sign in sign up
<<
Home , Centrin, Centrosome, Ninein

1134 Research Article Stability of the small γ- complex requires HCA66, a of the and the

Xavier Fant1, Nicole Gnadt1, Laurence Haren2 and Andreas Merdes1,2,* 1Wellcome Trust Centre for Biology, University of Edinburgh, Mayfield Road, Edinburgh EH9 3JR, UK 2Centre National de la Recherche Scientifique–Pierre Fabre, 3 rue des Satellites, 31400 Toulouse, France *Author for correspondence (e-mail: [email protected])

Accepted 16 December 2008 Journal of Cell Science 122, 1134-1144 Published by The Company of Biologists 2009 doi:10.1242/jcs.035238

Summary To investigate changes at the centrosome during the , (γ-tubulin, GCP2, and GCP3) in HCA66-depleted cells. By we analyzed the composition of the contrast, the levels of γ-tubulin ring complex such as from unsynchronized and S-phase-arrested cells by gel GCP4 and GCP-WD/NEDD1 were unaffected. We propose that electrophoresis and mass spectrometry. We identified HCA66, HCA66 is a novel regulator of γ-tubulin function that plays a a protein that localizes to the centrosome from S-phase to role in stabilizing components of the γ-tubulin small complex, and to the nucleolus throughout interphase. Silencing of HCA66 which is in turn essential for assembling the larger γ-tubulin expression resulted in failure of centrosome duplication ring complex. and in the formation of monopolar spindles, reminiscent of the phenotype observed after γ-tubulin silencing. Immunofluorescence microscopy showed that proteins of the Supplementary material available online at γ-tubulin ring complex were absent from the centrosome in http://jcs.biologists.org/cgi/content/full/122/8/1134/DC1 these monopolar spindles. Immunoblotting revealed reduced protein levels of all components of the γ-tubulin small complex Key words: Centrosome, γ-Tubulin, Mitosis, Monopolar, Spindle

Introduction phosphorylation-dependent manner. Recruitment of γ-tubulin in The centrosome constitutes a major -organizing centre mammalian cells may be further supported by a protein that in cells. are nucleated and anchored at the associates with the γ-tubulin ring complex and that attaches to the surface of the centrosome, at the pericentriolar material. γ-Tubulin centrosome, termed GCP-WD or NEDD1 (Lüders et al., 2006; is a major component of the pericentriolar material and supports Haren et al., 2006).

Journal of Cell Science . It is in dynamic exchange with a free To identify novel proteins that are responsible for cell cycle- cytoplasmic pool (Khodjakov and Rieder, 1999), and is found in dependent regulation of γ-tubulin, we compared the composition two major protein complexes (Oegema et al., 1999): a small ‘γ- of the pericentriolar material at different phases of the cell cycle. TuSC’ (γ-tubulin small complex), containing two molecules of γ- We characterized HCA66 as a protein of the nucleolus that tubulin associated with one molecule each of the γ-tubulin complex associates with the centrosome specifically from S-phase to mitosis. proteins GCP2 and GCP3; furthermore, a large ‘γ-TuRC’ (γ-tubulin HCA66 has initially been identified as an autoimmune antigen in ring complex), consisting of multiple γ-TuSCs and additional hepatocellular carcinomas, and has recently been found to bind to proteins, including GCP4, GCP5 and GCP6 (for a review, see the protein Apaf-1 of the apoptosis pathway (Wang et al., 2002; Raynaud-Messina and Merdes, 2007). The amount of γ-tubulin at Piddubnyak et al., 2007). In the present study, we demonstrate that the centrosome is regulated during the cell cycle and increases HCA66 is required for the stability of γ-TuSC proteins, and that sharply at the beginning of mitosis, when spindle formation requires silencing of HCA66 expression produces defects in an increase in microtubule nucleation activity (Zheng et al., 1991; duplication and spindle microtubule assembly. Lajoie-Mazenc et al., 1994; Khodjakov and Rieder, 1999). After completion of mitosis, the amounts of centrosome-bound γ-tubulin Results are reduced to interphase levels. So far, the mechanisms that regulate HCA66 is a nucleolar protein that associates transiently with γ-tubulin-dependent activity are only partly understood. Several the centrosome kinases have been implicated in regulating the recruitment of γ- To study changes at the centrosome during the cell cycle, we tubulin to the centrosome, such as Aurora A and (Lane and compared the protein composition of the pericentriolar material from Nigg, 1996; Hannak et al., 2001; Berdnik and Knoblich, 2002; unsynchronized Jurkat cells (66% in G1 phase, 25% in , as Terada et al., 2003). Moreover, the cell cycle-dependent recruitment verified by flow cytometry), and from Jurkat cells arrested in S of γ-tubulin complexes depends on proteins of the pericentriolar phase by a double aphidicolin block (85% in S phase, 10% in G1). material such as pericentrin, or ninein-like protein (Takahashi were isolated after lysis using a sucrose gradient, and et al., 2002; Casenghi et al., 2003; Chen et al., 2003; Zimmerman centrosome-containing fractions were pooled and extracted with 1 et al., 2004; Delgehyr et al., 2005). Whereas pericentrin recruits M potassium iodide to solubilize the pericentriolar material. The increased amounts of γ-tubulin complexes to the mitotic centrosome soluble pericentriolar material obtained from unsynchronized cells via GCP2 and GCP3, ninein and ninein-like protein anchor γ-tubulin (‘async’) or from S-phase-arrested cells (‘S’) was then compared preferably during interphase but are displaced during mitosis in a by gel electrophoresis (Fig. 1A). Bands with significantly increased HCA66 and γ-TuSC stability 1135

Fig. 1. HCA66 is a novel protein of the nucleolus and the centrosome. (A) Silver stained SDS-PAGE of pericentriolar material extracted from centrosomes of asynchronous Jurkat cells (async) or cells arrested in S phase (S). The arrowhead shows the band identified as HCA66. The sizes of the molecular weight markers (Mr) are indicated on the right. (B) Schematic representation of human HCA66, showing seven predicted HAT repeats (black boxes). Amino acid positions of the N and C termini (1 and 597), and the repeats are indicated. The region of HCA66 used for immunization of rabbits is indicated with a black line. (C) Immunoblots of whole cell lysates from HeLa and U-2 OS cells. Left: HeLa lysate probed with anti-HCA66 antibody (imm.) or the corresponding pre-immune serum (pre.). Right: lysates of regular U-2 OS cells or cells expressing GFP-HCA66, probed with anti-HCA66. Black arrowhead indicates HCA66, white arrowhead indicates GFP:HCA66. The positions of molecular weight markers (Mr) are indicated. (D) Immunoblots of U-2 OS cells after fractionation in buffer containing 50 mM Tris Journal of Cell Science (pH 6.8), 250 mM NaCl and the detergents Triton X-100 and deoxycholate (DOC) at increasing concentrations, as indicated. s, supernatant; p, pellet. (E) Immunofluorescence of U-2 OS cells stained with antibodies against endogenous HCA66, or transfected with GFP:HCA66. Cells were co-stained with antibodies against γ-tubulin or nucleophosmin (NPM). Nucleolar HCA66 is not in focus in the cell depicted in the second row. Arrowheads indicate the position of the centrosome. Scale bars: 10 μm.

intensity in S phase were investigated by MALDI-tof mass were obtained in U-2 OS cells (Fig. 1C). Moreover, our antibody spectrometry. One of these bands (Fig. 1A) was identified as recognized a higher molecular weight band in lysates from U-2 OS hepatocellular carcinoma-associated antigen 66 (HCA66), a protein cells overexpressing GFP:HCA66, corresponding to the GFP-tagged of 597 amino acids. Database searches revealed highly homologous protein (Fig. 1C). Fractionation of cells with salt and detergent sequences from ESTs in mouse, and budding yeast. revealed that HCA66 is largely insoluble. Most of HCA66 was found Alignment of HCA66 protein sequences (supplementary material in the pellet after extraction and centrifugation (Fig. 1D), and visual Fig. S1) showed that the N-terminal half of HCA66 (amino acids inspection revealed that all nuclei accumulated in these fractions. 1-202) is the most conserved region within the protein (30% identity Immunofluorescence experiments with our HCA66 antibody revealed + 31% conservative exchanges between budding yeast and human), a strong staining of the nucleolus, colocalizing with the marker suggesting an important role of this region for the function of the nucleophosmin (Fig. 1E). Consistently, proteomic analysis identified protein. Structure prediction software identified seven HAT repeats HCA66 as a nucleolar component (Andersen et al., 2005). Our in HCA66 (Fig. 1B). These are ‘half-a-tetratrico-peptide’ repeats immunofluorescence data further revealed one or two discrete dots with structural similarities to TPR and HEAT repeats; each repeat in the that colocalized with the centrosomal marker γ- is predicted to form two short amphipathic α-helices connected by tubulin (Fig. 1E). Expression of a GFP:HCA66 fusion construct a loop (Preker and Keller, 1998). HAT repeats in HCA66 were found confirmed the dual localization of HCA66 at the nucleolus and at the between amino acids 87-119, 121-153, 156-188, 304-335, 452-486, centrosome (Fig. 1E). We then tested by microscopy whether the 488-520 and 524-557. This type of repeats is thought to be involved association of HCA66 with the centrosome is cell cycle dependent, in protein-protein interactions. as indicated by our biochemical data on purified centrosomes (Fig. An antibody raised against a bacterially expressed fragment of 1A). We found that U-2 OS cells that were synchronized in S phase HCA66 recognized a single protein band of ~62 kDa on immunoblots and that were pulse labelled with bromo-deoxyuridine displayed of HeLa cell lysates (Fig. 1C). Equivalent immunoblotting results HCA66 localization at the centrosome in 91% (±5, n=250) of the 1136 Journal of Cell Science 122 (8)

cells, whereas in cultures synchronized in G1 phase only 24% (±7, localization does not depend on polymerized microtubules (Fig. 2C). n=250) of the cells showed detectable centrosomal staining (Fig. 2A). Moreover, HCA66 does not bind to acentriolar microtubule asters This suggests that HCA66 localizes to the centrosome in a cell cycle- induced by taxol treatment of mitotic cells (Fig. 2C). Taken together, dependent manner, and that most of HCA66 at the centrosome is these results suggest that HCA66 is a bona fide centrosomal protein. recruited at the G1-S transition. HCA66 remains at the centrosome Deconvolution microscopy at high magnification revealed that until . From onwards, centrosomal localization centrosomal HCA66 in S phase is mainly concentrated in an area of HCA66 is lost, and in HCA66 relocalizes to the nucleoli between the diplosomes, but not directly associated with the (Fig. 2B). Experiments using nocodazole indicated that centrosome (Fig. 2D). Besides centrosomal staining, HCA66 also displays Journal of Cell Science

Fig. 2. Centrosome localization of HCA66 is regulated during the cell cycle. (A) Immunofluorescence of HCA66 (green) in U-2 OS cells, synchronized in G1 (top) or S phase (bottom). Cells were co-stained with γ-tubulin (red). Insets on the right are magnifications of the centrosomal areas (top inset, γ-tubulin; middle, HCA66; bottom, merge). Arrowheads indicate the position of the centrosome. Histogram showing percentage of cells with HCA66 localizing to the centrosome, in G1 and S phase. (B) Immunofluorescence analysis of HCA66 localization at different stages of mitosis. Arrowheads indicate areas of perichromatin staining. HCA66 is in green, γ-tubulin is in red, DNA is in blue. (C) Top: interphase cell treated with 5 μm nocodazole to depolymerize microtubules, stained for HCA66 (red) and α-tubulin (green). Bottom: mitotic cell treated with 5 μm taxol to induce non-centrosomal microtubule asters, stained for HCA66 (red) and α-tubulin (green). Arrowheads indicate the localization of centrosome-associated HCA66. The centrosomal identity was verified with the centriole marker (data not shown). (D) Representative images showing localization of HCA66 relative to the centrioles. Panel showing immunofluorescence of four centrioles stained for centrin (red) and HCA66 (green). Top: maximum intensity projections of a stack of optical sections. The selected areas are shown at the bottom at higher magnification, in deconvolved optical sections taken at 0.2 μm z-steps. Scale bars: 10 μm. HCA66 and γ-TuSC stability 1137 Journal of Cell Science

Fig. 3. Identification of centrosomal and nucleolar targeting sequences of HCA66. (A) U-2 OS cells, transfected with different GFP:HCA66 constructs as indicated on the left, stained with antibody against γ-tubulin (red). The cell transfected with GFP:HCA661-149 is shown at two different exposures of the GFP channel. Numbers in the GFP panels indicate the exposure time relative to GFP:HCA66. Arrowheads indicate the positions of the centrosomes. (B) U-2 OS cells overexpressing GFP:HCA661-86 (green), co-stained with antibodies against centrin (white) and against γ-tubulin, GCP2, Nedd1 or endogenous HCA66 (red). Positions of centrioles co-localizing with GFP:HCA661-86 are indicated by arrowheads. Relative exposure times are indicated, as in A. Centrosomal HCA66 (c) and nucleolar HCA66 (nl) are recorded in two separate focal planes, in the cell depicted in the first row. Histogram, left: the percentage of interphase cells with centrosome staining of γ-tubulin, GCP2 or Nedd1 is indicated, following overexpression of GFP, GFP:HCA66 or GFP:HCA661-86. Graph, right: the intensity of γ- tubulin immunofluorescence at the centrosome is shown as a function of fluorescence levels of overexpressed GFP:HCA661-86 at the centrosome. (C) U-2 OS cells transfected with GFP, GFP:HCA66 or GFP:HCA661-86 (top). Microtubules were depolymerized in the cold for 2 hours and allowed to regrow for 2 minutes, before being fixed and processed for immunofluorescence of α-tubulin (bottom). The corresponding histogram indicates the percentage of cells with re-grown microtubule asters after 2, 3.5 and 5 minutes. Scale bars: 10 μm. 1138 Journal of Cell Science 122 (8)

staining of the perichromosomal layer (Fig. 2B), an area where a microtubule asters during this time. Following prolonged subset of nucleolar proteins localizes during mitosis (van Hooser et incubation to five minutes, centrosomal microtubule asters grew al., 2005). Accordingly, HCA66 was detected in the proteome in 46% of GFP:HCA661-86-expressing cells (Fig. 3C, graph). As analysis of the scaffold (Gassmann et al., 2005). a consequence of expressing high levels of GFP:HCA661-86 for two days, the cell cycle was affected, yielding only 7% of diploid Mapping of centrosomal and nucleolar targeting domains of cells in G1, 11% in S-phase, 20% in G2, and more than 50% HCA66 aneuploid cells, as seen by flow cytometry (supplementary material To map domains of HCA66 that mediate centrosomal and nucleolar Fig. S2B). Whereas mitotic figures were still visible in 0.5% of targeting, we generated deletion constructs tagged with GFP and the cells after 12 hours, no mitotic cells could be identified any examined their distribution in U-2 OS cells. GFP:HCA66151-597, which more by immunofluorescence from 24 hours onwards, suggesting lacks the most conserved N-terminal region, displayed diffuse that highly overexpressed GFP:HCA661-86 arrests the cell cycle. cytoplasmic and nuclear staining (Fig. 3A). To verify whether the N Immunoblot analysis of cells sorted for GFP fluorescence revealed terminus of HCA66 is sufficient for centrosomal and nucleolar that the amounts of γ-tubulin were unchanged in cells transfected targeting, we generated GFP:HCA661-149. Consistently, with GFP:HCA1-86 as compared to controls, indicating that the GFP:HCA661-149 localized both to the nucleolus and the centrosome, observed reduction of γ-tubulin at the centrosome was due to although the centrosome staining appeared to be very weak (Fig. 3A). displacement of the protein (supplementary material Fig. S2C). A smaller fusion protein encoded by GFP:HCA661-86 was absent from GFP:HCA661-86 did not displace endogenous HCA66 from the the nucleus, but colocalized with γ-tubulin at the centrosome (Fig. centrosome or from the nucleolus (Fig. 3B). 3A), indicating that the first 86 amino acids of HCA66 are sufficient to mediate centrosomal targeting. When expressed at low or moderate Depletion of HCA66 inhibits centriole duplication and leads to levels, GFP:HCA661-86 localized to the centrosome to a similar degree the formation of monopolar spindles in G1- and S-phase-arrested cells (in 60% of cells blocked in G1 Because full-length HCA66 localizes to the centrosome in a cell with 1 mM mimosine for 24 hours, or in 57% of cells released into cycle-dependent manner, we wanted to test whether HCA66 is S-phase from thymidine block, respectively). Moreover, involved in any aspect of centrosome function. For this reason, we GFP:HCA661-86 was found at the spindle poles in mitosis (Fig. 3A). performed RNA-silencing experiments using two different This indicated that the centrosome localization of this HCA66 oligonucleotides against HCA66 (Fig. 4A). Treatment with the fragment is not cell cycle dependent. The cell cycle-dependent oligonucleotide HCA-4 allowed reproducible depletion of 75% or localization of endogenous, full-length HCA66 is thus probably more of HCA66 protein after 48 hours, as determined by serial regulated outside the region of amino acids 1 to 86. dilution and blot densitometry (data not shown). Silencing of In a following step, we wanted to test whether HCA66 binds to HCA66 inhibited the duplication of centrioles, as two or less centrin any previously characterized centrosome component. Efforts to signals were seen in 50% of the depleted cells during mitosis (n=80) identify HCA66 interactors by immunoprecipitation and (Fig. 4B, graph), in contrast to controls that showed four centrioles biochemical methods were fruitless, due to the high insolubility in 70% of all mitotic cells. Consistently, silenced U-2 OS cells that of HCA66 and its deletion mutants throughout the cell cycle. We were arrested with hydroxyurea failed to re-duplicate centrioles

Journal of Cell Science therefore investigated the effect of overexpression of full-length efficiently (38% of the treated cells), whereas 69% of control cells GFP:HCA66, GFP:HCA66151-597 and GFP:HCA661-86 on the showed four or more centrioles (Fig. 4C). Overexpression of GFP- localization of centrosomal proteins. Experiments with GFP, GFP- tagged full-length HCA66, however, did not alter centriole numbers. tagged full-length HCA66, or GFP:HCA66151-597 had no visible Cells lacking HCA66 showed aberrant microtubule organization in effect on centrin, PCM-1, or γ-tubulin (Fig. 3A,B; supplementary mitosis, mostly in the form of monopolar spindles, and failure of material Fig. S2A). However, high overexpression of chromosome alignment (Fig. 4D). condensation and GFP:HCA661-86 led to reduced centrosomal localization of γ- immunolabelling of phosphorylated histone H3 suggested that these tubulin in 75% of asynchronous interphase cells, and induced the cells were in prometaphase (data not shown). formation of cytoplasmic aggregates (Fig. 3B; supplementary Depletion of HCA66 led to an increase of mitotic figures after material Fig. S2A). Closer inspection of cells synchronized either 48 hours, from ~5% in controls to ~13.4% in depleted cells, in G1 or in S-phase revealed that the numbers of cells lacking suggesting a delay in mitosis (Fig. 4E). Further analysis showed centrosomal γ-tubulin was similar in both cases, 74% of cells in that 80% of the mitotic cells were accumulating in prometaphase, G1 and 68% of cells in S-phase, after high overexpression of compared with ~55% of mitotic cells in controls (Fig. 4E), with GFP:HCA661-86. We found that increasing amounts of the vast majority containing monopolar spindles. We also observed GFP:HCA661-86 at the centrosome lowered the an increased number of cells with micronuclei upon HCA66 siRNA immunofluorescence signal of γ-tubulin at the centrosome below treatment (31%, compared with 12% in controls) (Fig. 4F), detection level (Fig. 3B, graph, right). The same HCA66 fragment suggesting that depletion of HCA66 led to chromosome segregation also had a strong effect on the localization of the γ-tubulin complex defects. Prolonged siRNA treatment up to 96 hours significantly proteins GCP2 and NEDD1, and weaker effects on PCM-1 and reduced the number of cells (Fig. 4G) and led to an almost complete centrin (Fig. 3B; supplementary material Fig. S2A). Consistent with disappearance of mitotic figures (<0.7%), indicating that HCA66 loss of γ-tubulin complex proteins from the centrosome, cells is essential for viability. overexpressing GFP:HCA661-86 were defective in microtubule re- growth from a centrosomal organizing centre after cold-induced Depletion of HCA66 leads to reduction of γ-TuSC protein depolymerization (Fig. 3C). Whereas 88% of control cells levels expressing GFP, or 75% of cells expressing GFP-tagged full-length The defects that we observed upon siRNA treatment against HCA66 re-grew microtubules within two minutes after recovery, HCA66, e.g. monopolar spindle formation or failure of centriole only 35% of the cells expressing GFP:HCA661-86 were able to form duplication, were reminiscent of the defects obtained from γ-tubulin HCA66 and γ-TuSC stability 1139 Journal of Cell Science

Fig. 4. HCA66 depletion leads to mitotic defects. (A) Immunoblots, probed with anti-HCA66, of U-2 OS cells treated with siRNA against HCA66 using two different oligonucleotides, HCA-2 and HCA-4, or control siRNA (C). α-Tubulin is shown as a loading control. (B) U-2 OS cells were transfected with HCA-4 oligonucleotides or control siRNA, and processed after 48 hours for immunofluorescence of HCA66 (green) and centrin to indicate the number of centrioles (insets show magnified areas of centrin staining). Mitotic cells are shown for both control and HCA66 siRNA. DNA is shown in blue. Histogram depicts the percentage of mitotic cells containing 0-1, 2, 3, 4, 5 or more centrioles per cells. Black columns, control cells; white columns, cells treated with HCA66 siRNA. (C) Control and HCA66-depleted U-2 OS cells treated with hydroxyurea (HU) to induce overduplication of centrioles. Graph depicts the percentage of cells containing ≤4 or >4 centrioles/cell. (D) Immunofluorescence of U-2 OS cells treated as in B. HCA66 is shown in green, α-tubulin in red and DNA in blue. One control cell in metaphase and three depleted cells in mitosis are shown. Histogram depicts the percentage of mitotic cells after control treatment or HCA66 siRNA, containing monopolar spindles (grey) or spindles with poorly separated poles (white). (E) Left panel: mitotic index of cells 48 hours after siRNA (control or HCA66). Mean from three experiments, error bars indicate s.d., ~500 cells were scored per condition. Right panel: frequency of different mitotic stages after 48 hours of HCA66 siRNA treatment (mean from three experiments, error bars indicate s.d., ~200 cells were scored per condition). (F) Percentage of cells with micronuclei after control and HCA66 siRNA for 48 hours (mean from three experiments, error bars indicate s.d., ~500 cells were scored per condition). (G) Growth curve of control- depleted cells and HCA66-depleted cells. Scale bars: 10 μm. 1140 Journal of Cell Science 122 (8)

depletion (Sunkel et al., 1995; Strome et al., 2001; Hannak et al., the γ-TuSC proteins might be more susceptible to degradation in 2002; Dammermann et al., 2004; Haren et al., 2006). As the absence of HCA66. To test these ideas, we compared the effects overexpression of GFP:HCA661-86 affects centrosomal γ-tubulin of the translation inhibitor cycloheximide and of the (Fig. 3B), we decided to investigate the behaviour of proteins of inhibitor MG132 with the phenotypes obtained after silencing of the γ-TuRC in cells treated with HCA66 siRNA. In interphase, γ- HCA66. We noticed that the phenotypes produced by these two tubulin at the centrosome was reduced to 45% of the respective drugs differed from the effects of HCA66 siRNA: more than 90% control levels (Fig. 5A,B). In mitotic control cells, γ-tubulin at the of the cells treated with either inhibitor still contained γ-tubulin at centrosome increased fourfold compared with interphase, in good the centrosome after 2 days, and we failed to observe any agreement with findings by Khodjakov and Rieder (Khodjakov and accumulation of monopolar spindles in these treated cells Rieder, 1999). However, in HCA66-depleted mitotic cells, (supplementary material Fig. S3D). We therefore conclude that the centrosome-bound γ-tubulin was drastically reduced to 7% of phenotype of HCA66 depletion is neither due to a general block of mitotic control levels (Fig. 5A,B), implying that HCA66 activity translation, nor due to an unspecific inhibition of proteasome- might be particularly important during centrosome maturation. dependent degradation. Although the formation of centrosomal microtubule asters after depolymerization and regrowth was delayed in HCA66-depleted Discussion cells (supplementary material Fig. S3A), photometric analysis of We characterize HCA66 as a novel component of the nucleolus that interphase and mitotic cells revealed that the overall amount of localizes to the centrosome in a cell cycle-dependent manner. We microtubule polymer was not significantly affected prior to demonstrate that HCA66 is necessary for centriole duplication and depolymerization (Fig. 5C). Thus, the reduction of γ-tubulin at the bipolar spindle assembly. Furthermore, we show that HCA66 plays centrosome after HCA66 depletion does not significantly alter a role in regulating the protein levels of the γ-TuSC components γ- steady state levels of microtubule polymer in our cells. This is tubulin, GCP2 and GCP3. By contrast, HCA66-depletion does not consistent with Strome et al. (Strome et al., 2001) and Hannak et affect the protein levels of γ-TuRC-specific proteins such as GCP4 al. (Hannak et al., 2002), who showed that microtubules can form or GCP-WD/NEDD1. Nevertheless, these proteins are found less despite depletion of γ-tubulin, although their nucleation from the concentrated at centrosomes in mitosis, potentially because their centrosome is kinetically disadvantaged. In addition to γ-tubulin, proper recruitment to the pericentriolar material requires fully the immunofluorescence signals of GCP2, GCP4 and Nedd1/GCP- assembled γ-TuRCs and thus depends on the presence of γ-TuSCs WD at the centrosome were reduced after HCA66 siRNA (Fig. (Raynaud-Messina and Merdes, 2007). Even though HCA66 is 5A,B). Other proteins of the centrosome and of the spindle pole necessary for γ-tubulin localization to the centrosome both in such as pericentrin, centrin, TPX2, Aurora A or Plk1 were not interphase and mitosis, depletion of HCA66 affects centrosomal significantly affected (Fig. 5A,B; supplementary material Fig. amounts of γ-tubulin most drastically in mitosis. This correlates S3B), suggesting that HCA66 siRNA affects specifically the with the cell cycle-specific localization of HCA66, which binds to centrosomal localization of γ-TuRC proteins. the centrosome only between S-phase and metaphase of mitosis, Subsequently, immunoblot analysis was performed to distinguish raising the possibility that HCA66 regulates γ-tubulin complex between problems of centrosomal recruitment of these proteins and proteins while centrosome bound.

Journal of Cell Science reduction in protein amounts. Fig. 6 shows that depletion of Because failure in centriole duplication has previously been HCA66 led to a decrease of the protein levels of γ-tubulin, GCP2 described to result from the depletion of γ-tubulin (Dammermann and GCP3. These three proteins are known to form the γ-TuSC. et al., 2004; Haren et al., 2006), we think that the centriole defects HCA66 and the γ-TuSC protein levels were reduced to a comparable seen after removal of HCA66 are probably due to the loss of γ- degree after HCA66 siRNA, to around 30 to 40% of control levels tubulin. Likewise, monopolar spindle formation in HCA66-depleted (graph, Fig. 6). Moreover, the levels of GCP2 were also reduced cells can be explained by the loss of functional γ-tubulin or γ-TuSCs, following depletion of γ-tubulin, suggesting that the expression of as seen in knock-down experiments or mutants in various species γ-TuSC components is interdependent (Fig. 6). By contrast, silencing (Sunkel et al., 1995; Barbosa et al., 2000; Strome et al., 2001; of γ-tubulin did not reciprocally affect the levels of HCA66. Hannak et al., 2002; Barbosa et al., 2003; Raynaud-Messina et al., Experiments involving reverse transcription of RNA, followed by 2004; Yuba-Kubo et al., 2005; Colombié et al., 2006; Haren et al., PCR for γ-tubulin, GCP2 and GCP3 showed that transcription of 2006). It is likely that the spindle defects in HCA66-depleted cells γ-TuSC was unaffected by HCA66 silencing, indicating that lead to chromosome segregation defects and micronuclei, explaining HCA66 is involved in regulating the protein levels but not the the increased cell death observed in HCA66-depleted cultures, but mRNA of γ-TuSC components (supplementary material Fig. S3C). we cannot exclude the possibility that HCA66 plays additional roles Whereas silencing of HCA66 diminished the amounts of all γ-TuSC in interphase that are important for the survival of the cells. components, protein levels of γ-TuRC-specific components such So far, the significance of the nucleolar localization of HCA66 as GCP4 or Nedd1/GCP-WD, or of the pericentriolar protein PCM- during interphase remains unclear. Interestingly, several other 1 were not reduced. Moreover, the levels of the kinases Aurora A nucleolar proteins have been described that also fulfil roles at the and Plk1 also remained constant (Fig. 6). Because Aurora A and mitotic spindle or at the centrosome, such as NuSAP and Plk1 still localize to the centrosome in the absence of HCA66 (Fig. nucleophosmin. NuSAP localizes to the spindle during mitosis and 5; supplementary material Fig. S3B), we conclude that HCA66 is crosslinks microtubules (Raemaekers et al., 2003; Ribbeck et al., not involved in regulating the expression, the stability or the 2006). Nucleophosmin binds to the centrosome and is implicated recruitment to the centrosome of these mitotic kinases. in controlling centriole duplication (Okuda et al., 2000). In addition, Because HCA66 showed similarities to the yeast pre- nucleophosmin participates in ribosome biogenesis (Frehlick et al., assembly factor Utp6p, and because depletion of HCA66 reduced 2007). At the molecular level, nucleophosmin acts as a chaperone, the levels of γ-TuSC proteins, we reasoned that translation of their potentially preventing protein aggregation in the nucleolus and mRNA might have been inhibited. Alternatively, we reasoned that assisting nucleo-cytoplasmic shuttling and protein assembly HCA66 and γ-TuSC stability 1141 Journal of Cell Science

Fig. 5. Depletion of HCA66 reduces pericentriolar localization of γ-TuRC proteins. (A) U-2 OS cells were transfected with HCA66 siRNA or control siRNA, and processed after 48 hours for immunofluorescence of HCA66, γ-tubulin, centrin, GCP2, GCP4, Nedd1, Aurora A and pericentrin, as indicated. Top panels left show interphase cells, the remaining panels show mitotic cells. Arrowheads indicate the positions of the centrosomes. (B) Histogram depicting the relative intensity of immunofluorescence at the mitotic centrosome, of proteins shown in A. Standard deviations are shown for both controls (black columns) and cells treated with HCA66 siRNA (white columns, n≥35). γ-Tubulin immunofluorescence was measured both in mitosis and in interphase (n=85); in the graphs, the average immunofluorescence intensity in mitosis is defined as 100% and used as a reference for interphase. (C) The immunofluorescence intensity of polymerized microtubules is quantified in interphase and mitosis (n=25). The signal in mitotic control cells is set at 100%. Labelling as in B. Scale bar: 10 μm. 1142 Journal of Cell Science 122 (8)

Fig. 6. Depletion of HCA66 reduces γ-TuSC protein levels. U-2 OS cells were transfected with ‘HCA-4’ siRNA oligonucleotides against HCA66 or with control siRNA (C). Whole-cell lysates were analyzed by immunoblotting with anti-HCA66, anti-γ-tubulin, anti-GCP2, anti- GCP3, anti-GCP4, anti-Aurora A, anti-Plk1, anti-Nedd1, anti-PCM-1 and anti-α-tubulin antibodies. Furthermore, immunoblot of cells treated with siRNA against γ-tubulin, probed with antibodies against γ-tubulin, GCP2, actin, CPAP and HCA66 are shown. Histogram indicating the signal intensities of western blots of HCA66, γ-tubulin, GCP2 and GCP3 from HCA66-depleted cells. The mean values from four different experiments and standard deviations are shown. The percentages are expressed in relation to the respective control levels of each protein (=100%). The calculation of all values was performed after normalization over α-tubulin levels, to correct for uneven loading.

(Szebeni and Olson, 1999; Yu et al., 2006). Likewise, HCA66 may UXT and co-factor D (Melki et al., 1993; Zhao et al., 2005; play a dual role at the centrosome and in ribosome assembly, similar Cunningham and Kahn, 2008). Interestingly, co-factor D contains to nucleophosmin. This would be consistent with our finding that a series of HEAT sequence repeats, reminiscent of the HAT repeats HCA66 shows with the budding yeast protein Utp6p, a found in HCA66, and silencing also results in spindle pole defects protein that is part of the 90S pre-ribosomal particle (Dragon et al., (Cunningham and Kahn, 2008). However, silencing of co-factor D 2002; Dosil and Bustelo, 2004). Depending on the cell cycle, does not alter γ-TuSC protein levels. HCA66 may associate with various protein complexes, such as pre- We propose that HCA66-dependent stability of γ-TuSC proteins ribosomal particles or γ-TuSCs. Our data indicate that represents a novel element of the complex regulatory machinery overexpression of the N-terminal region comprising amino acids 1 that controls microtubule nucleation, centrosome duplication and to 86 of HCA66 displaces γ-tubulin from the centrosome, arguing mitotic spindle assembly. In the future, more knowledge on the for an interaction between HCA66 and γ-tubulin. Because potential interactors of HCA66 will be needed to understand the overexpression of this N-terminal fragment does not displace exact molecular mechanisms. endogenous HCA66 and does not alter γ-tubulin protein levels, this fragment probably exerts a dominant effect on centrosome integrity. Materials and Methods Morover, this HCA66 fragment binds to the centrosome in a Cloning procedures constitutive manner throughout the cell cycle, whereas the full- HCA66 cDNA was generated by reverse transcription of RNA isolated from Jurkat length, endogenous HCA66 protein only accumulates at the cells. Full-length clones were prepared by PCR, using KOD DNA polymerase (Novagen) and primers CCGGGGTACCATGGCAGAGATAATTCCAGGA Journal of Cell Science centrosome between S-phase and mitosis. This suggests that the localization of HCA66 to the centrosome is regulated outside its (HCA66fwd) and CGCGGATCCTAAATGGCCAGTCTGATGCA (HCA66rev). pRSET-HCA6687-366 was generated by cutting full-length HCA66 with EcoRI and N-terminal region, and that the overexpressed short fragment of HindIII, and cloning it into pRSET-C (Invitrogen). GFP:HCA66 was generated by amino acids 1 to 86 behaves abnormally. Yeast two-hybrid and cloning full-length HCA66 into KpnI and BamHI sites of pEGFP-C1 (Clontech). biochemical assays failed to reveal binding of HCA66 to γ-TuSC GFP:HCA661-86 and GFP:HCA661-149 were generated by PCR using HCA66fwd with AAACTGCAGTCAATTCTCTCAATCTCATCCTTCTT or AAACTGCAGTTGG- proteins (data not shown), leading us to conclude that HCA66 and CTGCCATAATCCACAA, respectively. The PCR products were cloned into KpnI γ-tubulin may interact indirectly, or in a regulated, transient manner and XhoI sites of pEGFP-C1. GFP:HCA66151-597 was generated by PCR using primers that is not reproduced in vitro. When trying to identify binding AGAATTCAATGGAAGATCGATTGTCTTC and HCA66rev. The PCR product was cloned into EcoRI and BamHI sites of pEGFP-C1. partners of HCA66 in biochemical and immunoprecipitation assays, we noticed that HCA66 was highly insoluble. This complicated Antibodies ϫ E. coli further investigation of regulated transient interactions or low- 6 His-HCA6687-366 fusion protein was expressed in and affinity purified on affinity interactions with potential binding partners. nickel agarose beads under denaturing conditions. The eluted protein was used for γ antibody production in rabbits. Other primary antibodies used in this study were: We speculate that a possible mechanism by which the -TuSC mouse anti-alpha-tubulin (DM1A, Sigma-Aldrich), anti-γ-tubulin (mouse GTU-88 proteins might be regulated may include a chaperone activity by or rabbit AK-15, Sigma-Aldrich), mouse anti-actin MAB1501 (Chemicon), mouse HCA66, analogous to nucleophosmin function. Because no direct anti-pericentrin, rabbit anti-PCM-1 (Dammermann and Merdes, 2002), mouse anti- γ centrin 20H5 (gift from Dr J. Salisbury, Mayo Clinic, Rochester, MN), rabbit anti- binding of HCA66 to -TuSC proteins was seen, such an activity GCP2 (gift from Dr T. Stearns, Berkley, CA), rabbit anti-GCP4 (Fava et al., 1999), might involve additional partner proteins. HCA66 could either rabbit anti-GCP3 (gift from Dr M. Bornens, Paris, France), rabbit anti-Nedd1 (Haren protect the entity of the γ-TuSC, or protect individual γ-TuSC et al., 2006) and rabbit anti-CPAP (against a bacterially expressed, GST-tagged human components before assembly. Loss of individual γ-TuSC proteins CPAP fragment containing amino acids 1 to 295). might affect the translation of their partners via feedback or, Cell culture experiments alternatively, monomeric γ-complex proteins that fail to assemble U-2 OS cells were cultured in Dulbecco’s modified Eagle’s medium. Jurkat cells into γ-TuSCs might be degraded more rapidly than the assembled were cultured in RPMI 1640. All media were supplemented with 10% foetal calf γ serum, 2 mM L-glutamine, 50 IU penicillin and streptomycin. For ones. These two scenarios would explain the specific loss of all - immunofluorescence experiments, cells were synchronized by mitotic shake-off and TuSC proteins after silencing of HCA66 expression, and they replated for further 2 hours to enter G1 phase. Cells in S-phase were synchronized explain our observation of reduced GCP2 levels in cells in which by a double thymidine block and released for 3 hours, before addition of BrdU. γ-tubulin was silenced. Other chaperone proteins are known that Synchronization was verified by immunofluorescence of BrdU (rat anti BrdU, Harlan Scientific), indicating 17.5±2.5% of BrdU-positive cells in G1 populations versus interact with γ-tubulin and bind to the centrosome, including TCP1, HCA66 and γ-TuSC stability 1143

83.8±5.0% in S-phase populations. For centrosome purification, cells were arrested Barbosa, V., Yamamoto, R. R., Henderson, D. S. and Glover, D. M. (2000). Mutation in S-phase using a double aphidicolin block: 1 μg/ml of aphidicolin was added to of a Drosophila gamma tubulin ring complex subunit encoded by discs degenerate-4 the culture medium for 16 hours, washed off and the cells were grown for 9 hours differentially disrupts centrosomal protein localization. Genes Dev. 14, 3126-3139. under normal conditions. A second block was then performed for another 16 hours. Barbosa, V., Gatt, M., Rebollo, E., Gonzalez, C. and Glover, D. M. (2003). Drosophila The percentage of cells in S phase was determined by flow cytometry. For this, cells dd4 mutants reveal that gammaTuRC is required to maintain juxtaposed half spindles were washed in cold PBS and fixed in cold 70% ethanol. Cells were then washed in spermatocytes. J. Cell Sci. 116, 929-941. and incubated for 30 minutes at 37°C with RNase A (10 μg/ml). Propidium iodide Berdnik, D. and Knoblich, J. A. (2002). Drosophila Aurora-A is required for centrosome μ maturation and actin-dependent asymmetric protein localization during mitosis. Curr. (40 g/ml) was added to the cells before analysis with a FACSCalibur instrument Biol. and CellQuest software (Becton Dickinson). To assay for centriole overduplication, 12, 640-647. Bornens, M., Paintrand, M., Berges, J., Marty, M. C. and Karsenti, E. (1987). Structural U-2 OS cells were treated first for 12 hours with HCA66 siRNA or control RNA, and chemical characterization of isolated centrosomes. Cell Motil. 8, 238- then 2 mM hydroxyurea was added and incubation continued for additional 40 hours. 249. Casenghi, M., Meraldi, P., Weinhart, U., Duncan, P. I., Korner, R. and Nigg, E. A. Transfection procedures (2003). Polo-like kinase 1 regulates Nlp, a centrosome protein involved in microtubule GFP constructs were transfected using FuGene-6 (Roche) according to the nucleation. Dev. Cell 5, 113-125. manufacturer’s instructions. Cells were fixed 48 hours after transfection. Double- Chen, C. H., Howng, S. L., Cheng, T. S., Chou, M. H., Huang, C. Y. and Hong, Y. R. stranded siRNA oligomers were transfected into U-2 OS cells using a Nucleofector (2003). Molecular characterization of human ninein protein: two distinct subdomains apparatus, program U-24 and nucleofection solution V (Amaxa), according to the required for centrosomal targeting and regulating signals in cell cycle. Biochem. Biophys. manufacturer’s instructions. Two siRNAs targeting HCA66 mRNA were used Res. Commun. 308, 975-983. (Xeragon). Results presented here correspond to the targeting of nucleotides 421- Colombié, N., Vérollet, C., Sampaio, P., Moisand, A., Sunkel, C., Bourbon, H. M., 432 (HCA-4; CCAGCUUUGUGGAUUAUGGdTdT). Targeting of nucleotides 965- Wright, M. and Raynaud-Messina, B. (2006). The Drosophila gamma-tubulin small 983 (HCA-2; CAGAGGCCAUGUGGAAGUGdTdT) induced similar depletion complex subunit Dgrip84 is required for structural and functional integrity of the spindle Mol. Biol. Cell levels and cellular phenotypes. Control depletion was carried out using oligomers apparatus. 17, 272-282. targeting Luciferase. Depletion of γ-tubulin was performed as described (Haren et Cunningham, L. A. and Kahn, R. A. (2008). Cofactor D functions as a centrosomal al., 2006). protein and is required for the recruitment of the gamma-tubulin ring complex at centrosomes and organization of the mitotic spindle. J. Biol. Chem. 283, 7155-7165. Dammermann, A. and Merdes, A. (2002). Assembly of centrosomal proteins and Microtubule regrowth assay microtubule organization depends on PCM-1. J. Cell Biol. 159, 255-266. Cells grown on glass coverslips were transferred into pre-cooled medium on ice, then Dammermann, A., Müller-Reichert, T., Pelletier, L., Habermann, B., Desai, A. and into pre-warmed medium at 37°C. Regrowth was stopped by methanol fixation. Oegema, K. (2004). Centriole assembly requires both centriolar and pericentriolar material proteins. Dev. Cell 7, 815-829. Immunoblotting and indirect immunofluorescence Delgehyr, N., Sillibourne, J. and Bornens, M. (2005). Microtubule nucleation and Gel electrophoresis and immunobloting were performed using standard protocols. anchoring at the centrosome are independent processes linked by ninein function. J. Cell Serum against HCA66 was used at 1:1000 dilution. For immunofluorescence, cells Sci. 118, 1565-1575. were grown on glass coverslips, fixed with methanol at –20°C, and processed using Dosil, M. and Bustelo, X. R. (2004). Functional characterization of Pwp2, a WD family standard protocols. protein essential for the assembly of the 90 S pre-ribosomal particle. J. Biol. Chem. 279, The content of microtubule polymer in cells was determined by adapting a protocol 37385-37397. of Zhai et al. (Zhai et al., 1996). Briefly, cells were pre-extracted with 0.2% Triton Dragon, F., Gallagher, J. E., Compagnone-Post, P. A., Mitchell, B. M., Porwancher, X-100 in PHEM (60 mM PIPES, 25 mM HEPES, 1 mM EGTA, 2 mM MgCl ) at K. A., Wehner, K. A., Wormsley, S., Settlage, R. E., Shabanowitz, J., Osheim, Y. et 2 al. (2002). A large nucleolar U3 ribonucleoprotein required for 18S ribosomal RNA 37°C. Subsequently, cells were fixed with 4% formaldehyde in the same buffer Nature μ α biogenesis. 417, 967-970. supplemented with 1 M taxol, and stained for immunofluorescence of -tubulin. Fava, F., Raynaud-Messina, B., Leung-Tack, J., Mazzolini, L., Li, M., Guillemot, J. The amount of microtubule fluorescence was quantified in the whole cell after C., Cachot, D., Tollon, Y., Ferrara, P. and Wright, M. (1999). Human 76p: A new background subtraction. Images were acquired with an Axiocam camera on an member of the gamma-tubulin-associated protein family. J. Cell Biol. 147, 857-868. ϫ Axioskop 2 microscope (Carl Zeiss) using a 100 NA 1.30 objective, or with a Frehlick, L. J., Eirín-López, J. M. and Ausió, J. (2007). New insights into the COOLSNAP HQ ICX285 camera (Roper Scientific) on an OLYMPUS IX-70 nucleophosmin/nucleoplasmin family of nuclear chaperones. BioEssays 29, 49-59. microscope controlled by DeltaVision Softworx (Applied Precision), using a 100ϫ Gassmann, R., Henzing, A. J. and Earnshaw, W. C. (2005). Novel components of human Journal of Cell Science NA 1.40 objective. After deconvolution, image files were projected using the mitotic identified by proteomic analysis of the chromosome scaffold maximum intensity function. Image processing was carried out using Photoshop fraction. Chromosoma 113, 385-397. (Adobe). Hannak, E., Kirkham, M., Hyman, A. A. and Oegema, K. (2001). Aurora-A kinase is required for centrosome maturation in . J. Cell Biol. 155, 1109- Purification of centrosomes 1116. Centrosomes were purified from Jurkat cells as described previously (Bornens et al., Hannak, E., Oegema, K., Kirkham, M., Gonczy, P., Habermann, B. and Hyman, A. A. (2002). The kinetically dominant assembly pathway for centrosomal asters in 1987). Centrosome fractions were assayed for their ability to stimulate formation, J. Cell Biol. by incubation with concentrated mitotic frog egg extract or with pure porcine brain Caenorhabditis elegans is gamma-tubulin dependent. 157, 591-602. Haren, L., Remy, M. H., Bazin, I., Callebaut, I., Wright, M. and Merdes, A. (2006). tubulin. In both cases, rhodamine-labelled tubulin was added to visualize microtubules NEDD1-dependent recruitment of the gamma-tubulin ring complex to the centrosome by fluorescence microscopy. Purified centrosomes were incubated in 1 M KI at 4°C is necessary for centriole duplication and spindle assembly. J. Cell Biol. 172, 505- in the dark, then centrifuged at 120,000 g for 30 minutes at 4°C. The KI-soluble 515. material was then concentrated and filtered using a Centricon YM-10 (Millipore) Khodjakov, A. and Rieder, C. L. (1999). The sudden recruitment of gamma-tubulin to device. The retained proteins were recovered, boiled for 5 minutes in protein sample the centrosome at the onset of mitosis and its dynamic exchange throughout the cell buffer and stored at –80°C until loading onto 7.5% Tris-glycine polyacrylamide gels. cycle, do not require microtubules. J. Cell Biol. 146, 585-596. Protein bands were visualized by silver staining. Individual bands were cut and Lajoie-Mazenc, I., Tollon, Y., Detraves, C., Julian, M., Moisand, A., Gueth-Hallonet, digested with Trypsin (Promega) (Shevchenko et al., 1996). The MALDI-tof mass C., Debec, A., Salles-Passador, I., Puget, A., Mazarguil, H. et al. (1994). Recruitment spectra were acquired on a PerSeptive Biosystems Voyager DE STR instrument of antigenic gamma-tubulin during mitosis in animal cells: presence of gamma-tubulin (Applied Biosystems) and analyzed using MS-Fit tool (http://prospector.ucsf.edu/ in the mitotic spindle. J. Cell Sci. 107, 2825-2837. ucsfhtml4.0/msfit.htm). Lane, H. A. and Nigg, E. A. (1996). Antibody microinjection reveals an essential role for human polo-like kinase 1 (Plk1) in the functional maturation of mitotic centrosomes. J. Cell Biol. 135, 1701-1713. We are grateful to Drs V. Srsen, W. C. Earnshaw, K. Sawin and E. Lüders, J., Patel, U. K. and Stearns, T. (2006). GCP-WD is a gamma-tubulin targeting Schirmer (Edinburgh), for stimulating discussions and for sharing factor required for centrosomal and chromatin-mediated microtubule nucleation. Nat. equipment, and to Drs M. Bornens (Paris), J. Salisbury (Rochester) and Cell Biol. 8, 137-147. T. Stearns (Stanford) for the gift of reagents. The work was supported Melki, R., Vainberg, I. E., Chow, R. L. and Cowan, N. J. (1993). Chaperonin-mediated folding of vertebrate actin-related protein and gamma-tubulin. J. Cell Biol. 122, 1301- by a Senior Research Fellowship from the Wellcome Trust, by the 1310. CNRS, and by the Pierre Fabre Group. X.F. was supported by a Oegema, K., Wiese, C., Martin, O. C., Milligan, R. A., Iwamatsu, A., Mitchison, T. J. Wellcome Trust Prize Fellowship. Deposited in PMC for release after and Zheng, Y. (1999). Characterization of two related Drosophila gamma-tubulin 6 months. complexes that differ in their ability to nucleate microtubules. J. Cell Biol. 144, 721- 733. Okuda, M., Horn, H. F., Tarapore, P., Tokuyama, Y., Smulian, A. G., Chan, P. K., References Knudsen, E. S., Hofmann, I. A., Snyder, J. D., Bove, K. E. et al. (2000). Andersen, J. S., Lam, Y. W., Leung, A. K., Ong, S. E., Lyon, C. E., Lamond, A. I. and Nucleophosmin/B23 is a target of CDK2/ E in centrosome duplication. Cell 103, Mann, M. (2005). Nucleolar proteome dynamics. Nature 433, 77-83. 127-140. 1144 Journal of Cell Science 122 (8)

Piddubnyak, V., Rigou, P., Michel, L., Rain, J. C., Geneste, O., Wolkenstein, P., Vidaud, Takahashi, M., Yamagiwa, A., Nishimura, T., Mukai, H. and Ono, Y. (2002). D., Hickman, J. A., Mauviel, A. and Poyet, J. L. (2007). Positive regulation of apoptosis Centrosomal proteins CG-NAP and kendrin provide microtubule nucleation sites by by HCA66, a new Apaf-1 interacting protein, and its putative role in the physiopathology anchoring gamma-tubulin ring complex. Mol. Biol. Cell 13, 3235-3245. of NF1 microdeletion syndrome patients. Cell Death Differ. 14, 1222-1233. Terada, Y., Uetake, Y. and Kuriyama, R. (2003). Interaction of Aurora-A and centrosomin Preker, P. J. and Keller, W. (1998). The HAT helix, a repetitive motif implicated in RNA at the microtubule-nucleating site in Drosophila and mammalian cells. J. Cell Biol. 162, processing. Trends Biochem. Sci. 23, 15-16. 757-763. Raemaekers, T., Ribbeck, K., Beaudouin, J., Annaert, W., Van Camp, M., Stockmans, Van Hooser, A. A., Yuh, P. and Heald, R. (2005). The perichromosomal layer. Chromosoma I., Smets, N., Bouillon, R., Ellenberg, J. and Carmeliet, G. (2003). NuSAP, a novel 114, 377-388. microtubule-associated protein involved in mitotic spindle organization. J. Cell Biol. Wang, Y., Han, K. J., Pang, X. W., Vaughan, H. A., Qu, W., Dong, X. Y., Peng, J. R., 162, 1017-1029. Zhao, H. T., Rui, J. A., Leng, X. S. et al. (2002). Large scale identification of human Raynaud-Messina, B. and Merdes, A. (2007). Gamma-tubulin complexes and microtubule hepatocellular carcinoma-associated antigens by autoantibodies. J. Immunol. 169, 1102- organization. Curr. Opin. Cell Biol. 19, 24-30. 1109. Raynaud-Messina, B., Mazzolini, L., Moisand, A., Cirinesi, A. M. and Wright, M. Yu, Y., Maggi, L. B., Jr, Brady, S. N., Apicelli, A. J., Dai, M. S., Lu, H. and Weber, J. (2004). Elongation of centriolar microtubule triplets contributes to the formation of the D. (2006). Nucleophosmin is essential for ribosomal protein L5 nuclear export. Mol. mitotic spindle in gamma-tubulin-depleted cells. J. Cell Sci. 117, 5497-5507. Cell. Biol. 26, 3798-3809. Ribbeck, K., Groen, A. C., Santarella, R., Bohnsack, M. T., Raemaekers, T., Köcher, Yuba-Kubo, A., Kubo, A., Hata, M. and Tsukita, S. (2005). knockout analysis of T., Gentzel, M., Görlich, D., Wilm, M., Carmeliet, G. et al. (2006). NuSAP, a mitotic two gamma-tubulin isoforms in mice. Dev. Biol. 282, 361-373. RanGTP target that stabilizes and cross-links microtubules. Mol. Biol. Cell 17, 2646- Zhai, Y., Kronebusch, P. J., Simon, P. M. and Borisy, G. G. (1996). Microtubule dynamics 2660. at the G2/M transition: abrupt breakdown of cytoplasmic microtubules at Shevchenko, A., Wilm, M., Vorm, O. and Mann, M. (1996). Mass spectrometric breakdown and implications for spindle morphogenesis. J. Cell Biol. 135, 201-214. sequencing of proteins silver-stained polyacrylamide gels. Anal. Chem. 68, 850-858. Zhao, H., Wang, Q., Zhang, H., Liu, Q., Du, X., Richter, M. and Greene, M. I. (2005). Strome, S., Powers, J., Dunn, M., Reese, K., Malone, C. J., White, J., Seydoux, G. and UXT is a novel centrosomal protein essential for cell viability. Mol. Biol. Cell 16, 5857- Saxton, W. (2001). Spindle dynamics and the role of gamma-tubulin in early 5865. Caenorhabditis elegans embryos. Mol. Biol. Cell 12, 1751-1764. Zheng, Y., Jung, M. K. and Oakley, B. R. (1991). Gamma-tubulin is present in Drosophila Sunkel, C. E., Gomes, R., Sampaio, P., Perdigão, J. and González, C. (1995). Gamma- melanogaster and Homo sapiens and is associated with the centrosome. Cell 65, 817- tubulin is required for the structure and function of the microtubule organizing centre 823. in Drosophila neuroblasts. EMBO J. 14, 28-36. Zimmerman, W. C., Sillibourne, J., Rosa, J. and Doxsey, S. J. (2004). Mitosis-specific Szebeni, A. and Olson, M. O. (1999). Nucleolar protein B23 has molecular chaperone anchoring of gamma tubulin complexes by pericentrin controls spindle organization and activities. Protein Sci. 8, 905-912. mitotic entry. Mol. Biol. Cell 15, 3642-3657. Journal of Cell Science