DOCSLIB.ORG

Original Article Increased Expression of Sestrin2 in Human and Experimental Heart Failure

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Original Article Increased Expression of Sestrin2 in Human and Experimental Heart Failure Int J Clin Exp Pathol 2016;9(8):8075-8082 www.ijcep.com /ISSN:1936-2625/IJCEP0026068 Original Article Increased expression of Sestrin2 in human and experimental heart failure Menglong Wang*, Jianfang Liu*, Juanjuan Qin, Menglin Liu, Ying Feng, Lei Shi, Wenhui Yuan, Jing Ye, Jun Wan Department of Cardiology, Cardiovascular Research Institute, Hubei Key Laboratory of Cardiology, Renmin Hospi- tal of Wuhan University, Wuhan, PR China. *Equal contributors. Received February 16, 2016; Accepted June 13, 2016; Epub August 1, 2016; Published August 15, 2016 Abstract: Background: Sestrins (Sesns) are originally identified as critical antioxidant proteins and involved in com- plex regulation of cell viability in response to diverse stress conditions. However, the exact expression and func- tion of Sesns in heart failure (HF) remains unclear. Methods and results: Sesns expression was detected in heart samples from end-stage HF patients and unmatched donors by real-time polymerase chain reaction (RT-PCR), Western Blotting and Immunofluorescence. Mice myocardial ischemia/ reperfusion (I/R) and myocardial infarc- tion (MI) models and doxorubicin induced rat HF model were established to confirm the heart expression of Sesns. Sesn2 was significantly increased, whereas, no alteration for Sesn1 or Sesn3 in failing hearts when comparing with control hearts. Unexpectedly, the mRNA expression of Sesn2 in ischemic cardiomyopathy was higher than that in dilated cardiomyopathy. Immunofluorescence staining revealed all Sesns were expressed in non-cardiomyocytes in human heart. Furthermore, Sesn2 was co-expressed with vimentin, a marker for fibroblasts. Correlation analysis demonstrated Sesn2 levels were significantly correlated with expression levels of natriuretic peptide B (NPPB) and connective tissue growth factor (CTGF), markers for severity of HF and cardiac fibrosis. Meanwhile, the increased Sesn2 was validated in mice I/R and MI models, and also in doxorubicin induced rat HF model. Conclusions: Sesn2, which is expressed in cardiac fibroblasts, could be a potential biomarker to reflect the severity of HF and might play an important role during cardiac remodeling. Keywords: Heart failure, Sestrin, oxidative stress, fibrosis, biomarker Introduction and Sesn3), while most invertebrate express only one Sesn. The Sesn family proteins can be Redox signaling plays important role not only in induced by a variety of environmental stresses, physiological processes, but also in pathologi- including DNA damage, oxidative stress, and cal conditions in heart. At low concentrations, hypoxia [6, 8]. Once induced, Sesns can protect ROS modulate excitation-contraction coupling, cells against oxidative stress [9-11]. cell proliferation and differentiation through changes in cellular signalling and gene expres- It has been revealed that Sesn can maintain sion [1-3]. However, overproduction of ROS may cardiac function against aging in Drosophila result adverse cardiac remodeling, leading to [12]. Sesn null mutants and heart-specific de- further worsening of cardiac function [1]. It is pletion of Sesn cause irregularity of heart- accepted that oxidative stress is at least one beat, cardiac dilation, ultimately leading to de- main cause of heart failure (HF) [4]. Target- creased cardiac function [12]. Recently, a pro- ing oxidative stress is becoming an important tective function of Sesn2 against cardiac isch- strategy to fight HF. emia and reperfusion injury was demonstrated in mice. However, the expression and function Sestrins (Sesns) are highly conserved proteins of Sesns during HF remains unclear. In the pres- originally identified as critical antioxidant with ent study, we aimed to examine the expression sulfinic acid reductase activity, which is neces- of Sesns in human and experimental failing sary for the recycling of peroxiredoxin [5-7]. hearts, and explore their correlation with cardi- Mammals express three Sesns (Sesn1, Sesn2, ac function and fibrosis. Sestrin2 expression in heart failure Table 1. Primer pairs used in the present study thetize mice through intra- Target name Forward primer Reverse primer peritoneal injections (50 mg/ kg, Sigma-Aldrich). To estab- H-GAPDH GGATTTGGTCGTATTGGGCG TTCCCGTTCTCAGCCTTGAC lish myocardial ischemia/re- H-NPPB TCAGCCTCGGACTTGGAAAC AGACCCTTGCACCATCTTGG perfusion (I/R) model, a medi- H-CTGF CGACTGGAAGACACGTTTGG TGCAGGAGGCGTTGTCATT an sternotomy was perform- H-Sesn1 GCATGTTCCAACATTTCGTG TCCCACATCTGGATAAAGGC ed. And then the left coronary H-Sesn2 GCAGGGCCATCTGGAACTAT GTGCCTCCAGAAGAGGTTGT artery (LCA) was ligated with H-Sesn3 ATGCTTTGGCAAGCTTTGTT GCAAGATCACAAACGCAGAA a piece of tubing placed be- R-GAPDH ACGGGAAACCCATCACCATC TGGTGGTGCAGGATGCATTG tween the LCA and the su- R-NPPB TTCCTTAATCTGTCGCCGCTGG CAGCAGCTTCTGCATCGTGGAT ture to minimize coronary ar- tery trauma induced by occlu- R-Sesn1 ACCGAGTACCTTCGTTCTGC ACAGCATAAGCAGATGGGCA sion and to facilitate reperfu- R-Sesn2 CCTTTGTGTTTGGCTGTGGG AGAGCTTCTATGTCACGGGC sion. Reperfusion was initiat- R-Sesn3 CAATGGCCACCCATGAGGAT GCTGTCATACATGCGCTTCG ed after 1 h of occlusion. The M-GAPDH TGATGGGTGTGAACCACGAG TCATGAGCCCTTCCACGATG thoracic cavity was closed, M-NPPB GAGGTCACTCCTATCCTCTGG GCCATTTCCTCCGACTTTTCTC and the animal was extuba- M-Sesn1 GGACGAGGAACTTGGAATCA ATGCATCTGTGCGTCTTCAC ted after recovering consci- M-Sesn2 TAGCCTGCAGCCTCACCTAT TATCTGATGCCAAAGACGCA ousness. The hearts were M-Sesn3 TTACTTGAACGGAGCCTGAAG TCCATCAGAAGCAGATTCACG harvested after reperfusion with 24 h. Same procedure was repeated to establish Materials and methods myocardial infarction (MI) model, and the tho- racic cavity was closed after occlusion of the Human heart tissues LCA. The hearts were harvested at 1 week and 4 weeks after operation. Sham-operated Human heart tissues were collected from animals underwent the same surgical proce- transplanted hearts with end-stage heart fail- dure without LCA occlusion. ure, without diabetes mellitus. All samples were obtained from identical myocardial loci Doxorubicin induced rat heart failure model of left-ventricular to extremely ensure optimal uniformity. Control hearts were procured from Male SD (6-8 weeks old) rats were purchased organ donators who died of traffic accidents from Hunan SJA Laboratory Animal Co., Ltd. with no cardiac disease history. These hearts and were randomly divided into two groups. had originally been intended for transplan- The doxorubicin (Dox) group received Dox (2.5 tation, but failed to get suitable matching re- mg/kg/week) through intraperitoneal inject- cipients. The hearts were immediately dissec- ion for 6 weeks. The control group received tion into small portions, snap-frozen in liquid same volume saline as the same way. Two nitrogen, and then maintained at -80°C until weeks after the last injection, the rats were using. Heart samples used for pathological sacrificed and heart samples were collected study were fixed in 10% phosphate-buffered for research. formalin and embedded in paraffin. Quantitative real-time polymerase chain reac- Fully informed consent was obtained from all tion patients or family members before partici- pating in the study. This study protocol was Total RNA was extracted from heart tissue approved by the Ethics Committee of Renmin with TRIzol reagent (Roche, Indiana) as the Hospital of Wuhan University. manual instructed, and the concentration was assessed by Nanodrop 2000. A total of Mice myocardial ischemia/reperfusion and 2 μg RNA was used to synthesis cDNA using myocardial infarction models Transcriptor First Stand cDNA Synthesis Kit (Roche). Quantitative real-time PCR (qRT-PCR) Male C57BL/6 (8-10 weeks old) mice were pur- was performed with the LightCycler 480 SYBR chased from Hunan SJA Laboratory Animal Co., Green I Master (Roche) using the LightCycler Ltd. Pentobarbital sodium was used to anes- 480 real-time PCR system according to the 8076 Int J Clin Exp Pathol 2016;9(8):8075-8082 Sestrin2 expression in heart failure Table 2. Characteristics for heart failure patients staining was performed to Heart failure (n=28) detect collagen deposition. CTL (n=10) ICM (n=10) DCM (n=18) Immunofluorescence staining was used to further confirm Gender male, n 10 8 15 the expression and the loca- Age (yr), mean ± SD 52.30 ± 4.42 54.00 ± 5.42# 52.93 ± 7.40# tion of Sesns in heart. After LVEDD (mm), mean ± SD - 65.60 ± 10.37 69.63 ± 9.72* a 5-min high-pressure anti- LVEF (%), mean ± SD - 29.80 ± 5.09 25.58 ± 9.20* gen retrieval process (sodium CTL: Control hearts; ICM: Ischemic cardiomyopathy; DCM: Dilated cardiomyopathy; citrate buffer, 100×, pH 6.0), LVEDD: Left ventricular end diastolic diameter; LVEF: Left ventricular ejection frac- tion. #P>0.05 vs. CTL; *P>0.05 vs. ICM. the heart sections were incu- bated in PBS containing 10% fetal bovine serum for 60 min manufacturer’s instructions (Roche). The prim- and subsequently incubated overnight at 4°C er pairs were designed online using Primer- with the primary antibodies. The sections were Blast and were shown in Table 1. The PCR con- then washed with PBS and incubated with ditions used were as follows: initial denatur- the appropriate secondary antibodies for 1 h ation at 95°C for 10 minutes, followed by 40 at 37°C. The secondary antibodies used were cycles of 95°C for 10 seconds (denaturation), goat anti-rabbit IgG Alexa Fluor 568 conju- 60°C for 10 seconds (annealing), and 72°C for gate (Invitrogen, CA) and anti-mouse IgG Alexa 20 seconds (extension). The relative expres- Fluor 568 conjugate (Invitrogen, CA). The nu- sion levels of mRNAs were normalized to
Load more

Recommended publications
  • The Role of Nuclear Lamin B1 in Cell Proliferation and Senescence
    Downloaded from genesdev.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press The role of nuclear lamin B1 in cell proliferation and senescence Takeshi Shimi,1 Veronika Butin-Israeli,1 Stephen A. Adam,1 Robert B. Hamanaka,2 Anne E. Goldman,1 Catherine A. Lucas,1 Dale K. Shumaker,1 Steven T. Kosak,1 Navdeep S. Chandel,2 and Robert D. Goldman1,3 1Department of Cell and Molecular Biology, 2Department of Medicine, Division of Pulmonary and Critical Care Medicine, Feinberg School of Medicine, Northwestern University, Chicago, Illinois 60611, USA Nuclear lamin B1 (LB1) is a major structural component of the nucleus that appears to be involved in the regulation of many nuclear functions. The results of this study demonstrate that LB1 expression in WI-38 cells decreases during cellular senescence. Premature senescence induced by oncogenic Ras also decreases LB1 expression through a retinoblastoma protein (pRb)-dependent mechanism. Silencing the expression of LB1 slows cell proliferation and induces premature senescence in WI-38 cells. The effects of LB1 silencing on proliferation require the activation of p53, but not pRb. However, the induction of premature senescence requires both p53 and pRb. The proliferation defects induced by silencing LB1 are accompanied by a p53-dependent reduction in mitochondrial reactive oxygen species (ROS), which can be rescued by growth under hypoxic conditions. In contrast to the effects of LB1 silencing, overexpression of LB1 increases the proliferation rate and delays the onset of senescence of WI-38 cells. This overexpression eventually leads to cell cycle arrest at the G1/S boundary.
    [Show full text]
  • Ionizing Radiation Exposure of Stem Cell-Derived Chondrocytes Affects
    www.nature.com/scientificreports OPEN Ionizing radiation exposure of stem cell‑derived chondrocytes afects their gene and microRNA expression profles and cytokine production Ewelina Stelcer1,2,3*, Katarzyna Kulcenty1,2, Marcin Rucinski3, Marta Kruszyna‑Mochalska1,4, Agnieszka Skrobala1,4, Agnieszka Sobecka2,5, Karol Jopek3 & Wiktoria Maria Suchorska1,2 Human induced pluripotent stem cells (hiPSCs) can be diferentiated into chondrocyte‑like cells. However, implantation of these cells is not without risk given that those transplanted cells may one day undergo ionizing radiation (IR) in patients who develop cancer. We aimed to evaluate the efect of IR on chondrocyte‑like cells diferentiated from hiPSCs by determining their gene and microRNA expression profle and proteomic analysis. Chondrocyte‑like cells diferentiated from hiPSCs were placed in a purpose‑designed phantom to model laryngeal cancer and irradiated with 1, 2, or 3 Gy. High‑throughput analyses were performed to determine the gene and microRNA expression profle based on microarrays. The composition of the medium was also analyzed. The following essential biological processes were activated in these hiPSC‑derived chondrocytes after IR: "apoptotic process", "cellular response to DNA damage stimulus", and "regulation of programmed cell death". These fndings show the microRNAs that are primarily responsible for controlling the genes of the biological processes described above. We also detected changes in the secretion level of specifc cytokines. This study demonstrates that IR activates DNA damage response mechanisms in diferentiated cells and that the level of activation is a function of the radiation dose. Upper airway reconstruction, including tracheal and laryngotracheal resection and reconstruction, is a common surgical procedure afer resection of tumours or stenotic infammatory lesions 1.
    [Show full text]
  • Multidrug Transporter MRP4/ABCC4 As a Key Determinant of Pancreatic
    www.nature.com/scientificreports OPEN Multidrug transporter MRP4/ ABCC4 as a key determinant of pancreatic cancer aggressiveness A. Sahores1, A. Carozzo1, M. May1, N. Gómez1, N. Di Siervi1, M. De Sousa Serro1, A. Yanef1, A. Rodríguez‑González2, M. Abba3, C. Shayo2 & C. Davio1* Recent fndings show that MRP4 is critical for pancreatic ductal adenocarcinoma (PDAC) cell proliferation. Nevertheless, the signifcance of MRP4 protein levels and function in PDAC progression is still unclear. The aim of this study was to determine the role of MRP4 in PDAC tumor aggressiveness. Bioinformatic studies revealed that PDAC samples show higher MRP4 transcript levels compared to normal adjacent pancreatic tissue and circulating tumor cells express higher levels of MRP4 than primary tumors. Also, high levels of MRP4 are typical of high-grade PDAC cell lines and associate with an epithelial-mesenchymal phenotype. Moreover, PDAC patients with high levels of MRP4 depict dysregulation of pathways associated with migration, chemotaxis and cell adhesion. Silencing MRP4 in PANC1 cells reduced tumorigenicity and tumor growth and impaired cell migration. Transcriptomic analysis revealed that MRP4 silencing alters PANC1 gene expression, mainly dysregulating pathways related to cell-to-cell interactions and focal adhesion. Contrarily, MRP4 overexpression signifcantly increased BxPC-3 growth rate, produced a switch in the expression of EMT markers, and enhanced experimental metastatic incidence. Altogether, our results indicate that MRP4 is associated with a more aggressive phenotype in PDAC, boosting pancreatic tumorigenesis and metastatic capacity, which could fnally determine a fast tumor progression in PDAC patients. Pancreatic ductal adenocarcinoma (PDAC) is one of the most lethal human malignancies, due to its late diag- nosis, inherent resistance to treatment and early dissemination 1.
    [Show full text]
  • Aflatoxin Exposure During Early Life Is Associated with Differential DNA
    International Journal of Molecular Sciences Article Aflatoxin Exposure during Early Life Is Associated with Differential DNA Methylation in Two-Year-Old Gambian Children Akram Ghantous 1,†, Alexei Novoloaca 1,†, Liacine Bouaoun 1, Cyrille Cuenin 1, Marie-Pierre Cros 1, Ya Xu 2,3, Hector Hernandez-Vargas 1,4 , Momodou K. Darboe 5, Andrew M. Prentice 5 , Sophie E. Moore 5,6, Yun Yun Gong 7, Zdenko Herceg 1,‡ and Michael N. Routledge 2,8,*,‡ 1 International Agency for Research on Cancer, 150, Cours Albert Thomas, 69372 Lyon, France; [email protected] (A.G.); [email protected] (A.N.); [email protected] (L.B.); [email protected] (C.C.); [email protected] (M.-P.C.); [email protected] (H.H.-V.); [email protected] (Z.H.) 2 School of Medicine, University of Leeds, Leeds LS2 9JT, UK; [email protected] 3 Guangdong Provincial Key Laboratory of Malignant Tumor Epigenetics and Gene Regulation, Medical Research Center, Sun-Yat Sen University, Guangzhou 510006, China 4 Cancer Research Centre of Lyon (CRCL), Université de Lyon, 69008 Lyon, France 5 MRC Unit the Gambia at the London School of Hygiene and Tropical Medicine, Atlantic Boulevard, Fajara, Banjul P.O. Box 273, The Gambia; [email protected] (M.K.D.); [email protected] (A.M.P.); [email protected] (S.E.M.) 6 Department of Women and Children’s Health, King’s College London, St Thomas’ Hospital, London SE1 7EH, UK Citation: Ghantous, A.; Novoloaca, 7 School of Food Science and Nutrition, University of Leeds, Leeds LS2 9JT, UK; [email protected] 8 A.; Bouaoun, L.; Cuenin, C.; Cros, School of Food and Biological Engineering, Jiangsu University, Zhenjiang 212013, China M.-P.; Xu, Y.; Hernandez-Vargas, H.; * Correspondence: [email protected] Darboe, M.K.; Prentice, A.M.; Moore, † Joint first authors.
    [Show full text]
  • The Genetics of Bipolar Disorder
    Molecular Psychiatry (2008) 13, 742–771 & 2008 Nature Publishing Group All rights reserved 1359-4184/08 $30.00 www.nature.com/mp FEATURE REVIEW The genetics of bipolar disorder: genome ‘hot regions,’ genes, new potential candidates and future directions A Serretti and L Mandelli Institute of Psychiatry, University of Bologna, Bologna, Italy Bipolar disorder (BP) is a complex disorder caused by a number of liability genes interacting with the environment. In recent years, a large number of linkage and association studies have been conducted producing an extremely large number of findings often not replicated or partially replicated. Further, results from linkage and association studies are not always easily comparable. Unfortunately, at present a comprehensive coverage of available evidence is still lacking. In the present paper, we summarized results obtained from both linkage and association studies in BP. Further, we indicated new potential interesting genes, located in genome ‘hot regions’ for BP and being expressed in the brain. We reviewed published studies on the subject till December 2007. We precisely localized regions where positive linkage has been found, by the NCBI Map viewer (http://www.ncbi.nlm.nih.gov/mapview/); further, we identified genes located in interesting areas and expressed in the brain, by the Entrez gene, Unigene databases (http://www.ncbi.nlm.nih.gov/entrez/) and Human Protein Reference Database (http://www.hprd.org); these genes could be of interest in future investigations. The review of association studies gave interesting results, as a number of genes seem to be definitively involved in BP, such as SLC6A4, TPH2, DRD4, SLC6A3, DAOA, DTNBP1, NRG1, DISC1 and BDNF.
    [Show full text]
  • Arsenic Trioxide-Mediated Suppression of Mir-182-5P Is Associated with Potent Anti-Oxidant Effects Through Up-Regulation of SESN2
    www.impactjournals.com/oncotarget/www.oncotarget.com Oncotarget, 2018,Oncotarget, Vol. 9, (No.Advance 22), Publicationspp: 16028-16042 2018 Research Paper Arsenic trioxide-mediated suppression of miR-182-5p is associated with potent anti-oxidant effects through up-regulation of SESN2 Liang-Ting Lin1,10,*, Shin-Yi Liu2,*, Jyh-Der Leu3,4,*, Chun-Yuan Chang1, Shih-Hwa Chiou5,6,7, Te-Chang Lee7,8 and Yi-Jang Lee1,9 1Department of Biomedical Imaging and Radiological Sciences, National Yang-Ming University, Taipei, Taiwan 2Department of Radiation Oncology, MacKay Memorial Hospital, Taipei, Taiwan 3Division of Radiation Oncology, Taipei City Hospital Ren Ai Branch, Taipei, Taiwan 4Institute of Neuroscience, National Chengchi University, Taipei, Taiwan 5Department of Medical Research and Education, Taipei Veterans General Hospital, Taipei, Taiwan 6Institute of Clinical Medicine, School of Medicine, National Yang-Ming University, Taipei, Taiwan 7Institute of Pharmacology, National Yang-Ming University, Taipei, Taiwan 8Institute of Biomedical Sciences, Academia Sinica, Taipei, Taiwan 9Biophotonics and Molecular Imaging Research Center (BMIRC), National Yang-Ming University, Taipei, Taiwan 10Current address: Department of Health Technology and Informatics, The Hong Kong Polytechnic University, Hong Kong *These authors have contributed equally to this work Correspondence to: Te-Chang Lee, email: [email protected] Yi-Jang Lee, email: [email protected] Keywords: arsenic trioxide; sestrin 2; miR-182; oxidative stress; anti-oxidant effect Received: April 12, 2017 Accepted: February 24, 2018 Published: March 23, 2018 Copyright: Lin et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License 3.0 (CC BY 3.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
    [Show full text]
  • Downregulation of SNRPG Induces Cell Cycle Arrest and Sensitizes Human Glioblastoma Cells to Temozolomide by Targeting Myc Through a P53-Dependent Signaling Pathway
    Cancer Biol Med 2020. doi: 10.20892/j.issn.2095-3941.2019.0164 ORIGINAL ARTICLE Downregulation of SNRPG induces cell cycle arrest and sensitizes human glioblastoma cells to temozolomide by targeting Myc through a p53-dependent signaling pathway Yulong Lan1,2*, Jiacheng Lou2*, Jiliang Hu1, Zhikuan Yu1, Wen Lyu1, Bo Zhang1,2 1Department of Neurosurgery, Shenzhen People’s Hospital, Second Clinical Medical College of Jinan University, The First Affiliated Hospital of Southern University of Science and Technology, Shenzhen 518020, China;2 Department of Neurosurgery, The Second Affiliated Hospital of Dalian Medical University, Dalian 116023, China ABSTRACT Objective: Temozolomide (TMZ) is commonly used for glioblastoma multiforme (GBM) chemotherapy. However, drug resistance limits its therapeutic effect in GBM treatment. RNA-binding proteins (RBPs) have vital roles in posttranscriptional events. While disturbance of RBP-RNA network activity is potentially associated with cancer development, the precise mechanisms are not fully known. The SNRPG gene, encoding small nuclear ribonucleoprotein polypeptide G, was recently found to be related to cancer incidence, but its exact function has yet to be elucidated. Methods: SNRPG knockdown was achieved via short hairpin RNAs. Gene expression profiling and Western blot analyses were used to identify potential glioma cell growth signaling pathways affected by SNRPG. Xenograft tumors were examined to determine the carcinogenic effects of SNRPG on glioma tissues. Results: The SNRPG-mediated inhibitory effect on glioma cells might be due to the targeted prevention of Myc and p53. In addition, the effects of SNRPG loss on p53 levels and cell cycle progression were found to be Myc-dependent. Furthermore, SNRPG was increased in TMZ-resistant GBM cells, and downregulation of SNRPG potentially sensitized resistant cells to TMZ, suggesting that SNRPG deficiency decreases the chemoresistance of GBM cells to TMZ via the p53 signaling pathway.
    [Show full text]
  • Functional Genomics Study of Acute Heat Stress Response in the Small
    www.nature.com/scientificreports OPEN Functional genomics study of acute heat stress response in the small yellow follicles of layer-type Received: 30 January 2017 Accepted: 11 December 2017 chickens Published: xx xx xxxx Chuen-Yu Cheng1, Wei-Lin Tu1, Chao-Jung Chen2,3, Hong-Lin Chan4,5, Chih-Feng Chen1,6,7, Hsin-Hsin Chen1, Pin-Chi Tang1,2, Yen-Pai Lee1, Shuen-Ei Chen1,6,7 & San-Yuan Huang 1,6,7,8 This study investigated global gene and protein expression in the small yellow follicle (SYF; 6–8 mm in diameter) tissues of chickens in response to acute heat stress. Twelve 30-week-old layer-type hens were divided into four groups: control hens were maintained at 25 °C while treatment hens were subjected to acute heat stress at 36 °C for 4 h without recovery, with 2-h recovery, and with 6-h recovery. SYFs were collected at each time point for mRNA and protein analyses. A total of 176 genes and 93 distinct proteins with diferential expressions were identifed, mainly associated with the molecular functions of catalytic activity and binding. The upregulated expression of heat shock proteins and peroxiredoxin family after acute heat stress is suggestive of responsive machineries to protect cells from apoptosis and oxidative insults. In conclusion, both the transcripts and proteins associated with apoptosis, stress response, and antioxidative defense were upregulated in the SYFs of layer-type hens to alleviate the detrimental efects by acute heat stress. However, the genomic regulations of specifc cell type in response to acute heat stress of SYFs require further investigation.
    [Show full text]
  • Variation in Protein Coding Genes Identifies Information Flow
    bioRxiv preprint doi: https://doi.org/10.1101/679456; this version posted June 21, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Animal complexity and information flow 1 1 2 3 4 5 Variation in protein coding genes identifies information flow as a contributor to 6 animal complexity 7 8 Jack Dean, Daniela Lopes Cardoso and Colin Sharpe* 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 Institute of Biological and Biomedical Sciences 25 School of Biological Science 26 University of Portsmouth, 27 Portsmouth, UK 28 PO16 7YH 29 30 * Author for correspondence 31 [email protected] 32 33 Orcid numbers: 34 DLC: 0000-0003-2683-1745 35 CS: 0000-0002-5022-0840 36 37 38 39 40 41 42 43 44 45 46 47 48 49 Abstract bioRxiv preprint doi: https://doi.org/10.1101/679456; this version posted June 21, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Animal complexity and information flow 2 1 Across the metazoans there is a trend towards greater organismal complexity. How 2 complexity is generated, however, is uncertain. Since C.elegans and humans have 3 approximately the same number of genes, the explanation will depend on how genes are 4 used, rather than their absolute number.
    [Show full text]
  • Identifying Rare Genetic Variation in Obsessive-Compulsive Disorder
    Yale University EliScholar – A Digital Platform for Scholarly Publishing at Yale Yale Medicine Thesis Digital Library School of Medicine January 2020 Identifying Rare Genetic Variation In Obsessive-Compulsive Disorder Sarah Abdallah Follow this and additional works at: https://elischolar.library.yale.edu/ymtdl Recommended Citation Abdallah, Sarah, "Identifying Rare Genetic Variation In Obsessive-Compulsive Disorder" (2020). Yale Medicine Thesis Digital Library. 3876. https://elischolar.library.yale.edu/ymtdl/3876 This Open Access Thesis is brought to you for free and open access by the School of Medicine at EliScholar – A Digital Platform for Scholarly Publishing at Yale. It has been accepted for inclusion in Yale Medicine Thesis Digital Library by an authorized administrator of EliScholar – A Digital Platform for Scholarly Publishing at Yale. For more information, please contact [email protected]. Identifying Rare Genetic Variation in Obsessive-Compulsive Disorder A Thesis Submitted to the Yale University School of Medicine in Partial Fulfillment of the Requirements for the Degree of Doctor of Medicine by Sarah Barbara Abdallah 2020 ABSTRACT IDENTIFYING RARE GENETIC VARIATION IN OBSESSIVE-COMPULSIVE DISORDER Sarah B. Abdallah, Carolina Cappi, Emily Olfson, and Thomas V. Fernandez. Child Study Center, Yale University School of Medicine, New Haven, CT Obsessive-compulsive disorder (OCD) is a neuropsychiatric developmental disorder with known heritability (estimates ranging from 27%-80%) but poorly understood etiology. Current treatments are not fully effective in addressing chronic functional impairments and distress caused by the disorder, providing an impetus to study the genetic basis of OCD in the hopes of identifying new therapeutic targets. We previously demonstrated a significant contribution to OCD risk from likely damaging de novo germline DNA sequence variants, which arise spontaneously in the parental germ cells or zygote instead of being inherited from a parent, and we successfully used these identified variants to implicate new OCD risk genes.
    [Show full text]
  • Sestrin2 Aggravates Oxidative Stress of Neurons by Decreasing the Expression of Nrf2
    European Review for Medical and Pharmacological Sciences 2018; 22: 3493-3501 Sestrin2 aggravates oxidative stress of neurons by decreasing the expression of Nrf2 L.-L. ZHANG, Z.-J. ZHANG Department of Neurology, Hangzhou Fuyang Hospital of Traditional Chinese Medicine, Zhejiang, China Abstract. – OBJECTIVE: Oxidative injury is an Introduction essential part of the pathological changes of ce- rebral ischemia-reperfusion. Sestrin2 (Sesn2), a conserved antioxidant protein, is activated Stroke is a neurological deficit syndrome under stress to protect cells against oxidative caused by acute vascular or blood abnormalities stress. This study mainly explored the function leading to disorders of blood circulation in the and mechanism of Sesn2 during cerebral isch- brain. It is one of the diseases that severely affects emia-reperfusion injury in rats. human health and cause deaths worldwide1-3. Pre- MATERIALS AND METHODS: Oxygen-glu- vention and treatment of ischemic stroke research cose deprivation/reoxygenation (OGD/R) mod- have received more and more attention. Cerebral el of primary neurons was established. MTS and LDH (lactate dehydrogenase) kit were used to ischemia-reperfusion injury is a very complex detect cell viability and cell damage by colori- pathophysiological process, showing a rapid cas- metric method. The superoxide dismutase (SOD) cade reaction. The mechanism mainly includes kit and malondialdehyde (MDA) kit were used to overload of intracellular calcium (Ca), lipid per- access the level of SOD and MDA in neurons. oxidation, oxygen free radical damage, apoptosis To establish a model of middle cerebral artery gene activation, excitement (EAA) cytotoxicity, occlusion (MCAO) in adult male Sprague-Daw- 4-7 ley (SD) rats, the process of cerebral isch- inflammatory cytokine damage, etc.
    [Show full text]
  • Molecular Targeting and Enhancing Anticancer Efficacy of Oncolytic HSV-1 to Midkine Expressing Tumors
    University of Cincinnati Date: 12/20/2010 I, Arturo R Maldonado , hereby submit this original work as part of the requirements for the degree of Doctor of Philosophy in Developmental Biology. It is entitled: Molecular Targeting and Enhancing Anticancer Efficacy of Oncolytic HSV-1 to Midkine Expressing Tumors Student's name: Arturo R Maldonado This work and its defense approved by: Committee chair: Jeffrey Whitsett Committee member: Timothy Crombleholme, MD Committee member: Dan Wiginton, PhD Committee member: Rhonda Cardin, PhD Committee member: Tim Cripe 1297 Last Printed:1/11/2011 Document Of Defense Form Molecular Targeting and Enhancing Anticancer Efficacy of Oncolytic HSV-1 to Midkine Expressing Tumors A dissertation submitted to the Graduate School of the University of Cincinnati College of Medicine in partial fulfillment of the requirements for the degree of DOCTORATE OF PHILOSOPHY (PH.D.) in the Division of Molecular & Developmental Biology 2010 By Arturo Rafael Maldonado B.A., University of Miami, Coral Gables, Florida June 1993 M.D., New Jersey Medical School, Newark, New Jersey June 1999 Committee Chair: Jeffrey A. Whitsett, M.D. Advisor: Timothy M. Crombleholme, M.D. Timothy P. Cripe, M.D. Ph.D. Dan Wiginton, Ph.D. Rhonda D. Cardin, Ph.D. ABSTRACT Since 1999, cancer has surpassed heart disease as the number one cause of death in the US for people under the age of 85. Malignant Peripheral Nerve Sheath Tumor (MPNST), a common malignancy in patients with Neurofibromatosis, and colorectal cancer are midkine- producing tumors with high mortality rates. In vitro and preclinical xenograft models of MPNST were utilized in this dissertation to study the role of midkine (MDK), a tumor-specific gene over- expressed in these tumors and to test the efficacy of a MDK-transcriptionally targeted oncolytic HSV-1 (oHSV).
    [Show full text]