The Yeast Heterochromatin Protein Sir3 Experienced Functional Changes in the AAA+ Domain After Gene Duplication and Subfunctionalization

Genetics: Early Online, published on August 21, 2017 as 10.1534/genetics.117.300180

The yeast heterochromatin protein Sir3 experienced functional changes in the AAA+ domain after gene duplication and subfunctionalization

Ashleigh S. Hanner* and Laura N. Rusche*1

*Department of Biological Sciences, State University of New York at Buffalo, 14260

Key Words: Gene Silencing, Escape from Adaptive Conflict (EAC), Gene Sharing

Corresponding author:

1. Laura N. Rusche

[email protected]

716‐645‐5198

109 Cooke Hall

Buffalo, NY 14260

ABSTRACT

A key unresolved issue in molecular evolution is how paralogs diverge after gene duplication. For multifunctional genes, duplication is often followed by subfunctionalization.

Subsequently, new or optimized molecular properties may evolve once the protein is no longer constrained to achieve multiple functions. A potential example of this process is the evolution of the yeast heterochromatin protein Sir3, which arose by duplication from the conserved DNA replication protein Orc1. We previously found that Sir3 subfunctionalized after duplication. In this study, we investigated whether Sir3 evolved new or optimized properties after subfunctionalization. This possibility is supported by our observation that non‐duplicated

Orc1/Sir3 proteins from three species were unable to complement a sir3Δ mutation in

Saccharomyces cerevisiae. To identify regions of Sir3 that may have evolved new properties, we created chimeric proteins of ScSir3 and non‐duplicated Orc1 from Kluyveromyces lactis. We identified the AAA+ base subdomain of KlOrc1 as insufficient for heterochromatin formation in

S. cerevisiae. In Orc1, this subdomain is intimately associated with other ORC subunits, enabling

ATP hydrolysis. In Sir3, this subdomain binds Sir4 and perhaps nucleosomes. Our data are inconsistent with the insufficiency of KlOrc1 resulting from its ATPase activity or an inability to bind ScSir4. Thus, once Sir3 was no longer constrained to assemble into the ORC complex, its heterochromatin‐forming potential evolved through changes in the AAA+ base subdomain.

INTRODUCTION

Gene duplication is a fundamental mechanism through which genetic diversity increases. A common outcome of gene duplication is subfunctionalization, in which the functions of an ancestral gene are partitioned between the duplicates. Several theoretical models describe subfunctionalization and differ with respect to whether new or specialized functions emerge after subfunctionalization. Models including Duplication‐Degeneration‐

Complementation (DDC) (Force et al., 1999) and Constructive Neutral Evolution (Stoltzfus,

1999) describe a situation in which no new function arises. In this scenario, the duplicate genes acquire complementary inactivating mutations, such that they each perform a subset of the ancestral functions. Other models, such as Escape from Adaptive Conflict (EAC) (Hittinger and

Carroll, 2007) and Gene Sharing (Hughes, 1994) describe a situation in which new or enhanced function does arise. In this scenario, the ancestral gene cannot optimize any one of its functions without disrupting the others. However, after duplication and subfunctionalization, the duplicate genes escape this conflict and can acquire optimizing mutations. To gain insight into gene fate after subfunctionalization, we have examined the yeast genes ORC1 and SIR3, a duplicate pair that arose during a whole‐genome duplication and for which there is extensive functional and structural information.

Orc1 is a conserved eukaryotic protein required for DNA replication. It is the largest subunit of the Origin Recognition Complex (ORC), which binds to and identifies origins of replication throughout the genome (Li and Stillman, 2012). In Saccharomyces cerevisiae, ORC also serves as a silencer‐binding protein, which recruits the SIR complex (Silent Information

Regulator) to the silenced cryptic mating‐type loci, HMRa and HMLα. In particular, the Orc1

subunit binds to Sir1 (Triolo and Sternglanz, 1996), which in turn recruits other Sir proteins to

establish a domain of repressive or “silenced” chromatin. The paralog of Orc1, Sir3, is also involved in silenced chromatin formation but has a different role. Sir3 binds to deacetylated nucleosomes (Hecht et al., 1995; Onishi et al., 2007), enabling the spreading of the SIR complex along a chromosome (Hoppe et al., 2002; Luo et al., 2002; Rusche et al., 2002). SIR‐mediated silencing occurs at the cryptic mating‐type loci, whose repression maintains haploid cell identity, and at telomeres, where this chromatin is thought to stabilize the ends of chromosomes.

Orc1 and Sir3 retain homology along their entire lengths and have three major structural domains (Figure 1). The AAA+ domain is a hallmark of the AAA+ superfamily, whose members couple ATP hydrolysis to structural rearrangements of proteins. In this family, ATP binding and hydrolysis requires amino acids from two interacting AAA+ domains. Although both

Orc1 and Sir3 contain an AAA+ domain, Sir3 lacks key amino acids required to bind ATP and has no detectable ATPase activity (Bell et al., 1995). Instead, the AAA+‐like domain in Sir3 interacts with Sir4 (Chang et al., 2003; Ehrentraut et al., 2011; King et al., 2006) and is also proposed to bind histones (Altaf et al., 2007; Ehrentraut et al., 2011; Hecht et al., 1995). A second domain is a winged helix domain, whose ancestral function is to bind DNA (Gaudier et al., 2007).

However, the winged helix domains of both Sir3 and Orc1 in S. cerevisiae lack this activity and instead are involved in homo‐dimerization (Oppikofer et al., 2013). The third domain is the N‐ terminal bromo‐adjacent homology (BAH) domain. The BAH domains of both Orc1 and Sir3 bind to nucleosomes (Armache et al., 2011; Onishi et al., 2007; Zhang et al., 2015). The BAH domain of ScOrc1 also binds to Sir1 (Hou et al., 2005; Triolo and Sternglanz, 1996). In addition to these

three structural domains, there is a rapidly evolving linker that separates the BAH domain from the AAA+ domain.

Prior work indicates that Orc1 and Sir3 subfunctionalized after duplication (Hickman and

Rusche, 2010; van Hoof, 2005). In particular, the non‐duplicated Orc1 from Kluyveromyces lactis, which serves as a proxy for the ancestral non‐duplicated protein, has both replication and silencing functions. KlOrc1 is required for transcriptional repression at heterochromatic loci, and its nucleosome‐binding BAH domain is required for spreading across these loci

(Hickman and Rusche, 2010), as seen for ScSir3. Another indication that the ancestral protein had a silencing function is that the non‐duplicated ORC1 gene from Lachancea kluyverii weakly complements a sir3Δ mutation in S. cerevisiae (van Hoof, 2005). These results imply that Orc1 was involved in heterochromatin formation before the gene duplication and therefore that subfunctionalization occurred after duplication.

Despite the role of KlOrc1 in forming heterochromatin in its native context, we found that when KlOrc1 is expressed in a S. cerevisiae sir3Δ strain, heterochromatin formation does not occur. This inability of KlOrc1 to complement a sir3Δ mutation suggests that Sir3 acquired new or optimized molecular properties after duplication. If so, Sir3 could be an example of the type of evolutionary change described by the EAC and gene sharing models. To examine this possibility, we identified the sections of KlOrc1 that are insufficient for heterochromatin formation by creating chimeric proteins composed of ScSir3 and KlOrc1. We discovered that the primary insufficiency lies in the AAA+ base subdomain. This portion of Sir3 interacts with Sir4.

However, our data are inconsistent with the insufficiency of the KlOrc1 base subdomain resulting from a failure to interact with ScSir4. Moreover, our data do not support the

possibility that the presumed ability of KlOrc1 to bind ATP interferes with heterochromatin formation in S. cerevisiae. Therefore, the AAA+ base subdomain may have acquired new or optimized molecular properties after duplication.

MATERIALS AND METHODS

Yeast strain construction and growth

The yeast strains used in this study (Table 1) were derived from W303‐1a. Yeast were grown in YM (0.67% yeast nitrogen base without amino acids, 2% glucose) or CSM‐Trp (YM supplemented with a mixture of amino acids and other nutrients but lacking tryptophan (MPBio

4512‐522)). Yeast transformation was performed using lithium acetate and PEG (Schiestl and

Gietz, 1989). Cells were harvested at an OD600 around 1, washed twice with TEL (10 mM tris, pH

7.5; 1 mM EDTA; 100 mM LiOAc), and resuspended in 10 μl TEL/ OD cells. For transformation,

100 μl of cells were added to 0.1 µg plasmid DNA or 0.1 μg of linear DNA plus 30 µg sheared salmon sperm DNA.

To express KlSir4‐HA or ScSir4‐HA in S. cerevisiae, we first generated tagging cassettes on plasmids and then used these cassettes to transform strain LRY1098. Plasmid pLR588 contains the ScSIR4 gene with a C‐terminal HA tag and downstream HIS3 marker. The original source for the 3xHA tag was pMPY‐3XHA (Schneider et al., 1995). This plasmid was altered by site‐directed mutagenesis to add a stop codon immediately after the HA tag (…DVPDYAA stop), yielding pLR522. Next, HIS3 from pRS403 (Sikorski and Hieter, 1989) was ligated into the SphI and XmaI sites of pLR522 in place of URA3, generating pLR541. The original source for the

ScSIR4 gene was pJR2027 (gift from Jasper Rine), based on vector pRS315. The 3x‐HA tag plus

HIS3 marker from pLR541 was inserted at the 3’ end of the ScSIR4 gene through homologous recombination in yeast, generating pLR588. Finally, plasmid pLR588 was modified by replacing

the open reading frame of ScSIR4 with that of KlSIR4 (KLLA0F13420g) to generate pLR1122. The tagging cassettes were isolated from both plasmids and used to transform S. cerevisiae.

Plasmid Construction

Plasmids used in this study (Table 2) were derived from pLR911, a yeast CEN/TRP1 plasmid expressing Sir3‐V5 from the ScSIR3 promoter. This plasmid was created by replacing the HA tag in pJR2299 (ScSIR3‐HA plasmid from Jasper Rine) with a V5 tag amplified from pFA6a–6×GLY–V5–hphMX4 (Funakoshi and Hochstrasser, 2009) using homologous recombination. To express Orc1 proteins from non‐duplicated species in S. cerevisiae, plasmids were constructed in which the open reading frame of ScSIR3 in pLR911 was replaced with the

ORC1 open reading frame from another species. ORC1 from Kluyveromyces lactis was isolated from plasmid pLR824 (Hickman and Rusche, 2010), ORC1 from Zygosaccharomyces rouxii was isolated from yeast strain CBS732 (Pribylova and Sychrova, 2003) and ORC1 from Lachancea kluyveri was derived from plasmid pLR0649 (van Hoof, 2005). To generate chimeric ScSIR3 and

KlORC1 genes, portions of KlORC1 were amplified from pLR824 and used to replace the homologous regions of ScSIR3 in plasmid pLR911.

Plasmids were generated either by homologous recombination in yeast or by PCR stitching. For homologous recombination, the parent plasmid, pLR911, was cut with a restriction enzyme within the region to be replaced, and a PCR product was generated containing the desired region of KlORC1 flanked by ~40 bp of ScSIR3 sequence. A sir3Δ strain

(LRY1098) was transformed with both DNA fragments (150 ng of cut plasmid and 300 ng of PCR

product), and cells containing recombined plasmids were selected on CSM‐Trp medium.

Candidate plasmids were recovered from yeast and amplified in E. coli. For PCR stitching, which is a variant of site‐directed mutagenesis, a PCR product was created in which the desired region of KlORC1 was flanked by ~25 bp of ScSIR3 sequence. This PCR product was then used as a primer to amplify and modify pLR911. The cycling parameters were 3 min at 95°C, eighteen cycles of 40 sec at 95°C, 50 sec at 62°C, and 27 min at 68°C, followed by 20 min at 68°C. The newly synthesized plasmid was recovered through E. coli after the template DNA had been digested with DpnI, which cleaves only methylated DNA. All plasmids were confirmed by sequencing.

Mating Assay

Semi‐quantitative mating assays were performed as previously described (Lynch and

Rusche, 2010) using MATα cells (LRY1098) containing a plasmid expressing the chimeric

SIR3/ORC1 genes and a selectable marker TRP1. These cells were grown to mid‐log phase, resuspended in CSM‐Trp at a density of 10 OD/ml, and diluted in a 10‐fold series in CSM‐Trp.

For the plating control, 3μl of each dilution was spotted on CSM‐Trp. For mating, an equal volume of MATa mating partner (LRY1021) was added to each dilution at a constant concentration of 10 OD/ml in YPD (1% Yeast Extract, 2% Peptone, 2% Glucose). 3μl of that mixture was spotted on YM to select for prototrophic diploids.

Immunoblotting

Immunoblots were performed as previously described (Hickman and Rusche, 2010).

Cells were grown to an OD600 of 1.0 and fixed with a final concentration of 10% TCA prior to cell

lysis. 45 OD equivalents of fixed cells were lysed by vortexing 5 minutes in the presence of silica

beads (0.5 mm dia. #11079105z, BioSpec Products) in 40 μL lysis buffer (10 mM HEPES pH 7.9,

150 mM KCl, 1.5 mM MgCl2, 0.5 mM DTT, 10% glycerol, 5 µg/ml chymostatin, 2 µg/ml pepstatin

A, 156 µg/ml benzamidine, 35.2 µg/ml TPCK, 174 µg/ml PMSF, and 1X Complete Protease

Inhibitor (Roche)). Proteins were denatured by the addition of 1/3 volume sample buffer (30%

glycerol, 15% β‐mercaptoethanol, 6% SDS, 200 mM Tris pH 6.8, 0.08 mg/mL bromophenol blue)

and incubation at 95° for 5 min. Finally, samples were clarified by centrifugation. 10 µl of protein extract was resolved on a 7.5% acrylamide gel, transferred to membrane (Amersham

45004008), and probed to detect Sir3/Orc1 chimeric proteins (anti‐V5 Millipore ab3792) or

Pgk1 (abcam ab113687) as a loading control.

RNA Isolation and cDNA Synthesis

RNA was extracted in hot phenol (Schmitt et al., 1990) from cells grown to an OD600 of

1.0 in CSM‐Trp. For cDNA synthesis, genomic DNA was removed from RNA samples in a total

volume of 30 μl containing 3 μg of RNA, DNAse buffer, and 3 units Ambion Turbo DNase

(AM2238) at 37°C for 30 minutes. The samples were then extracted with phenol/chloroform and precipitated with ethanol. cDNA was generated using the iScript Advanced cDNA Synthesis

Kit (BioRad 170‐8843). A 20 μl reaction containing 10 μl of DNase treated RNA, 1x iScript

Advanced Mix, and 1 μl iScript reverse transcriptase was incubated for 30 minutes at 42°C and then inactivated for 5 minutes at 85°C.

cDNA was quantified using a BioRad CFX384 real‐time PCR machine. The silenced genes

(HMRa1 or YFR057W) and a control gene (NTG1) were quantified relative to a standard curve prepared from genomic DNA (LRY1098 containing pLR0911). Primers are listed in Table 3. The ratio of the silenced gene to the control gene was determined for each sample. Two technical replicates (independent RNA isolations) were prepared from each of two biological replicates

(independent transformants). The ratios for all four replicate samples were averaged, and this value was normalized to the average ratio in cells expressing ScSir3‐V5.

Chromatin Immunoprecipitation

Chromatin immunoprecipitation was performed as previously described (Rusche and

Rine, 2001). Cells were grown in CSM‐Trp, harvested at an OD600 of approximately 1, and crosslinked for 30 minutes in 1% formaldehyde. For immunoprecipitation, 2 µl of anti V5 antibody (Millipore ab3792) was used. Two technical replicates (independent immunoprecipitations) were prepared from each of two biological replicates (independent transformants). The immunoprecipitated DNA was analyzed by real‐time PCR to quantify the recovery of silenced loci (HMR‐E and TelVI‐R) and a control locus (ATS1) relative to a standard curve prepared from input DNA. The ratio of the experimental locus to the control locus is represented as relative enrichment. Primers are listed in table 3.

Yeast Immunofluorescence

Immunofluorescence was performed as previously described (Keeling and Miller, 2011).

The yeast cell wall was digested with Zymolyase (10 mg/mL in 1M sorbitol/PBS) for 45 minutes at room temperature. Cells were then blocked with 5mg/ml BSA in PBS (137mM NaCl, 2.7mM

KCl, 10mM Na2HPO4, 1.8mM KH2PO4 , pH7.4) for 1 hour, incubated overnight in primary

antibody (anti‐V5, Millipore, ab3792) diluted 1:100 in PBS, and then incubated 2 hours at room temperature in secondary antibody (Cy3‐conjugated AffiniPure Goat Anti‐Rabbit IgG, Jackson

ImmunoResearch, 111‐165‐144). Finally, the cells were stained with DAPI (1 µg/ml in PBS) for

15 minutes and visualized as previously described (Chavel et al., 2014) on a Zeiss PLAN‐

APOCHROMAT 100X objective using the DIC, rhodamine and DAPI channels. Images were

captured for multiple fields of view, and the subcellular localization of the Cy3 signal was scored

for 150 cells of each genotype.

Data availability

All strains and plasmids are available upon request. All data necessary for evaluating our conclusions are represented within this paper.

RESULTS

Non‐duplicated Orc1 proteins did not complement a sir3∆ mutation in S. cerevisiae

Given that Orc1 and Sir3 subfunctionalized (Hickman and Rusche, 2010), non‐duplicated

Orc1 proteins might be expected to complement a sir3∆ mutation in S. cerevisiae. To test this hypothesis, we expressed three non‐duplicated Orc1 proteins from the ScSIR3 promoter in an S. cerevisiae sir3∆ strain. To assess silenced chromatin formation, we examined whether the cryptic mating‐type locus HMRa was repressed using a semi quantitative mating assay. These

MATα cells will only mate if HMRa is silenced. The haploid MATα cells were plated with a MATa tester strain, and prototrophic diploids were selected on minimal medium (Figure 2A). Controls indicated that yeast cells lacking Sir3 did not mate (row 1), whereas cells expressing ScSir3 did mate (rows 2, 3). In contrast, cells expressing non‐duplicated Orc1 proteins from

Zygosaccharomyces rouxii, K. lactis, or L. kluyveri did not mate (rows 4‐ 6). The non‐duplicated

Orc1 proteins were expressed at levels comparable to ScSir3 (Figure 2B), indicating that the failure to complement was not due to lack of expression. This inability of the non‐duplicated

Orc1 proteins to restore silenced chromatin formation in the absence of ScSir3 is consistent with the hypothesis that Sir3 evolved a new property after duplication.

These results differ from a previous report that ORC1 from L. kluyveri does complement a sir3Δ mutation in S. cerevisiae (van Hoof, 2005). However, the reported complementation is extremely weak, and we have been unable to reproduce this result using the original strains and plasmids (data not shown).

The KlOrc1 AAA+ domain was insufficient for silencing in S. cerevisiae

To delineate the region of KlOrc1 that is insufficient in S. cerevisiae and thus may have evolved new molecular properties, we created chimeric proteins of ScSir3 and KlOrc1. These chimeric proteins were expressed from a ScSIR3 promoter and had a C‐terminal V5 tag. As a starting point, we focused on the four structural divisions of the protein (Figure 1A, Figure 3A) and replaced the BAH, linker, AAA+, and winged helix domains of ScSir3 with the homologous portions of KlOrc1. All these chimeric proteins were expressed at levels comparable to ScSir3

(Figure 3B).

We first tested whether these chimeric proteins were able to silence HMRa using the mating assay (Figure 3C). Cells expressing chimeric proteins containing the BAH, linker, or winged helix domains of KlOrc1 were able to mate as efficiently as full‐length ScSir3 (Figure 3C, constructs 5, 6, 8). In contrast, cells expressing a chimeric protein containing the KlOrc1 AAA+ domain did not mate (Figure 3C construct 7). To directly assess the ability of these chimeric proteins to repress transcription, we measured the levels of a1 mRNA from HMRa as well as

YFR057W at telomere VI‐R, which is a read‐out for telomeric silencing (Figures 3D and E). In keeping with the mating assay, a1 and YFR057W were no longer repressed in the presence of

KlOrc1 or the chimeric protein containing the KlOrc1 AAA+ domain. These results indicate that the primary insufficiency of KlOrc1 is in the AAA+ domain.

To determine whether these chimeric proteins were deficient in recruitment to silenced regions, we preformed chromatin immunoprecipitation (ChIP) (Figures 3F and G). For this assay, we used an antibody against the V5 tag and examined relative enrichment compared to a control locus, ATS1, which is not associated with Sir proteins. We found that the chimeric 15

proteins containing the KlOrc1 BAH or winged helix domains had a modest decrease in association with HMR‐E and telomere VI‐R. In contrast, full‐length KlOrc1 and the chimeric protein containing the K. lactis AAA+ domain did not localize to HMR‐E or telomere VI‐R. Thus,

the insufficiency in the AAA+ domain is due to a deficiency in recruitment rather than a later step in chromatin assembly or transcriptional repression.

One explanation for the lack of function of KlOrc1 and the chimeric protein containing the KlOrc1 AAA+ domain, is that they were not properly localized to the nucleus. Therefore, we examined the subcellular localization of these proteins using an immunofluorescence assay

(Figure 4). From a population of 150 cells, we determined the numbers of cells with nuclear, cytoplasmic, or nuclear and cytoplasmic localization of the V5 tag. In addition, some cells lacked any signal, presumably because the antibodies failed to enter the cells. All the V5‐tagged proteins were primarily nuclear and had similar fractions of cells with each localization pattern.

This included the functional ScSir3‐V5 and chimeric protein containing KlOrc1 BAH and the non‐ functional KlOrc1‐V5 and chimeric protein containing the KlOrc1 AAA+ domain. Thus, improper localization did not account for the lack of function of KlOrc1 and the chimeric protein.

Disruption of Walker A box in KlOrc1 did not restore silencing

The AAA+ domain of KlOrc1 is presumed to have ATPase activity, based on the presence of key conserved amino acids and the critical role for this activity in DNA replication. However, the Sir3 AAA+ domain has no detectable ATPase activity. Therefore, one potential explanation for the inability of the KlOrc1 AAA+ domain to function in silenced chromatin formation in S.

cerevisiae is that its presumed ATPase activity interferes with the assembly of silenced chromatin. If this were the case, disrupting this activity might enable the protein to generate heterochromatin in S. cerevisiae. Therefore, we mutated the Walker A box, which is a canonical motif required for ATP binding. In particular, we placed the non‐functional Walker A box of

ScSir3 into full‐length KlOrc1 or the chimeric protein containing the KlOrc1 AAA+ domain

(Figure 5A). However, this substitution did not rescue the ability of KlOrc1 to achieve mating in

S. cerevisiae (Figure 5). Therefore, there are likely other regions of the KlOrc1 AAA+ domain that are insufficient for silencing, and it is not simply the presumed ATPase activity of this domain that hinders function in S. cerevisiae.

The base subdomain of the KlOrc1 AAA+ domain was insufficient for silencing in S. cerevisiae

To narrow down the region of the AAA+ domain of KlOrc1 that was insufficient in S. cerevisiae, we created additional chimeric proteins. First, the major structural units of the AAA+ domain were replaced with the homologous portions of KlOrc1, namely the pre‐AAA+, base, and lid subdomains (Figure 6A). These chimeric proteins were all expressed (Figure 6B). Cells expressing a chimeric protein containing the KlOrc1 AAA+ base subdomain were unable to mate

(Figure 6C, construct 12) or repress transcription (Figures 6D and E). In contrast, the chimeric proteins containing KlOrc1 pre‐AAA+ or lid subdomains promoted mating and transcriptional silencing (constructs 11, 13). Moreover, the chimeric protein containing the KlOrc1 AAA+ base subdomain was not associated with silenced loci (Figures 6F and G). Nevertheless, although it

did not function, the chimeric protein containing the KlOrc1 AAA+ base subdomain was properly localized to the nucleus (Figure 4).

We noted that the KlOrc1 pre‐AAA+ subdomain also disrupted function at Telomere VI‐R but not HMR (construct 11, compare Figures 6E and G with Figures 6D and F). The pre‐AAA+ subdomain of ScSir3 interacts with Rap1 (Moretti and Shore, 2001), and this interaction is especially critical for recruitment to telomeres. Perhaps the pre‐AAA+ subdomain of KlOrc1 has lower affinity for ScRap1. Nevertheless, the subdomain does function at HMR‐E.

To further delineate the critical region within the base subdomain, we made additional chimeric proteins. The smallest portion of KlOrc1 that was non‐functional in S. cerevisiae was the base subdomain without its first two alpha‐helices (construct 14). This chimeric protein was unable to silence at HMRa or telomere VI‐R and did not associate with these loci (Figure 6).

Substitutions of individual helices within the base subdomain did not perturb function (data not shown). Thus, the critical deficiency in KlOrc1 lies within the AAA+ base subdomain.

Providing KlSir4, the natural binding partner of KlOrc1, did not restore silencing

One known property of the AAA+ base domain in ScSir3 is to bind ScSir4 (Ehrentraut et al., 2011). If this interaction surface has evolved over time, species‐specific contacts between

Sir3/Orc1 and Sir4 might prevent KlOrc1 from associating with ScSir4. As a first test of this possibility, we generated a chimeric protein in which the Sir4‐interacting loop of ScSir3

(Ehrentraut et al., 2011) was replaced with the homologous loop from KlOrc1. If this loop from

KlOrc1 does not interact with ScSir4, this chimeric protein should be non‐functional. However, it functioned equivalently to full‐length ScSir3 (Figure 6, construct 15).

As a further test of the possibility that KlOrc1 cannot interact with ScSir4, we determined whether the ability of KlOrc1 to form heterochromatin could be restored by expressing its natural partner, Sir4 from K. lactis. To do so, we replaced the genomic copy of

ScSIR4 with KlSIR4. Importantly, cells expressing ScSir3 and KlSir4 were able to mate at a low level (Figure 7B, row 3; see also (Astrom and Rine, 1998)), indicating that KlSir4 does function as part of the S. cerevisiae SIR complex. Nevertheless, KlOrc1 remained unable to restore mating in cells expressing KlSir4 (Figure 7B row 4). This lack of function was also observed for chimeric proteins containing portions of the KlOrc1 AAA+ domain (rows 5‐7). Furthermore, these chimeric proteins were not recruited to HMRa or to telomere VI‐R (Figures 7D and E).

Therefore, the insufficiency of the KlOrc1 AAA+ base subdomain is most likely not due to an inability to bind Sir4.

The KlOrc1 bridging helix destabilized ScSir3

In addition to the AAA+ domain, a second region of KlOrc1 that disrupted function in

ScSir3 was the bridging helix between the AAA+ and winged helix domains. We originally found that a chimeric protein containing the KlOrc1 winged helix domain plus the bridging helix was not functional (Figure 8, construct 17). To localize the portion of this domain that interfered with silencing, we created chimeric proteins containing just the winged helix domain or the bridging helix. A chimeric protein containing the KlOrc1 winged helix domain was expressed and

restored mating similarly to ScSir3 (Figure 8, construct 8). In contrast, the chimeric protein containing just the KlOrc1 bridging helix was unable to restore silencing (Figure 8, construct 18).

Moreover, this chimeric protein was not expressed (Figure 8B). This lack of expression was not due to a sequence error in the plasmid and occurred for three independent transformants.

Moreover, the mRNA for this chimeric protein was present in these transformants (data not shown). Therefore, we considered the possibility that the KlOrc1 bridging helix destabilizes the

ScSir3 protein.

This potential instability of the chimeric protein could occur because the KlOrc1 bridging helix does not pack well against the ScSir3 protein. If so, stability might be maintained if the

KlOrc1 bridging helix were placed into ScSir3 in a manner that retains appropriate packing interactions. To test this idea, we created two additional chimeric proteins. One chimeric protein contains the last quarter of the KlOrc1 bridging helix and the KlOrc1 winged helix domain against which it packs (Oppikofer et al., 2013), and the second chimeric protein contains the other three quarters of the bridging helix and the AAA+ lid domain against which it packs (Ehrentraut et al., 2011). These two chimeric proteins were expressed (Figure 8B, constructs 19 and 20), indicating that protein stability was restored. Moreover, these chimeric proteins functioned similarly to ScSir3 (Figures 8C‐G). Given that neither portion of the bridging helix interferes with function when it occurs in the presence of its proper packing partner, we conclude that the lack of function of the chimeric protein containing the full KlOrc1 bridging helix results from poor packing against ScSir3. Thus, the KlOrc1 bridging helix does not lack a property present in ScSir3, and there is no evidence that a new molecular property evolved in either the bridging helix or the winged helix domain.

DISCUSSION

In this study, we identified a discrete portion of the non‐duplicated KlOrc1 protein as being insufficient for heterochromatin formation in the duplicated species S. cerevisiae.

Specifically, the insufficiency lies in the AAA+ base subdomain minus its first two alpha helices.

We hypothesize that this portion of Sir3 acquired new molecular properties after duplication.

The AAA+ base subdomains of duplicated Orc1 and Sir3 have distinct functions, consistent with this region evolving after duplication. The AAA+ base subdomain of Orc1 interlocks with other AAA+ domains in ORC (Bleichert et al., 2015; Chen et al., 2008), and these interactions promote ATP binding and hydrolysis. In contrast, the AAA+ subdomain of Sir3 contacts the heterochromatin protein Sir4 and is also proposed to bind nucleosomes

(Ehrentraut et al., 2011). We considered whether the inability of KlOrc1 to function in the Sir complex is due to its potential ATPase activity. However, disrupting the Walker A ATP‐binding domain of KlOrc1 did not recover the ability to function in the silencing complex (Figure 5).

Therefore, the potential ATPase activity in itself is not the reason that KlOrc1 fails to generate heterochromatin in S. cerevisiae.

In ScSir3 the AAA+ base subdomain does not bind or hydrolyze ATP but instead binds

ScSir4. A similar interaction is thought to occur in K. lactis, with KlOrc1 binding KlSir4. It was therefore possible that KlOrc1 fails to function in S. cerevisiae because it cannot bind ScSir4.

Indeed, Sir4 is one of the most rapidly evolving proteins within the Saccharomyces clade (Zill et al., 2010) and thus could theoretically form species‐specific interactions with Sir3/Orc1.

However, given that KlSir4 complements a Scsir4Δ mutation (Astrom and Rine, 1998) it must interact with S. cerevisiae Sir proteins and in much the same way that ScSir4 does. Moreover, 21

expression of KlSir4 in S. cerevisiae did not restore silencing in the presence of KlOrc1 (Figure 7).

Therefore, the insufficiency within the AAA+ base subdomain is most likely not due to its inability to bind ScSir4.

The other proposed function for the AAA+ base subdomain and surrounding regions is to bind nucleosomes. Although the best characterized nucleosome‐binding domain of Sir3 is the BAH domain (Armache et al., 2011; Onishi et al., 2007), the existence of a lower affinity nucleosome‐binding region in the AAA+ domain is supported by biochemical studies (Altaf et al., 2007; Ehrentraut et al., 2011; Hecht et al., 1995). It is possible that this secondary nucleosome‐binding region does not exist in non‐duplicated Orc1 proteins, such as KlOrc1, and only evolved after the AAA+ base domain was no longer constrained to assemble into ORC.

Further studies will be required to test this possibility.

This study suggests that Sir3 and Orc1 followed the Escape from Adaptive Conflict (EAC) or Gene Sharing model of evolution after duplication (Hittinger and Carroll, 2007; Hughes,

1994). Even though the non‐duplicated KlOrc1 contributes to heterochromatin formation in its native context (Hickman and Rusche, 2010), it was unable to complement a sir3Δ mutation in S. cerevisiae (Figure 2). Moreover, non‐duplicated Orc1 proteins from two other species also failed to function in S. cerevisiae, suggesting that Sir3 gained new molecular properties after subfunctionalization. A potential “conflict” experienced by the non‐duplicated Orc1 might be that because the AAA+ domain must pack into the ORC it cannot evolve surfaces that pack optimally with the Sir chromatin. Perhaps due to this conflict, heterochromatin formation in K. lactis requires additional factors not needed in S. cerevisiae. In particular, the Sum1 DNA‐ binding protein is required for silencing at cryptic mating‐type loci in K. lactis (Hickman and

Rusche, 2009) but is not needed in S. cerevisiae. The further evolution of Sir3 after duplication may have eliminated the need for Sum1. Thus, functional differences in the proteomes of S. cerevisiae and K. lactis may offset functional differences in ScSir3 and KlOrc1.

We conclude that Sir3 specialized within the AAA+ base subdomain after subfunctionalization. Our data are not consistent with the scenarios that the ATPase of Orc1 interferes with silencing or that KlOrc1 fails to bind ScSir4. Therefore, we favor the possibility that this region gained the ability to bind nucleosomes.

ACKNOWLEDGEMENTS

We thank Ambro van Hoof, Jasper Rine, and Hana Sychrová for strains and plasmids. We also thank Gerald Koudelka for help analyzing the structural modules of ScSir3 and Jacky Chow for help with the fluorescence microscopy. This research was supported by startup funds provided to LNR by the College of Arts and Sciences at the State University of New York at Buffalo and NSF grant MCB‐1615367.

REFERENCES

Altaf, M., Utley, R.T., Lacoste, N., Tan, S., Briggs, S.D., and Cote, J. (2007). Interplay of chromatin modifiers on a short basic patch of histone H4 tail defines the boundary of telomeric heterochromatin. Mol Cell 28, 1002-1014. Armache, K.J., Garlick, J.D., Canzio, D., Narlikar, G.J., and Kingston, R.E. (2011). Structural basis of silencing: Sir3 BAH domain in complex with a nucleosome at 3.0 A resolution. Science 334, 977-982. Astrom, S.U., and Rine, J. (1998). Theme and variation among silencing proteins in Saccharomyces cerevisiae and Kluyveromyces lactis. Genetics 148, 1021-1029. Bell, S.P., Mitchell, J., Leber, J., Kobayashi, R., and Stillman, B. (1995). The multidomain structure of Orc1p reveals similarity to regulators of DNA replication and transcriptional silencing. Cell 83, 563-568. Bleichert, F., Botchan, M.R., and Berger, J.M. (2015). Crystal structure of the eukaryotic origin recognition complex. Nature 519, 321-326. Byrne, K.P., and Wolfe, K.H. (2005). The Yeast Gene Order Browser: combining curated homology and syntenic context reveals gene fate in polyploid species. Genome Res 15, 1456- 1461. Chang, J.F., Hall, B.E., Tanny, J.C., Moazed, D., Filman, D., and Ellenberger, T. (2003). Structure of the coiled-coil dimerization motif of Sir4 and its interaction with Sir3. Structure 11, 637-649. Chavel, C.A., Caccamise, L.M., Li, B., and Cullen, P.J. (2014). Global regulation of a differentiation MAPK pathway in yeast. Genetics 198, 1309-1328. Chen, Z., Speck, C., Wendel, P., Tang, C., Stillman, B., and Li, H. (2008). The architecture of the DNA replication origin recognition complex in Saccharomyces cerevisiae. Proc Natl Acad Sci U S A 105, 10326-10331. Ehrentraut, S., Hassler, M., Oppikofer, M., Kueng, S., Weber, J.M., Mueller, J.W., Gasser, S.M., Ladurner, A.G., and Ehrenhofer-Murray, A.E. (2011). Structural basis for the role of the Sir3 AAA+ domain in silencing: interaction with Sir4 and unmethylated histone H3K79. Genes Dev 25, 1835-1846. Force, A., Lynch, M., Pickett, F.B., Amores, A., Yan, Y.L., and Postlethwait, J. (1999). Preservation of duplicate genes by complementary, degenerative mutations. Genetics 151, 1531- 1545. Funakoshi, M., and Hochstrasser, M. (2009). Small epitope-linker modules for PCR-based C- terminal tagging in Saccharomyces cerevisiae. Yeast 26, 185-192. Gaudier, M., Schuwirth, B.S., Westcott, S.L., and Wigley, D.B. (2007). Structural basis of DNA replication origin recognition by an ORC protein. Science 317, 1213-1216. Hecht, A., Laroche, T., Strahl-Bolsinger, S., Gasser, S.M., and Grunstein, M. (1995). Histone H3 and H4 N-termini interact with SIR3 and SIR4 proteins: a molecular model for the formation of heterochromatin in yeast. Cell 80, 583-592. Hickman, M.A., and Rusche, L.N. (2009). The Sir2-Sum1 complex represses transcription using both promoter-specific and long-range mechanisms to regulate cell identity and sexual cycle in the yeast Kluyveromyces lactis. PLoS Genet 5, e1000710. Hickman, M.A., and Rusche, L.N. (2010). Transcriptional silencing functions of the yeast protein Orc1/Sir3 subfunctionalized after gene duplication. Proc Natl Acad Sci U S A 107, 19384-19389. 24

Hittinger, C.T., and Carroll, S.B. (2007). Gene duplication and the adaptive evolution of a classic genetic switch. Nature 449, 677-681. Hoppe, G.J., Tanny, J.C., Rudner, A.D., Gerber, S.A., Danaie, S., Gygi, S.P., and Moazed, D. (2002). Steps in assembly of silent chromatin in yeast: Sir3-independent binding of a Sir2/Sir4 complex to silencers and role for Sir2-dependent deacetylation. Mol Cell Biol 22, 4167-4180. Hou, Z., Bernstein, D.A., Fox, C.A., and Keck, J.L. (2005). Structural basis of the Sir1-origin recognition complex interaction in transcriptional silencing. Proceedings of the National Academy of Sciences of the United States of America 102, 8489-8494. Huang, and Miller (1991). A time-efficient, linear-space local similarity algorithm. Adv Appl Math 12, 337-357. Hughes, A.L. (1994). The evolution of functionally novel proteins after gene duplication. Proceed Biol Sci/Royal Society 256, 119-124. Keeling, J.W., and Miller, R.K. (2011). Indirect immunofluorescence for monitoring spindle assembly and disassembly in yeast. Methods in molecular biology (Clifton, NJ) 782, 231-244. King, D.A., Hall, B.E., Iwamoto, M.A., Win, K.Z., Chang, J.F., and Ellenberger, T. (2006). Domain structure and protein interactions of the silent information regulator Sir3 revealed by screening a nested deletion library of protein fragments. The Journal of biological chemistry 281, 20107-20119. Li, H., and Stillman, B. (2012). The origin recognition complex: a biochemical and structural view. Sub-cellular biochemistry 62, 37-58. Luo, K., Vega-Palas, M.A., and Grunstein, M. (2002). Rap1-Sir4 binding independent of other Sir, yKu, or histone interactions initiates the assembly of telomeric heterochromatin in yeast. Genes & development 16, 1528-1539. Lynch, P.J., and Rusche, L.N. (2010). An auxiliary silencer and a boundary element maintain high levels of silencing proteins at HMR in Saccharomyces cerevisiae. Genetics 185, 113-127. Moretti, P., and Shore, D. (2001). Multiple interactions in Sir protein recruitment by Rap1p at silencers and telomeres in yeast. Molecular and cellular biology 21, 8082-8094. Onishi, M., Liou, G.G., Buchberger, J.R., Walz, T., and Moazed, D. (2007). Role of the conserved Sir3-BAH domain in nucleosome binding and silent chromatin assembly. Mol Cell 28, 1015-1028. Oppikofer, M., Kueng, S., Keusch, J.J., Hassler, M., Ladurner, A.G., Gut, H., and Gasser, S.M. (2013). Dimerization of Sir3 via its C-terminal winged helix domain is essential for yeast heterochromatin formation. EMBO J 32, 437-449. Pribylova, L., and Sychrova, H. (2003). Efficient transformation of the osmotolerant yeast Zygosaccharomyces rouxii by electroporation. J Microbiol Methods 55, 481-484. Rusche, L.N., Kirchmaier, A.L., and Rine, J. (2002). Ordered nucleation and spreading of silenced chromatin in Saccharomyces cerevisiae. Mol Biol Cell 13, 2207-2222. Rusche, L.N., and Rine, J. (2001). Conversion of a gene-specific repressor to a regional silencer. Genes Dev 15, 955-967. Schiestl, R.H., and Gietz, R.D. (1989). High efficiency transformation of intact yeast cells using single stranded nucleic acids as a carrier. Curr Genet 16, 339-346. Schmitt, M.E., Brown, T.A., and Trumpower, B.L. (1990). A rapid and simple method for preparation of RNA from Saccharomyces cerevisiae. Nucleic acids research 18, 3091-3092. Schneider, B.L., Seufert, W., Steiner, B., Yang, Q.H., and Futcher, A.B. (1995). Use of polymerase chain reaction epitope tagging for protein tagging in Saccharomyces cerevisiae. Yeast 11, 1265-1274.

Sikorski, R.S., and Hieter, P. (1989). A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics 122, 19-27. Stoltzfus, A. (1999). On the possibility of constructive neutral evolution. Journal of molecular evolution 49, 169-181. Triolo, T., and Sternglanz, R. (1996). Role of interactions between the origin recognition complex and SIR1 in transcriptional silencing. Nature 381, 251-253. van Hoof, A. (2005). Conserved functions of yeast genes support the duplication, degeneration and complementation model for gene duplication. Genetics 171, 1455-1461. Zhang, W., Sankaran, S., Gozani, O., and Song, J. (2015). A Meier-Gorlin syndrome mutation impairs the ORC1-nucleosome association. ACS Chem Biol 10, 1176-1180. Zill, O.A., Scannell, D., Teytelman, L., and Rine, J. (2010). Co-evolution of transcriptional silencing proteins and the DNA elements specifying their assembly. PLoS Biol 8, e1000550.

TABLES

Table 1. Yeast strains used in this study Strains Genotype Source JRY4013 W303‐1a MATα ADE2 lys2Δ can1‐100 his3‐11 leu2‐3,112 J. Rine trp1‐1 ura3‐1 LRY1098/JRY4608 JRY4013 sir3Δ::LEU2 J. Rine LRY3080 JRY4013 sir3Δ::LEU2 sir4Δ::KlSIR4‐HA‐HIS3 This study LRY3081 JRY4013 sir3Δ::LEU2 ScSIR4::HA‐HIS3 This study LRY1021 MATa his4Δ P. Schatz

Table 2. Plasmids used in this study. pRS314 (Sikorski and Hieter, 1989), pJR2299 (Rine lab), and pLR824 (Hickman and Rusche, 2010) were previously described. All other plasmids were generated for this study.

Table 3. Oligonucleotides used for quantitative PCR

Description Oligo Sequence ChIP primers ATS1 GGTAACGCAGCCGTTTGAGC ATS1 CCTCATCGTGCCCCAGTCC HMR‐E GTACCCTTTTTATTGCATATAG HMR‐E GTTTGCAAATGTGGACGAAAAG 0.3 Kb from Tel VI‐R CTGAGTTCGGATCACTACACAC 0.3 Kb from Tel VI‐R GATCATTGAGGATCTATAATCAAC 1.3 Kb from Tel VI‐R GTAGGAATGCGAAAGGATCTGTC 1.3 Kb from Tel VI‐R GTGCTAAAGGAATCCCCAGAGAC 1.7 Kb from Tel VI‐R CAAATTGCAGGCAAATAAACAC 1.7 Kb from Tel VI‐R GCATGATGATCCCCAATAAC 2.3 Kb from Tel VI‐R GACGGAAAGAGGGCAGAAAG 2.3 Kb from Tel VI‐R CAGCGCACGTTTGTTTGATG 3.3 Kb from Tel VI‐R GAGTTTTGTAGTAGCGATCCGAC 3.3 Kb from Tel VI‐R GTAGTGTAACCATAAGAAATCCAG cDNA primers NTG1 CAAGGTTCCTCGATTTAGTG NTG1 GACTCCAGATCAGACAAGAAC YFR057W CAATAGCCTTTCAAAGCATAC YFR057W GCTTTGTTACGCTTGCACTTG HMR‐a1 ATGGAAAGTAATTTGACTAAAGTAG HMR‐a1 CCAAACTCTTACTTGAAGTGGAG

FIGURES

Figure 1 Structural organization of Orc1/Sir3 proteins. Major structural domains are represented in white for ScSir3 or black for KlOrc1. Each domain is labeled with its molecular function. Amino acid sequence identity (similarity) between ScSir3 and KlOrc1 was calculated for each domain using EMBL‐EBI LALIGN Pairwise Sequence alignment (Huang and Miller,

1991).

Winged BAH Linker AAA+ Helix Rap1 Sir4 ScSir3 Nucleosome Nucleosome? Dimer

33.3 (68.0) 26.5 (65.5) 21.6 (55.9)

KlOrc1 Nucleosome ATPase Dimer Figure 2 Non‐duplicated Orc1 proteins did not complement a sir3Δ mutation in S. cerevisiae.

(A) Mating was assessed for sir3Δ MATα cells (LRY1098) carrying plasmids encoding ScSir3

(pJR2299, pLR911), Z. rouxii Orc1 (pLR1058), K. lactis Orc1 (pLR915), L. kluyverii Orc1 (pLR1056) or an empty vector (pRS314). Cells were diluted tenfold and spotted on CSM lacking tryptophan

(CSM‐Trp) as a plating control (right). The same diluted cells were combined with a constant amount of MATa tester cells (LRY1021) and spotted on minimal medium (YM) to detect the prototrophic diploids. The evolutionary relationship of the species (Byrne and Wolfe, 2005) is indicated by a cladogram on the left. (B) Expression of Orc1/Sir3 proteins in the cells used in panel A was examined by immunoblotting. Orc1/Sir3 proteins were detected with antibodies against V5. Pgk1 (3‐phosphoglycerate kinase) served as a loading control.

A B Duplication Mating Dilution Control Empty Vector ScSir3-HA

ScSir3-V5 Empty VectorScSir3-HA ScSir3-V5 ZrOrc1-V5 KlOrc1-V5 LkOrc1-V5 ZrOrc1-V5 Anti V5 KlOrc1-V5 Anti Pgk1 LkOrc1-V5 YM CSM-Trp Figure 3 The KlOrc1 AAA+ domain was insufficient for silencing in S. cerevisiae. (A) The chimeric proteins studied are represented by graphics, in which white indicates ScSir3 sequences and black indicates KlOrc1 sequences. (B) Expression of the chimeric proteins described in panel A was assessed by immunoblotting, as for figure 2. (C) Mating assays were conducted as for figure 2. S. cerevisiae cells expressed the indicated ScSir3‐KlOrc1 chimeric proteins. (D) Levels of a1 mRNA were measured by quantitative RT‐PCR for cells expressing the indicated chimeric proteins. For each strain, a1 mRNA was quantified relative to a control locus,

NTG1, and then mRNA levels were normalized to cells expressing ScSir3‐V5. (E) Levels of

YFR057W mRNA were measured as for panel D. (F) The association of chimeric proteins with the HMR‐E silencer was determined by ChIP. The x‐axis represents the relative enrichment of the chimeric protein at the silencer compared to a control locus, ATS1. (G) The association of chimeric proteins with telomere VI‐R was determined by ChIP as for panel F.

A B C Anti V5 Anti Pgk1 Mating Dilution Control # Graphic KlOrc1 Domain Empty Vector Empty Vector 3 None Sir3-HA Sir3-HA 3 3 4 Full Length 4 5 BAH 4 5 5 6 Linker 6 6 7 AAA+ 7 7 8 Winged Helix 8 8 YM CSM-Trp

D a1 mRNA E YFR057W mRNA Empty Vector Empty Vector Sir3-HA Sir3-HA 3 3 4 4 5 5 6 6 7 7 8 8 0 2 4 6 8 10 12 0 2 4 6 8 10 Expression Relative to ScSir3-V5 Expression Relative to ScSir3-V5 F V5 ChIP at HMR-E G V5 ChIP at Telomere VI-R

Empty Vector 100

ATS1 Sir3-HA Sir3-HA 222A 80 3 3 6 4 4 915A 60 5 6 5 3 8 40

to to t Relative 7 6 919A n 5 8 20 7 me h 8 4 7 982A ric 0 n

0 10 20 30 40 50 E 0.0Kb 1.0 2.0 3.0 4.0 Enrichment Relative toATS1 YFR057W Figure 4 ScSir3, KlOrc1, and chimeric proteins were predominantly nuclear. (A) The proteins examined are represented by graphics, in which white indicates ScSir3 sequences and black indicates KlOrc1 sequences. (B) Representative images of Cy3‐labeled V5‐tagged proteins. The first column shows the DIC images merged with both fluorescence channels. The next two columns show Cy3 and DAPI staining, and the last column shows the merged Cy3 and DAPI channels. (C) The subcellular localization of the Cy3 signal was scored for 150 cells. Localization was nuclear (purple), nuclear and cytoplasmic (gray), or cytoplasmic (green). In addition some cells had no fluorescence (yellow).

A B DIC Cy3 DAPI MERGE

# Graphic KlOrc1 Domain Empty Vector 3 None 4 Full Length Sir3-No Tag 5 BAH 7 AAA+ No Antibody 12 AAA+ Base 3 C Localization of V5-tagged proteins 4 EmptyEmpty VectorVector Sir3-NoSir3-No TagTag No Antibody 3 No Antibody 5 4 ScSir3 5 KlOrc1 7 BAH 12 AAA 7 0 20 40 60 80 100 120 140 160 Number of Cells

Nucleus Nucleus and Cytoplasm Cytoplasm Neither 12 Figure 5 Disruption of Walker A box in KlOrc1 did not restore silencing. (A) An alignment of

Walker A boxes from K. lactis Orc1 and S. cerevisiae Sir3 and Orc1. The bar indicates the amino acids that were replaced in KlOrc1 (pLR1103) or a chimeric protein with the KlOrc1 AAA+ domain (pLR1119). (B) Expression of the proteins with mutated Walker A domains was assessed by immunoblotting. (C) Mating assays were conducted for S. cerevisiae cells expressing the indicated chimeric proteins.

A # Graphic KlOrc1 Domain 3 None 7 AAA+ 9 Full with ScWalker A 10 AAA+ with ScWalker A

B C Anti V5 Anti Pgk1 Mating Dilution Control Empty Vector Empty Vector 3 3 7 7 9 9 10 10 YM CSM-Trp Figure 6 The base subdomain of the KlOrc1 AAA+ domain was insufficient for silencing in S.

cerevisiae. (A) The structure of the AAA+ domain (PDB‐3te6) is colored to show the three subdomains, with a portion of the pre‐AAA+ subdomain in green, the base subdomain in red, and the lid subdomain in blue. Only a small fragment of the pre AAA+ domain was modeled in the crystal structure. The Sir4‐interaction loop is colored violet. The graphical representation of chimeric proteins is indicated. (B) Expression of chimeric proteins was assessed by immunoblotting. (C) Mating assays were conducted using cells expressing the indicated chimeric proteins. mRNA levels were measured for a1 (D) or YFR057W (E) using quantitative RT‐

PCR for cells expressing the indicated proteins. The association of chimeric proteins with the

HMR‐E silencer (F) or telomere VI‐R (G) was determined by ChIP.

A N Fragment Pre AAA+ # Graphic KlOrc1 Domain AAA+ Base 3 None 7 AAA+ Sir4 11 Pre AAA+ Interaction 12 AAA+ Base Loop 13 AAA+ Lid C 14 AAA+ Base w/o 1st 2 Alpha Helices AAA+ Lid 15 Sir4 Interation Loop

B C Empty Vector Empty Vector 3 3 7 7 11 11 12 12 13 13 14 14 15 15 YM CSM-Trp D a1 mRNA E YFR057W mRNA Empty Vector Empty Vector 3 3 7 7 11 11 12 12 13 13 14 14 15 15 0 5 10 15 20 0 1 2 3 45 6 7 8

F V5 ChIP at HMR-E G V5 ChIP at Telomere VI-R 80 3 Sir3-HA Sir3-HA ATS1 60 3 3 7 40 7 to ve 11 15 12 11 13 12 20 14 15 13 13 10 14 11 15 0

Enrichment Rela Enrichment 0.0Kb 1.0 2.0 3.0 4.0 0 10 20 30 40 50

ATS1 YFR057W Figure 7 Co‐expression of KlSir4 and KlOrc1 did not restore silencing in S. cerevisiae. (A) The graphical representation of chimeric proteins. (B) Mating assays were conducted using cells expressing the indicated chimeric proteins, as well as KlSir4‐HA or ScSir4‐HA. (C) Expression of chimeric proteins was assessed by immunoblotting. The association of chimeric proteins with the HMR‐E silencer (D) or telomere VI‐R (E) was determined by ChIP.

A B # Graphic KlOrc1 Domain Mating Dilution Control 3 None Sir3-No Tag Sir3-No Tag Full Length 4 3 7 AAA+ 4 12 AAA+ Base 7 12 14 AAA+ Base w/o 1st 2 Alpha Helices 14 Empty Vector C Sir3-No Tag Anti V5 Anti Pgk1 Anti V5 Anti Pgk1 Sir3-No Tag Sir3-No Tag Sir3-No Tag 3 Sir3-No Tag Sir3-No Tag 4 3 3 7 4 4 12

7 7 ScSir4-HA14 KlSir4-HA 12 12 Empty Vector KlSir4-HA 14 ScSir4-HA 14 YM CSM-Trp Empty Vector Empty Vector

D V5 ChIP at HMR-E E V5 ChIP at Telomere VI-R 30 Sir3-No Tag Sir3-No Tag 3 KlSir4-HA

ATS1 25 3 20 4 4 7 15 12

7 8 14 ScSir4-HA Sir3-No Tag 12 3

14 to hm ent 6 4 c i Sir3-No Tag nr 4 3 E

4 e v 2 7 ti la ScSir4-HA KlSir4-HA 12 e 0 14 R 0.0Kb 1.0 2.0 3.0 4.0 0 2 4 6 8 10 12 14 16 Relative Enrichment toATS1 YFR057W Figure 8 The K. lactis bridging helix destabilized ScSir3. (A) The AAA+ (PDB‐3te6) and Winged

Helix (PDB‐3zco) domains are colored to show the bridging helix (black), AAA+ lid subdomain

(blue), and winged helix domain (gray). Portions of the bridging helix are modeled in each of the two structures, although some amino acids are not in either structure. The graphical representation of each chimeric protein is indicated to the right. (B) Expression of chimeric proteins was assessed by immunoblotting. (C) Mating assays were conducted using S. cerevisiae cells expressing the indicated ScSir3‐KlOrc1 chimeric proteins. mRNA levels were measured for a1 (D) or YFR057W (E) using quantitative RT‐PCR. The association of chimeric proteins with the

HMR‐E silencer (F) or telomere VI‐R (G) was determined by ChIP.

A # Graphic KlOrc1 Domain AAA+ Lid 3 None Subdomain 17 Bridging Helix & Winged Helix Domain 18 Bridging Helix 8 Winged Helix Domain Bridging Helix 19 1/4 Bridging Helix &Winged Helix Winged Helix AAA+ Lid & 3/4 of Bridging Helix Domain 20

B C Anti V5Anti Pgk1 Mating Dilution Control ScSir3-HA ScSir3-HA 3 3 17 17 18 18 8 8 19 19 20 20 YM CSM-Trp D a1 mRNA E YFR057W mRNA Empty Vector Empty Vector 3 3 17 17 8 8 19 19 20 20 0 2 4 6 8 0 2 4 6 8 10 Expression Relative to ScSir3-V5 Expression Relative to ScSir3-V5

F G V5 ChIP at Telomere VI-R V5 ChIP at HMR-E 35 Sir3-HA ATS1 ScSir3-HA 3 30 3 3 to 17

ve 25 8 17 ti 8 19 20 20 8 Rela 15 20 nt nt 19 10 19

20 5 17 richme

50 10 15 20 25 n

E 0 1.0 2.0 3.0 Enrichment Relative toATS1 0.0Kb YFR057W