls mitotypes were assayed by Sanger sequencing using ND4

107

forward 5`-TCTTCGACTTCCAAGACGTTCA-3` and reverse 3`-

TGAAGCTCCAGTTTCTGGGTC-5`.

Stock flies were maintained in 250 ml glass bottles at a constant density of 200 ± 25 adults. They were raised on instant Drosophila media (Formula 4-24® Instant Drosophila medium, Plain, Carolina Biological Supply Company) at 23 °C, with 50% relative humidity, and were kept on 12:12 h light: dark cycles. To produce flies for this study, eggs were collected from 5 d old stock flies using oviposition plates (5% agar, 10% treacle) with a thin spread of baker’s yeast paste. Eggs were collected, washed briefly with diluted bleach, rinsed, and placed onto the experimental diets as per Clancy and Kennington (2001). The microbiome was standardized after 2 d following Aw et al. (2018).

In this study, pupae and late third-instar wandering female larvae were included.

Pupae were sexed by the presence of sex-combs (Flagg, 1988). Third-instar larvae migrating on the side of the vial were selected and sexed (Maimon and Gilboa, 2011).

6.2.1.2 Experimental diets

The 1:2 P:C ratio larval diet was the control (Towarnicki and Ballard, 2017). I used ethanol and H2O2 as exogenous dietary stressors. Ethanol is a natural stressor produced by rotting fruit. H2O2 is produced in cells as a consequence of OXPHOS but can also be generated through external means including exposure to pollutants and radiation. Following preliminary titrations to optimize concentrations (App. 6-1), a final concentration of 2% was chosen for the ethanol treatment and 2.5 mM for the H2O2 treatment. Experimental diets with either ethanol or H2O2 were carefully constructed. The 1:2 P:C ratio diet was cooked, cooled to 60

°C in a water bath, and then either ethanol or H2O2 was added. 108

To determine whether ethanol penetrated the gut, larvae from the control and ethanol treatments were collected and larval guts were removed and discarded. The carcasses were placed in 200 μl Eppendorf tubes with a hole pierced in the base using sharpened forceps.

Each tube was placed in a 1.5 ml Eppendorf tube, and spun using a desk centrifuge for 10 s to collect hemolymph. From the control and ethanol fed samples, 10 μl of hemolymph was diluted with 50 μl of ddH2O, added to a 96 well microtiter plate and absorbance was measured at 230 nm. Preliminary analysis showed no difference in absorbance if ddH2O or saline was used for the dilution. Hemolymph extracted from six groups of 10 Dah; w1118 and

Alst; w1118 larvae from the control and ethanol diets was assayed.

To determine whether the H2O2 added to the diet penetrated the gut, hemolymph was extracted from larvae as above. H2O2 levels were measured from the control and treated larvae using Amplex Red. In the presence of peroxidase Amplex Red reacts with H2O2 in a

1:1 stoichiometry to produce the red-fluorescent oxidation product, resorufin, which was fluorometrically assayed at 585 nm. Hemolymph extracted from six groups of 10 Dah; w1118

1118 and Alst; w larvae from the control and H2O2 diets was assayed.

6.2.2 Physiological assays

6.2.2.1 Time to pupation

Previously in Chapter 2 I found that Dahomey larvae developed to pupation slower than

Alstonville larvae when raised at 23 ºC and fed the 1:2 P:C diet. Eggs were collected as described above and individually placed into vials in batches of 10. Larvae were observed every 4 h during daylight hours and were individually time stamped when they reached pupation. For Dah; w1118 and Alst; w1118, 30 replicate vials were established for the control 109

diet, 10 vials for the ethanol treated diet, and 20 vials for the H2O2 treated diet. For Mad; w1118, VF; w1118, Dah; CS, and Alst; CS, 10 replicate vials were established for each treatment.

6.2.2.2 Pupal dry weight

Pupae were collected 4-5 d after pupariation, when sex combs were evident. Female Dah; w1118 and Alst; w1118 pupae were collected and weighed using a Sartorius microbalance (AGG

Gottingen, Germany). Pupae were then placed in 1.5 ml tubes with cotton covering the opening, and dried in an incubator at 60 °C overnight as per Komata et al. (2018). Pupae were again weighed to record dry weight. For the control diet, 18 groups of 10 pupae were weighed for each mitotype. For the ethanol and H2O2 treated diets, 12 groups of 10 pupae were weighed per mitotype.

6.2.3 H2O2 levels and antioxidant responses

6.2.3.1 H2O2 levels

Basal H2O2 levels were quantified from isolated mitochondria while total H2O2 levels were assayed in the cytosol using Amplex Red (Melvin and Ballard, 2006). Mitochondria and the cytosolic fraction were isolated following Aw et al. (2018). Briefly, larval guts were removed, the carcasses added to mitochondrial isolation buffer, and ground using a pestle.

Homogenate was added to a cotton filtered syringe and filtered solution was added to new 1.5 ml Eppendorf tubes. Tubes were then centrifuged to separate the mitochondrial pellet from the supernatant containing the cytosolic fraction. Protein concentrations of the mitochondrial

110

and cytosolic fractions were quantified by Bradford assay. For the Dah; w1118 and Alst; w1118 mitotypes, late third-instar female larvae were collected in 12 groups of 10 larvae for the control diet, six groups of 10 larvae for the ethanol treatment, and 12 groups of 10 larvae for the H2O2 treatment.

6.2.3.2 Superoxide dismutase (SOD) activity

Mitochondria from Dah; w1118 and Alst; w1118 were isolated, as reported above, and SOD activity was determined in mitochondria extracts and, in the cytosol, using the ABCAM SOD assay kit (AB65354). Six groups of 10 late third-instar wandering female larvae were assayed for each treatment.

6.2.3.3 Expression of antioxidant genes

Expression of Sod2 and GstE1 from Dah; w1118 and Alst; w1118 was determined from third- instar wandering female larvae. Collected larvae were snap-frozen in liquid nitrogen, RNA was extracted using TRIZOL (Invitrogen), and cDNA was synthesized using SuperScript II

RT (ThermoFisher). Primer sequences specific for Sod2 were obtained from Hu et al. (2013) while those for GstE1 were sourced from Aw et al. (2018). SYBR Green (ThermoFisher) chemistry was used to perform quantitative real-time PCR (Correa et al., 2012). Following

Aw et al. (2018) gene expression was normalized with Actin and RP49 and was expressed as relative to Dah; w1118 fed the control diet. For the Dah; w1118 and Alst; w1118 mitotypes, gene expression was quantified from 12 groups of three larvae for the control diet, and six groups of three larvae for the ethanol and H2O2 diets.

111

6.2.4 Mitochondrial functions

6.2.4.1. Membrane potential

Mitochondria were isolated from Dah; w1118 and Alst; w1118, as described above, and mitochondrial membrane potential of isolated mitochondria was fluorometrically quantified by JC-10 dye (Bajracharya and Ballard, 2016). For the control diet, 12 groups of five third- instar wandering female larvae were assayed. For the ethanol and H2O2 treatments, six groups of five larvae were tested.

6.2.4.2 Respiratory control ratio (RCR)

RCR from Dah; w1118 and Alst; w1118 mitochondria was measured using a Seahorse XF24 respirometer (Aw et al., 2018). RCR was calculated as state III / state IVo. For the control diet, 12 groups of 10 third-instar wandering female larvae were included. For the ethanol and

H2O2 treated diets, six groups of 10 larvae were assayed.

6.2.4.3 Microbial challenge

Third-instar wandering female larvae were infected with a sharp needle dipped into a concentrated bacterial solution of Escherichia coli (Shia et al., 2009). Between samples the needle was flamed, dipped in room temperature distilled water and then into the bacterial solution. Puncturing of the larval epidermis was confirmed by direct observation of a small discharge of hemolymph. After infection larvae were placed on sucrose plates (5% sucrose,

5% agar) and survival determined after 6 h. When fed the control diet, 50 larvae were assayed

112

1118 1118 for Dah; w and 90 for Alst; w . When fed food treated with ethanol and H2O2, 10 and 40 larvae were assayed for each mitotype, respectively. To determine the effect of injury 10 additional larvae from each mitotype-by-treatment group were poked with a sterile needle.

From this control group just two of 60 larvae died so these additional controls are not included in subsequent analyses.

6.2.5 Data analysis

All data were analyzed for normality using Shapiro-Wilkes W tests and tested for outliers through box plots. If any data points were greater than 1.5 times the interquartile range, they were removed. Mixed-model ANOVA analyses were conducted on all data sets including the main effects of treatment, mitotype and their two-way interaction using JMP 13 (SAS institute). I then conducted post hoc Student’s t-tests to determine significance between mitotypes. All measurements were from biologically distinct samples forming biological replicates. Statistical tests were not conducted to predetermine sample size.

6.3 Results

6.3.1. Physiological assays

6.3.1.1. Time to pupation

1118 Addition of ethanol and H2O2 to the diet caused a flip in development time and Dah; w developed more quickly than Alst; w1118 (Fig. 6-1A). In Dah; w1118 addition of ethanol to the diet did not influence development time, while addition of H2O2 to the diet resulted in development being ~15% faster. Regarding Alst; w1118, dietary ethanol caused development to slow by ~12%, while H2O2 caused development to speed up by ~9%. When the mitotypes were harbored in the w1118 nuclear background there was a significant effect of mitotype, 113

treatment, and the two-way interaction (F1,499= 14.98, p < 0.001, F1,499= 166.97, p < 0.001,

F2,499= 23.09, p < 0.001, respectively). In each condition, post hoc t-tests showed significant differences in time to pupation between the mitotypes (control: t246= 3.51, p < 0.001, ethanol: t87= 3.57, p < 0.001, H2O2: t166= 4.68, p < 0.001).

Determination of ethanol and H2O2 levels in the hemolymph showed the expected results. Absorbance of ethanol was significantly higher in the ethanol fed larvae compared to the controls (App. 6-2A), and significantly higher basal ROS levels were found in the H2O2 treated larvae (App. 6-2B).

Permuting the mitotype and nuclear background generalized the observed differences in development time. The Madang mitotype (with the V161L mutation) reacted like

Dahomey, while the Victoria Falls mitotype responded in a manner similar to Alstonville

(Fig. 6-1B). ANOVA showed significant effects of mitotype, treatment and their interaction

(F1,255= 6.84, p < 0.001, F1,255= 44.49, p < 0.001, F2,255= 15.56, p < 0.001, respectively).

Again, post hoc t-tests showed significant differences in time to pupation between the mitotypes (control: t87= 2.93, p = 0.004, ethanol: t86 = 2.91, p < 0.001, H2O2: t82 = 4.68, p <

0.001). Permuting the nuclear genetic background with Canton S further corroborated the influence of the mtDNA mutation (Fig. 6-1C), with significant effects of mitotype, treatment and their interaction observed (F1,240= 6.84, p < 0.001, F2,255= 44.49, p < 0.001, F2,255= 15.56, p < 0.001, respectively). Post hoc t-tests showed significant differences in time to pupation between the mitotypes (control: t75= 2.77, p = 0.007, ethanol: t81= 4.45, p < 0.001, H2O2: t84=

3.64, p < 0.001). As a consequence of the generalization I focus on Dah; w1118 and Alst; w1118 mitotypes for the remainder of the study.

114

6.3.1.2 Pupal dry weight

The mitotypes responded differently to the experimental diets. When ethanol and H2O2 are added to the food the weight of Dah; w1118 pupae increased by ~65% while that of Alst; w1118 pupae decreased by ~27% (Fig. 6-1D). Pupal weight showed a significant main effect of mitotype, no significant main effect of treatment, but a significant mitotype and treatment interaction (F1,78= 14.45, p < 0.001, F2,78= 1.70, p = 0.19, F2,78= 17.28, p < 0.001). Post hoc t- tests showed significant differences in pupal dry weight between the mitotypes (control: t34=

3.03, p < 0.001, ethanol: t22= 4.20, p < 0.001, t22= 3.49, p = 0.002). For clarity, I refer to Dah; w1118 as Dahomey and Alst; w1118 as Alstonville for the remainder of the study.

115

Fig. 6-1. Physiological assays show that the V161L ND4 mutation in complex I influences time to pupation and pupal weight. (A) Time to pupation of Dahomey (Dah; w1118) and

Alstonville (Alst; w1118). (B) Time to pupation of Mad; w1118 and VF; w1118. (C) Time to pupation of Dah; CS and Alst; CS. (D) Pupal dry weight of Dahomey (Dah; w1118) and

Alstonville (Alst; w1118). Bars show the mean (± SE). Above the bars ** indicates p < 0.01,

*** indicates p < 0.001, as determined by post-hoc t tests (see text for details).

116

6.3.2 Hydrogen peroxide levels and antioxidant responses

6.3.2.1 H2O2 levels

H2O2 levels are higher in Dahomey than Alstonville and levels are most similar when larvae are fed the control diet (Fig. 6-2A). ANOVA of basal mitochondrial H2O2 production showed a significant effect of mitotype, but no significant effect of treatment or a mitotype by treatment interaction (F1,30= 50.12, p < 0.001, F2,30= 0.43, p= 0.65,

F2,30= 3.17, p = 0.06, respectively). Post hoc t-tests showed significant differences in mitochondrial H2O2 levels between mitotypes (control: t17= 2.85, p= 0.01, ethanol: t6=

4.52, p = 0.004, H2O2: t7= 6.28, p < 0.001).

Cytosolic H2O2 levels were affected by treatment and mitotype. When fed the stress treated diets levels were lower in Dahomey than Alstonville but the reverse was true when larvae were fed the control diet. Dietary addition of ethanol and H2O2 increased cytosolic H2O2 by ~17% in Dahomey and by ~91% in Alstonville (Fig. 6-2B).

ANOVA showed significant effects of mitotype, treatment, and the mitotype by treatment interaction (F1,46= 8.43, p < 0.001, F2,46= 49.08, p < 0.001, F2,46= 18.93, p <

0.001, respectively). Post hoc t-tests showed significant differences in cytosolic H2O2 between mitotypes in each condition (control: t19= 5.93, P < 0.001, ethanol: t8= 2.93, p

= 0.02, t19= 3.58, p = 0.002).

6.3.2.2 Superoxide dismutase (SOD) activity

Overall, mitochondrial SOD activity was ~71% higher in Dahomey than Alstonville larvae (Fig. 6-2C). Again, activity was most similar when larvae were fed the control

117 diet. ANOVA of mitochondrial SOD activity showed a significant effect of mitotype, but no significant effect of treatment or mitotype by treatment interaction (F1,24= 78.29, p < 0.001, F2,24 = 2.49, p = 0.10, F2,24= 1.96, p= 0.16, respectively). Post hoc t-tests showed significant differences between mitotypes (control: t8= 6.36. p < 0.001, ethanol: t8= 4.76, p = 0.001, H2O2: t8= 5.27, p < 0.001).

Cytosolic SOD activity was ~42% higher in Dahomey than Alstonville larvae

(Fig. 6-2D). Activity was highest in larvae fed food supplemented with H2O2 and lowest in the control group. ANOVA of cytosolic SOD activity showed significant effects of mitotype, treatment, and the mitotype by treatment interaction (F1,24= 292.5, p < 0.001,

F2,24= 134.33, p < 0.001, F2,24= 6.09, p = 0.007, respectively). Post hoc t-tests showed significant differences in cytosolic SOD between mitotypes in each treatment (control: t8= 8.58, p < 0.001, ethanol: t8= 12.51, p < 0.001, H2O2: t8= 8.78, p < 0.001).

3.2.3. Expression of antioxidant genes

Expression of Sod2 in Dahomey was about twice that of Alstonville larvae (Fig. 6-2E) in all treatments. ANOVA of Sod2 expression showed a significant effect of mitotype, however, treatment and the mitotype by treatment interaction were not significant

(F1,40= 23.87, p < 0.001, F2,40= 0.24, p = 0.79, F2,40= 0.65, p = 0.53, respectively). Post hoc t-tests showed significant mitotype specific differences in Sod2 expression in all experimental groups (control: t22= 3.93, p < 0.001, ethanol: t9= 2.99, p= 0.02, H2O2: t9=

2.39, p = 0.04).

Expression of GstE1 in Dahomey was more than double that of Alstonville on all diets. Addition of ethanol and H2O2 to diet increased GstE1 expression in both mitotypes 5-fold and 3-fold, respectively (Fig. 6-2F). ANOVA of GstE1 expression 118 showed significant effects of mitotype and treatment, but the interaction of mitotype and diet was not significant (F1,38= 33.15, p < 0.001, F2,38= 22.34, p < 0.001, F2,38= 2.25, p =

0.12, respectively). Post hoc t-tests showed significant differences in GstE1 expression levels between the mitotypes (control: t21= 3.88, p < 0.001, ethanol: t9= 3.12, p = 0.01,

H2O2: t8= 2.49, p = 0.04).

119

Fig. 6-2. H2O2 levels and antioxidant responses of Dahomey (Dah) and Alstonville

(Alst) larvae in both the mitochondria and cytosol. (A) Mitochondrial H2O2 levels. (B)

Cytosolic H2O2 levels. (C) Mitochondrial SOD activity. (D) Cytosolic SOD activity. (E)

120 Expression of Sod2. (F) Expression of GstE1. Bars show the mean (± SE). Above the bars * indicates p < 0.05, ** indicates p < 0.01, *** indicates p < 0.001 as determined by post-hoc t-tests (see text for details).

6.3.3. Mitochondrial functions

3.3.1. Membrane potential

Membrane potential appeared to be buffered to dietary treatment effects in Dahomey but not Alstonville larvae. Dietary addition of ethanol and H2O2 did not affect the membrane potential of Dahomey larvae but caused a ~59% reduction in the mitochondrial membrane potential of Alstonville larvae (Fig. 6-3A). ANOVA of mitochondrial membrane potential showed no significant effect of mitotype but significant effects of treatment, and the interaction of mitotype and treatment (F1, 37=

1.94, p = 0.17, F2,37= 36.08, p < 0.001, F2,37= 27.33, p < 0.001, respectively). Further, post hoc t-tests showed significant differences in membrane potential between

Dahomey and Alstonville in each condition (control: t19= 5.02, p < 0.001, ethanol: t10=

4.81, p < 0.001, H2O2: t8= 4.92, p < 0.001).

3.3.2. Respiratory control ratio (RCR)

Like membrane potential, RCR is not affected by stressors in Dahomey. In contrast, dietary addition of ethanol and H2O2, caused the RCR of Alstonville to decrease by 54%

(Fig. 6-3B). ANOVA of RCR showed significant effects of mitotype, treatment and the interaction of mitotype and treatment (F1,42= 5.97, p = 0.02, F2,42= 8.97, p < 0.001,

F2,42= 16.06, p < 0.001, respectively). Post hoc t-tests showed significant differences in

121 RCR between the mitotypes in each treatment (control: t22= 2.7, p = 0.01, ethanol: t10=

4.48, p < 0.001, H2O2: t10= 6.91, p < 0.001).

3.3.3. Microbial challenge

The influence of microbial challenge on larval survival was treatment and mitotype dependent (Fig. 6-3C). In the case of Dahomey, addition of ethanol to the diet resulted in 80% of larvae surviving. Addition of H2O2 reduced survival to 55%, while 74% survived on the control diet. Comparatively, Alstonville larvae are more treatment sensitive. Addition of ethanol to the diet resulted in 30% larval survival, with the high error on this sample due to the small sample size. Addition of H2O2 to the diet increased survival to 92% compared to the 50% survival observed on the control diet. ANOVA of survival after microbial challenge showed no significant main effects of mitotype or treatment, but a significant mitotype by treatment interaction (F1,233= 2.3, p = 0.13,

F2,233= 2.17, p = 0.12, F2,233= 13.71, p < 0.001, respectively). Post hoc t-tests showed significant differences in survival after microbial challenge between the mitotypes in each treatment (control: t138= 2.82, p = 0.006, ethanol: t18= 2.47, p = 0.02, H2O2: t77=

4.09, p < 0.001).

122

Fig. 6-3. Mitochondrial functions and microbial challenge of Dahomey (Dah) and

Alstonville (Alst). (A) Mitochondrial membrane potential relative to Dahomey on the control diet. (B) RCR as determined by state III respiration over state IVo respiration.

(C) Percentage survival after infection with E. coli. Bars show the mean (± SE). Above the bars * indicates p < 0.05, ** indicates p < 0.01, *** indicates p < 0.001 as determined by post-hoc t-tests (see text for details).

6.4 Discussion

Insects live in heterogeneous environments and they must be able to survive a battery of environmental stressors if they are to reproduce. ROS are chemicals that have been shown to be involved in a range of responses to stressful environments. Our knowledge

123 of the effects of ROS is still growing but it is clear that levels must be balanced within an organism for normal survival and reproduction. At low levels ROS is a signaling molecule and can promote cellular proliferation, thiol peroxidase functions, and influence gene expression (D'Autréaux and Toledano, 2007; Ristow and Zarse, 2010;

Stone and Yang, 2006). However, excess ROS levels cause damage to cellular components and organelles (Circu and Aw, 2010; Redza-Dutordoir and Averill-Bates,

2016; Simon et al., 2000). This necessary balance prompted us to consider mechanisms by which ROS is managed at a cellular level. I hypothesized that high levels of mitochondrial H2O2 would result in ROS leaking into the cytosol through RIRR.

Plausibly, the elevated cytosolic ROS levels would then induce a cytosolic antioxidant response and prevent damage from dietary toxicants that enter cells. To test this hypothesis, I compared the organismal and cellular responses of larvae harboring two

Drosophila mitotypes when they were fed diets supplemented with two stressors. These mitotypes differ by a V161L ND4 mutation that causes differences in mitochondrial

ROS production (Aw et al., 2018).

In this Chapter I identified that the Dahomey mitotype developed to pupation faster than the Alstonville mitotype when stressors were added to diet (Fig 6-1A). Pupae were also heavier (Fig 6-1D). However, there are specific differences and similarities in the action of the two stressors on mitotype development. Addition of ethanol to the diet did not change the time to pupation of Dahomey but slowed the development of

Alstonville. In contrast, dietary addition of H2O2 sped up the development of both mitotypes. As previously reported, when fed the control diet, the Dahomey mitotype developed slower than the Alstonville mitotype (Aw et al., 2018) and had reduced pupal weight (Fig. 6-1D). Developing to sexual maturity in insects is a key fitness trait

(Boivin et al., 2001; Feng et al., 2009; Kliot and Ghanim, 2012), where faster

124 development is correlated with higher adult fecundity and adult survival (Kingsolver and Huey, 2008). Pupal weight is positively linked with mating success and fecundity of the adult fly (Angilletta Jr et al., 2004; De Moed et al., 1999; Kingsolver and Huey,

2008) and suggests a possible adaptation of Dahomey mtDNA to stressful environments. Differences and similarities in response to ethanol and H2O2 stress have previously been observed. Logan-Garbisch et al. (2015) found differences in the response to the two stressors. They identified that a D. melanogaster strain with mutations in Phosphoinositide-dependent kinase 1 displayed increased survival to adulthood when fed ethanol treated diet but had decreased survival when fed H2O2 treated diet. Courgeon et al. (1993) found that acute exposure of D. melanogaster cells to ethanol and H2O2 stress increased the rate of actin synthesis at similar levels for both stressors. Heterogeneity in larval preferences of D. melanogaster strains to agar containing alcohol has also been reported (Parsons, 1977) and a future study may test whether the Dahomey and Alstonville larvae have distinct preferences to agar containing alcohol.

I identified a mitotype dependent beneficial effect of elevated basal mitochondrial H2O2 in promoting an antioxidant response to the two exogenous stressors. In all treatments, Dahomey larvae had higher mitochondrial H2O2 levels than

Alstonville and these levels were correlated with the mitochondrial antioxidant response, as measured by SOD activity and Sod2 expression (Fig 2A, C & E). While low levels of mitochondrial ROS are often considered ideal (Stone and Yang, 2006), this may only be true under laboratory conditions. Perhaps, this view comes from the literature suggesting that mitochondrial ROS is a by-product of OXPHOS and is often considered indicative of reduced coupling (Bazil et al., 2016; Fruehauf and Meyskens,

2007; Marcinek et al., 2005). Plausibly, however, mildly elevated levels of

125 mitochondrial ROS may provide flexibility to environmental stressors by priming the antioxidant response. Ristow and Schmeisser (2014) described increased mitochondrial

ROS levels as causing a vaccination-like adaptive response that provides long term stress defense. Mitochondrial ROS have also been implicated in providing increased survival under hypoxia in Caenorhabditis elegans (Schieber and Chandel, 2014) and in maintaining organismal homeostasis in a variety of organisms (Shadel and Horvath,

2015).

When fed the stressful diets, Dahomey had lower cytosolic H2O2 than

Alstonville (Fig. 6-2B), while having mildly higher levels when fed the control diet.

The mildly higher levels in larvae fed the control diet are likely due to RIRR leakage into the cytoplasm which then induced a cytosolic antioxidant response. Fed the stressful diets Dahomey had higher cytosolic SOD activity and higher expression of

GstE1 than Alstonville (Fig. 6-2D & F). In contrast, I suggest the high levels of cytosolic H2O2 in Alstonville fed the stressors occurred because the antioxidant system was not primed by RIRR from the mitochondria. If true, this suggests that RIRR is an important mechanism that has potential to influence fitness of organism harboring distinct mitotypes. In addition to the tested antioxidants, it is possible that a wider range of antioxidants are upregulated in Dahomey as part of a response to elevated mitochondrial H2O2 levels (Ristow and Zarse, 2010; Yun and Finkel, 2014). In

Drosophila, Keap1/Nrf2 signaling is activated by oxidants, inducing antioxidant and detoxification responses, and confers increased tolerance to oxidative stress (Sykiotis and Bohmann, 2008). Similar antioxidant responses are associated with improved health and fitness in a variety of organisms (Shirpoor et al., 2009; Wentzel and Eriksson, 2006;

Wentzel et al., 2006; Zhang et al., 2016). Zhang et al. (2016) found that the freshwater snail Radix swinhoei sensitively responds to toxins by manipulating its antioxidant

126 system to cope with toxicity. Shirpoor et al. (2009) showed that ethanol intake by pregnant Wistar rats induces homocysteine-mediated oxidative stress in the offspring that can be alleviated by vitamin E as an antioxidant. Wentzel et al. (2006) found that ethanol exposure in mice disturbs embryogenesis partly by enhanced oxidative stress, and the adverse effects can be ameliorated by antioxidative treatment. I suggest future studies may investigate the antioxidant response further through measurement of catalase and thiol levels.

The primed cytosolic antioxidant response of Dahomey likely prevented damage to mitochondrial membranes from the dietary ethanol and H2O2. Fed the stressful diets mitochondrial membrane potential and RCR were unaltered in Dahomey but decreased in Alstonville. Membrane potential is the key bioenergetic factor that controls the respiratory rate and ATP synthesis (Nicholls, 2004) and is reduced by proton leak

(Korshunov et al., 1997; Skulachev, 1996). RCR is considered the most useful general measure of mitochondrial function, as changes that reduce OXPHOS are reflected in reductions of RCR (Affourtit and Brand, 2005; Brand and Nicholls, 2011).

There were distinct differences in responses of the two mitotypes to bacterial infection. Overall, more Dahomey survived infection and their response to stressors was less variable than Alstonville. Furthermore, the relative responses of the mitotypes to

H2O2 differed when compared to the ethanol treatment and the control. Notably, a high proportion of larvae survived infection. It is well established that H2O2 has antibacterial properties, and can be localized to the site of bacterial infection (Brun et al., 2006; Fang,

2011; Spooner and Yilmaz, 2011). Likely, the immune deficiency pathway is moderated by ROS levels. West et al. (2011a) revealed a novel pathway linking innate immune signaling to mitochondria and implicates ROS as important components of antibacterial responses. This idea of a protective role of H2O2 does not, however, explain the ethanol

127 treated diet results where Alstonville has high H2O2 levels but low survival after infection. Plausibly, then there may be a specific mitotype by ethanol interaction response to bacterial infection. In Drosophila, Zhu et al. (2014) show that complex interactions between the mitotype, nuclear genome, and the environment influence cellular and organismal functions that affect fitness, aging, and disease in nature.

Additional research is required to determine whether these survival results are specific to the interaction of ethanol and E.coli or if they are generalizable to additional pathogens (Brun et al., 2006; Lemaitre et al., 1996).

In conclusion, I identified a mitotype specific response to environmental stress, whereby the mitotype that produces slightly elevated levels of endogenous mitochondrial H2O2 is resistant to exogenous dietary stressors. I show that the Dahomey mitotype developed to pupation faster than the Alstonville mitotype when ethanol and

H2O2 were added to diet. This coincided with no reduction of mitochondrial functions in

Dahomey, while the presence of dietary stressors reduced membrane potential and RCR in Alstonville. I argue the high levels of endogenous H2O2 production in Dahomey, due to the mutation in the ND4 subunit of Complex I, primed the antioxidant response, as seen by the higher activity of cytosolic SOD and expression of GstE1. I propose that a primed antioxidant response may provide a mitotype dependent resilience, or even organismal preference, to exogenous dietary ethanol stress, particularly in climates where food rots more quickly.

128 Chapter 7

Discussion

129 7.1 Introduction

The work in this thesis examined the interaction of mitochondrial DNA (mtDNA) with diet from an evolutionary fitness and organismal health perspective. Specifically, the aim of this thesis was to determine if a single mtDNA mutation could have a favourable effect on organismal fitness and health. In Chapter 2 I worked towards identifying a favourable mitotype by diet interaction and the paper to which Chapters 3 and 4 contribute identified the functionally significant V161L ND4 mutation as significantly altering the relative fitness of the Alstonville and Dahomey mitotypes when fed either the 1:2 or 1:16 Protein: Carbohydrate ratio (P:C) diet. Chapter 5 built on this work to examine the effects of the mutation in adults regarding lifespan, and demonstrated a context depended benefit to organismal health. In Chapter 6, I identified that a higher level of basal mitochondrial reactive oxygen species (ROS) production in Dahomey provided an advantage in a stressed environment.

I have drawn two overarching conclusions from this work. First, a single mtDNA mutation can provide a selective advantage and be favourable to organismal health. Second, increased fitness and organismal health derived from this mtDNA mutation is context dependent, with diet, temperature, and environmental stressors influencing the response. I will briefly expand on the conclusions drawn from this thesis and outline the key limitations and future directions of my work presented in this thesis.

7.2 A single mtDNA mutation can provide a selective fitness advantage

As outlined in Chapter 1, it has been argued that most mutations in mtDNA are neutral, slightly deleterious, or deleterious and may be removed by natural selection. This view established the molecular clock hypothesis that has been used to determine the age of human populations (Dos Reis et al., 2016). However if mutations in mtDNA can

130 provide a selective advantage (Ballard and Whitlock, 2004; Ballard and Youngson,

2015), then the use of the molecular clock may not be wholly accurate. In Chapter 2 I identified increased fitness of Dahomey fed the 1:16 P:C diet and in Aw et al. (2018), from which Chapters 3 and 4 contribute, the increased fitness was directly linked to the

V161L ND4 mutation. Aw et al. (2018) demonstrated that the increased fitness of

Dahomey fed the 1:16 P:C diet resulted in a high selection co-efficient, demonstrating a mitotype dependent selective advantage under laboratory conditions. Additionally,

Chapter 5 demonstrated a favourable health related response to the 1:2 diet in Dahomey with increased longevity

7.3 Mitotype specific favourable responses are context dependent

I identified Dahomey as having a fitness advantage relative to Alstonville under certain environmental conditions. These fitness advantages were observed when Dahomey was fed the 1:16 P:C diet (at temperatures above 19° C), and when fed the 1:2 P:C diet only when oxidative stressors were present. Curiously structural modelling of the mutation

(Aw et al., 2018) predicted that the V161L mutation would slow proton pumping, reducing energy production. Under optimal conditions Dahomey would be predicted to have a fitness disadvantage due to lower ATP generation. However, as I have demonstrated that the selective advantage of the mutation is context dependent its presence may be due to spatial and temporal balancing selection. As outlined in Chapter

1 this mode of selection predicts that selective pressures exerted through factors such as diet, temperature and stressors vary throughout the year.

7.4 Future directions

Through the work in this thesis I identified a mitochondrial dependent selective advantage. This advantage resulted from a mitotype by diet interaction. Further, this

131 work narrowed the possible candidate mutations down to one specific mutation. In doing so there were limitations to the work, and several interesting ideas that I believe should be further explored.

7.4.1 Gene modification of the Alstonville mitotype

Through the work in this thesis I identified the V161L ND4 mutation as functionally significant, and utilised this model in Chapters 5 and 6 to test specific hypotheses related to mtDNA’s influence on ageing and environmental stressors. While this model has shown to be robust in testing these hypotheses, the comparisons between Alstonville and Dahomey are not completely ‘clean’. Comparisons between the mitotypes must consider that they differ by more than just a single mutation. In addition to the V161L

ND4 mutation there are four additional non-synonymous, four synonymous, five silent and 52 A+T-rich mutations. In Chapter 6 I utilised the Victoria Falls and Madang mitotypes to generalize the development results, as Victoria Falls closely matches the

Alstonville mitotype, while Madang harbours the V161L mutation present in Dahomey.

While this method is indicative that only the V161L mutation is causing the observed differences in fitness, it is not definitive as Victoria Falls and Madang also differ by two other non-synonymous, four synonymous, three silent and 41 A+T-rich region mutations.

I propose a future approach to ‘clean-up’ the comparison between Alstonville and Dahomey would be to utilise targeted gene editing to introduce the V161L ND4 mutation into Alstonville mtDNA. A comparison between the original Alstonville and this V161L ND4 Alstonville mitotype would eliminate the issues raised above. Ideally I would introgress this new mitotype into several nuclear genetic backgrounds to determine any possibly mitotype by nuclear genetic background interactions.

132 Unfortunately evidence suggests that targeted editing of mtDNA is not yet possible (Gammage et al., 2018). For manipulating and editing nuclear DNA there are multiple approaches to instigate targeted mutations. Mutagens that are non-targeted can be utilised to instigate mutations in mtDNA, though it is incredibly unlikely to obtain the specific mutation due to the inherent random chance. Xu et al. (2008) utilised targeted restriction enzymes to produce two fly lines with slightly deleterious ND2 mutations through indels, however they did not report any SNPs, and so would not seem a viable method for specific gene editing. The highest profile targeted gene editing methods include Zinc fingers nucleases and CRISPR/cas9. While these techniques are well documented in editing nuclear DNA (Miller et al., 2007; Ran et al., 2013), they have not yet been shown to edit mtDNA. The main impediment of gene editing of mtDNA is that exogenous RNA import into the mitochondria is currently not possible.

The process of gene editing utilising CRISPR relies on the intake of RNA, and the cas-9 protein into the mitochondria. Secondly, double stranded break repair is necessary for targeted gene editing. In mammalian mitochondria there is a lack of double stranded break repair mechanisms, although this does not appear to be an issue in D. melanogaster (Morel et al., 2008). The only currently proven movement of genetic material to transform mitochondrial DNA has only been possible in yeast and algae

(Remacle et al., 2006) through biolistics, where genetic material is bonded to metal beads and propelled at high velocity to pierce the mitochondrial membranes.

7.4.2 Mitochondria under selection?

The overarching implication of this thesis is that the identified ND4 V161L mutation that resulted in differences in development time may provide a significant fitness advantage in nature. A limitation of this thesis is that I have not determined whether the implications of this work are true in nature, as all studies were performed

133 under laboratory settings. I suggest it is necessary to explore this in two stages. The first stage would be to determine whether the mitotypes used in this study still maintained in nature. The second stage would investigate whether the same levels of selection occurred in population cages set-up under natural conditions outside the laboratory.

7.4.2.1 Are the Alstonville and Dahomey mitotypes maintained in nature?

As part of determining the impact of this work I would propose to collect flies to assay the levels of each mitotype in nature. Alstonville is part of the A1 haplotype identified by Camus et al. (2017). This haplogroup is associated with flies predominately in the

Northern latitudes of Australia. The V161L ND4 mutation has been found in two geographically distinct locations (Dahomey in West Africa, and Madang in Papua New

Guinea) and it is possible that this mutation is maintained at some level in nature.

Alternatively it may merely be an aberration. Collecting D. melanogaster in either of these locations would be necessary to determine whether the mutation is still present. I would suggest collections in Alstonville and Madang throughout the year to assay their frequency in nature. As environmental factors may differ throughout the year and likely so to would the frequency of these mitotypes if their presence in a population is maintained through spatial and temporal balancing selection.

An important consideration if the V161L mutation was found in nature would be to compare the ‘wild’ mtDNA to the original Madang mtDNA. In nuclear DNA nearby genes to one under selection can be maintained by genetic hitchhiking. Due to mtDNA’s low levels of recombination and circular structure I would expect large portions of the ‘wild’ mtDNA to be similar to the original if the V161L mutation is under positive selection.

134 7.4.2.2 Population cage studies in nature

To test whether the implications of this work are applicable to the real-world, I would establish population cages in nature under similar design to those in Aw et al. (2018), with dietary perturbation. The observed selective advantage of mtDNA may be an artefact of the laboratory based experimental design. I would establish two sets of cages in at least two distinct environments (tropics, sub-tropics, temperate, etc.) to determine the robustness of possible environmental effects. The cages would be established with equal numbers of Alstonville and Dahomey. The sets of cages would differ by their starting diet, one set starting on the 1:2 P:C diet, and one starting on the 1:16 P:C diet, with the two sets run concurrently. I would assay the frequency of the mitotypes in each cage throughout the first four generations to determine if selection through diet by mitotype interactions is occurring then swap to the reciprocal diet.

Further work would need to be conducted to determine if any observed differences in fitness are due to larval development as seen in this thesis, or possibly due to larval survival or adult fecundity, which can alter frequencies in population cages

(Mossman et al., 2019).

7.4.3 Mitotype responses in juveniles are not in adults

The majority of this thesis is focused on the interaction of diet with mitotype in juveniles. Chapter 5 provides a natural extension of these findings, by testing the effects of these diets on adult longevity. Interestingly, I found that the diet most favourable to each mitotype as juvenile larvae, was deleterious as adults, and led to earlier death. This implies that the pathways involved in juveniles are not present in adults. I would want to further investigate these results through transcriptomic and metabolomics analyses to

135 identify the pathways involved, and compare them to the larval results. This would provide insight into the role of mtDNA mutations in later life as a health perspective.

7.5 Societal implications

The implication of a selective advantage of mtDNA, and the influence of distinct mitotypes on organismal health may include human health. Mitochondrial donation as an in vitro fertilisation technique has been used to prevent the inheritance of mitochondrial diseases (Dimond and Stephens, 2018). Through pronuclear transfer the pronuclei of a fertilised egg, with disease causing mitochondria, is removed and placed in a donor egg with healthy mitochondria (Craven et al., 2010). As this fertilisation uses the genetic material of 3 individuals it has been termed the “three person baby”. This process was considered ethically acceptable in humans in 2013 by the U.K Nuffield council on Bioethics (Reinhardt et al., 2013).

Ethical issues were raised such as the matching of specific mitotypes. First, specific mitotypes have been shown to have fitness and longevity altering effects, through alterations of nuclear gene expression (Reinhardt et al., 2013). A second issue is of misuse through the selection of the mitochondrial population used in pronuclei transfer. Jenuth et al. (1997) found in heteroplasmic mice that mitochondrial populations underwent tissue-specific selection. A possible case of misuse may be from utilising a mixed population of mitochondria that have favourable mutations, such as those taken from elite long-distance runners and sprinters that have different energetic requirements. In this scenario the mixed mitochondrial population may result in offspring with an athletic advantage.

136 7.6 Conclusion

In this thesis I have identified favourable phenotypic responses to a single mtDNA mutation. These responses are context sensitive, and may help explain the maintenance of mitochondrial variation within species. More work needs to be done to identify whether these favourable phenotypic responses are generalisable, and occur in nature.

My thesis provides a small step towards understanding the biology of mitochondria and the functions of mtDNA.

137 References

138

Overview references Aw, W.C., Towarnicki, S.G., Melvin, R.G., Youngson, N.A., Garvin, M.R., Hu, Y., Nielsen, S., Thomas, T., Pickford, R., Bustamante, S., Vila-Sanjurjo, A., Smyth, G.K., Ballard, J.W.O., 2018. Genotype to phenotype: Diet-by-mitochondrial DNA haplotype interactions drive metabolic flexibility and organismal fitness. PLoS Genet 14, e1007735. Towarnicki, S.G., Ballard, J.W.O., 2017. Drosophila mitotypes determine developmental time in a diet and temperature dependent manner. J Insect Physiol 100, 133-139. Towarnicki, S.G., Ballard, J.W.O., 2018. Mitotype interacts with diet to influence longevity, fitness, and mitochondrial functions in adult female Drosophila. Front Genet 9, 593.

139 Chapter 1 references

Adeola, A.C., Ommeh, S.C., Song, J.J., Olaogun, S.C., Sanke, O.J., Yin, T.T., Wang, G.D., Wu, S.F., Zhou, Z.Y., Lichoti, J.K., Agwanda, B.R., Dawuda, P.M., Murphy, R.W., Peng, M.S., Zhang, Y.P., 2017. A cryptic mitochondrial DNA link between North European and West African dogs. J Genet Genom 44, 163-170. Alexeyev, M., Shokolenko, I., Wilson, G., LeDoux, S., 2013. The maintenance of mitochondrial DNA integrity--critical analysis and update. Cold Spring Harb Perspect Biol 5, a012641. Alferink, L.J., Kiefte-de Jong, J.C., Erler, N.S., Veldt, B.J., Schoufour, J.D., de Knegt, R.J., Ikram, M.A., Metselaar, H.J., Janssen, H., Franco, O.H., Darwish Murad, S., 2018. Association of dietary macronutrient composition and non-alcoholic fatty liver disease in an ageing population: the Rotterdam Study. Gut, 1088-1098. Allio, R., Donega, S., Galtier, N., Nabholz, B., 2017. Large variation in the ratio of mitochondrial to nuclear mutation rate across animals: implications for genetic diversity and the use of mitochondrial DNA as a molecular marker. Mol Biol Evol 34, 2762-2772. Ammeux, N., Housden, B.E., Georgiadis, A., Hu, Y., Perrimon, N., 2016. Mapping signaling pathway cross-talk in Drosophila cells. Proc Natl Acad Sci U S A 113, 9940-9945. Amunts, A., Brown, A., Toots, J., Scheres, S.H., Ramakrishnan, V., 2015. The structure of the human mitochondrial ribosome. Science 348, 95-98. Arnqvist, G., Novicic, Z.K., Castro, J.A., Sayadi, A., 2016. Negative frequency dependent selection on sympatric mtDNA haplotypes in Drosophila subobscura. Hereditas 153, 15. Aw, W.C., Correa, C.C., Clancy, D.J., Ballard, J.W.O., 2011. Mitochondrial DNA variants in Drosophila melanogaster are expressed at the level of the organismal phenotype. Mitochondrion 11, 756-763. Aw, W.C., Garvin, M.R., Ballard, J.W.O., 2018. Exogenous factors may differentially influence the selective costs of mtDNA mutations. Adv Anat Embryol Cell Biol, 51-74. Aw, W.C., Garvin, M.R., Melvin, R.G., Ballard, J.W.O., 2017. Sex-specific influences of mtDNA mitotype and diet on mitochondrial functions and physiological traits in Drosophila melanogaster. PLoS One 12, e0187554. Bajracharya, R., Ballard, J.W.O., 2016. Low protein to carbohydrate ratio diet delays onset of Parkinsonism like phenotype in Drosophila melanogaster parkin null mutants. Mech Ageing Dev 160, 19-27. Bajracharya, R., Bustamante, S., Ballard, J.W.O., 2017. Stearic acid supplementation in high protein to carbohydrate (P:C) ratio diet improves physiological and mitochondrial functions of Drosophila melanogaster parkin null mutants. J Gerontol A Biol Sci Med Sci 00, 1-9. Ballard, J.W.O, Melvin, R., 2010. Linking the mitochondrial genotype to the organismal phenotype. Mol eco 19, 1523-1539. Ballard, J.W.O., James, A.C., 2004. Differential fitness of mitochondrial DNA in perturbation cage studies correlates with global abundance and population history in Drosophila simulans. Proc R Soc Lond Biol, 271, 1197. Ballard, J.W.O., Katewa, S.D., Melvin, R.G., Chan, G., 2007a. Comparative analysis of mitochondrial genotype and aging. Ann N Y Acad Sci 1114, 93-106. Ballard, J.W.O., Melvin, R.G., Katewa, S.D., Maas, K., 2007b. Mitochondrial DNA variation is associated with measurable differences in life-history traits and

140 mitochondrial metabolism in Drosophila simulans. Evolution: Int J Org Evo 61, 1735-1747. Ballard, J.W.O., Whitlock, M.C., 2004. The incomplete natural history of mitochondria. Mol eco 13, 729-744. Baradaran, R., Berrisford, J.M., Minhas, G.S., Sazanov, L.A., 2013. Crystal structure of the entire respiratory complex I. Nature 494, 443-448. Basit, F., van Oppen, L.M., Schockel, L., Bossenbroek, H.M., van Emst-de Vries, S.E., Hermeling, J.C., Grefte, S., Kopitz, C., Heroult, M., Hgm Willems, P., Koopman, W.J., 2017. Mitochondrial complex I inhibition triggers a mitophagy-dependent ROS increase leading to necroptosis and ferroptosis in melanoma cells. Cell Death Dis 8, e2716. Birse, R.T., Choi, J., Reardon, K., Rodriguez, J., Graham, S., Diop, S., Ocorr, K., Bodmer, R., Oldham, S., 2010. High-fat-diet-induced obesity and heart dysfunction are regulated by the TOR pathway in Drosophila. Cell Metab 12, 533-544. Blacket, M.J., Malipatil, M.B., Semeraro, L., Gillespie, P.S., Dominiak, B.C., 2017. Screening mitochondrial DNA sequence variation as an alternative method for tracking established and outbreak populations of Queensland fruit fly at the species southern range limit. Ecol Evo 7, 2604-2616. Bruce, K.D., Hoxha, S., Carvalho, G.B., Yamada, R., Wang, H.D., Karayan, P., He, S., Brummel, T., Kapahi, P., Ja, W.W., 2013. High carbohydrate-low protein consumption maximizes Drosophila lifespan. Exp Gerontol 48, 1129-1135. Burman, J.L., Itsara, L.S., Kayser, E.B., Suthammarak, W., Wang, A.M., Kaeberlein, M., Sedensky, M.M., Morgan, P.G., Pallanck, L.J., 2014. A Drosophila model of mitochondrial disease caused by a complex I mutation that uncouples proton pumping from electron transfer. Dis Model Mech 7, 1165-1174. Caro, P., Gomez, J., Sanchez, I., Naudi, A., Ayala, V., López-Torres, M., Pamplona, R., Barja, G., 2009. Forty percent methionine restriction decreases mitochondrial oxygen radical production and leak at complex I during forward electron flow and lowers oxidative damage to proteins and mitochondrial DNA in rat kidney and brain mitochondria. Rejuv Res12, 421-434. Charlesworth, B., 2009. Effective population size and patterns of molecular evolution and variation. Nat Rev Genet 10, 195. Charlesworth, B., 2010. Molecular population genomics: a short history. Genet Res 92, 397-411. Charlesworth, D., 2006. Balancing selection and its effects on sequences in nearby genome regions. PLoS Genetics 2, e64. Chen, S., Oliveira, M.T., Sanz, A., Kemppainen, E., Fukuoh, A., Schlicht, B., Kaguni, L.S., Jacobs, H.T., 2012. A cytoplasmic suppressor of a nuclear mutation affecting mitochondrial functions in Drosophila. Genetics 192, 483-493. Ciesielski, G.L., Nadalutti, C.A., Oliveira, M.T., Jacobs, H.T., Griffith, J.D., Kaguni, L.S., 2018. Structural rearrangements in the mitochondrial genome of Drosophila melanogaster induced by elevated levels of the replicative DNA helicase. Nucleic Acids Res 46, 3034-3046. Clancy, D.J., 2008. Variation in mitochondrial genotype has substantial lifespan effects which may be modulated by nuclear background. Aging Cell 7, 795-804. Correa, C.C., Aw, W.C., Melvin, R.G., Pichaud, N., Ballard, J.W.O., 2012. Mitochondrial DNA variants influence mitochondrial bioenergetics in Drosophila melanogaster. Mitochondrion 12, 459-464. de Duve, C., 2007. The origin of eukaryotes: a reappraisal. Nat Rev Genet 8, 395-403.

141 De Stordeur, E., 1997. Nonrandom partition of mitochondria in heteroplasmic Drosophila. Heredity 79 ( Pt 6), 615-623. Dimond, R., Stephens, N., 2018. Three persons, three genetic contributors, three parents: Mitochondrial donation, genetic parenting and the immutable grammar of the ‘three x x’. Health 22, 240-258. Diop, S.B., Birse, R.T., Bodmer, R., 2017. High fat diet feeding and high throughput triacylglyceride assay in Drosophila melanogaster. J Vis Exp 127, 56029. Dobzhansky, T., 1943. Genetics of natural populations IX. Temporal changes in the composition of populations of Drosophila pseudoobscura. Genetics 28, 162. Dobzhansky, T., 1955. A review of some fundamental concepts and problems of population genetics, Cold Spring Harb Symp Quant Biol 20, 1-15. Doi, A., Suzuki, H., Matsuura, E.T., 1999. Genetic analysis of temperature-dependent transmission of mitochondrial DNA in Drosophila. Heredity 82, 555. Dos Reis, M., Donoghue, P.C., Yang, Z., 2016. Bayesian molecular clock dating of species divergences in the genomics era. Nat Rev Genet 17, 71. Dudkina, N.V., Sunderhaus, S., Boekema, E.J., Braun, H.-P., 2008. The higher level of organization of the oxidative phosphorylation system: mitochondrial supercomplexes. J Bioenerg Biomembr 40, 419. Eanes, W.F., 1999. Analysis of selection on enzyme polymorphisms. Annu Rev Ecol Sys 30, 301-326. Elson, J.L., Smith, P.M., Vila-Sanjurjo, A., 2015. Heterologous inferential analysis (HIA) as a method to understand the role of mitochondrial rRNA mutations in pathogenesis, Mito Med. Springer, 369-383. Fernández-Vizarra, E., Tiranti, V., Zeviani, M., 2009. Assembly of the oxidative phosphorylation system in humans: what we have learned by studying its defects. Biochimica et Biophysica Acta 1793, 200-211. Fiedorczuk, K., Letts, J.A., Degliesposti, G., Kaszuba, K., Skehel, M., Sazanov, L.A., 2016. Atomic structure of the entire mammalian mitochondrial complex I. Nature 538, 406-410. Gammage, P.A., Moraes, C.T., Minczuk, M., 2018. Mitochondrial genome engineering: the revolution may not be CRISPR-Ized. Trends Genet 34, 101-110. Garesse, R., 1988. Drosophila melanogaster mitochondrial DNA: gene organization and evolutionary considerations. Genetics 118, 649-663. Geer, B., Perille, T., 1977. Effects of dietary sucrose and environmental temperature on fatty acid synthesis in Drosophila melanogaster. Insect Biochem 7, 371-379. Gillespie, J.H., Turelli, M., 1989. Genotype-environment interactions and the maintenance of polygenic variation. Genetics 121, 129-138. Gonzalez-Franquesa, A., Patti, M.E., 2017. Insulin resistance and mitochondrial dysfunction. Adv Exp Med Biol 982, 465-520. Gorman, G.S., Chinnery, P.F., DiMauro, S., Hirano, M., Koga, Y., McFarland, R., Suomalainen, A., Thorburn, D.R., Zeviani, M., Turnbull, D.M., 2016. Mitochondrial diseases. Nat Rev Dis Primers 2, 16080. Gregersen, N., Hansen, J., Palmfeldt, J., 2012. Mitochondrial proteomics—a tool for the study of metabolic disorders. J Inherit Metab Dis 35, 715-726. Guerrero-Castillo, S., Baertling, F., Kownatzki, D., Wessels, H.J., Arnold, S., Brandt, U., Nijtmans, L., 2017. The assembly pathway of mitochondrial respiratory chain complex I. Cell Metab 25, 128-139. Guo, R., Zong, S., Wu, M., Gu, J., Yang, M., 2017. Architecture of human mitochondrial respiratory megacomplex I2III2IV2. Cell 170, 1247-1257, e1212.

142 He, J., Mao, C.C., Reyes, A., Sembongi, H., Di Re, M., Granycome, C., Clippingdale, A.B., Fearnley, I.M., Harbour, M., Robinson, A.J., Reichelt, S., Spelbrink, J.N., Walker, J.E., Holt, I.J., 2007. The AAA+ protein ATAD3 has displacement loop binding properties and is involved in mitochondrial nucleoid organization. J Cell Biol 176, 141-146. Hénault, M., Landry, C.R., 2017. When nuclear‐encoded proteins and mitochondrial RNAs do not get along, species split apart. EMBO reports 18, 8-10. Hill, G.E., 2016. Mitonuclear coevolution as the genesis of speciation and the mitochondrial DNA barcode gap. Ecol Evol 6, 5831-5842. Hirst, J., King, M.S., Pryde, K.R., 2008. The production of reactive oxygen species by complex I. Biochem Soc Trans 36, 976-980. Holmbeck, M.A., Donner, J.R., Villa-Cuesta, E., Rand, D.M., 2015. A Drosophila model for mito-nuclear diseases generated by an incompatible interaction between tRNA and tRNA synthetase. Dis Model Mech 8, 843-854. Iijima, K., Zhao, L., Shenton, C., Iijima-Ando, K., 2009. Regulation of energy stores and feeding by neuronal and peripheral CREB activity in Drosophila. PLoS One 4, e8498. James, A.C., Ballard, J.W.O., 2003. Mitochondrial genotype affects fitness in Drosophila simulans. Genetics 164, 187-194. Kazancioglu, E., Arnqvist, G., 2014. The maintenance of mitochondrial genetic variation by negative frequency-dependent selection. Ecol Lett 17, 22-27. Knöppel, A., Näsvall, J., Andersson, D.I., 2016. Compensating the fitness costs of synonymous mutations. Mol Biol Evol 33, 1461-1477. Kolodziej, U., Maciejczyk, M., Niklinska, W., Waszkiel, D., Zendzian-Piotrowska, M., Zukowski, P., Zalewska, A., 2017. Chronic high-protein diet induces oxidative stress and alters the salivary gland function in rats. Arch Oral Biol 84, 6-12. Le Couteur, D.G., Solon-Biet, S., Wahl, D., Cogger, V.C., Willcox, B.J., Willcox, D.C., Raubenheimer, D., Simpson, S.J., 2016. New Horizons: Dietary protein, ageing and the Okinawan ratio. Age Ageing 45, 443-447. Lee, B.C., Kaya, A., Ma, S., Kim, G., Gerashchenko, M.V., Yim, S.H., Hu, Z., Harshman, L.G., Gladyshev, V.N., 2014. Methionine restriction extends lifespan of Drosophila melanogaster under conditions of low amino-acid status. Nat Commun 5, 3592. Lee, K.P., Simpson, S.J., Clissold, F.J., Brooks, R., Ballard, J.W.O., Taylor, P.W., Soran, N., Raubenheimer, D., 2008. Lifespan and reproduction in Drosophila: New insights from nutritional geometry. Proc. Natl. Acad. Sci. U. S. A. 105, 2498-2503. Lee, S.R., Han, J., 2017. Mitochondrial Nucleoid: Shield and switch of the mitochondrial genome. Oxid Med Cell Longev 2017, 8060949. Lee, T.V., Sethi, M.K., Leonardi, J., Rana, N.A., Buettner, F.F., Haltiwanger, R.S., Bakker, H., Jafar-Nejad, H., 2013. Negative regulation of notch signaling by xylose. PLoS Genet 9, e1003547. Leffler, E.M., Bullaughey, K., Matute, D.R., Meyer, W.K., Segurel, L., Venkat, A., Andolfatto, P., Przeworski, M., 2012. Revisiting an old riddle: what determines genetic diversity levels within species? PLoS Biology 10, e1001388. Lewis, D.L., Farr, C.L., Farquhar, A.L., Kaguni, L.S., 1994. Sequence, organization, and evolution of the A+T region of Drosophila melanogaster mitochondrial DNA. Mol Biol Evol 11, 523-538. Lloyd, T.E., Taylor, J.P., 2010. Flightless flies: Drosophila models of neuromuscular disease. Ann N Y Acad Sci 1184, e1-20.

143 Lotz, C., Lin, A.J., Black, C.M., Zhang, J., Lau, E., Deng, N., Wang, Y., Zong, N.C., Choi, J.H., Xu, T., 2013. Characterization, design, and function of the mitochondrial proteome: from organs to organisms. J Proteome res 13, 433-446. Lushchak, O.V., Gospodaryov, D.V., Rovenko, B.M., Yurkevych, I.S., Perkhulyn, N.V., Lushchak, V.I., 2014. Specific dietary carbohydrates differentially influence the life span and fecundity of Drosophila melanogaster. J Gerontol A Biol Sci Med Sci 69, 3-12. Ma, H., O'Farrell, P.H., 2015. Selections that isolate recombinant mitochondrial genomes in animals. Elife 4, e07247. Ma, H., O'Farrell, P.H., 2016. Selfish drive can trump function when animal mitochondrial genomes compete. Nat Genet 48, 798-802. Matavelli, C., Carvalho, M.J., Martins, N.E., Mirth, C.K., 2015. Differences in larval nutritional requirements and female oviposition preference reflect the order of fruit colonization of Zaprionus indianus and Drosophila simulans. J Insect Physiol 82, 66-74. Mockett, R.J., Orr, W.C., Rahmandar, J.J., Sohal, B.H., Sohal, R.S., 2001. Antioxidant status and stress resistance in long- and short-lived lines of Drosophila melanogaster. Exp Gerontol 36, 441-463. Mohanty, P., Ghanim, H., Hamouda, W., Aljada, A., Garg, R., Dandona, P., 2002. Both lipid and protein intakes stimulate increased generation of reactive oxygen species by polymorphonuclear leukocytes and mononuclear cells. Am J Clin Nutr 75, 767-772. Monnerot, M., Solignac, M., Wolstenholme, D.R., 1990. Discrepancy in divergence of the mitochondrial and nuclear genomes of Drosophila teissieri and Drosophila yakuba. J Mol Evol 30, 500-508. Montooth, K.L., Abt, D.N., Hofmann, J.W., Rand, D.M., 2009. Comparative genomics of Drosophila mtDNA: Novel features of conservation and change across functional domains and lineages. J Mol Evol 69, 94-114. Mossman, J.A., Biancani, L.M., Zhu, C.-T., Rand, D.M., 2016. Mitonuclear epistasis for development time and its modification by diet in Drosophila. Genetics 203, 463-484. Mossman, J.A., Jennifer, Y.G., Navarro, F., Rand, D.M., 2019. Mitochondrial DNA fitness depends on nuclear genetic background in Drosophila. G3. 400067.402019. Mossman, J.A., Tross, J.G., Jourjine, N.A., Li, N., Wu, Z., Rand, D.M., 2017. Mitonuclear interactions mediate transcriptional responses to hypoxia in Drosophila. Mol Biol Evo 34, 447-466. Pandey, U.B., Nichols, C.D., 2011. Human disease models in Drosophila melanogaster and the role of the fly in therapeutic drug discovery. Pharmacol Rev 63, 411-436. Peng, T.X., Moya, A., Ayala, F.J., 1991. Two modes of balancing selection in Drosophila melanogaster: overcompensation and overdominance. Genetics 128, 381-391. Perera, S., Ramos, A., Alvarez, L., Jurado, D., Guardiola, M., Lima, M., Aluja, M.P., Santos, C., 2018. Reappraising the human mitochondrial DNA recombination dogma. bioRxiv, 304535. Pichaud, N., Ballard, J.W.O., Tanguay, R.M., Blier, P.U., 2013a. Mitochondrial haplotype divergences affect specific temperature sensitivity of mitochondrial respiration. J Bioenerg Biomembr 45, 25-35.

144 Pichaud, N., Messmer, M., Correa, C.C., Ballard, J.W.O., 2013b. Diet influences the intake target and mitochondrial functions of Drosophila melanogaster males. Mitochondrion 13, 817-822. Piganeau, G., Eyre-Walker, A., 2009. Evidence for variation in the effective population size of animal mitochondrial DNA. PLoS One 4, e4396. Rambold, A.S., Cohen, S., Lippincott-Schwartz, J., 2015. Fatty acid trafficking in starved cells: regulation by lipid droplet lipolysis, autophagy, and mitochondrial fusion dynamics. Dev Cell 32, 678-692. Rand, D.M., Clark, A.G., Kann, L.M., 2001. Sexually antagonistic cytonuclear fitness interactions in Drosophila melanogaster. Genetics 159, 173-187. Rand, D.M., Haney, R.A., Fry, A.J., 2004. Cytonuclear coevolution: the genomics of cooperation. Trends Ecol Evol 19, 645-653. Rizzuto, R., De Stefani, D., Raffaello, A., Mammucari, C., 2012. Mitochondria as sensors and regulators of calcium signalling. Nat Rev Mol Cell Biol 13, 566. Ruiz-Pesini, E., Mishmar, D., Brandon, M., Procaccio, V., Wallace, D.C., 2004. Effects of purifying and adaptive selection on regional variation in human mtDNA. Science 303, 223-226. Sanz, A., Caro, P., Ayala, V., Portero-Otin, M., Pamplona, R., Barja, G., 2006. Methionine restriction decreases mitochondrial oxygen radical generation and leak as well as oxidative damage to mitochondrial DNA and proteins. FASEB J 20, 1064-1073. Schon, E.A., Gilkerson, R.W., 2010. Functional complementation of mitochondrial DNAs: mobilizing mitochondrial genetics against dysfunction. BBA General Subjects 1800, 245-249. Senyilmaz-Tiebe, D., Pfaff, D.H., Virtue, S., Schwarz, K.V., Fleming, T., Altamura, S., Muckenthaler, M.U., Okun, J.G., Vidal-Puig, A., Nawroth, P., Teleman, A.A., 2018. Dietary stearic acid regulates mitochondria in vivo in humans. Nat Commun 9, 3129. Simpson, S.J., Le Couteur, D.G., James, D.E., George, J., Gunton, J.E., Solon-Biet, S.M., Raubenheimer, D., 2017. The Geometric Framework for Nutrition as a tool in precision medicine. Nutr Health Aging 4, 217-226. Siri-Tarino, P.W., Sun, Q., Hu, F.B., Krauss, R.M., 2010. Saturated fatty acids and risk of coronary heart disease: modulation by replacement nutrients. Curr Atheroscler Rep 12, 384-390. Slatkin, M., Hudson, R., 1991. Pairwise comparisons of mitochondrial DNA sequences in stable and exponentially growing populations. Genetics 143, 579-587. Soares, P., Ermini, L., Thomson, N., Mormina, M., Rito, T., Röhl, A., Salas, A., Oppenheimer, S., Macaulay, V., Richards, M.B., 2009. Correcting for purifying selection: an improved human mitochondrial molecular clock. Am J Hum Genet 84, 740-759. Solignac, M., Monnerot, M., Mounolou, J.C., 1983. Mitochondrial DNA heteroplasmy in Drosophila mauritiana. Proc Natl Acad Sci U. S. A. 80, 6942-6946. Solon-Biet, S.M., McMahon, A.C., Ballard, J.W.O., Ruohonen, K., Wu, L.E., Cogger, V.C., Warren, A., Huang, X., Pichaud, N., Melvin, R.G., Gokarn, R., Khalil, M., Turner, N., Cooney, G.J., Sinclair, D.A., Raubenheimer, D., Le Couteur, D.G., Simpson, S.J., 2014. The ratio of macronutrients, not caloric intake, dictates cardiometabolic health, aging, and longevity in ad libitum-fed mice. Cell Metab 19, 418-430. Solon-Biet, S.M., Walters, K.A., Simanainen, U.K., McMahon, A.C., Ruohonen, K., Ballard, J.W.O., Raubenheimer, D., Handelsman, D.J., Le Couteur, D.G.,

145 Simpson, S.J., 2015. Macronutrient balance, reproductive function, and lifespan in aging mice. Proc Natl Acad Sci U. S. A. 112, 3481-3486. Soultoukis, G.A., Partridge, L., 2016. Dietary protein, metabolism, and aging. Annu Rev Biochem 85, 5-34. Stoneking, M., 2000. Hypervariable sites in the mtDNA control region are mutational hotspots. Am J Hum Genet 67, 1029-1032. Stroud, D.A., Surgenor, E.E., Formosa, L.E., Reljic, B., Frazier, A.E., Dibley, M.G., Osellame, L.D., Stait, T., Beilharz, T.H., Thorburn, D.R., Salim, A., Ryan, M.T., 2016. Accessory subunits are integral for assembly and function of human mitochondrial complex I. Nature 538, 123-126. Sugihara, K., Yui, R., Ibaragi, Y., Matsuura, E.T., 2006. Complete nucleotide sequence of the A+T-rich region of Drosophila mauritiana mitochondrial DNA. Genes Genet Syst 81, 21-28. Tegelberg, S., Tomašić, N., Kallijärvi, J., Purhonen, J., Elmér, E., Lindberg, E., Nord, D.G., Soller, M., Lesko, N., Wedell, A., 2017. Respiratory chain complex III deficiency due to mutated BCS1L: a novel phenotype with encephalomyopathy, partially phenocopied in a Bcs1l mutant mouse model. Orphanet J Rare Dis 12, 73. Thurmond, J., Goodman, J.L., Strelets, V.B., Attrill, H., Gramates, L.S., Marygold, S.J., Matthews, B.B., Millburn, G., Antonazzo, G., Trovisco, V., Kaufman, T.C., Calvi, B.R., FlyBase, C., 2019. FlyBase 2.0: the next generation. Nucleic Acids Res 47, D759-D765. Tsujino, F., Kosemura, A., Inohira, K., Hara, T., Otsuka, Y.F., Obara, M.K., Matsuura, E.T., 2002. Evolution of the A+T-rich region of mitochondrial DNA in the melanogaster species subgroup of Drosophila. J Mol Evol 55, 573-583. Van den Ouweland, J., Lemkes, H., Ruitenbeek, W., Sandkuijl, L., De Vijlder, M., Struyvenberg, P., Van de Kamp, J., Maassen, J., 1992. Mutation in mitochondrial tRNA Leu (UUR) gene in a large pedigree with maternally transmitted type II diabetes mellitus and deafness. Nature Genet 1, 368. Vimolmangkang, S., Zheng, H., Peng, Q., Jiang, Q., Wang, H., Fang, T., Liao, L., Wang, L., He, H., Han, Y., 2016. Assessment of sugar components and genes involved in the regulation of sucrose accumulation in peach fruit. J Agric Food Chem 64, 6723-6729. Wang, C., Liu, X., Wei, B., 2011. Mitochondrion: an emerging platform critical for host antiviral signaling. Expert Opin Ther Targets 15, 647-665. Wang, M., Huang, Y.P., Wu, H., Song, K., Wan, C., Chi, A.N., Xiao, Y.M., Zhao, X.Y., 2017. Mitochondrial complex I deficiency leads to the retardation of early embryonic development in Ndufs4 knockout mice. PeerJ 5, e3339. Wolff, J., Nafisinia, M., Sutovsky, P., Ballard, J.W.O, 2013. Paternal transmission of mitochondrial DNA as an integral part of mitochondrial inheritance in metapopulations of Drosophila simulans. Heredity 110, 57. Wolff, J.N., Camus, M.F., Clancy, D.J., Dowling, D.K., 2016. Complete mitochondrial genome sequences of thirteen globally sourced strains of fruit fly (Drosophila melanogaster) form a powerful model for mitochondrial research. Mito DNA Mapp Seq Anal 27, 4672-4674. Wolff, J.N., Ladoukakis, E.D., Enríquez, J.A., Dowling, D.K., 2014. Mitonuclear interactions: evolutionary consequences over multiple biological scales. Phil Tran Royal Soc B: Bio Sci 369, 20130443.

146 Yarham, J.W., Elson, J.L., Blakely, E.L., McFarland, R., Taylor, R.W., 2010. Mitochondrial tRNA mutations and disease. Wiley Interdisc Rev: RNA 1, 304- 324. Yasukawa, T., Kang, D., 2018. An overview of mammalian mitochondrial DNA replication mechanisms. J Biochem 164, 183-193. Youle, R.J., Van Der Bliek, A.M., 2012. Mitochondrial fission, fusion, and stress. Science 337, 1062-1065. Zhang, Y., Jiang, L., Hu, W., Zheng, Q., Xiang, W., 2011. Mitochondrial dysfunction during in vitro hepatocyte steatosis is reversed by omega-3 fatty acid–induced upregulation of mitofusin 2. Metabol 60, 767-775. Zheng, W., Gianoulis, T.A., Karczewski, K.J., Zhao, H., Snyder, M., 2011. Regulatory variation within and between species. Annu Rev Genomics Hum Genet 12, 327- 346. Zhou, A., Rohou, A., Schep, D.G., Bason, J.V., Montgomery, M.G., Walker, J.E., Grigorieff, N., Rubinstein, J.L., 2015. Structure and conformational states of the bovine mitochondrial ATP synthase by cryo-EM. Elife 4, e10180. Zhu, C.T., Ingelmo, P., Rand, D.M., 2014. GxGxE for lifespan in Drosophila: mitochondrial, nuclear, and dietary interactions that modify longevity. PLoS Genet 10, e1004354. Zhu, J., Vinothkumar, K.R., Hirst, J., 2016. Structure of mammalian respiratory complex I. Nature 536, 354-358.

147 Chapter 2 references

Amunts, A., Brown, A., Toots, J., Scheres, S.H., Ramakrishnan, V., 2015. Ribosome. The structure of the human mitochondrial ribosome. Science 348, 95. Aw, W.C., Correa, C.C., Clancy, D.J., Ballard, J.W.O., 2011. Mitochondrial DNA variants in Drosophila melanogaster are expressed at the level of the organismal phenotype. Mitochondrion 11, 756-763. Azevedo, R.B., French, V., Partridge, L., 2002. Temperature modulates epidermal cell size in Drosophila melanogaster. J Insect Physiol 48, 231-237. Ballard, J.W.O., Youngson, N.A., 2015. Review: can diet influence the selective advantage of mitochondrial DNA haplotypes? Biosci Rep 35, e00277 . Bartko, J.J., 1966. The intraclass correlation coefficient as a measure of reliability. Psych Rep 19, 3-11. Behmer, S.T., 2009. Insect herbivore nutrient regulation. Annu Rev Entomol 54, 165- 187. Berrigan, D., Partridge, L., 1997. Influence of temperature and activity on the metabolic rate of adult Drosophila melanogaster. Comp Biochem Physiol A Physiol 118, 1301-1307. Blier, P.U., Dufresne, F., Burton, R.S., 2001. Natural selection and the evolution of mtDNA-encoded peptides: evidence for intergenomic co-adaptation. Trends Genet 17, 400-406. Burke, C.J., Waddell, S., 2011. Remembering nutrient quality of sugar in Drosophila. Curr Biol 21, 746-750. Burman, J.L., Itsara, L.S., Kayser, E.B., Suthammarak, W., Wang, A.M., Kaeberlein, M., Sedensky, M.M., Morgan, P.G., Pallanck, L.J., 2014. A Drosophila model of mitochondrial disease caused by a complex I mutation that uncouples proton pumping from electron transfer. Dis Model Mech 7, 1165-1174. Celotto, A.M., Chiu, W.K., Van Voorhies, W., Palladino, M.J., 2011. Modes of metabolic compensation during mitochondrial disease using the Drosophila model of ATP6 dysfunction. PLoS One 6, e25823. Clancy, D.J., 2008. Variation in mitochondrial genotype has substantial lifespan effects which may be modulated by nuclear background. Aging Cell 7, 795-804. Clancy, D.J., Kennington, 2001. A simple method to achieve consistent larval density in bottle cultures. Drosoph Inf Serv 84, 168–169. Correa, C.C., Aw, W.C., Melvin, R.G., Pichaud, N., Ballard, J.W.O., 2012. Mitochondrial DNA variants influence mitochondrial bioenergetics in Drosophila melanogaster. Mitochondrion 12, 459-464. David, J., Clavel, M.F., 1967. Influence of temperature during the course of development on various biometric characteristics of adult Drosophila melanogaster. J Insect Physiol 13, 717-729. De Moed, G.H., Kruitwagen, C.L.J.J., De Jong, G., Scharloo, W., 1999. Critical weight for the induction of pupariation in Drosophila melanogaster: genetic and environmental variation. J Evolution Biol 12, 852-858. Dowling, D.K., Friberg, U., Hailer, F., Arnqvist, G., 2007. Intergenomic epistasis for fitness: within-population interactions between cytoplasmic and nuclear genes in Drosophila melanogaster. Genetics 175, 235-244. Dowling, D.K., Friberg, U., Lindell, J., 2008. Evolutionary implications of non-neutral mitochondrial genetic variation. Trends Ecol Evol 23, 546-554. Elson, J.L., Smith, P.M., Greaves, L.C., Lightowlers, R.N., Chrzanowska-Lightowlers, Z.M., Taylor, R.W., Vila-Sanjurjo, A., 2015. The presence of highly disruptive 148 16S rRNA mutations in clinical samples indicates a wider role for mutations of the mitochondrial ribosome in human disease. Mitochondrion 25, 17-27. Farzin, M., Albert, T., Pierce, N., VandenBrooks, J.M., Dodge, T., Harrison, J.F., 2014. Acute and chronic effects of atmospheric oxygen on the feeding behavior of Drosophila melanogaster larvae. J Insect Physiol 68, 23-29. Fields, A.P., Rodriguez, E.H., Jovanovic, M., Stern-Ginossar, N., Haas, B.J., Mertins, P., Raychowdhury, R., Hacohen, N., Carr, S.A., Ingolia, N.T., Regev, A., Weissman, J.S., 2015. A regression-based analysis of ribosome-profiling data reveals a conserved complexity to mammalian translation. Mol Cell 60, 816-827. Finch, T.M., Zhao, N., Korkin, D., Frederick, K.H., Eggert, L.S., 2014. Evidence of positive selection in mitochondrial complexes I and V of the African elephant. PLoS One 9, e92587. French, V., Feast, M., Partridge, L., 1998. Body size and cell size in Drosophila: the developmental response to temperature. J Insect Physiol 44, 1081-1089. Fujita, M., Tanimura, T., 2011. Drosophila evaluates and learns the nutritional value of sugars. Curr Biol 21, 751-755. Gałecki, A., Burzykowski, T., 2013. Linear mixed-effects models using R: A step-by- step approach. Springer Science & Business Media, Springer, NY. Galgani, J.E., Moro, C., Ravussin, E., 2008. Metabolic flexibility and insulin resistance. Am J Physiol Endocrinol Metab 295, E1009-1017. Garvin, M.R., Bielawski, J.P., Gharrett, A.J., 2011. Positive Darwinian selection in the piston that powers proton pumps in complex I of the mitochondria of Pacific salmon. PLoS One 6, e24127. Gnaiger, E., Boushel, R., Sondergaard, H., Munch-Andersen, T., Damsgaard, R., Hagen, C., Diez-Sanchez, C., Ara, I., Wright-Paradis, C., Schrauwen, P., Hesselink, M., Calbet, J.A., Christiansen, M., Helge, J.W., Saltin, B., 2015. Mitochondrial coupling and capacity of oxidative phosphorylation in skeletal

149 muscle of Inuit and Caucasians in the arctic winter. Scand J Med Sci Sports 25 Suppl 4, 126-134. Goda, T., Leslie, J.R., Hamada, F.N., 2014. Design and analysis of temperature preference behavior and its circadian rhythm in Drosophila. J Vis Exp, e51097. Godoy-Herrera, R., Burnet, B., Connolly, K., Gogarty, J., 1984. The development of locomotor activity in Drosophila melanogaster larvae. Heredity 52, 63-75. Gu, W., Novak, R.J., 2006. Statistical estimation of degree days of mosquito development under fluctuating temperatures in the field. J Vector Ecol 31, 107- 112. Hazelrigg, T., Levis, R., Rubin, G.M., 1984. Transformation of white locus DNA in Drosophila: dosage compensation, zeste interaction, and position effects. Cell 36, 469-481. Immonen, E., Ronn, J., Watson, C., Berger, D., Arnqvist, G., 2016. Complex mitonuclear interactions and metabolic costs of mating in male seed beetles. J Evol Biol 29, 360-370. Isono, K., Morita, H., 2010. Molecular and cellular designs of insect taste receptor system. Front Cell Neurosci 4, 20. James, A.C., Azevedo, R.B., Partridge, L., 1997. Genetic and environmental responses to temperature of Drosophila melanogaster from a latitudinal cline. Genetics 146, 881-890. James, J.E., Piganeau, G., Eyre-Walker, A., 2016. The rate of adaptive evolution in animal mitochondria. Mol Ecol 25, 67-78. Kazancioglu, E., Arnqvist, G., 2014. The maintenance of mitochondrial genetic variation by negative frequency-dependent selection. Ecol Lett 17, 22-27. Kelley, D.E., Mandarino, L.J., 2000. Fuel selection in human skeletal muscle in insulin resistance: a reexamination. Diabetes 49, 677-683. Kemppainen, E., George, J., Garipler, G., Tuomela, T., Kiviranta, E., Soga, T., Dunn, C.D., Jacobs, H.T., 2016. Mitochondrial dysfunction plus high-sugar diet provokes a metabolic crisis that inhibits growth. PLoS One 11, e0145836. Krsticevic, F.J., Santos, H.L., Januario, S., Schrago, C.G., Carvalho, A.B., 2010. Functional copies of the Mst77F gene on the Y chromosome of Drosophila melanogaster. Genetics 184, 295-307. Kurbalija Novicic, Z., Immonen, E., Jelic, M., AnEthelkovic, M., Stamenkovic-Radak, M., Arnqvist, G., 2015. Within-population genetic effects of mtDNA on metabolic rate in Drosophila subobscura. J Evol Biol 28, 338-346. Le Couteur, D.G., Tay, S.S., Solon-Biet, S., Bertolino, P., McMahon, A.C., Cogger, V.C., Colakoglu, F., Warren, A., Holmes, A.J., Pichaud, N., Horan, M., Correa, C., Melvin, R.G., Turner, N., Ballard, J.W.O., Ruohonen, K., Raubenheimer, D., Simpson, S.J., 2014. The influence of macronutrients on splanchnic and hepatic lymphocytes in aging mice. J Gerontol A Biol Sci Med Sci 70, 1499-1507. Lee, H.C., Wei, Y.H., 2005. Mitochondrial biogenesis and mitochondrial DNA maintenance of mammalian cells under oxidative stress. Int J Biochem Cell Biol 37, 822-834. Lee, K.P., Simpson, S.J., Clissold, F.J., Brooks, R., Ballard, J.W.O., Taylor, P.W., Soran, N., Raubenheimer, D., 2008. Lifespan and reproduction in Drosophila:

150 New insights from nutritional geometry. Proc Natl Acad Sci U. S. A. 105, 2498- 2503. Li, Q., Lin, K., Sun, H., Liu, S., Huang, K., Huang, X., Chu, J., Yang, Z., 2016. Mitochondrial haplogroup M9a1a1c1b is associated with hypoxic adaptation in the Tibetans. J Hum Genet 61, 1021-1026. Liu, Z., Huang, X., 2013. Lipid metabolism in Drosophila: development and disease. Acta Biochim Biophys Sin 45, 44-50. Loeb, J., Northrop, J.H., 1916. Is there a temperature coefficient for the duration of life? Proc Natl Acad Sci U. S. A. 2, 456-457. Maimon, I., Gilboa, L., 2011. Dissection and staining of Drosophila larval ovaries. J Vis Exp. Meiklejohn, C.D., Holmbeck, M.A., Siddiq, M.A., Abt, D.N., Rand, D.M., Montooth, K.L., 2013. An Incompatibility between a mitochondrial tRNA and its nuclear- encoded tRNA synthetase compromises development and fitness in Drosophila. PLoS Genet 9, e1003238. Mossman, J.A., Biancani, L.M., Zhu, C.T., Rand, D.M., 2016. Mitonuclear epistasis for development time and its modification by diet in Drosophila. Genetics 203, 463- 484. Na, J., Musselman, L.P., Pendse, J., Baranski, T.J., Bodmer, R., Ocorr, K., Cagan, R., 2013. A Drosophila model of high sugar diet-induced cardiomyopathy. PLoS Genet 9, e1003175. Piper, M.D., Blanc, E., Leitao-Goncalves, R., Yang, M., He, X., Linford, N.J., Hoddinott, M.P., Hopfen, C., Soultoukis, G.A., Niemeyer, C., Kerr, F., Pletcher, S.D., Ribeiro, C., Partridge, L., 2014. A holidic medium for Drosophila melanogaster. Nat Methods 11, 100-105. Rahman, M., Nirala, N.K., Singh, A., Zhu, L.J., Taguchi, K., Bamba, T., Fukusaki, E., Shaw, L.M., Lambright, D.G., Acharya, J.K., Acharya, U.R., 2014. Drosophila Sirt2/mammalian SIRT3 deacetylates ATP synthase β and regulates complex V activity. J Cell Biol 206, 289-305. Raubenheimer, D., Simpson, S.J., 1997. Integrative models of nutrient balancing: application to insects and vertebrates. Nutr Res Rev 10, 151-179. Rawson, P.D., Burton, R.S., 2002. Functional coadaptation between cytochrome c and cytochrome c oxidase within allopatric populations of a marine copepod. Proc Natl Acad Sci U. S. A. 99, 12955-12958. Rodrigues, M.A., Martins, N.E., Balance, L.F., Broom, L.N., Dias, A.J., Fernandes, A.S., Rodrigues, F., Sucena, E., Mirth, C.K., 2015. Drosophila melanogaster larvae make nutritional choices that minimize developmental time. J Insect Physiol 81, 69-80. Rollins, L.A., Woolnough, A.P., Fanson, B.G., Cummins, M.L., Crowley, T.M., Wilton, A.N., Sinclair, R., Butler, A., Sherwin, W.B., 2016. Selection on mitochondrial

151 variants occurs between and within individuals in an expanding invasion. Mol Biol Evol 33, 995-1007. Ross, J.M., Coppotelli, G., Hoffer, B.J., Olson, L., 2014. Maternally transmitted mitochondrial DNA mutations can reduce lifespan. Sci Rep 4, 6569. Ruiz-Pesini, E., Mishmar, D., Brandon, M., Procaccio, V., Wallace, D.C., 2004. Effects of purifying and adaptive selection on regional variation in human mtDNA. Science 303, 223-226. Salminen, T.S., Oliveira, M.T., Cannino, G., Lillsunde, P., Jacobs, H.T., Kaguni, L.S., 2017. Mitochondrial genotype modulates mtDNA copy number and organismal phenotype in Drosophila. Mitochondrion 34, 75-83. Santos, M., Fowler, K., Partridge, L., 1994. Gene-environment interaction for body size and larval density in Drosophila melanogaster: an investigation of effects on development time, thorax length and adult sex ratio. Heredity 72 (Pt 5), 515-521. Schluter, D., 2000. The Ecology of Adaptive Radiation. Ox Uni Press. Shen, P., 2012. Analysis of feeding behavior of Drosophila larvae on liquid food. Cold Spring Harb Protoc 2012. Simpson, S.J., Batley, R., Raubenheimer, D., 2003. Geometric analysis of macronutrient intake in humans: the power of protein? Appetite 41, 123-140. Simpson, S.J., Raubenheimer, D., 1997. Geometric analysis of macronutrient selection in the rat. Appetite 28, 201-213. Simpson, S.J., Raubenheimer, D., 2009. Macronutrient balance and lifespan. Aging 1, 875-880. Sokal, R.R., Rohlf, F.J., 1995. Biometry: The Principles and Practice of Statistics in Biological Research, third ed. W.H. Freeman, New York. Solon-Biet, S.M., McMahon, A.C., Ballard, J.W.O., Ruohonen, K., Wu, L.E., Cogger, V.C., Warren, A., Huang, X., Pichaud, N., Melvin, R.G., Gokarn, R., Khalil, M., Turner, N., Cooney, G.J., Sinclair, D.A., Raubenheimer, D., Le Couteur, D.G., Simpson, S.J., 2014. The ratio of macronutrients, not caloric intake, dictates cardiometabolic health, aging, and longevity in ad libitum-fed mice. Cell Metab 19, 418-430. Stabell, M., Larsson, J., Aalen, R.B., Lambertsson, A., 2007. Drosophila dSet2 functions in H3-K36 methylation and is required for development. Biochem Biophys Res Co 359, 784-789. Stevenson, R.D., 1985. The relative importance of behavioral and physiological adjustments controlling body temperature in terrestrial ectotherms. The American Naturalist 126, 362-386. Teulier, L., Rouanet, J.L., Letexier, D., Romestaing, C., Belouze, M., Rey, B., Duchamp, C., Roussel, D., 2010. Cold-acclimation-induced non-shivering

152 thermogenesis in birds is associated with upregulation of avian UCP but not with innate uncoupling or altered ATP efficiency. J Exp Biol 213, 2476-2482. Troncoso, B., 1987. The development of larval movement patterns in Drosophila. Heredity 58, 321-329. Vargas, M.A., Luo, N., Yamaguchi, A., Kapahi, P., 2010. A role for S6 kinase and serotonin in postmating dietary switch and balance of nutrients in D. melanogaster. Curr Biol 20, 1006-1011. Wallace, D.C., 2005. The mitochondrial genome in human adaptive radiation and disease: on the road to therapeutics and performance enhancement. Gene 354, 169-180. Wallace, D.C., 2010. Mitochondrial DNA mutations in disease and aging. Environ Mol Mutagen 51, 440-450. Wolff, J.N., Camus, M.F., Clancy, D.J., Dowling, D.K., 2015. Complete mitochondrial genome sequences of thirteen globally sourced strains of fruit fly (Drosophila melanogaster) form a powerful model for mitochondrial research. Mitochondrial DNA, 1-3. Wu, Q., Zhang, Y., Xu, J., Shen, P., 2005a. Regulation of hunger-driven behaviors by neural ribosomal S6 kinase in Drosophila. Proc Natl Acad Sci U. S. A. 102, 13289-13294. Wu, Q., Zhao, Z., Shen, P., 2005b. Regulation of aversion to noxious food by Drosophila neuropeptide Y- and insulin-like systems. Nat Neurosci 8, 1350-1355. Yadav, P., Sharma, V.K., 2014. Correlated changes in life history traits in response to selection for faster pre-adult development in the fruit fly Drosophila melanogaster. J Exp Biol 217, 580-589. Zhu, C.T., Ingelmo, P., Rand, D.M., 2014. GxGxE for lifespan in Drosophila: mitochondrial, nuclear, and dietary interactions that modify longevity. PLoS Genet 10, e1004354.

153 Chapter 3 references

Aw, W.C., Bajracharya, R., Towarnicki, S.G., Ballard, J.W.O., 2016. Assessing bioenergetic functions from isolated mitochondria in Drosophila melanogaster. J. Biol. Methods, e42. Aw, W.C., Correa, C.C., Clancy, D.J., Ballard, J.W.O., 2011. Mitochondrial DNA variants in Drosophila melanogaster are expressed at the level of the organismal phenotype. Mitochondrion 11, 756-763. Bajad, S.U., Lu, W., Kimball, E.H., Yuan, J., Peterson, C., Rabinowitz, J.D., 2006. Separation and quantitation of water soluble cellular metabolites by hydrophilic interaction chromatography-tandem mass spectrometry. J Chromatogr A 1125, 76-88. Bland, M.L., 2016. Measurement of carbon dioxide production from radiolabeled substrates in Drosophila melanogaster. J Vis Exp 112, 54045. Chertemps, T., Duportets, L., Labeur, C., Ueda, R., Takahashi, K., Saigo, K., Wicker- Thomas, C., 2007. A female-biased expressed elongase involved in long-chain hydrocarbon biosynthesis and courtship behavior in Drosophila melanogaster. Proc Natl Acad Sci U. S. A. 104, 4273-4278. Choi, S., Lim, D.S., Chung, J., 2015. Feeding and fasting signals converge on the LKB1-SIK3 pathway to regulate lipid metabolism in Drosophila. PLoS Genet 11, e1005263. Church, R., Robertson, F., 1966. A biochemical study of the growth of Drosophila melanogaster. J Exp Zool 162. Clancy, D.J., 2008. Variation in mitochondrial genotype has substantial lifespan effects which may be modulated by nuclear background. Aging Cell 7, 795-804. Colombani, J., Bianchini, L., Layalle, S., Pondeville, E., Dauphin-Villemant, C., Antoniewski, C., Carre, C., Noselli, S., Leopold, P., 2005. Antagonistic actions of ecdysone and insulins determine final size in Drosophila. Science 310, 667-670. D'Souza, B., Meloty-Kapella, L., Weinmaster, G., 2010. Canonical and non-canonical Notch ligands. Curr Top Devel Biol 92, 73-129. Grönke, S., Mildner, A., Fellert, S., Tennagels, N., Petry, S., Müller, G., Jackle, H., Kuhnlein, R.P., 2005. Brummer lipase is an evolutionary conserved fat storage regulator in Drosophila. Cell Metab 1, 323-330. Gutierrez, E., Wiggins, D., Fielding, B., Gould, A.P., 2007. Specialized hepatocyte-like cells regulate Drosophila lipid metabolism. Nature 445, 275-280. Hoffmann, A.A., Harshman, L.G., 1999. Desiccation and starvation resistance in Drosophila: patterns of variation at the species, population and intrapopulation levels. Heredity 83 ( Pt 6), 637-643. Iijima, K., Zhao, L., Shenton, C., Iijima-Ando, K., 2009. Regulation of energy stores and feeding by neuronal and peripheral CREB activity in Drosophila. PLoS One 4, e8498. Lee, T.V., Sethi, M.K., Leonardi, J., Rana, N.A., Buettner, F.F., Haltiwanger, R.S., Bakker, H., Jafar-Nejad, H., 2013. Negative regulation of notch signaling by xylose. PLoS Genet 9, e1003547. Makki, R., Cinnamon, E., Gould, A.P., 2014. The development and functions of oenocytes. Annu Rev Entomol 59, 405-425. Noack, H., Kunz, W.S., Augustin, W., 1992. Evaluation of a procedure for the simultaneous determination of oxidized and reduced pyridine nucleotides and adenylates in organic phenol extracts from mitochondria. Anal Biochem 202, 162- 165. 154 Okajima, T., Irvine, K.D., 2002. Regulation of notch signaling by O-linked fucose. Cell 111, 893-904. Reis, T., Van Gilst, M.R., Hariharan, I.K., 2010. A buoyancy-based screen of Drosophila larvae for fat-storage mutants reveals a role for Sir2 in coupling fat storage to nutrient availability. PLoS Genet 6, e1001206. Santos, G.C., Zeidler, J.D., Pérez-Valencia, J.A., Sant’Anna-Silva, A.C.B., Da Poian, A.T., El-Bacha, T., Almeida, F.C.L., 2017. Metabolomic analysis reveals vitamin D-induced decrease in polyol pathway and subtle modulation of glycolysis in HEK293T cells. Sci Rep 7, 9510. Schwasinger-Schmidt, T.E., Kachman, S.D., Harshman, L.G., 2012. Evolution of starvation resistance in Drosophila melanogaster: measurement of direct and correlated responses to artificial selection. J Evol Biol 25, 378-387. Sharma, V., Ichikawa, M., Freeze, H.H., 2014. Mannose metabolism: more than meets the eye. Biochem Biophys Res Commun 453, 220-228. Towarnicki, S.G., Ballard, J.W.O., 2017. Drosophila mitotypes determine developmental time in a diet and temperature dependent manner. J Insect Physiol 100, 133-139. Tubon, T.C., Jr., Zhang, J., Friedman, E.L., Jin, H., Gonzales, E.D., Zhou, H., Drier, D., Gerstner, J.R., Paulson, E.A., Fropf, R., Yin, J.C., 2013. dCREB2-mediated enhancement of memory formation. J Neurosci 33, 7475-7487. Wehr, M.C., Holder, M.V., Gailite, I., Saunders, R.E., Maile, T.M., Ciirdaeva, E., Instrell, R., Jiang, M., Howell, M., Rossner, M.J., Tapon, N., 2013. Salt-inducible kinases regulate growth through the Hippo signalling pathway in Drosophila. Nat Cell Biol 15, 61-71. Wolff, J.N., Camus, M.F., Clancy, D.J., Dowling, D.K., 2016. Complete mitochondrial genome sequences of thirteen globally sources strains of fruit fly (Drosophila melanogaster) form a powerful model for mitochondrial research. Mitochondrial DNA 27, 1-3. Zeng, B., Huang, Y., Xu, J., Shiotsuki, T., Bai, H., Palli, S.R., Huang, Y., Tan, A., 2017. The FOXO transcription factor controls insect growth and development by regulating juvenile hormone degradation in the silkworm, Bombyx mori. J Biol Chem 292, 11659-11669. Zhang, J., Little, C.J., Tremmel, D.M., Yin, J.C., Wesley, C.S., 2013. Notch-inducible hyperphosphorylated CREB and its ultradian oscillation in long-term memory formation. J Neurosci 33, 12825-12834.

155 Chapter 4 references

Arrese, E.L., Soulages, J.L., 2010. Insect fat body: energy, metabolism, and regulation. Annu Rev Entomol 55, 207-225. Brinster, R.L., 1966. Glucose 6-phosphate-dehydrogenase activity in the preimplantation mouse embryo. Biochem J 101, 161-163. Britton, J.S., Lockwood, W.K., Li, L., Cohen, S.M., Edgar, B.A., 2002. Drosophila's insulin/PI3-kinase pathway coordinates cellular metabolism with nutritional conditions. Dev. Cell 2, 239-249. Ceddia, R.B., Bikopoulos, G.J., Hilliker, A.J., Sweeney, G., 2003. Insulin stimulates glucose metabolism via the pentose phosphate pathway in Drosophila Kc cells. FEBS Lett 555, 307-310. Celotto, A.M., Chiu, W.K., Van Voorhies, W., Palladino, M.J., 2011. Modes of metabolic compensation during mitochondrial disease using the Drosophila model of ATP6 dysfunction. PLoS One 6, e25823. Chowdhary, S., Tomer, D., Dubal, D., Sambre, D., Rikhy, R., 2017. Analysis of mitochondrial organization and function in the Drosophila blastoderm embryo. Sci Rep 7, 5502. Egan, B., Zierath, J.R., 2013. Exercise metabolism and the molecular regulation of skeletal muscle adaptation. Cell Metab 17, 162-184. Ekstrand, M.I., Falkenberg, M., Rantanen, A., Park, C.B., Gaspari, M., Hultenby, K., Rustin, P., Gustafsson, C.M., Larsson, N.G., 2004. Mitochondrial transcription factor A regulates mtDNA copy number in mammals. Hum Mol Genet 13, 935- 944. Erion, R., Sehgal, A., 2013. Regulation of insect behavior via the insulin-signaling pathway. Front Physiol 4, 353. Fan, W., Waymire, K.G., Narula, N., Li, P., Rocher, C., Coskun, P.E., Vannan, M.A., Narula, J., MacGregor, G.R., Wallace, D.C., 2008. A mouse model of mitochondrial disease reveals germline selection against severe mtDNA mutations. Science 319, 958-962. Greenberg, C.C., Jurczak, M.J., Danos, A.M., Brady, M.J., 2006. Glycogen branches out: new perspectives on the role of glycogen metabolism in the integration of metabolic pathways. Am J Physiol Endocrinol Metab 291, E1-8. Gronke, S., Clarke, D.F., Broughton, S., Andrews, T.D., Partridge, L., 2010. Molecular evolution and functional characterization of Drosophila insulin-like peptides. PLoS Genet 6, e1000857. Kohane, M.J., 1994. Energy, development and fitness in Drosophila melanogaster. Proc Biol Sci 257, 185-191. Milot, E., Moreau, C., Gagnon, A., Cohen, A.A., Brais, B., Labuda, D., 2017. Mother’s curse neutralizes natural selection against a human genetic disease over three centuries. Nat Ecol Evol 1, 1400. Murphy, C.T., Hu, P.J., 2013. Insulin/insulin-like growth factor signaling in C. elegans. WormBook, 1-43. Nakae, J., Kido, Y., Accili, D., 2001. Distinct and overlapping functions of insulin and IGF-I receptors. Endocr Rev 22, 818-835. Patel, M.R., Miriyala, G.K., Littleton, A.J., Yang, H., Trinh, K., Young, J.M., Kennedy, S.R., Yamashita, Y.M., Pallanck, L.J., Malik, H.S., 2016. A mitochondrial DNA hypomorph of cytochrome oxidase specifically impairs male fertility in Drosophila melanogaster. Elife 5, e16923.

156 Rezzi, S., Martin, F.-P.J., Shanmuganayagam, D., Colman, R.J., Nicholson, J.K., Weindruch, R., 2009. Metabolic shifts due to long-term caloric restriction revealed in nonhuman primates. Exp Gerontol 44, 356. Ruaud, A.F., Lam, G., Thummel, C.S., 2011. The Drosophila NR4A nuclear receptor DHR38 regulates carbohydrate metabolism and glycogen storage. Mol Endocrinol 25, 83-91. Salin, K., Liquet, E., Rey, B., Roussel, D., Voituron, Y., 2015. Alteration of mitochondrial efficiency affects oxidative balance, development and growth in frog (Rana temporaria) tadpoles. J Exp Biol 215, 863-869. Stanton, R.C., 2012. Glucose-6-phosphate dehydrogenase, NADPH, and cell survival. IUBMB Life 64, 362-369. Stewart, J.B., Freyer, C., Elson, J.L., Wredenberg, A., Cansu, Z., Trifunovic, A., Larsson, N.-G., 2008. Strong purifying selection in transmission of mammalian mitochondrial DNA. PLoS biology 6, e10. Swalwell, H., Kirby, D.M., Blakely, E.L., Mitchell, A., Salemi, R., Sugiana, C., Compton, A.G., Tucker, E.J., Ke, B.-X., Lamont, P.J., 2011. Respiratory chain complex I deficiency caused by mitochondrial DNA mutations. Eur J Hum Genet 19, 769. Taguchi, A., White, M.F., 2008. Insulin-like signaling, nutrient homeostasis, and life span. Annu Rev Physiol 70, 191-212. Tian, W.N., Braunstein, L.D., Pang, J., Stuhlmeier, K.M., Xi, Q.C., Tian, X., Stanton, R.C., 1998. Importance of glucose-6-phosphate dehydrogenase activity for cell growth. J Biol Chem 273, 10609-10617. Towarnicki, S.G., Ballard, J.W.O., 2017. Drosophila mitotypes determine developmental time in a diet and temperature dependent manner. J Insect Physiol 100, 133-139. Tuppen, H.A., Blakely, E.L., Turnbull, D.M., Taylor, R.W., 2010. Mitochondrial DNA mutations and human disease. Biochim Biophys Acta Bioenerg 1797, 113-128. Wieser, W., 1994. Cost of growth in cells and organisms: general rules and comparative aspects. Biol Rev Camb Philos Soc 69, 1-33. Wu, Q., Zhang, Y., Xu, J., Shen, P., 2005. Regulation of hunger-driven behaviors by neural ribosomal S6 kinase in Drosophila Proc Natl Acad Sci U S A 102, 13289- 13294. Zhao, X.L., Campos, A.R., 2012. Insulin signalling in mushroom body neurons regulates feeding behaviour in Drosophila larvae. J. Exp. Biol. 215, 2696-2702.

157 Chapter 5 references

Aguila, J.R., Hoshizaki, D.K., Gibbs, A.G., 2013. Contribution of larval nutrition to adult reproduction in Drosophila melanogaster. J. Exp. Biol. 216, 399-406. Aw, W.C., Bajracharya, R., Towarnicki, S.G., Ballard, J.W.O., 2016. Assessing bioenergetic functions from isolated mitochondria in Drosophila melanogaster. J. Biol. Methods, e42. Aw, W.C., Garvin, M.R., Melvin, R.G., Ballard, J.W.O., 2017. Sex-specific influences of mtDNA mitotype and diet on mitochondrial functions and physiological traits in Drosophila melanogaster. PLoS One 12, e0187554. Aw, W.C., Towarnicki, S.G., Melvin, R.G., Youngson, N.A., Garvin, M.R., Hu, Y., Nielsen, S., Thomas, T., Pickford, R., Bustamante, S., Vila-Sanjurjo, A., Smyth, G.K., Ballard, J.W.O., 2018. Genotype to phenotype: Diet-by-mitochondrial DNA haplotype interactions drive metabolic flexibility and organismal fitness. PLoS Genet 14, e1007735. Bajracharya, R., Ballard, J.W.O., 2016. Low protein to carbohydrate ratio diet delays onset of Parkinsonism like phenotype in Drosophila melanogaster parkin null mutants. Mech. Ageing Dev. 160, 19-27. Ballard, J.W.O., 2005. Drosophila simulans as a novel model for studying mitochondrial metabolism and aging. Exp. Gerontol. 40, 763-773. Ballard, J.W.O., Kreitman, M., 1995. Is mitochondrial DNA a strictly neutral marker? Trends Ecol. Evol. 10, 485-488. Ballard, J.W.O., Whitlock, M.C., 2004. The incomplete natural history of mitochondria. Mol Ecol 13, 729-744. Bazin, E., Glemin, S., Galtier, N., 2006. Population size does not influence mitochondrial genetic diversity in animals. Science 312, 570-572. Bazzell, B., Ginzberg, S., Healy, L., Wessells, R.J., 2013. Dietary composition regulates Drosophila mobility and cardiac physiology. J. Exp. Biol. 216, 859-868. Beaulieu, M., Geiger, R.E., Reim, E., Zielke, L., Fischer, K., 2015. Reproduction alters oxidative status when it is traded-off against longevity. Evolution 69, 1786-1796. Bellizzi, D., D'Aquila, P., Giordano, M., Montesanto, A., Passarino, G., 2012. Global DNA methylation levels are modulated by mitochondrial DNA variants. Epigenomics 4, 17-27. Brand, M.D., Nicholls, D.G., 2011. Assessing mitochondrial dysfunction in cells. Biochem. J. 435, 297-312. Catterson, J.H., Knowles-Barley, S., James, K., Heck, M.M., Harmar, A.J., Hartley, P.S., 2010. Dietary modulation of Drosophila sleep-wake behaviour. PLoS One 5, e12062. Clancy, D.J., 2008. Variation in mitochondrial genotype has substantial lifespan effects which may be modulated by nuclear background. Aging cell 7, 795-804. Clancy, D.J., Kennington, 2001. A simple method to achieve consistent larval density in bottle cultures. Drosoph. Inf. Serv. 84, 168–169. Copeland, J.M., Cho, J., Lo, T., Jr., Hur, J.H., Bahadorani, S., Arabyan, T., Rabie, J., Soh, J., Walker, D.W., 2009. Extension of Drosophila life span by RNAi of the mitochondrial respiratory chain. Curr Biol 19, 1591-1598. Correa, C.C., Aw, W.C., Melvin, R.G., Pichaud, N., Ballard, J.W.O., 2012. Mitochondrial DNA variants influence mitochondrial bioenergetics in Drosophila melanogaster. Mitochondrion 12, 459-464.

158 Dickinson, A., Yeung, K.Y., Donoghue, J., Baker, M.J., Kelly, R.D., McKenzie, M., Johns, T.G., St. John, J.C., 2013. The regulation of mitochondrial DNA copy number in glioblastoma cells. Cell. Death Differ. 20, 1644-1653. Elson, J.L., Smith, P.M., Vila-Sanjurjo, A., 2015. Heterologous inferential analysis (HIA) as a method to understand the role of mitochondrial rRNA mutations in pathogenesis. Methods Mol. Biol. 1264, 369-383. Fujita, M., Tanimura, T., 2011. Drosophila evaluates and learns the nutritional value of sugars. Curr. Biol. 21, 751-755. Galtier, N., Nabholz, B., Glemin, S., Hurst, G.D., 2009. Mitochondrial DNA as a marker of molecular diversity: a reappraisal. Mol Ecol 18, 4541-4550. Gargano, J.W., Martin, I., Bhandari, P., Grotewiel, M.S., 2005. Rapid iterative negative geotaxis (RING): a new method for assessing age-related locomotor decline in Drosophila. Exp. Gerontol. 40, 386-395. Garvin, M.R., Bielawski, J.H., Sazanov, L.A., Gharrettm, A.J., 2015. Review and meta- analysis of natural selection in mitochondrial complex I in metazoans. J. Zoolog. Syst. Evol. Res. 53, 1-17. Goddeeris, M.M., Cook-Wiens, E., Horton, W.J., Wolf, H., Stoltzfus, J.R., Borrusch, M., Grotewiel, M.S., 2003. Delayed behavioural aging and altered mortality in Drosophila beta integrin mutants. Aging cell 2, 257-264. Haeler, E., Fiedler, K., Grill, A., 2014. What prolongs a butterfly's life?: Trade-offs between dormancy, fecundity and body size. PLoS One 9, e111955. Hu, Y., Sopko, R., Foos, M., Kelley, C., Flockhart, I., Ammeux, N., Wang, X., Perkins, L., Perrimon, N., Mohr, S.E., 2013. FlyPrimerBank: an online database for Drosophila melanogaster gene expression analysis and knockdown evaluation of RNAi reagents. G3 (Bethesda) 3, 1607-1616. Iijima, K., Zhao, L., Shenton, C., Iijima-Ando, K., 2009. Regulation of energy stores and feeding by neuronal and peripheral CREB activity in Drosophila. PLoS One 4, e8498. James, J.E., Piganeau, G., Eyre-Walker, A., 2016. The rate of adaptive evolution in animal mitochondria. Mol Ecol 25, 67-78. Kaptijn, R., Thomese, F., Liefbroer, A.C., Van Poppel, F., Van Bodegom, D., Westendorp, R.G., 2015. The trade-off between female fertility and longevity during the epidemiological transition in the Netherlands. PLoS One 10, e0144353. Khazaeli, A.A., Curtsinger, J.W., 2013. Pleiotropy and life history evolution in Drosophila melanogaster: uncoupling life span and early fecundity. J. Gerontol. A. Biol. Sci. Med. Sci. 68, 546-553. Lee, K.P., Simpson, S.J., Clissold, F.J., Brooks, R., Ballard, J.W.O., Taylor, P.W., Soran, N., Raubenheimer, D., 2008. Lifespan and reproduction in Drosophila: New insights from nutritional geometry. Proc. Natl. Acad. Sci. U. S. A. 105, 2498-2503. Li, Q., Lin, K., Sun, H., Liu, S., Huang, K., Huang, X., Chu, J., Yang, Z., 2016. Mitochondrial haplogroup M9a1a1c1b is associated with hypoxic adaptation in the Tibetans. J. Hum. Genet. 61, 1021-1026. Luceri, C., Bigagli, E., Femia, A.P., Caderni, G., Giovannelli, L., Lodovici, M., 2018. Aging related changes in circulating reactive oxygen species (ROS) and protein carbonyls are indicative of liver oxidative injury. Toxicol. Rep. 5, 141-145. Mawhinney, R.M., Staveley, B.E., 2011. Expression of GFP can influence aging and climbing ability in Drosophila. Genet. Mol. Res. 10, 494-505.

159 Melvin, R.G., Ballard, J.W.O., 2006. Intraspecific variation in survival and mitochondrial oxidative phosphorylation in wild-caught Drosophila simulans. Aging cell 5, 225-233. Melvin, R.G., Ballard, J.W.O., 2011. Females with a mutation in a nuclear-encoded mitochondrial protein pay a higher cost of survival than do males in Drosophila. J Gerontol A Biol Sci Med Sci 66, 765-770. Metaxakis, A., Partridge, L., 2013. Dietary restriction extends lifespan in wild-derived populations of Drosophila melanogaster. PLoS One 8, e74681. Nam, S.C., Kang, C., 2005. DNA light-strand preferential recognition of human mitochondria transcription termination factor mTERF. J. Biochem. Mol. Biol. 38, 690-694. Ng, L.F., Gruber, J., Cheah, I.K., Goo, C.K., Cheong, W.F., Shui, G., Sit, K.P., Wenk, M.R., Halliwell, B., 2014. The mitochondria-targeted antioxidant MitoQ extends lifespan and improves healthspan of a transgenic Caenorhabditis elegans model of Alzheimer disease. Free Radic. Biol. Med. 71, 390-401. Obata, F., Fons, C.O., Gould, A.P., 2018. Early-life exposure to low-dose oxidants can increase longevity via microbiome remodelling in Drosophila. Nat. Commun. 9, 975. Odnokoz, O., Nakatsuka, K., Klichko, V.I., Nguyen, J., Solis, L.C., Ostling, K., Badinloo, M., Orr, W.C., Radyuk, S.N., 2017. Mitochondrial peroxiredoxins are essential in regulating the relationship between Drosophila immunity and aging. Biochim. Biophys. Acta. 1863, 68-80. Owusu-Ansah, E., Song, W., Perrimon, N., 2013. Muscle mitohormesis promotes longevity via systemic repression of insulin signaling. Cell 155, 699-712. Parmakelis, A., Kotsakiozi, P., Rand, D., 2013. Animal mitochondria, positive selection and cyto-nuclear coevolution: insights from pulmonates. PLoS One 8, e61970. Partridge, L., Piper, M.D., Mair, W., 2005. Dietary restriction in Drosophila. Mech. Ageing. Dev. 126, 938-950. Pichaud, N., Chatelain, E.H., Ballard, J.W.O., Tanguay, R., Morrow, G., Blier, P.U., 2010. Thermal sensitivity of mitochondrial metabolism in two distinct mitotypes of Drosophila simulans: evaluation of mitochondrial plasticity. J. Exp. Biol. 213, 1665-1675. Pichaud, N., Messmer, M., Correa, C.C., Ballard, J.W.O., 2013. Diet influences the intake target and mitochondrial functions of Drosophila melanogaster males. Mitochondrion 13, 817-822. Ragland, S.S., Sohal, R.S., 1975. Ambient temperature, physical activity and aging in the housefly, Musca domestica. Exp. Gerontol. 10, 279-289. Richman, T.R., Rackham, O., Filipovska, A., 2014. Mitochondria: Unusual features of the mammalian mitoribosome. Int. J. Biochem. Cell. Biol. 53, 115-120. Ristow, M., 2014. Unraveling the truth about antioxidants: mitohormesis explains ROS- induced health benefits. Nat. Med. 20, 709-711. Ristow, M., Schmeisser, K., 2014. Mitohormesis: promoting health and lifespan by increased levels of reactive oxygen species (ROS). Dose Response 12, 288-341. Roberti, M., Bruni, F., Loguercio Polosa, P., Manzari, C., Gadaleta, M.N., Cantatore, P., 2006. MTERF3, the most conserved member of the mTERF-family, is a modular factor involved in mitochondrial protein synthesis. Biochim. Biophys. Acta. 1757, 1199-1206. Roberti, M., Polosa, P.L., Bruni, F., Manzari, C., Deceglie, S., Gadaleta, M.N., Cantatore, P., 2009. The MTERF family proteins: mitochondrial transcription regulators and beyond. Biochim. Biophys. Acta. 1787, 303-311.

160 Rollins, L.A., Woolnough, A.P., Fanson, B.G., Cummins, M.L., Crowley, T.M., Wilton, A.N., Sinclair, R., Butler, A., Sherwin, W.B., 2016. Selection on mitochondrial variants occurs between and within individuals in an expanding invasion. Mol. Biol. Evol. 33, 995-1007. Schaar, C.E., Dues, D.J., Spielbauer, K.K., Machiela, E., Cooper, J.F., Senchuk, M., Hekimi, S., Van Raamsdonk, J.M., 2015. Mitochondrial and cytoplasmic ROS have opposing effects on lifespan. PLoS Genet 11, e1004972. Sharma, R., Yang, Y., Sharma, A., Awasthi, S., Awasthi, Y.C., 2004. Antioxidant role of glutathione S-transferases: protection against oxidant toxicity and regulation of stress-mediated apoptosis. Antioxid. Redox Signal 6, 289-300. Sheehan, D., Meade, G., Foley, V.M., Dowd, C.A., 2001. Structure, function and evolution of glutathione transferases: implications for classification of non- mammalian members of an ancient enzyme superfamily. Biochem. J. 360, 1-16. Solon-Biet, S.M., McMahon, A.C., Ballard, J.W.O., Ruohonen, K., Wu, L.E., Cogger, V.C., Warren, A., Huang, X., Pichaud, N., Melvin, R.G., Gokarn, R., Khalil, M., Turner, N., Cooney, G.J., Sinclair, D.A., Raubenheimer, D., Le Couteur, D.G., Simpson, S.J., 2014. The ratio of macronutrients, not caloric intake, dictates cardiometabolic health, aging, and longevity in ad libitum-fed mice. Cell Metab. 19, 418-430. Solon-Biet, S.M., Mitchell, S.J., Coogan, S.C., Cogger, V.C., Gokarn, R., McMahon, A.C., Raubenheimer, D., de Cabo, R., Simpson, S.J., Le Couteur, D.G., 2015. Dietary protein to carbohydrate ratio and caloric restriction: comparing metabolic outcomes in mice. Cell Rep. 11, 1529-1534. Sun, X., Komatsu, T., Lim, J., Laslo, M., Yolitz, J., Wang, C., Poirier, L., Alberico, T., Zou, S., 2012. Nutrient-dependent requirement for SOD1 in lifespan extension by protein restriction in Drosophila melanogaster. Aging cell 11, 783-793. Tapia, P.C., 2006. Sublethal mitochondrial stress with an attendant stoichiometric augmentation of reactive oxygen species may precipitate many of the beneficial alterations in cellular physiology produced by caloric restriction, intermittent fasting, exercise and dietary phytonutrients: "Mitohormesis" for health and vitality. Med. Hypotheses 66, 832-843. Teske, P.R., Golla, T.R., Sandoval-Castillo, J., Emami-Khoyi, A., van der Lingen, C.D., von der Heyden, S., Chiazzari, B., Jansen van Vuuren, B., Beheregaray, L.B., 2018. Mitochondrial DNA is unsuitable to test for isolation by distance. Sci. Rep. 8, 8448. Towarnicki, S.G., Ballard, J.W.O., 2017. Drosophila mitotypes determine developmental time in a diet and temperature dependent manner. J. Insect Physiol. 100, 133-139. Vargas, M.A., Luo, N., Yamaguchi, A., Kapahi, P., 2010. A role for S6 kinase and serotonin in postmating dietary switch and balance of nutrients in D. melanogaster. Curr. Biol. 20, 1006-1011. Vontas, J.G., Small, G.J., Hemingway, J., 2001. Glutathione S-transferases as antioxidant defence agents confer pyrethroid resistance in Nilaparvata lugens. Biochem. J. 357, 65-72. Westendorp, R.G., Kirkwood, T.B., 1998. Human longevity at the cost of reproductive success. Nature 396, 743-746. Wolff, J.N., Ladoukakis, E.D., Enriquez, J.A., Dowling, D.K., 2014. Mitonuclear interactions: evolutionary consequences over multiple biological scales. Philos. Trans. R. Soc. Lond. B. Biol. Sci. 369, 20130443.

161 Wu, Q., Zhang, Y., Xu, J., Shen, P., 2005. Regulation of hunger-driven behaviors by neural ribosomal S6 kinase in Drosophila. Proc. Natl. Acad. Sci. U. S. A. 102, 13289-13294. Yu, G., Xiang, H., Tian, J., Yin, J., Pinkert, C.A., Li, Q., Zhao, X., 2015. Mitochondrial haplotypes influence metabolic traits in porcine transmitochondrial cybrids. Sci. Rep. 5, 13118. Zhang, J., Little, C.J., Tremmel, D.M., Yin, J.C., Wesley, C.S., 2013. Notch-inducible hyperphosphorylated CREB and its ultradian oscillation in long-term memory formation. J. Neurosci. 33, 12825-12834. Zhao, H.W., Zhou, D., Haddad, G.G., 2011. Antimicrobial peptides increase tolerance to oxidant stress in Drosophila melanogaster. J. Biol. Chem. 286, 6211-6218. Zhu, C.-T., Ingelmo, P., Rand, D.M., 2014. G*G*E for lifespan in Drosophila: mitochondrial, nuclear, and dietary interactions that modify longevity. PLoS Genet 10, e1004354.

162 Chapter 6 References

Affourtit, C., Brand, M.D., 2005. Stronger control of ATP/ADP by proton leak in pancreatic β-cells than skeletal muscle mitochondria. Biochem J 393, 151-159. Angilletta Jr, M.J., Steury, T.D., Sears, M.W., 2004. Temperature, growth rate, and body size in ectotherms: fitting pieces of a life-history puzzle. Intergr Comp Biol 44, 498-509. Aw, W.C., Towarnicki, S.G., Melvin, R.G., Youngson, N.A., Garvin, M.R., Hu, Y., Nielsen, S., Thomas, T., Pickford, R., Bustamante, S., Vila-Sanjurjo, A., Smyth, G., Ballard, J.W.O., 2018. Genotype to phenotype: Diet-by-mitochondrial DNA haplotype interactions drive metabolic flexibility and organismal fitness. PLoS Genet 14, e1007735. Bajracharya, R., Ballard, J.W.O., 2016. Low protein to carbohydrate ratio diet delays onset of Parkinsonism like phenotype in Drosophila melanogaster parkin null mutants. Mech Ageing Dev 160, 19-27. Bazil, J.N., Beard, D.A., Vinnakota, K.C., 2016. Catalytic coupling of oxidative phosphorylation, ATP demand, and reactive oxygen species generation. Biophys J 110, 962-971. Bednarova, A., Kodrik, D., Krishnan, N., 2015. Knockdown of adipokinetic hormone synthesis increases susceptibility to oxidative stress in Drosophila--a role for dFoxO? Comp Biochem Physiol C Toxicol Pharmacol 171, 8-14. Biancini, G.B., Moura, D.J., Manini, P.R., Faverzani, J.L., Netto, C.B., Deon, M., Giugliani, R., Saffi, J., Vargas, C.R., 2015. DNA damage in Fabry patients: An investigation of oxidative damage and repair. Mutat Res Genet Toxicol Environ Mutagen 784-785, 31-36. Boivin, T., d'Hieres, C.C., Bouvier, J.C., Beslay, D., Sauphanor, B., 2001. Pleiotropy of insecticide resistance in the codling moth, Cydia pomonella. Entomol Exp Appl 99, 381-386. Brand, M.D., Nicholls, D.G., 2011. Assessing mitochondrial dysfunction in cells. Biochem J 435, 297-312. Brun, S., Vidal, S., Spellman, P., Takahashi, K., Tricoire, H., Lemaitre, B., 2006. The MAPKKK Mekk1 regulates the expression of Turandot stress genes in response to septic injury in Drosophila. Genes Cells 11, 397-407. Calvo, D., Molina, J.M., 2005. Fecundity–body size relationship and other reproductive aspects of Streblote panda (Lepidoptera: Lasiocampidae). Ann Entomol Soc Am 98, 191-196. Camus, M.F., Clancy, D.J., Dowling, D.K., 2012. Mitochondria, maternal inheritance, and male aging. Curr Biol 22, 1717-1721. Chauhan, V., Chauhan, A., 2016. Effects of methylmercury and alcohol exposure in Drosophila melanogaster: Potential risks in neurodevelopmental disorders. Int J Dev Neurosci 51, 36-41. Chen, W., Hardy, P., Wilce, P.A., 1997. Differential expression of mitochondrial NADH dehydrogenase in ethanol-treated rat brain: revealed by differential display. Alcohol Clin Exp Res 21, 1053-1056. Cheng, J., Nanayakkara, G., Shao, Y., Cueto, R., Wang, L., Yang, W.Y., Tian, Y., Wang, H., Yang, X., 2017. Mitochondrial proton leak plays a critical role in pathogenesis of cardiovascular diseases. Adv Exp Med Biol 982, 359-370. Cherry, S., Silverman, N., 2006. Host-pathogen interactions in Drosophila: new tricks from an old friend. Nat Immunol 7, 911.

163 Chung, P.P., Ballard, J.W.O., Hyne, R.V., 2013. Differential survival and reproductive performance across three mitochondrial lineages in Melita plumulosa following naphthalene exposure. Chemosphere 93, 1064-1069. Circu, M.L., Aw, T.Y., 2010. Reactive oxygen species, cellular redox systems, and apoptosis. Free Radic Biol Med 48, 749-762. Clancy, D.J., 2008. Variation in mitochondrial genotype has substantial lifespan effects which may be modulated by nuclear background. Aging Cell 7, 795-804. Clancy, D.J., Kennington, W.J., 2001. A simple method to achieve consistent larval density in bottle cultures. Drosoph Inf Serv 84, 168-169. Clark, A.G., Fucito, C.D., 1998. Stress tolerance and metabolic response to stress in Drosophila melanogaster. Heredity 81, 514-527. Clarke, N., Routledge, E.J., Garner, A., Casey, D., Benstead, R., Walker, D., Watermann, B., Gnass, K., Thomsen, A., Jobling, S., 2009. Exposure to treated sewage effluent disrupts reproduction and development in the seasonally breeding ramshorn snail (Subclass: Pulmonata, Planorbarius corneus). Environ Sci Technol 43, 2092-2098. Colicino, E., Power, M.C., Cox, D.G., Weisskopf, M.G., Hou, L., Alexeeff, S.E., Sanchez-Guerra, M., Vokonas, P., Spiro, A., 3rd, Schwartz, J., Baccarelli, A.A., 2014. Mitochondrial haplogroups modify the effect of black carbon on age- related cognitive impairment. Environ Health 13, 42. Correa, C.C., Aw, W.C., Melvin, R.G., Pichaud, N., Ballard, J.W.O., 2012. Mitochondrial DNA variants influence mitochondrial bioenergetics in Drosophila melanogaster. Mitochondrion 12, 459-464. Courgeon, A.-M., Maingourd, M., Maisonhaute, C., Montmory, C., Rollet, E., Tanguay, R.M., Best-Belpomme, M., 1993. Effect of hydrogen peroxide on cytoskeletal proteins of Drosophila cells: comparison with heat shock and other stresses. Exp Cell Res 204, 30-37. D'Autréaux, B., Toledano, M.B., 2007. ROS as signalling molecules: mechanisms that generate specificity in ROS homeostasis. Nat Rev Cell Biol 8, 813-824. De Moed, G.H., Kruitwagen, C.L.J.J., De Jong, G., Scharloo, W., 1999. Critical weight for the induction of pupariation in Drosophila melanogaster: genetic and environmental variation. J Evol Bio 12, 852-858. Duan, Y., Guttman, S.I., Oris, J.T., Bailer, A.J., 2001. Differential survivorship among allozyme genotypes of Hyalella azteca exposed to cadmium, zinc or low pH. Aquat Toxicol 54, 15-28. Duttaroy, A., Paul, A., Kundu, M., Belton, A., 2003. A Sod2 null mutation confers severely reduced adult life span in Drosophila. Genetics 165, 2295-2299. Fang, F.C., 2011. Antimicrobial actions of reactive oxygen species. MBio 2, e00141- 00111. Fedorova, M., Bollineni, R.C., Hoffmann, R., 2014. Protein carbonylation as a major hallmark of oxidative damage: update of analytical strategies. Mass Spectrom Rev 33, 79-97. Feng, Y., Wu, Q., Xu, B., Wang, S., Chang, X., Xie, W., Zhang, Y., 2009. Fitness costs and morphological change of laboratory‐selected thiamethoxam resistance in the B‐type Bemisia tabaci (Hemiptera: Aleyrodidae). J Appl Entamol 133, 466-472. Filograna, R., Godena, V.K., Sanchez-Martinez, A., Ferrari, E., Casella, L., Beltramini, M., Bubacco, L., Whitworth, A.J., Bisaglia, M., 2016. Superoxide Dismutase (SOD)-mimetic M40403 Is protective in cell and fly models of paraquat toxicity: implications for Parkinson disease. J Biol Chem 291, 9257-9267.

164 Flagg, R.O., 1988. Carolina Drosophila Manual. Carolina Biological Supply Company Burlington. Fruehauf, J.P., Meyskens, F.L., 2007. Reactive oxygen species: a breath of life or death? Clin Cancer Res 13, 789-794. Gibson, J.B., May, T.W., Wilks, A.V., 1981. Genetic variation at the alcohol dehydrogenase locus in Drosophila melanogaster in relation to environmental variation: Ethanol levels in breeding sites and allozyme frequencies. Oecologia 51, 191-198. Grimm, S., Hohn, A., Grune, T., 2012. Oxidative protein damage and the proteasome. Amino Acids 42, 23-38. Hamby-Mason, R., Chen, J.J., Schenker, S., Perez, A., Henderson, G.I., 1997. Catalase mediates acetaldehyde formation from ethanol in fetal and neonatal rat brain. Alcohol Clin Exp Res 21, 1063-1072. Heliovaara, K., Vaisanen, R., Kemppi, E., 1989. Change of pupal size of Panolis flammea (Lepidoptera; Noctuidae) and Bupalus piniarius (Geometridae) in response to concentration of industrial pollutants in their food plant. Oecologia 79, 179-183. Hoffmann, A.A., Hallas, R., Sinclair, C., Partridge, L., 2001. Rapid loss of stress resistance in Drosophila melanogaster under adaptation to laboratory culture. Evolution 55, 436-438. Hoffmann, A.A., Parsons, P.A., 1984. Olfactory response and resource utilization in Drosophila: Interspecific comparisons. Biol J Linn Soc 22, 45-53. Hu, Y., Sopko, R., Foos, M., Kelley, C., Flockhart, I., Ammeux, N., Wang, X., Perkins, L., Perrimon, N., Mohr, S.E., 2013. FlyPrimerBank: an online database for Drosophila melanogaster gene expression analysis and knockdown evaluation of RNAi reagents. G3 (Bethesda) 3, 1607-1616. Jaeschke, H., Ramachandran, A., 2018. Oxidant stress and lipid peroxidation in acetaminophen hepatotoxicity. React Oxyg Species 5, 145-158. Jerrells, T.R., Smith, W., Eckardt, M.J., 1990. Murine model of ethanol‐induced immunosuppression. Alcohol Clin Exp Res 14, 546-550. Jing, H., Liu, H., Zhang, L., Gao, J., Song, H., Tan, X., 2018. Ethanol induces autophagy regulated by mitochondrial ROS in Saccharomyces cerevisiae. J Microbiol Biotechnol 28, 1982-1991. Kingsolver, J.G., Huey, R.B., 2008. Size, temperature, and fitness: three rules. Evol Ecol 10, 251-268. Kliot, A., Ghanim, M., 2012. Fitness costs associated with insecticide resistance. Pest Manag Sci 68, 1431-1437. Kodrik, D., Bednarova, A., Zemanova, M., Krishnan, N., 2015. Hormonal regulation of response to oxidative stress in insects-an update. Int J Mol Sci 16, 25788-25816. Komata, S., Lin, C.P., Sota, T., 2018. Do juvenile developmental and adult body characteristics differ among genotypes at the doublesex locus that controls female-limited Batesian mimicry polymorphism in Papilio memnon?: A test for the "cost of mimicry" hypothesis. J. Insect. Physiol. 107, 1-6. Kong, E.C., Allouche, L., Chapot, P.A., Vranizan, K., Moore, M.S., Heberlein, U., Wolf, F.W., 2010. Ethanol‐regulated genes that contribute to ethanol sensitivity and rapid tolerance in Drosophila. Alcohol Clin Exp Res 34, 302-316. Korshunov, S.S., Skulachev, V.P., Starkov, A.A., 1997. High protonic potential actuates a mechanism of production of reactive oxygen species in mitochondria. FEBS Lett 416, 15-18.

165 Lemaitre, B., Nicolas, E., Michaut, L., Reichhart, J.M., Hoffmann, J.A., 1996. The dorsoventral regulatory gene cassette spatzle/Toll/cactus controls the potent antifungal response in Drosophila adults. Cell 86, 973-983. Lindsley, D.L., 1968. Genetic variations of Drosophila melanogaster. Carnegie Inst 627. Logan-Garbisch, T., Bortolazzo, A., Luu, P., Ford, A., Do, D., Khodabakhshi, P., French, R.L., 2015. Developmental ethanol exposure leads to dysregulation of lipid metabolism and oxidative stress in Drosophila. G3 (Bethesda) 5, 49-59. Maimon, I., Gilboa, L., 2011. Dissection and staining of Drosophila larval ovaries. J Vis Exp, 2537. Marcinek, D.J., Schenkman, K.A., Ciesielski, W.A., Lee, D., Conley, K.E., 2005. Reduced mitochondrial coupling in vivo alters cellular energetics in aged mouse skeletal muscle. J Physiol 569, 467-473. Melvin, R.G., Ballard, J.W.O., 2006. Intraspecific variation in survival and mitochondrial oxidative phosphorylation in wild-caught Drosophila simulans. Aging Cell 5, 225-233. Mitterbock, F., Fuhrer, E., 1988. Effects of Fluoride-Polluted Spruce Leaves on Nun Moth Caterpillars (Lymantria-Monacha). J Appl Entamol 105, 19-27. Mpho, M., Callaghan, A., Holloway, G.J., 2002. Temperature and genotypic effects on life history and fluctuating asymmetry in a field strain of Culex pipiens. Heredity (Edinb) 88, 307-312. Neckameyer, W.S., Nieto-Romero, A.R., 2015. Response to stress in Drosophila is mediated by gender, age and stress paradigm. Stress 18, 254-266. Nicholls, D.G., 2004. Mitochondrial membrane potential and aging. Aging cell 3, 35- 40. Niveditha, S., Deepashree, S., Ramesh, S.R., Shivanandappa, T., 2017. Sex differences in oxidative stress resistance in relation to longevity in Drosophila melanogaster. J Comp Physiol B 187, 899-909. Parsons, P.A., 1977. Larval reaction to alcohol as an indicator of resource utilization differences between Drosophila melanogaster and D. simulans. Oecologia 30, 141-146. Phillips, J.P., Campbell, S.D., Michaud, D., Charbonneau, M., Hilliker, A.J., 1989. Null mutation of copper/zinc superoxide dismutase in Drosophila confers hypersensitivity to paraquat and reduced longevity. Proc Natl Acad Sci U. S. A. 86, 2761-2765. Polak, M., Kroeger, D.E., Cartwright, I.L., Ponce deLeon, C., 2004. Genotype-specific responses of fluctuating asymmetry and of preadult survival to the effects of lead and temperature stress in Drosophila melanogaster. Environ Pollut 127, 145-155. Qiu, S., Xiao, C., Meldrum Robertson, R., 2017. Different age-dependent performance in Drosophila wild-type Canton-S and the white mutant w1118 flies. Comp Biochem Physiol A Mol Integr Physiol 206, 17-23. Quiring, D.T., McNeil, J.N., 1984. Influence of intraspecific larval competition and mating on the longevity and reproductive performance of females of the leaf miner Agrornyza frontella (Rondani) (Diptera: Agromyzidae). Can J Zool 62, 2197-2200. Redza-Dutordoir, M., Averill-Bates, D.A., 2016. Activation of apoptosis signalling pathways by reactive oxygen species. Biochim Biophys Acta 1863, 2977-2992.

166 Ringwood, A.H., Levi-Polyachenko, N., Carroll, D.L., 2009. Fullerene exposures with oysters: embryonic, adult, and cellular responses. Environ Sci Technol 43, 7136- 7141. Ristow, M., Schmeisser, K., 2014. Mitohormesis: Promoting health and lifespan by increased levels of reactive oxygen species (ROS). Dose Response 12, 288-341. Ristow, M., Zarse, K., 2010. How increased oxidative stress promotes longevity and metabolic health: The concept of mitochondrial hormesis (mitohormesis). Exp Gerontol 45, 410-418. Sakamuru, S., Attene-Ramos, M.S., Xia, M., 2016. Mitochondrial membrane potential assay, High-Throughput Screening Assays in Toxicology. Springer, pp. 17-22. Schieber, M., Chandel, N.S., 2014. TOR signaling couples oxygen sensing to lifespan in C. elegans. Cell Rep 9, 9-15. Schizas, N.V., Chandler, G.T., Coull, B.C., Klosterhaus, S.L., Quattro, J.M., 2001. Differential survival of three mitochondrial lineages of a marine benthic copepod exposed to a pesticide mixture. Environ Sci Technol 35, 535-538. Scott, T.L., Rangaswamy, S., Wicker, C.A., Izumi, T., 2014. Repair of oxidative DNA damage and cancer: recent progress in DNA base excision repair. Antioxid Redox Signal 20, 708-726. Service, P., Hutchinson, E., MacKinley, M., Rose, M., 1985. Resistance to environmental stress in Drosophila melanogaster selected for postponed senescence. Physiol Zool 58, 380-389. Shadel, G.S., Horvath, T.L., 2015. Mitochondrial ROS signaling in organismal homeostasis. Cell 163, 560-569. Sheehan, D., Meade, G., Foley, V.M., Dowd, C.A., 2001. Structure, function and evolution of glutathione transferases: implications for classification of non- mammalian members of an ancient enzyme superfamily. Biochem J 360, 1-16. Shia, A.K., Glittenberg, M., Thompson, G., Weber, A.N., Reichhart, J.M., Ligoxygakis, P., 2009. Toll-dependent antimicrobial responses in Drosophila larval fat body require Spatzle secreted by haemocytes. J Cell Sci 122, 4505-4515. Shirpoor, A., Salami, S., Khadem-Ansari, M.H., Minassian, S., Yegiazarian, M., 2009. Protective effect of vitamin E against ethanol-induced hyperhomocysteinemia, DNA damage, and atrophy in the developing male rat brain. Alcohol Clin Exp Res 33, 1181-1186. Simon, H.-U., Haj-Yehia, A., Levi-Schaffer, F., 2000. Role of reactive oxygen species (ROS) in apoptosis induction. Apoptosis 5, 415-418. Skulachev, V.P., 1996. Role of uncoupled and non-coupled oxidations in maintenance of safely low levels of oxygen and its one-electron reductants. Q Rev Biophys 29, 169-202. Spooner, R., Yilmaz, O., 2011. The role of reactive-oxygen-species in microbial persistence and inflammation. Int J Mol Sci 12, 334-352. Stone, J.R., Yang, S., 2006. Hydrogen peroxide: a signaling messenger. Antioxid Redox Signal 8, 243-270. Suski, J.M., Lebiedzinska, M., Bonora, M., Pinton, P., Duszynski, J., Wieckowski, M.R., 2012. Relation between mitochondrial membrane potential and ROS formation. Methods Mol Biol 810, 183-205. Sykiotis, G.P., Bohmann, D., 2008. Keap1/Nrf2 signaling regulates oxidative stress tolerance and lifespan in Drosophila. Dev Cell 14, 76-85. Tal, M.C., Sasai, M., Lee, H.K., Yordy, B., Shadel, G.S., Iwasaki, A., 2009. Absence of autophagy results in reactive oxygen species-dependent amplification of RLR signaling. Proc Natl Acad Sci U. S. A. 106, 2770-2775.

167 Towarnicki, S.G., Ballard, J.W.O., 2017. Drosophila mitotypes determine developmental time in a diet and temperature dependent manner. J Insect Physiol 100, 133-139. Vives-Bauza, C., Gonzalo, R., Manfredi, G., Garcia-Arumi, E., Andreu, A.L., 2006. Enhanced ROS production and antioxidant defenses in cybrids harbouring mutations in mtDNA. Neurosci Lett 391, 136-141. Wang, Q., Shi, G., Song, D., Rogers, D.J., Davis, L.K., Chen, X., 2002. Development, survival, body weight, longevity, and reproductive potential of Oemena hirta (Coleoptera: Cerambycidae) under different rearing conditions. J Econ Entomol 95, 563-569. Warrington, S., 1987. Relationship between SO2 dose and growth of the pea aphid, Acyrthosiphon pisum, on peas. Environ Pollut 43, 155-162. Wentzel, P., Eriksson, U.J., 2006. Ethanol-induced fetal dysmorphogenesis in the mouse is diminished by high antioxidative capacity of the mother. Toxicol Sci 92, 416-422. Wentzel, P., Rydberg, U., Eriksson, U.J., 2006. Antioxidative treatment diminishes ethanol-induced congenital malformations in the rat. Alcohol Clin Exp Res 30, 1752-1760. West, A.P., Brodsky, I.E., Rahner, C., Woo, D.K., Erdjument-Bromage, H., Tempst, P., Walsh, M.C., Choi, Y., Shadel, G.S., Ghosh, S., 2011a. TLR signalling augments macrophage bactericidal activity through mitochondrial ROS. Nature 472, 476. West, A.P., Khoury-Hanold, W., Staron, M., Tal, M.C., Pineda, C.M., Lang, S.M., Bestwick, M., Duguay, B.A., Raimundo, N., MacDuff, D.A., 2015. Mitochondrial DNA stress primes the antiviral innate immune response. Nature 520, 553. West, A.P., Shadel, G.S., Ghosh, S., 2011b. Mitochondria in innate immune responses. Nat Rev Immuno 11, 389. Williams, M.J., 2007. Drosophila hemopoiesis and cellular immunity. J Immunol 178, 4711-4716. Wittkopp, S., Staimer, N., Tjoa, T., Gillen, D., Daher, N., Shafer, M., Schauer, J.J., Sioutas, C., Delfino, R.J., 2013. Mitochondrial genetic background modifies the relationship between traffic-related air pollution exposure and systemic biomarkers of inflammation. PLoS One 8, e64444. Yadav, P., Sharma, V.K., 2014. Correlated changes in life history traits in response to selection for faster pre-adult development in the fruit fly Drosophila melanogaster. J Exp Biol 217, 580-589. Yan, S., Sorrell, M., Berman, Z., 2014. Functional interplay between ATM/ATR- mediated DNA damage response and DNA repair pathways in oxidative stress. Cell Mol Life Sci 71, 3951-3967. Yun, J., Finkel, T., 2014. Mitohormesis. Cell metab 19, 757-766. Zarse, K., Schmeisser, S., Groth, M., Priebe, S., Beuster, G., Kuhlow, D., Guthke, R., Platzer, M., Kahn, C.R., Ristow, M., 2012. Impaired insulin/IGF1 signaling extends life span by promoting mitochondrial L-proline catabolism to induce a transient ROS signal. Cell Metab 15, 451-465. Zhang, J., Xie, Z., Wang, Z., 2016. Oxidative stress responses and toxin accumulation in the freshwater snail Radix swinhoei (Gastropoda, Pulmonata) exposed to microcystin-LR. Environ Sci Pollut Res Int 23, 1353-1361.

168 Zhu, C.T., Ingelmo, P., Rand, D.M., 2014. GxGxE for lifespan in Drosophila: mitochondrial, nuclear, and dietary interactions that modify longevity. PLoS Genet 10, e1004354. Zorov, D.B., Filburn, C.R., Klotz, L.O., Zweier, J.L., Sollott, S.J., 2000. Reactive oxygen species (ROS)-induced ROS release: a new phenomenon accompanying induction of the mitochondrial permeability transition in cardiac myocytes. J Exp Med 192, 1001-1014. Zorov, D.B., Juhaszova, M., Sollott, S.J., 2014. Mitochondrial reactive oxygen species (ROS) and ROS-induced ROS release. Physiol Rev 94, 909-950. Zorova, L.D., Popkov, V.A., Plotnikov, E.Y., Silachev, D.N., Pevzner, I.B., Jankauskas, S.S., Babenko, V.A., Zorov, S.D., Balakireva, A.V., Juhaszova, M., 2018. Mitochondrial membrane potential. Anal Biochem 552, 50-59.

169 Chapter 7 references

Aw, W.C., Towarnicki, S.G., Melvin, R.G., Youngson, N.A., Garvin, M.R., Hu, Y., Nielsen, S., Thomas, T., Pickford, R., Bustamante, S., 2018. Genotype to phenotype: Diet-by-mitochondrial DNA haplotype interactions drive metabolic flexibility and organismal fitness. PLoS Genetics 14, e1007735. Ballard, J.W.O., Whitlock, M.C., 2004. The incomplete natural history of mitochondria. Mol Eco13, 729-744. Ballard, J.W.O., Youngson, N.A., 2015. Review: can diet influence the selective advantage of mitochondrial DNA haplotypes? Biosci Rep 35. Camus, M.F., Wolff, J.N., Sgro, C.M., Dowling, D.K., 2017. Experimental support that natural selection has shaped the latitudinal distribution of mitochondrial haplotypes in Australian Drosophila melanogaster. Mol Biol Evol 34, 2600-2612. Craven, L., Tuppen, H.A., Greggains, G.D., Harbottle, S.J., Murphy, J.L., Cree, L.M., Murdoch, A.P., Chinnery, P.F., Taylor, R.W., Lightowlers, R.N., 2010. Pronuclear transfer in human embryos to prevent transmission of mitochondrial DNA disease. Nature 465, 82. Dimond, R., Stephens, N., 2018. Three persons, three genetic contributors, three parents: Mitochondrial donation, genetic parenting and the immutable grammar of the ‘three x x’. Health 22, 240-258. Dos Reis, M., Donoghue, P.C., Yang, Z., 2016. Bayesian molecular clock dating of species divergences in the genomics era. Nature Rev Genet 17, 71. Gammage, P.A., Moraes, C.T., Minczuk, M., 2018. Mitochondrial genome engineering: the revolution may not be CRISPR-Ized. Trends Genet 34, 101-110. Jenuth, J.P., Peterson, A.C., Shoubridge, E.A., 1997. Tissue-specific selection for different mtDNA genotypes in heteroplasmic mice. Nature Genet 16, 93. Miller, J.C., Holmes, M.C., Wang, J., Guschin, D.Y., Lee, Y.-L., Rupniewski, I., Beausejour, C.M., Waite, A.J., Wang, N.S., Kim, K.A., 2007. An improved zinc- finger nuclease architecture for highly specific genome editing. Nat Biotechnol 25, 778. Morel, F., Renoux, M., Lachaume, P., Alziari, S., 2008. Bleomycin-induced double- strand breaks in mitochondrial DNA of Drosophila cells are repaired. Mut Res Fund Mol Mech Mutagen 637, 111-117. Mossman, J.A., Jennifer, Y.G., Navarro, F., Rand, D.M., 2019. Mitochondrial DNA fitness depends on nuclear genetic background in Drosophila. G3 9, 1175-1188. Ran, F.A., Hsu, P.D., Wright, J., Agarwala, V., Scott, D.A., Zhang, F., 2013. Genome engineering using the CRISPR-Cas9 system. Nat Protoc 8, 2281. Reinhardt, K., Dowling, D.K., Morrow, E.H., 2013. Mitochondrial replacement, evolution, and the clinic. Science 341, 1345-1346. Remacle, C., Cardol, P., Coosemans, N., Gaisne, M., Bonnefoy, N., 2006. High- efficiency biolistic transformation of Chlamydomonas mitochondria can be used to insert mutations in complex I genes. Proc Natl Acad Sci U. S. A. 103, 4771- 4776. Xu, H., DeLuca, S.Z., O'farrell, P.H., 2008. Manipulating the metazoan mitochondrial genome with targeted restriction enzymes. Science 321, 575-577.

170 Appendices

171 Chapter 2 supplementary material

App. 2-1. Feeding rate of D. melanogaster lines Alst;w1118 and Dah;w1118 fed 1:12 P:C diet at three temperatures (19 °C, 23 °C, and 27 °C). Bars indicate amount of dye labelled food consumed in 1 hour ± SE. No significant differences were detected.

172 App. 2-2. Mitochondrial DNA differences between the Alstonville and Dahomey mitotypes aligned to the consensus D. melanogaster mtDNA sequence (accession numbers: KP843842, KP843845, and U37541.1 respectively) using MUSCLE (Edgar, 2004). Position of Amino

Acid/SNP’s reported from start of each gene/RNA transcript. (A) Nonsynonymous mutations in Dahomey. (B) Ribosomal RNA mutations (C)

Synonymous mutations, and (D) A+T-rich mutations.

† Indicates that the genes are present on the minor strand, and ● indicates that the sequence is the same as the consensus.

(A) ND4 ATP6 COXIII Position 480 † 554 117 Consensus Val Met Asp Alstonville ● ● ● Dahomey Leu Ile Asn 16S (B) 12S rRNA rRNA Position 497† 78† 240† Consensus G A A Alstonville ● U G Dahomey A ● ● (C) COX1 CYTB ND1 Position 38 362 183 278† 527† Consensus T A C G A

173 Alstonville ● G T ● G Dahomey C ● ● A ●

(D) Type 1 Repeat

2146 2213 2343

Position 2145

143 205 234 319 364 484 725 994 1062 1063 1096 1157 1389 1512 1521 1544 1545 1679 1681 1843 2025 2027

Consensus A A A T T T T T A T T G C A A T A - T G - T T G A G Alstonville T ● T A ● A ● ● T A A ● ● T G ● ● T A ● A ● ● ● ● A Dahomey ● T ● ● A ● C A ● ● ● A T ● ● A G A ● A T A A A T ● Central T Stretch Type 2 Repeat

Position

2490 2492 2782 2809 3158 3239 3240 3247 3248 3461 3627 3634 3697 3699 3705 3706 3707 3926 4171 4181 4206 4322 4447 4448

Consensus T A A T C T T - - G G A C A - T T G - T T G T A Alstonville A T ● A A A A T T ● T ● ● ● T ● ● C A ● ● ● A T

Dahomey ● ● T ● ● ● ● A A A ● T T T A A A ● T A A A ● ●

174 Chapter 4 supplementary material

App. 4-1: Glucose-6-phosphate dehydrogenase (G6PD) activity.

Activity was determined spectrophotometrically from the rate of reduction of NADP (n

= 8 biological rep/mitotype). Bars (mean ± s.e.m). * p< 0.05, as calculated by t-tests

(see text).

175

Chapter 6 Supplementary material

App. 6-1: Time to pupation of Dah; w1118 and Alst; w1118 fed diets containing (A) ethanol and (B) H2O2. In comparison to the control a significant flip in development time of the two mitotypes was identified at concentrations of 2% ethanol and 2.5 mM

H2O2. Above the bars * indicates p < 0.05, ** indicates p < 0.01, *** indicates p <

0.001 as determined by post-hoc t-tests.

176

1118 App. 6-2: Ethanol and H2O2 levels in larval haemolymph. Both Dah; w and Alst;

1118 w larvae fed the diet supplemented with ethanol (A) or H2O2 (B) had in their haemolymph significantly higher levels of ethanol (t22= 11.28, p < 0.001), or

H2O2 (t22= 8.08, p < 0.001), respectively, as compared with larvae fed the control diet.

177