ABO Blood Group Distribution and Ischaemic Heart Disease
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
ABO (ISBT 001) Blood Group Alleles V1.1 171023
Names for ABO (ISBT 001) blood group alleles v1.1 171023 Names for ABO (ISBT 001) Blood Group Alleles General description: The ABO system was discovered as in 1900 and is considered the first and clinically most important system. The ABO gene and its 7 coding exons give rise to one of two principally different glycosyltransferases. The A glycosyltransferase (GTA) catalyzes the addition of a donor substrate, UDP-N-acetylgalactosamine, to an acceptor substrate known as the H antigen. The B glycosyltransferase (GTB) differs by only four amino-acid substitutions from GTA and performs the same enzymatic reaction but uses UDP-galactose as donor substrate. In this way, genetic polymorphism gives rise to two related antigens in this system. Any polymorphism or mutation that changes the activity or specificity of the encoded enzyme may therefore alter the ABO phenotype. Alterations that completely abolish enzymic activity give rise to the blood group O phenotype, in which the H antigen remains unconverted and no A or B antigen can be detected. If the genetic alteration decreases the activity of the enzyme, or alters its subcellular location and thereby decreases conversion of H to A or B, a weak A or B subgroup phenotype can result. Furthermore, certain polymorphisms result in promiscuous enzymes that can synthesize both A and B antigen, thereby resulting in the so-called cisAB or B(A) phenotypes. The A phenotype is divided into A1 and A2. The former is more prevalent in all populations and has approximately 5 times more A epitopes per red cell. The GTA1 is also better than GTA2 at synthesizing certain forms of A, .e.g. -
Demonstration of SNP Genotyping Using a Single Nucleotide Extension Method and the 3500 Series Genetic Analyzer
YOUR INNOVATIVE RESEARCH ABO BLOOD GROUP DETERMINATION Demonstration of SNP Genotyping Using a Single Nucleotide Extension Method and the 3500 Series Genetic Analyzer Introduction This publication describes the collaboration The Department of Legal between researchers at the Okayama Medicine, Okayama University Graduate School of Medicine, University Graduate School and at Applied Dentistry and Pharmaceutical Sciences develops research Biosystems (Foster City, CA, USA), aimed methodologies for crime detec- tion techniques that utilize DNA ® at demonstrating a SNaPshot Multiplex analyses, including the discov- System genotyping protocol on the Applied ery of new polymorphic DNA loci and tools to identify gender Biosystems® 3500xL Genetic Analyzer from sample material. Visiting fellow Dr. Doi is involved in an capillary electrophoresis (CE) instrument. ongoing effort to refine DNA- based blood typing techniques and is also developing a DNA Genotyping to determine ABO blood type identification method that is useful on composite samples. group status is a valuable tool in forensic Pictured are Dr. Yusuke Doi (top applications where routine serological right); Dr. Yuji Yamamoto (top left); Mayumi Okashita (bottom typing is not feasible. Therefore, right); and Hiroko Ide (bottom left). laboratories that are developing ABO blood group typing applications appreciate workflows that provide fast, accurate, and reliable results, particularly if the assay delivers data for samples that contain very ABO Genotyping of six SNP sites within the ABO gene (cor- low concentrations of gDNA or degraded Identification of specific combinations of responding to nucleotides 261, 297, 681, 703, gDNA. In this publication, we present a single nucleotide polymorphisms (SNPs) 802, and 803). These six sites are sufficient in the ABO locus on chromosome 9 can for accurate determination of ten common simple, rapid, and robust workflow for be used to determine ABO blood type. -
Repetitive Elements in Humans
International Journal of Molecular Sciences Review Repetitive Elements in Humans Thomas Liehr Institute of Human Genetics, Jena University Hospital, Friedrich Schiller University, Am Klinikum 1, D-07747 Jena, Germany; [email protected] Abstract: Repetitive DNA in humans is still widely considered to be meaningless, and variations within this part of the genome are generally considered to be harmless to the carrier. In contrast, for euchromatic variation, one becomes more careful in classifying inter-individual differences as meaningless and rather tends to see them as possible influencers of the so-called ‘genetic background’, being able to at least potentially influence disease susceptibilities. Here, the known ‘bad boys’ among repetitive DNAs are reviewed. Variable numbers of tandem repeats (VNTRs = micro- and minisatellites), small-scale repetitive elements (SSREs) and even chromosomal heteromorphisms (CHs) may therefore have direct or indirect influences on human diseases and susceptibilities. Summarizing this specific aspect here for the first time should contribute to stimulating more research on human repetitive DNA. It should also become clear that these kinds of studies must be done at all available levels of resolution, i.e., from the base pair to chromosomal level and, importantly, the epigenetic level, as well. Keywords: variable numbers of tandem repeats (VNTRs); microsatellites; minisatellites; small-scale repetitive elements (SSREs); chromosomal heteromorphisms (CHs); higher-order repeat (HOR); retroviral DNA 1. Introduction Citation: Liehr, T. Repetitive In humans, like in other higher species, the genome of one individual never looks 100% Elements in Humans. Int. J. Mol. Sci. alike to another one [1], even among those of the same gender or between monozygotic 2021, 22, 2072. -
High Rhesus (Rh(D))
Golassa et al. BMC Res Notes (2017) 10:330 DOI 10.1186/s13104-017-2644-3 BMC Research Notes RESEARCH ARTICLE Open Access High rhesus (Rh(D)) negative frequency and ethnic‑group based ABO blood group distribution in Ethiopia Lemu Golassa1†, Arega Tsegaye2†, Berhanu Erko1 and Hassen Mamo3* Abstract Background: Knowledge of the distribution of ABO-Rh(D) blood groups in a locality is vital for safe blood services. However, the distribution of these blood systems among Ethiopians in general is little explored. This study was, there- fore, designed to determine the ABO-Rh(D) blood group distribution among patients attending Gambella hospital, southwestern Ethiopia. Methods: A cross-sectional study was conducted between November and December 2013 (N 449). The patients were grouped into two broad categories. Those who originally moved from diferent parts of Ethiopia= and currently residing in Gambella are named ‘highlanders’ (n 211). The other group consisted of natives (Nilotics) to the locality (n 238). ABO-Rh(D) blood groups were typed =by agglutination, open-slide test method, using commercial antisera (Biotech= laboratories Ltd, Ipswich, Sufolk, UK). Results: Overall, majority of the participants (41.20%) had blood type ‘O’ followed by types ‘A’ (34.96%), ‘B’ (20.48%) and ‘AB’ (3.34%). However, blood type ‘A’ was the most frequent (44.07%) blood group among the ‘highlanders’ and 50.42% of Nilotic natives had type ‘O’. The proportion of participants devoid of the Rh factor was 19.37%. Conclusions: While the ABO blood group distribution is similar to previous reports, the Rh(D) frequency is much higher than what was reported so far for Ethiopia and continental Africa. -
Introduction to the Rh Blood Group.Pdf
Introduction to the Rhesus Blood Group Justin R. Rhees, M.S., MLS(ASCP)CM, SBBCM University of Utah Department of Pathology Medical Laboratory Science Program Objectives 1. Describe the major Rhesus (Rh) blood group antigens in terms of biochemical structure and inheritance. 2. Describe the characteristics of Rh antibodies. 3. Translate the five major Rh antigens, genotypes, and haplotypes from Fisher-Race to Wiener nomenclature. 4. State the purpose of Fisher-Race, Wiener, Rosenfield, and ISBT nomenclatures. Background . How did this blood group get its name? . 1937 Mrs. Seno; Bellevue hospital . Unknown antibody, unrelated to ABO . Philip Levine tested her serum against 54 ABO-compatible blood samples: only 13 were compatible. Rhesus (Rh) blood group 1930s several cases of Hemolytic of the Fetus and Newborn (HDFN) published. Hemolytic transfusion reactions (HTR) were observed in ABO- compatible transfusions. In search of more blood groups, Landsteiner and Wiener immunized rabbits with the Rhesus macaque blood of the Rhesus monkeys. Rhesus (Rh) blood group 1940 Landsteiner and Wiener reported an antibody that reacted with about 85% of human red cell samples. It was supposed that anti-Rh was the specificity causing the “intragroup” incompatibilities observed. 1941 Levine found in over 90% of erythroblastosis fetalis cases, the mother was Rh-negative and the father was Rh-positive. Rhesus macaque Rhesus (Rh) blood group Human anti-Rh and animal anti- Rh are not the same. However, “Rh” was embedded into blood group antigen terminology. The -
615.Full.Pdf
Copyright 6 1995 hy the Genetics Society of America Developmental Genetical Analysis and Molecular Cloning of the abnormal oocyte Gene of Drosophila melamgaster John Tomkiel,” Laura Fanti: Maria Berloco: Luigi Spinelli,+John W. Tamk~m,~ Barbara T. Wakimoto*9sand Sergio Pimpinellit” *Department of Genetics, University of Washington, Seattle, Washington 98195, +Zstituto di Genetica, Universita di Ban‘, 70126 Ban’, Italy, IDepartment of Biology, University of California, Santa Cruz, California 95064 and $Department of Zoology, University of Washington, Seattle, Washington 981 95 Manuscript received September 6, 1994 Accepted for publication March 8, 1995 ABSTRACT Studies of the abnormal oocyte (abo) gene of Drosophila mlanogaster have previously been limitedto the analysis of a single mutant allele, abnmmal oocyte’ (abo’). The abo’ mutation causes a maternal-effect lethality that can be partially rescued zygotically by the abo+ allele and by increasing the dosage of specific regions of heterochromatin denoted ABO. This report describes the propertiesof abo’, a new Pelement-induced allelethat allowed us to reexamine the natureof maternaleffect defect. Comparisons of the phenotype of progeny of abo‘/abo’ and abo’/abo’ females show that the preblastoderm lethality previously described asa component of the abo mutant maternal effect results froma recessive fertilization defect associated with the abo’ chromosome. We demonstrate here that the abeinduced maternaleffect lethality occurs predominately late in embryogenesis after cuticle deposition but before hatching. The phenocritical period forzygotic rescue by heterochromatin coincideswith this periodof late embryogene- sis. We have used the abo’ mutation to map and molecularly clone the gene.We show that the abo gene is located in the 32C cytogenetic interval and identify the putative abo transcript from mFWA isolated from adult females. -
An Ancient Deletion in the ABO Gene Affects the Composition of the Porcine Microbiome by Altering Intestinal N-Acetyl-Galactosam
bioRxiv preprint doi: https://doi.org/10.1101/2020.07.16.206219; this version posted July 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Effect of the ABO locus on the porcine gut microbiome Page 1 of 66 1 An ancient deletion in the ABO gene affects the composition of the porcine microbiome 2 by altering intestinal N-acetyl-galactosamine concentrations. 3 Hui Yang1*, Jinyuan Wu1*, Xiaochang Huang1, Yunyan Zhou1, Yifeng Zhang1, Min Liu1, Qin Liu1, 4 Shanlin Ke1, Maozhang He1, Hao Fu1, Shaoming Fang1, Xinwei Xiong1, Hui Jiang1, Zhe Chen1, 5 Zhongzi Wu1, Huanfa Gong1, Xinkai Tong1, Yizhong Huang1, Junwu Ma1, Jun Gao1, Carole 6 Charlier2,1, Wouter Coppieters2,1, Lev Shagam2, Zhiyan Zhang1, Huashui Ai1, Bin Yang1, Michel 7 Georges2,1,$ ,† , Congying Chen1, $,†, Lusheng Huang1, $,†,#. 8 1National Key Laboratory for Swine genetic improvement and production technology, 9 Ministry of Science and Technology of China, Jiangxi Agricultural University, NanChang, Jiangxi 10 Province, 330045, PR China. 2Unit of Animal Genomics, GIGA-Institute and Faculty of 11 Veterinary Medicine, University of Liege, 4000 Liege, Belgium. 12 *Contributed equally to this work. $Senior authors. †Corresponding authors. #Lead contact. 13 14 Summary 15 We have generated a large heterogenous stock population by intercrossing eight divergent 16 pig breeds for multiple generations. We have analyzed the composition of the intestinal 17 microbiota at different ages and anatomical locations in > 1,000 6th- and 7th- generation 18 animals. We show that, under conditions of exacerbated genetic yet controlled 19 environmental variability, microbiota composition and abundance of specific taxa (including 20 Christensenellaceae) are heritable in this monogastric omnivore. -
ABO Blood Group a Transferase and Its Codon 69 Substitution
www.nature.com/scientificreports OPEN ABO blood group A transferase and its codon 69 substitution enzymes synthesize FORS1 antigen of FORS Received: 12 March 2019 Accepted: 17 June 2019 blood group system Published: xx xx xxxx Miyako Yamamoto 1, Maria Cristina Tarasco1,2, Emili Cid 1,3, Hidetomo Kobayashi1,4 & Fumiichiro Yamamoto 1,3 Human histo-blood group A transferase (AT) catalyzes the biosynthesis of oligosaccharide A antigen important in blood transfusion and cell/tissue/organ transplantation. This enzyme may synthesize Forssman antigen (FORS1) of the FORS blood group system when exon 3 or 4 of the AT mRNA is deleted and/or the LeuGlyGly tripeptide at codons 266–268 of AT is replaced by GlyGlyAla. The Met69Ser/Thr substitutions also confer weak Forssman glycolipid synthase (FS) activity. In this study, we prepared the human AT derivative constructs containing any of the 20 amino acids at codon 69 with and without the GlyGlyAla substitution, transfected DNA to newly generated COS1(B3GALNT1 + A4GALT) cells expressing an enhanced level of globoside (Gb4), the FS acceptor substrate, and immunologically examined the FORS1 expression. Our results showed that all those substitution constructs at codon 69 exhibited FS activity. The combination with GlyGlyAla signifcantly increased the activity. The conserved methionine residue in the ABO, but not GBGT1, gene-encoded proteins may implicate its contribution to the separation of these genes in genetic evolution. Surprisingly, with increased Gb4 availability, the original human AT with the methionine residue at codon 69 was also demonstrated to synthesize FORS1, providing another molecular mechanism of FORS1 appearance in cancer of ordinary FORS1- negative individuals. -
SUPPLEMENTARY DATA ABO Blood Group Determined by Genotyping in the NEO Study in the NEO Genotype Data, Only Rs8176749:G>A Was Directly Genotyped on the Array
SUPPLEMENTARY DATA ABO blood group determined by genotyping in the NEO study In the NEO genotype data, only rs8176749:G>A was directly genotyped on the array. Rs7853989:G>C was derived by imputation, with an imputation quality of 0.99. Rs8176719:insC and rs8176750:delC were not available and replaced by rs8176645:A>T (R2=0.98 with rs8176719:insC, imputation quality of 0.80) and rs8176704:G>A (R2=0.99 with rs8176750:delC, imputation quality of 0.99) separately. The best guess genotypes for the imputed SNPs were determined by the highest probability of the genotype with a minimum threshold of 0.7. If the highest probability of the genotype was below the minimum threshold, the genotype of that SNP was set to missing. Theoretically, 15 combinations of the four ABO alleles were possible, and 14 out of the 15 combinations were observed in the current NEO study population. Modelling the effects of ABO gene expression changes on insulin secretion in vitro The knock-down efficiency was assessed by Q-PCR (Light Cycler 480-II Real-time PCR system - Roche) on total RNA extracted using RNeasy kit (Qiagen), and reversed transcribed using M-MLV reverse transcriptase (Invitrogen). Fold induction was calculated using the DeltaCT method with GAPDH as housekeeping gene. The primers used were the following: ABO-Fw: ACAGACACTGAACCATCCTGGGTT; ABO-Rv: AGACAAACACTGCGAAGGGAAGGA; GAPDH-Fw: ATCATCCCTGCATCCACTG; GAPDH-Rv: ATCATACTTGGCAGGTTTCTCC. Transduced MIN6 cells were subjected to a GSIS assay. Briefly, cells were pre-incubated in a modified Krebs-Ringer bicarbonate buffer with HEPES (KRBH) containing 2 mmol/l glucose for 1.5 h at 37°C. -
A Novel ABO Gene Variant Leads to Discrepant Results in Forward/Reverse and Molecular Blood Grouping
Original Article Transfus Med Hemother 2013;40:454–458 Received: March 26, 2013 DOI: 10.1159/000356378 Accepted: May 13, 2013 Published online: October 27, 2013 A Novel ABO Gene Variant Leads to Discrepant Results in Forward/Reverse and Molecular Blood Grouping Meike Goebela Ines Halm-Heinrichb Andreas Parknerb Gabriele Rinka Marcell U. Heimb Peter Bugerta a Institute of Transfusion Medicine and Immunology, Medical Faculty Mannheim, Heidelberg University; German Red Cross Blood Service Baden-Württemberg – Hessen, Mannheim, b Institute of Transfusion Medicine and Immunohematology, Otto-von-Guericke University Hospital, Magdeburg, Germany Keywords Introduction ABO phenotyping and genotyping · ABO sequencing ABO gene variant · PCR-SSP The ABO gene is located on the long arm of human chro- mosome 9 and consists of 7 exons. Exons 6 and 7 encode the Summary major proportion including the catalytic domain of the glyco- Background: Discrepant results in antigen and reverse syltransferases that mediate the expression of A and B anti- ABO blood typing are often caused by a variant ABO gens [1, 2]. A number of studies have shown a clear genotype- gene. Molecular analysis can help to characterize such phenotype correlation [3–5], and almost 300 gene variants are variants. Here, we describe the identification of a novel listed in the open access database dbRBC at the NCBI web- ABO gene variant in a patient with aberrant ABO pheno- site [6]. Most of the gene variants are characterized by one or type and discrepant genotyping results. Methods: A pa- more SNPs leading to amino acid changes or stop codons. In tient with discrepant results in automated forward and addition, some variants result from nucleotide insertions or reverse ABO phenotyping was further investigated by deletions (INDELs) mostly leading to a frame shift of the serological (gel and tube technique) and molecular (com- reading frame and subsequent alteration of the encoded mercial and inhouse PCR-SSP, DNA sequencing) meth- amino acid sequence. -
The Maternal Effect Gene, Abnormal Oocyte (Abo), of Drosophila Melanogaster Encodes a Specific Negative Regulator of Histones
The maternal effect gene, abnormal oocyte (abo), of Drosophila melanogaster encodes a specific negative regulator of histones Maria Berloco*, Laura Fanti†, Achim Breiling‡, Valerio Orlando‡, and Sergio Pimpinelli†§ *Istituto di Genetica, Universita`di Bari, 70126 Bari, Italy; †Istituto Pasteur, Fondazione Cenci Bolognetti, Dipartimento di Genetica e Biologia Molecolare, Universita`‘‘La Sapienza,’’ 00185 Roma, Italy; and ‡DIBIT, San Raffaele Scientific Institute, 20132 Milano, Italy Communicated by Dan L. Lindsley, University of California, San Diego, La Jolla, CA, August 14, 2001 (received for review May 23, 2001) The abnormal oocyte (abo) gene of Drosophila melanogaster is a pGEM11zF (Promega). Clones were sequenced by using peculiar maternal effect gene whose mutations cause a maternal- AmpliCycle Sequencing Kit (Perkin–Elmer). effect lethality that can be rescued by specific regions of hetero- To make the expression construct for enhanced green fluo- chromatin during early embryogenesis. Here we show that abo rescent protein (EGFP)-tagged Abo, a GFP gene fragment was encodes an evolutionary conserved chromosomal protein that fused to the 3Јend of the abo gene by using the pP{GS[ryϩ, localizes exclusively to the histone gene cluster and binds to the UASEGFP]} vector and the method described in ref. 5. The regulatory regions of such genes. We also show a significant germline transformation was carried out according to ref. 6. increase of histone transcripts in eggs of abo mutant mothers and a partial rescue of the abo maternal-effect defect by deficiencies of Isolation of RNA and Northern Blot Analyses. For abo RNA blot the histone gene cluster. On the basis of these results, we suggest analyses, Drosophila RNA samples were isolated by using the that the Abo protein functions specifically as a negative regulator Ultraspec II RNA Isolation System, according to manufacturer’s of histone transcription and propose a molecular model to account instruction (Biotecx Laboratories, Houston). -
A Cell-Specific Regulatory Region of the Human ABO Blood Group Gene
www.nature.com/scientificreports OPEN A cell‑specifc regulatory region of the human ABO blood group gene regulates the neighborhood gene encoding odorant binding protein 2B Rie Sano1*, Yoichiro Takahashi1, Haruki Fukuda1, Megumi Harada1, Akira Hayakawa1, Takafumi Okawa1, Rieko Kubo1, Haruo Takeshita2, Junichi Tsukada3 & Yoshihiko Kominato1 The human ABO blood group system is of great importance in blood transfusion and organ transplantation. ABO transcription is known to be regulated by a constitutive promoter in a CpG island and regions for regulation of cell‑specifc expression such as the downstream + 22.6‑kb site for epithelial cells and a site in intron 1 for erythroid cells. Here we investigated whether the + 22.6‑kb site might play a role in transcriptional regulation of the gene encoding odorant binding protein 2B (OBP2B), which is located on the centromere side 43.4 kb from the + 22.6‑kb site. In the gastric cancer cell line KATOIII, quantitative PCR analysis demonstrated signifcantly reduced amounts of OBP2B and ABO transcripts in mutant cells with biallelic deletions of the site created using the CRISPR/Cas9 system, relative to those in the wild‑type cells, and Western blotting demonstrated a corresponding reduction of OBP2B protein in the mutant cells. Moreover, single‑molecule fuorescence in situ hybridization assays indicated that the amounts of both transcripts were correlated in individual cells. These fndings suggest that OBP2B could be co‑regulated by the + 22.6‑kb site of ABO. Te human ABO blood group system is of great importance in blood transfusion and organ transplantation. Te carbohydrate structures of ABO blood group antigens are produced by the A- and B-transferases encoded by the A and B alleles, respectively1.