Loss of Function of DOCK4 in Myelodysplastic Syndromes Stem

Published OnlineFirst July 15, 2019; DOI: 10.1158/1078-0432.CCR-19-0924

Translational Cancer Mechanisms and Therapy Clinical Cancer Research Loss of Function of DOCK4 in Myelodysplastic Syndromes Stem Cells is Restored by Inhibitors of DOCK4 Signaling Networks Sriram Sundaravel1, Wen-Liang Kuo1, Jong Jin Jeong1, Gaurav S. Choudhary2, Shanisha Gordon-Mitchell2, Hui Liu1, Tushar D. Bhagat2, Kathy L. McGraw3, Sandeep Gurbuxani4, Alan F. List3, Amit Verma2, and Amittha Wickrema1

Abstract

Purpose: Myelodysplastic syndromes (MDS) with deletion levels of tyrosine phosphorylation when DOCK4 expression of chromosome 7q/7 [-7/(del)7q MDS] is associated with levels were reduced using DOCK4-specificsiRNA.Ourdata worse outcomes and needs novel insights into pathogenesis. also found that increased phosphorylation of SHIP1 and Reduced expression of signaling protein dedicator of cytoki- SHP1 phosphatases were due to LYN kinase targeting these nesis 4 (DOCK4) in patients with -7/(del)7q MDS leads to a phosphatases as substrates. Increased migration and imped- block in hematopoietic stem cell (HSC) differentiation. Iden- iment of HSC differentiation were consequences of these tification of targetable signaling networks downstream of signaling alterations. Pharmacologic inhibition of SHP1 DOCK4 will provide means to restore hematopoietic differ- reversed these functional aberrations in HSCs expressing low entiation in MDS. DOCK4 levels. In addition, differentiation block seen in Experimental Design: We utilized phosphoproteomics DOCK4 haplo-insufficient [-7/(del)7q] MDS was rescued by approaches to identify signaling proteins perturbed as a inhibition of SHP1 phosphatase. result of reduced expression of DOCK4 in human HSCs Conclusions: LYN kinase and phosphatases SHP1 and and tested their functional significance in primary model SHIP1 are perturbed when DOCK4 expression levels are low. systems. Inhibition of SHP1 promotes erythroid differentiation in Results: We demonstrate that reduced levels of DOCK4 healthy HSCs and in -7/(del)7q MDS samples with low lead to increased global tyrosine phosphorylation of proteins DOCK4 expression. Inhibitors of LYN, SHP1 and SHIP1 also in primary human HSCs. LYN kinase and phosphatases abrogated increased migratory properties in HSCs expressing INPP5D (SHIP1) and PTPN6 (SHP1) displayed greatest reduced levels of DOCK4.

Introduction Mutations or reduced expression of DOCK4 can lead to malig- nancies in prostate, breast, lung, brain, and blood tissues as well as Dedicator of cytokinesis 4 (DOCK4) is one of the members of solid tumor metastasis (8–11). Its known functions include the 11 DOCK family proteins, which are conserved across differ- regulation of motility via Rac1 GTPases and actin cytoskele- ent mammalian species (1). It is a large protein of approximately ton (12, 13). However, very little is known with respect to the 225 KDa with multiple signaling/protein–protein interaction impact of reduced levels of DOCK4 expression within the stem domains (2). The gene for DOCK4 protein is located in the q cell compartment. Using healthy blood stem cells and blood stem arm of chromosome 7. Recent studies have highlighted the cells expressing reduced levels of DOCK4, [as seen in the malig- importance of normal levels of DOCK4 expression across mul- nant blood disorder myelodysplastic syndromes (MDS)], we tiple tissue types in maintaining cellular homeostasis (3–7). identified downstream signaling networks regulated by DOCK4 and functional implications of reduced DOCK4 expression within the blood stem cell compartment. 1 Section of Hematology/Oncology, Department of Medicine, The University of MDS are clonal stem cell disorders, where DOCK4 expres- Chicago, Chicago, Illinois. 2Albert Einstein College of Medicine, Montefiore sion is reduced because of either deletion of chromosome Medical Center, Bronx, New York. 3Moffitt Cancer Center, Tampa, Florida. 4Department of Pathology, The University of Chicago, Chicago, Illinois. 7q or mutations or promoter hypermethylation in DOCK4 gene (14). Patients with this disorder experience multi-lineage Note: Supplementary data for this article are available at Clinical Cancer Research Online (http://clincancerres.aacrjournals.org/). dysplasia and peripheral cytopenia (15). Our previous studies have shown that reduced levels of DOCK4 lead to dysplastic Corresponding Author: Amittha Wickrema, The University of Chicago, 5841 erythropoiesis and restoring DOCK4 expression in primary South Maryland Avenue, MC 2115, Chicago, IL 60637-1470. Phone: 773-702-4615; Fax: 773-702-3111; E-mail: [email protected] MDS erythroblasts improved erythroid differentiation (14, 16). This work focused on the impact of DOCK4 aberrations on Clin Cancer Res 2019;25:5638–49 postlineage-committed erythroid progenitors and not in doi: 10.1158/1078-0432.CCR-19-0924 hematopoietic stem cells (HSC) even though DOCK4 is highly 2019 American Association for Cancer Research. expressed in early-stage stem cells. Moreover, downstream

5638 Clin Cancer Res; 25(18) September 15, 2019

Reduced Expression of DOCK4 in Myelodysplasia

cells were cultured in Stemspan SFEM II (Stemcell Technologies Translational Relevance Inc) supplemented with 50 ng/mL thrombopoietin (TPO), Better understanding of mechanisms underlying ineffective 50 ng/mL stem cell factor (SCF), 50 ng/mL Fms-related tyrosine hematopoiesis in myelodysplastic syndromes (MDS) is criti- kinase-3 ligand (FLT3-L), 50 ng/mL IL3, and 50 ng/mL IL6 until cally needed to develop novel therapeutic strategies. Reduced used for subsequent experiments. All the cytokines were pur- levels of the adaptor protein dedicator of cytokinesis 4 chased from R&D Systems. Benzidine-hematoxylin staining of (DOCK4) is frequently observed in MDS with deletion of the cytospun HSCs was performed as described previously (20). chromosome 7q/7 [-7/(del)7q MDS]. Restoring DOCK4 In the experiments involving cytokine deprivation and expo- expression in -7/(del)7q MDS overcomes differentiation block sure, HSCs were washed twice to get rid of cytokines and cultured and improves erythroid differentiation. Here, we demonstrate in Iscove's modified Dulbecco's medium (IMDM; Lonza) con- avenues for restoring the DOCK4 functions by targeting sig- taining 1% (v/v) BSA fraction V (Thermo Fisher Scientific) for naling elements downstream of DOCK4 in human HSCs. 3 hours. Following this, the cells were exposed to cytokines for 15 Using HSCs from patients with MDS expressing reduced levels minutes at a concentration of 250 ng/mL. Specific cytokines and (haploinsufficient) of DOCK4 due to chromosome 7 dele- cytokine cocktail used in experiments are described in figure tions, we demonstrate that inhibitors of one of the three legends appropriately. identified regulators of DOCK4 is capable of relieving the TF1 erythroleukemia cells were purchased from ATCC and differentiation block along the erythroid lineage. In addition, cultured in RPMI (Gibco) containing 10% (v/v) FBS (Life Tech- inhibitors of all three regulators restored aberrant stem cell nologies), supplemented with 4 ng/mL GM-CSF. HEK293 cells migration properties observed in HSCs harboring aberrant were cultured in DMEM (Gibco) containing 10% (v/v) FBS. DOCK4 expression. All studies involving human subjects were conducted in accordance with U.S. Common Rule. Peripheral blood or bone marrow aspirates from each patient with MDS were obtained after insti- tutional review board approval and informed written consent. þ signaling networks regulated by DOCK4 in prelineage- CD34 HSPCs from patients with MDS were purified as described þ committed HSCs are not known. previously using CD34 Selection Kit purchased from Stemcell In this article, we used a population of early-stage human Technologies, Inc (16, 21). primary HSCs, as defined by expression of surface marker proteins þ CD34 and CD90 to identify downstream signaling networks Nucleofection of CD34 HSCs regulated by DOCK4. Furthermore, we determined the functions Control (#D-001810-10, Dharmacon Inc.) or DOCK4 siRNA þ of DOCK4 and the consequences of reduced DOCK4 expression (Dharmacon Inc.) was nucleofected into CD34 HSCs using þ in early HSCs. These studies revealed several phosphatases and CD34 Cells Nucleofection Kit (Lonza) according to the manu- kinases are regulated by DOCK4. We demonstrate that DOCK4 facturer's protocol. Briefly, 2.5 106 cells were nucleofected with regulated tyrosine phosphorylation of a large number of signaling 300 nmol/L siRNA using the U-08 program in the Nucleofector II proteins resulting in significant increases in global phospho- machine. Following nucleofection, cells were cultured in Stemspan tyrosine levels. Using mass spectrometry phosphoproteomic SFEM II supplemented with 50 ng/mL TPO, 50 ng/mL SCF, approaches, we precisely identified LYN (tyrosine protein 50 ng/mL FLT3-L, 50 ng/mL IL3, and 50 ng/mL IL6 until used for kinase-Lyn), PTPN6 [tyrosine-protein phosphatase nonreceptor subsequent experiments. Similarly, in the experiments involving type 6, also known as Src homology region 2 domain-containing knockdown of LYN, SHIP1,orSHP1, respective smartpool siRNA phosphatase-1 (SHP1)], and INPP5D [(phosphatidylinositol (Dharmacon Inc.) were used. In the experiments involving TF1 cells, 3,4,5-trisphosphate 5-phosphatase 1, also known as Src homol- control or DOCK4 siRNA was nucleofected using Nucleofection ogy 2 domain containing inositol polyphosphate 5-phosphatase Kit T (Lonza) according to the manufacturer's protocol. 1 (SHIP1)] as most significantly impacted (hyper tyrosine- phosphorylated) proteins. LYN kinase directly phosphorylated Mass spectrometry phosphoproteomics phosphatases SHP1 and SHIP1 at tyrosine sites 536 and 1021, HSCs that were briefly cultured for 3 hours were used to respectively. Low DOCK4 levels led to increased stem cell migra- knockdown DOCK4 and recultured for 24 hours prior to lysing tion, which was blunted in the presence of pharmacologic both DOCK4-knockdown (50%) and DOCK4-intact cells using inhibitors of LYN or SHP1 or SHIP1. In DOCK4-deficient MDS phosphorylation lysis buffer [50 mmol/L HEPES (pH 7.3), patient samples [-7/(del)7q], we observed increased numbers of 150 mmol/L sodium chloride, 1 mmol/L EDTA, 1.5 mmol/L mag- þ þ CD34 /CD45 cells in circulation. Finally, we demonstrate that nesium chloride, 100 mmol/L sodium fluoride, 10 mmol/L pharmacologic inhibition of SHP1 in DOCK4-deficient HSCs sodium pyrophosphate, 200 mmol/L sodium orthovanadate, from patients with MDS can improve erythroid differentiation. 10% glycerol, 0.5% Triton X-100, and 1 mmol/L phenylmethyl- Altogether, this study has identified a new signaling network that sulfonyl fluoride) as described previously (22). Protein concen- can be leveraged to potentially overcome the functional defects tration in the supernatants was determined by BCA assay. A total that arise because of reduced expression of DOCK4 in MDS. of 450 mg of total protein for each of the two samples were reduced and alkylated prior to trypsin digestion. Phosphopeptides from the digests were enriched using TiO2 beads and fractionated Materials and Methods them by high pH reverse phase into four fractions each (23). Each Primary HSC isolation and culture fraction was desalted prior to LC/MS analysis. Nano LC/MS-MS þ þ CD34 /CD90 HSCs were purified from mobilized peripheral analyses were performed with a 75 mm 10.5 cm PicoChip blood of healthy donors purchased from Key Biologicals, Inc. column packed with 3 mm Reprosil C18 beads with Dionex using a CliniMACS (Miltenyi Biotec, Inc) device (16–19). Purified UltiMate 3000 Rapid Separation nanoLC coupled to a Q Exactive

www.aacrjournals.org Clin Cancer Res; 25(18) September 15, 2019 5639

Sundaravel et al.

HF Hybrid Quadrupole-Orbitrap Mass Spectrometer (Thermo ing shaker at 4C. Immunoprecipitation followed by immuno- Fisher Scientific Inc). A 150 mm 3 cm trap packed with 3 mm blot analysis was performed as described earlier. beads was installed in-line. Peptides were separated in 120-minute gradient. Data were acquired in data-dependent MS-MS mode Transfection and immunoprecipitation with a top-15 method. Dynamic exclusion was set to 20 seconds Flag-tagged full-length DOCK4 plasmid (ref. 8; gift from and charge 1þ ions were excluded. MS1 scans were collected from Dr. Linda Van Aelst, Cold Spring Harbor Laboratory) was cotrans- 300–2,000 m/z with resolving power equal to 60,000. The MS1 fected along with GFP-tagged LYN plasmid (ref. 24; gift from automatic gain control (AGC) was set to 3 106. Precursors were Dr. Anna Huttenlocher, University of Wisconsin, Madison, WI) isolated with a 2.0 m/z isolation width, and the HCD normalized or GFP-tagged SHIP1 plasmid (ref. 25; gift from Dr. Aaron collision energy was set to 30%. The MS2 AGC was set to 1 105 Marshall, University of Manitoba, Winnipeg, Canada) or GFP- with the resolving power set at 30,000. Phosphopeptides in which tagged SHP1 plasmid (ref. 26; gift from Dr. Stephen Shaw, NCI) the phosphorylation sites that can be assigned to a single amino using Lipofectamine 2000 Reagent (Thermo Fisher Scientific) acid with 75% probability or better in at least one sample were according to the manufacturer's protocol. Twenty-four hours filtered. Robust z-scores were computed from the log2-fold changes later cells were harvested, lysed, and protein concentration was to compare knocked down cells versus control cells and defined a calculated using Lowry–Bradford assay. Protein G Dynabeads z-score of 1.5 as upregulated and 1.5 as downregulated. (Thermo Fisher Scientific) were coated with indicated antibodies and immunoprecipitation was carried out according to In vitro kinase assays the manufacturer's protocol. GFP-trap beads (ChromoTek Inc) Multiple doses of recombinant active LYN kinase (SignalChem) were used to immunoprecipitate GFP-tagged proteins. The eluted were incubated along with 250 ng recombinant active SHIP1 samples after immunoprecipitation were analyzed by immuno- (SignalChem) or recombinant SHP1 (SignalChem) in the pres- blotting as described earlier. ence of ATP at a final concentration of 100 mmol/L. The total volume of each in vitro reaction was 25 mL using kinase dilution Database for Annotation Visualization and Integrated buffer I (SignalChem) and deionized water. The samples were Discovery analysis incubated in a 30C water bath for 15 minutes. The kinase Proteins that were hyper-tyrosine phosphorylated greater than reaction was stopped by adding 8.3 mL4 Laemmli Buffer 1.5-fold and tyrosine phosphorylated proteins identified only in (Bio-Rad) and boiling the samples for 5 minutes. The samples DOCK4 knockdown samples were subjected to functional anno- were then analyzed by immunoblotting. In the samples where tation analysis available in the Database for Annotation Visual- inhibitor was added, the LYN/Src inhibitor, RK20449 (Selleck ization and Integrated Discovery (DAVID website, http://david. Inc.) was added to a final concentration of 500 nmol/L. abcc.ncifcrf.gov/) Gene ontology option GOTERM_BP_ALL was selected and a functional annotation chart generated. LYN kinase activity assay (in vitro) LYN kinase activities in the presence of flag-tagged DOCK4 or Immunofluorescence recombinant DOCK4 C-terminus were measured using the Uni- Control and DOCK4-knockdown HSCs were immobilized on versal Tyrosine Kinase Activity Assay Kit (Takara) according to the Alcian blue–coated coverslips and stained for actin with Phalloi- manufacturer's guidelines. In experiments involving flag-tagged din (Thermo Fisher Scientific) as described previously (16). DOCK4, we ectopically expressed Flag-tagged full-length DOCK4 Images were captured using Leica STED-SP5 confocal microscope in HEK293 cells and immunoprecipitated flag-tagged DOCK4 at 63 magnification. Fiji ImageJ software was used to quantify using anti-Flag coated protein G Dynabeads (Thermo Fisher the promigratory cells using the circularity feature. At least 100 Scientific) according to the manufacturer's protocol. Following cells from four random fields were analyzed. this, increasing amounts of immunoprecipitated flag-tagged DOCK4 as indicated was incubated with 20 ng of active recom- Transwell migration assays binant LYN kinase or active recombinant JAK2 kinase. Similarly, HSC migration assays were performed using transwells. Briefly, in experiments involving recombinant DOCK4 C-terminus, 150,000 HSCs were suspended in 100 mL of starvation media increasing concentration of DOCK4 C-terminus (Proteintech) as [IMDM containing 1% (v/v) BSA fract V] and was added to the top indicated was incubated with 20 ng of active recombinant LYN chamber of the 5-mm pore transwell insert (24-well plate format kinase or active recombinant JAK2 kinase. transwell, Corning). A total of 0.5 mL of starvation media with various concentrations (0–100 ng/mL) of chemokine stromal- In vitro binding assay derived factor-1 alpha was added to the bottom chamber. The Flag-tagged recombinant DOCK4 C-terminus was generated by transwell plates were incubated for 4 hours in a 37 C5%CO2. The cloning DOCK4 C-terminus using primers DOCK4 C-terminus transwell inserts were carefully removed and the migrated cells in forward primer - 50-GGTGCCATGGGCCACCATCACCACCA- the bottom chamber were resuspended. Samples were obtained TCATCACCACCATCACCCTTTGTTGTCTGACAAACACAC and from the bottom chamber and stained with Acridine orange and DOCK4 C-terminus reverse primer - 50-CACCCTCGAGTCAC- propidium iodide nuclear dyes (AO-PI dye, Nexcelom). The TTGTCGTCATCGTCTTTGTAGTCTAACTGAGAGACCTTGCGG stained samples were enumerated using Nexcelom Auto 2000 into pET15b plasmid purchased from Novagen. Following Cell Counter (Nexcelom). All the migration experiments were cloning, we produced recombinant flag-tagged DOCK4 C- performed in triplicates. In the experiments involving inhibitor terminus according to the manufacturer's protocol. A total treatments [LYN/Src inh. – RK20449 (Selleck Inc.), SHIP1 inh. – of 100 ng recombinant LYN and 400 ng of flag-tagged recom- 3AC (EMD Millipore Inc.), and SHP1 inh. – TPI-1 (Cayman Inc.)], binant DOCK4 C-terminus was incubated overnight along the cells were exposed to inhibitors for 1 hour in IMDM contain- with anti-IgG- or anti-Flag–coated magnetic beads in a rotat- ing 1% BSA media prior to adding to the top chamber of the

5640 Clin Cancer Res; 25(18) September 15, 2019 Clinical Cancer Research

Reduced Expression of DOCK4 in Myelodysplasia

transwell. Migration assays with TF1 cells were performed as DOCK4 regulates the phosphorylation of kinases and described previously (27). phosphatases To identify the proteins that were impacted in their phosphor- Methylcellulose colony assays and hemoglobin ELISA ylation because of reduced DOCK4 expression, we performed A total of 1,500 HSCs from healthy or MDS patients phosphoproteomic analysis by mass spectrometry. These experi- were cultured in methylcellulose (Stemcell Technologies Inc. ments uncovered a large number of phosphopeptides belonging catalog no. H4434) supplemented with 2 U/mL erythro- to mostly kinases and phosphatases that were hyperphosphory- poietin for 14–16 days in the presence/absence of SHP1 lated in cells that expressed low levels of DOCK4. Among them, inhibitor, 4 mmol/L TPI-1 (Cayman Inc.). DMSO was used as SHP1, SHIP1, and LYN exhibited greatest increase in tyrosine a vehicle control. After 14–16 days, the colonies were enu- phosphorylation (Table 1). We then focused on LYN kinase and merated and imaged. Images of the colonies were captured phosphatases SHP1 and SHIP1 for further study because these using Olympus microscope at 10 magnification. Following enzymes have been extensively studied during blood cell devel- colony enumeration, cells were collected from the methylcel- opment (29). We used commercially available phospho-specific lulose plates and hemoglobin levels were quantitated using antibodies against each of the three proteins to confirm our mass Hemoglobin ELISA Kit (Abcam #ab157707) according to the spectrometry results, which showed LYN, SHIP1, and SHP1 manufacturer's guidelines. proteins were phosphorylated at tyrosine sites 397, 1021, and 536, respectively (Fig. 2A–D). These results were also confirmed in þ Statistical analysis TF-1 erythroleukemia cells, which are at early phase (CD34 )of The error bars are computed as mean SEM. Student t blood cell development (Supplementary Fig. S2A–S2F). tests were performed to determine the statistical significance between the samples. In experiments involving dose responses, SHIP1 and SHP1 are substrates for LYN kinase one-way ANOVA test was performed to determine statistical Next, we wanted to determine whether LYN kinase was directly significance. Experiments were from three biological repli- responsible for phosphorylating the two phosphatases, SHIP1 cates, and values with P < 0.05 were considered statistically and SHP1 as a result of LYN kinase activation because of reduced significant. expression of DOCK4 (Supplementary Fig. S2G). To determine whether SHIP1 and SHP1 are direct targets of LYN kinase, we designed cell-free in vitro kinase assays, where either recombinant Results full-length SHIP1 protein or recombinant full-length SHP1 pro- Reduction of DOCK4 increases global tyrosine tein was incubated with active form of recombinant LYN kinase in phosphorylation in HSCs a biochemical assay in the presence of a kinase buffer. A parallel We first examined steady state expression levels of DOCK4 in assay using the same substrates but recombinant JAK2 as the HSCs and in lineage-committed progenitors, which showed a kinase enzyme was also performed as a control. The reaction relatively high level of expression in HSCs but low levels in products were then analyzed by immunoblotting using an anti- committed progenitors (Fig. 1A). We confirmed that cells used phospho SHIP1 (Y1021) antibody or an anti-phospho SHP1 in our studies were highly enriched for the HSC phenotype by (Y536) antibody. The results of these experiments showed that þ þ determining the CD34 /CD90 expression and cell morphology LYN kinase phosphorylated SHIP1 at tyrosine 1021 and SHP1 at (Supplementary Fig. S1A–S1C), which showed 84% cells were tyrosine 536 in a dose-dependent manner, whereas JAK2 kinase double positive and greater that 99% were positive for CD34 early did not show such phosphorylation of SHIP1 or SHP1 (Fig. 2E stem/progenitor cell marker. We then knocked down DOCK4 in and F; Supplementary Fig. S2H and S2I). Furthermore, the pres- these cells by siRNA, which enabled us to reduce the levels by 50% ence of the LYN/Src inhibitor, abrogated phosphorylation of both consistently in multiple primary samples as determined by qPCR SHIP1 and SHP1, reenforces the specificity of the in vitro kinase (Fig. 1B). We then determined HSC response to cytokines in cells assays (Fig. 2E and F; Supplementary Fig. S2H and S2I). To that are expressing DOCK4 at 50% of their normal levels, by determine whether SHIP1 and SHP1 are substrates of LYN kinase exposing them to a cocktail of stem cell cytokines (TPO, SCF, in HSCs, we inhibited LYN using the LYN/Src inhibitor in cultured Flt3L, IL3, and IL6; ref. 28) after a short deprivation of cytokines. HSCs. Immunoblotting analysis showed that SHIP1 (Y1021) and We also exposed cells expressing DOCK4 at their normal levels to SHP1 (Y536) phosphorylation decreased in a dose-dependent the same cocktail before harvesting cells and performing immu- manner when LYN was inhibited (Fig. 2G; Supplementary noblotting against an anti-phospho tyrosine antibody. These Fig. S2J–S2L). Taken together these results demonstrated that experiments revealed increased tyrosine phosphorylation of a reduced expression of DOCK4 initiate a sequential phosphory- large number of proteins in DOCK4 knockdown samples com- lation events impacting the signaling cascade involving LYN pared with the ones that had normal levels of DOCK4 expression kinase, SHIP1, and SHP1. (Fig. 1C and D). This increase was observed regardless of cytokine stimulation suggesting DOCK4 levels alone were sufficient to DOCK4 interacts with LYN kinase and SHIP1 but not SHP1 elicit global phosphorylation response. Levels of protein under Next, we wanted to ascertain whether DOCK4 directly interacts each condition were equivalent as reflected by no difference in with LYN kinase, as well as SHIP1 and SHP1 phosphatases in AKT phosphorylation or GAPDH in DOCK4-knockdown cells addition to whether DOCK4 regulates LYN kinase activity. To test and nontargeting control cells (Fig. 1C and E). Collectively, these this, we ectopically expressed Flag-tagged full-length DOCK4 and data demonstrated that reduced levels of DOCK4 increased global GFP-tagged full-length LYN in HEK293 cells and performed tyrosine phosphorylation and suggested that DOCK4 functions as reciprocal coimmunoprecipitation experiments coupled with a signaling intermediate downstream of several cytokine receptors immunoblot analysis. Immunoprecipitation of Flag-tagged in HSCs. DOCK4 followed by using anti-GFP/LYN antibody for detection,

www.aacrjournals.org Clin Cancer Res; 25(18) September 15, 2019 5641

Sundaravel et al.

Figure 1. Expression of DOCK4 and increased global phosphorylation of proteins in human primary HSCs with reduced DOCK4 levels. A, Expression of DOCK4 in CD34þ/ CD90þ HSCs and in lineage-committed progenitors. B, qPCR analysis for DOCK4 expression following knockdown of DOCK4 by 50% in primary HSCs. The data are 24 hours postnucleofection. Data are represented as mean SEM from six biological replicates (, P < 0.0005; Student t test). C, Immunoblot (IB) analysis 24 hours following DOCK4 knockdown (KD) in HSCs with or without exposure to a ﬁve-cytokine cocktail (TPO, SCF, FLT3 ligand, IL3, and IL6) for 15 minutes as described in Materials and Methods. An anti-pan phosphotyrosine antibody was used to detect phosphorylated proteins. The same membrane was stripped and reprobed with an anti-phospho-AKT antibody to show activity of signaling in response to cytokine stimulation as a control. GAPDH was used as a loading control. D, Quantitation of fold change in phospho-tyrosine levels in C. Comparisons were made between cells expressing DOCK4 at normal levels and cells expressing DOCK4 at 50% levels with and without cytokine exposure. Data are represented as mean SEM from four biological replicates (, P < 0.05; Student t test). E, Quantitation of the levels of phospho-AKT in HSCs from control and DOCK4-knockdown samples. Data are represented as mean SEM from four biological replicates. NT, nontargeting control.

as well as immunoprecipitation with GFP-trap beads and immu- DOCK4 directly interacted with LYN (Fig. 2H). Similarly, we noblot analysis with anti-FLAG/DOCK4 antibody showed that ectopically expressed Flag-tagged full-length DOCK4 and GFP- tagged full-length SHIP1 in HEK293 cells and performed recip- Table 1. Differentially tyrosine-phosphorylated proteins in cells with reduced rocal coimmunoprecipitation experiments coupled with immu- DOCK4 levels noblot analysis. Immunoprecipitation of Flag-tagged DOCK4 Phospho Fold change followed by using anti-GFP/SHIP1 antibody for detection, as Protein names Gene names site (z-score) well as immunoprecipitation with GFP-trap beads and immuno- PTPN6 Tyrosine-protein phosphatase (SHP1) 536 5.43 blot analysis with anti-FLAG/DOCK4 antibody showed that nonreceptor type 6 Phosphatidylinositol 3,4,5- INPP5D (SHIP1) 865 4.36 DOCK4 directly interacted with SHIP1 (Fig. 2I). However, when trisphosphate 5-phosphatase 1 similar experiments were performed using GFP-tagged full-length Neural Wiskott–Aldrich WASL 256 2.77 SHP1, we did not detect a direct interaction between DOCK4 and syndrome protein SHP1 suggesting that changes in phosphorylation seen in SHP1 is Tyrosine-protein kinase Lyn; LYN; HCK 397; 411 2.45 indirect and most likely only through LYN kinase (Fig. 2J). tyrosine-protein kinase HCK We then determined whether LYN kinase activity is regulated by Signal transducer and activator STAT3 705 1.76 in vitro of transcription 3 DOCK4 levels. To accomplish this, we set up an kinase Glycogen synthase kinase-3 beta; GSK3B; GSK3A 216; 279 1.58 assay where varying amounts recombinant DOCK4 protein was glycogen synthase kinase-3 alpha incubated with recombinant active form of LYN kinase and SHC-transforming protein 1 SHC1 427 2.76 measured LYN kinase activity using a commercially available CWF19-like protein 2 CWF19L2 201 2.8 ELISA. These experiments showed that increasing amounts of PGM2L1 Glucose 1,6-bisphosphate synthase 383 4.2 DOCK4 protein decreased LYN kinase activity (Fig. 2K and L;

5642 Clin Cancer Res; 25(18) September 15, 2019 Clinical Cancer Research

Reduced Expression of DOCK4 in Myelodysplasia

Figure 2. Reduced levels of DOCK4 leads to increased phosphorylation of LYN kinase and phosphatases SHIP1 and SHP1 and their interactions with DOCK4. A, Immunoblot (IB) analysis 24 hours following DOCK4 knockdown (KD) in HSCs with or without exposure to a five-cytokine cocktail (TPO, SCF, FLT3 ligand, IL3, and IL6) for 15 minutes as described in Materials and Methods. An anti-phospho LYN (Y397) antibody, an anti-phospho SHIP1 (Y1021) antibody, or an anti-phospho SHP1 (Y536) antibody was used for detection. Same membranes were stripped and reprobed with anti-LYN, SHIP1, SHP1, or anti-GAPDH antibody as protein loading controls. B–D, Quantitation of the levels of phospho-LYN (Y397), phospho-SHIP1 (Y1021), and phospho-SHP1 (Y536) in A. Data are represented as mean SEM from four biological replicates (, P < 0.05; Student t test.). NT, nontargeting control. E, An in vitro kinase assay was performed using recombinant SHIP1 and increasing concentrations of active LYN kinase under cell-free conditions for ascertaining whether SHIP1 is a direct target for phosphorylation by LYN. JAK2 kinase and LYN/Src inhibitor were used as controls. In vitro kinase reaction products were resolved on SDS-PAGE gel and immunoblot analysis performed using an anti- phospho SHIP1 (Y1021) antibody. The same immunoblots were also probed with anti-SHIP1 antibody as protein loading control. Representative data from three independent experiments are shown. F, An in vitro kinase experiment as described in E was set up to test whether SHP1 is a direct substrate of LYN. In vitro kinase reaction products were resolved on a SDS-PAGE gel and immunoblot analysis performed using an anti-phospho SHP1 (Y536) antibody. The same immunoblots were also probed with anti-SHP1 antibody as loading control. Representative data from three independent experiments are shown. G, Cultured HSCs were exposed to increasing doses of LYN/Src inhibitor, RK20449 in the presence or absence of stem cell cytokines. Samples were resolved and immunoblotted for phospho-LYN (Y397), phospho-SHIP1 (Y1021), and phospho-SHP1 (Y536). The same blot was probed with LYN, SHIP1, or SHP1 antibodies as protein loading controls. Representative data from three biological replicates are shown. Determination of DOCK4 interaction with LYN, SHIP1, and SHP1. Flag-tagged DOCK4 together with either GFP-tagged LYN (H) or GFP-tagged SHIP1 (I) or GFP-tagged SHP1 (J) was transfected into HEK293 cells and protein lysates were used in reciprocal immunoprecipitation (IP) assays. Immunoprecipitations were performed with an anti-Flag antibody followed by immunoblot analysis using either anti- LYN antibody, anti-SHIP1 antibody, or anti-SHP1 antibodies. As controls, immunoprecipitations were also performed using GFP-trap beads followed by an anti- Flag antibody. Anti-DOCK4 or GFP antibodies were also used as additional controls. K, Flag-tagged DOCK4 was transfected into HEK293 cells and immunoprecipitated with anti-Flag antibody followed by immunoblot analysis using anti-Flag and anti-DOCK4 antibodies. Samples were prepared using different amounts of anti-flag immunoprecipitated beads. L, LYN kinase activity assay was performed using recombinant LYN kinase and increasing amounts of flag-DOCK4 to ascertain whether DOCK4 controls LYN kinase activity. JAK2 kinase and LYN/Src inhibitor were used as controls. Data are mean SEM from three independent experiments (, P < 0.00005; One way ANOVA).

Supplementary Fig. S2M and S2N). However, when recombinant Decreased DOCK4 expression leads to increased HSC JAK2 was used as a control no modulation of JAK2 activity was migration observed when increasing amounts of DOCK4 was used in the To identify the functional implications of increased tyrosine assay (Fig. 2L; Supplementary Fig. S2M). signaling in DOCK4-deﬁcient HSCs, we performed in silico

www.aacrjournals.org Clin Cancer Res; 25(18) September 15, 2019 5643

Sundaravel et al.

Figure 3. Reduced levels of DOCK4 leads to increased cell migration and cell morphology in HSCs. A, Differentially phosphorylated proteins displayed in Table 1 were used for in silico gene ontology pathway analysis to predict functional pathways associated with identified phosphoproteins. Predicted functional pathways are displayed graphically. B, Transwell cell migration assays performed to compare differences in cell mobility/migration in HSCs expressing normal and reduced levels of DOCK4. Data are represented as mean SEM from four biological replicates (, P < 0.005; Student t test.). C, Changes in HSC morphology following knockdown (KD) of DOCK4 was determined by staining for cytoskeletal F-actin and analyzed by immunofluorescence microscopy. Cells which depicted spread morphology with bundled actin at the leading edges are shown in white arrows (scale bar, 15 mm). Individual cells at high magnification showing pronounced cell spreading and bundled F-actin when DOCK4 levels were reduced. D, Cell shape/circularity was measured in HSCs expressing normal and reduced levels of DOCK4 using circularity parameter in Fiji image analysis software. A minimum of 100 cells from four random fields were quantified (, P < 0.0005; Student t test; NT, nontargeting control).

DAVID analysis using the list ofproteinsthatwereidentified by observed in TF1 cells when DOCK4 levels were reduced mass spectrometry to be highly phosphorylated (Table 1). This (Supplementary Fig. S3B). analysis revealed cell migration as one of the highly enriched biological pathways (Fig. 3A). We tested this prediction exper- Inhibition of LYN, SHIP1, or SHP1 protein levels or their imentallybycarryingouttranswellmigrationassaysusing activity decreases HSC migration HSCs expressing normal levels and reduced levels of DOCK4, Given that LYN, SHIP1, and SHP1 are downstream of DOCK4, which showed increased rates of migration of cells expressing we next determined whether the LYN kinase and its two down- reduced levels of DOCK4 (Fig. 3B). Similar results were also stream targets SHIP1 and SHP1 were involved in regulating HSC observed in TF1 cells following DOCK4 knockdown (Supple- migration. We reduced the expression levels of LYN, SHIP1, or mentary Fig. S3A). Because F-actin in the cytoskeleton play a SHP1 in HSCs by 50% or greater by knocking down these proteins key function in cell migration, we examined for changes in the using specific siRNAs (Supplementary Fig. S4A–S4C). Using these F-actin network in HSCs expressing reduced levels of DOCK4 cells, we performed in vitro transwell migration assays and com- and compared them with HSCs expressing normal levels of pared their migration with cells that expressed LYN, SHIP1, and F-actin. These experiments revealed significantly increased SHP1 at normal levels. The results of these experiments revealed numbers of cells displaying promigratory features such as cell that reduced expression of LYN or SHIP1 or SHP1 led to a spreading and bundled F-actin in the leading edges of the cells significant decrease in the migration of HSCs compared with the (Fig. 3C). In follow-up experiments we quantified the extent of controls (Fig. 4A). We extended these studies and performed a cell spreading in DOCK4-knocked down (50% knockdown) series of experiments where we exposed HSCs to increasing cells and cells expressing normal levels of DOCK4 by comput- concentrations of inhibitors of LYN/Src kinase, SHIP1, and SHP1 ing circularity values using the built-in circularity feature avail- and evaluated their migration response. These studies demon- able in the Fiji software. This quantitation revealed that cell strated a dose-dependent decrease in HSC migration (Fig. 4B–D). spreading was significantly increased when DOCK4 levels Taken together, increased migration of HSCs observed in cells were reduced in HSCs as indicated by the decrease in circularity expressing reduced levels of DOCK4 seemed to be as a result of values (Fig. 3D). Similar promigratory features were also each of the three signaling molecules identified in this study.

5644 Clin Cancer Res; 25(18) September 15, 2019 Clinical Cancer Research

Reduced Expression of DOCK4 in Myelodysplasia

Figure 4. Inhibition of LYN or SHP1 or SHIP1 activities reverse increased migration exhibited by DOCK4-deﬁcient HSCs. A, Transwell migration assays performed following knockdown (KD) of LYN, SHP1 or SHIP1 by using speciﬁc siRNAs in HSCs. Data are represented as mean SEM from three technical replicates (, P < 0.05; Student t test). Data are representative of three biological replicates. B–D, Transwell migration assays performed on HSCs expressing normal levels of DOCK4 exposed to increasing concentrations of LYN/Src inhibitor (RK20449), SHP1 inhibitor (TPI-1), and SHIP1 inhibitor (3AC), respectively. Data are represented as mean SEM from three technical replicates (, P < 0.005; One-way ANOVA). Transwell migration assays performed on HSCs expressing reduced levels of DOCK4 in the presence or absence of LYN/Src inhibitor (RK20449; E), SHP1 inhibitor (TPI-1; F), and SHIP1 inhibitor (3AC; G). Data are represented as mean SEM from three technical replicates (, P < 0.05; Student t test). Data are representative of three biological replicates. NT, nontargeting control.

Inhibitors of LYN, SHIP1, and SHP1 restore normal HSC (3AC) and SHP1 (TPI-1) under conditions to promote erythroid migratory properties in DOCK4-deficient cells colony formations. The results of these experiments revealed that Next, we interrogated whether inhibition of LYN kinase, SHIP1, LYN/SRC kinase inhibitors suppressed formation of erythroid or SHP1 can reverse the increased migration observed in HSCs colonies, whereas the SHIP1 inhibitor, 3AC, showed no change in expressing reduced levels of DOCK4. We performed in vitro colony numbers in patient with -7/(del)7q MDS HSCs (data not transwell migration assays using HSCs expressing normal and shown). However, MDS patient samples that were exposed to the reduced levels of DOCK4 in the presence and absence of phar- SHP1 inhibitor exhibited a 50% increase in erythroid colonies, as macologic inhibitors of LYN/Src kinase, SHIP1, or SHP1. As well as up to 5-fold increase in hemoglobin content without expected, in the absence of LYN/Src inhibitor, DOCK4-deficient suppressing overall colony numbers (Fig. 5A–D). In agreement HSCs exhibited significant increase in transwell migration when with these data morphology of the erythroid colonies was larger compared with the controls (Fig. 4E). However, in the presence of and brighter red in intensity compared with HSCs from patients LYN/Src inhibitor, the increased migration exhibited by the with -7/(del)7q MDS that were not exposed to the inhibitor. In DOCK4-knocked down cells was significantly blunted and addition, enumeration of differential colonies showed a shift returned to migration levels exhibited by DOCK4 intact HSCs from myeloid to erythroid under the culture conditions that was (Fig. 4E). In a similar manner, increased migration exhibited by used in these experiments. To test whether pharmacologic inhi- DOCK4-deficient HSCs was also significantly reduced in the bition of SHP1 under conditions where DOCK4 expression was at presence of pharmacologic inhibitors of SHIP1 and SHP1 50% will result in improved erythroid differentiation, we per- (Fig. 4F and G). Taken together, these studies provide evidence formed methyl cellulose colony assays using HSCs that have been that aberrant migration resulted by reduced DOCK4 levels can be treated with DOCK4 siRNAs to reduce DOCK4 expression to restored to normal levels by pharmacologically targeting its haploinsufficient levels in the presence or absence of SHP1 downstream targets LYN or SHIP1 or SHP1. inhibitor. These experiments revealed that exposure of cells expressing reduced levels of DOCK4 to SHP1 inhibitor signifi- Inhibition of SHP1 promotes erythroid differentiation cantly increased the erythroid colonies, whereas cells expressing in -7/(del)7q MDS samples normal levels of DOCK4 showed no increase in colony numbers Because anemia is central to morbidity and mortality of after exposure to the same inhibitor in comparison with the patients with MDS, we investigated whether one or more of the vehicle-treated controls (Fig. 5E). In addition, SHP1 inhibitor inhibitors of downstream effectors of DOCK4 are capable of increased the hemoglobin levels and size of the erythroid colonies improving erythroid differentiation with minimal toxicity to in the experimental arm of the study compared with the control HSCs (Supplementary Fig. S5A). We setup hematopoietic colony arm (Fig. 5F and G). SHP1 inhibition did not have any impact on assays using HSCs from patients with MDS in the presence and differentiation of HSCs expressing normal levels of DOCK4 absence of inhibitors of LYN/SRC kinase (RK20449), SHIP1 (Fig. 5E–G; Supplementary Fig. S5B–S5E).

www.aacrjournals.org Clin Cancer Res; 25(18) September 15, 2019 5645

Sundaravel et al.

Figure 5. Inhibition of SHP1 activity promotes erythroid differentiation in DOCK4-deficient MDS. CD34þ stem/progenitor cells were purified from -7/(del)7q MDS patients' bone marrow mononucleated cells and methylcellulose colony assays were set up in the presence or absence of SHP1 inhibitor, TPI-1 (4 mmol/L). A, After 14–16 days of culture under differentiation conditions, total number of colonies enumerated from each arm of the experiment. Data are mean SEM from 7 different patients with -7/(del)7q MDS. B, Scoring for early erythroid (BFU-E), late erythroid (CFU-E), and myeloid (CFU-GM; , P < 0.05; Student t test.). Data are mean SEM from 7 different patients with -7/(del)7q MDS. C, ELISA performed to determine beta hemoglobin expression. Data are represented as mean SEM from three technical replicates (, P < 0.05; , P < 0.005; Student t test.). D, Photomicrographs depicting colony morphology and the extent of hemoglobin after 14–16 days in methylcellulose (scale bar, 100 mm). Twenty-four hours following DOCK4 knockdown in HSCs, methylcellulose colony assays were set up in the presence or absence of SHP1 inhibitor, TPI-1 (4 mmol/L). E, After 14–16 days of culture under erythroid differentiation conditions percentage of erythroid colonies enumerated from each arm of the experiment. Data are mean SEM from four biological replicates. (, P < 0.05; Student t test). F, ELISA performed to determine hemoglobin expression. Data are representative of five biological replicates (, P < 0.05; , P < 0.005; Student t test.). G, Photomicrographs depicting colony morphology and the extent of hemoglobin after 14–16 days in methylcellulose (scale bar, 100 mm). H, Schematic of the DOCK4 signaling pathway in HSCs.

Increased HSPC mobilization into the peripheral circulation eral blood samples from patients that are haplo-insufﬁcient for in patients with -7/(del)7q MDS DOCK4 [-7/(del)7q] expression. Flow cytometry analysis was þ Because increased migration of HSCs within the bone marrow performed to determine the percentages of CD34 subpopula- þ can lead to increased HSPC mobilization, we examined periph- tion within the CD45 population using peripheral blood

5646 Clin Cancer Res; 25(18) September 15, 2019 Clinical Cancer Research

Reduced Expression of DOCK4 in Myelodysplasia

samples from healthy individuals, patients with non -7q MDS, is effective in reducing the melanoma tumor burden in and patients with -7/(del)7q MDS. We found that compared with mice (44). In another study it was shown that mice lacking þ non -7q MDS samples, percent CD34 cells in -7/(del)7q MDS Shp1 do not respond to TGF-b (45). Because previous work samples were approximately 8.8-fold higher (P ¼ 0.05; Supple- by us and others have shown that in MDS TGF-b signaling is mentary Fig. S6A and S6B). overactive and inhibiting this pathway can restore hematopoiesis in MDS (46–48), our current work identifying SHP1 inhibition leading to terminal erythroid differentiation pro- Discussion vides a unique opportunity to develop inhibitors of SHP1 that In this study, we identify key signaling pathways regulated by mightbeeffectiveintreatingpatientswithMDS. the adaptor protein DOCK4 (Fig. 5E). As a classical adaptor Kinase inhibitors such as midostaurin are effective in patients protein, DOCK4 lacks catalytic activity but provide multiple with high-risk Flt3-mutated MDS/acute myelogenous leukemia, docking sites for other signaling elements and regulate their whereas proerythroid differentiation agents such as luspatercept catalytic activities or stabilities via protein–protein interac- and erythropoietin are effective in patients with low-risk MDS. tion (30, 31). In our previous work we demonstrated that in Our findings in this study highlight the potential use of SHP1 differentiating primary human erythroblasts DOCK4 activates inhibitor as a proerythroid differentiation agent in patients with one of its downstream targets, RAC1 GTPase, which in turn intermediate/high risk MDS with chromosome 7 deletions. promotes formation of the actin skeletal network required for Future investigation of SHP1 inhibitor as single agent and in terminal differentiation (16). Now we show in HSCs that reduced combination with luspatercept or 5-azacytidine/decitabine as a levels of DOCK4 results in global increase in tyrosine phosphor- treatment strategy in -7/del(7q) MDS is warranted. Taken togeth- ylation both with and without exposure to hematopoietic cyto- er, this study has uncovered a signaling network regulated by kines. Among the increased phosphorylated proteins LYN kinase, DOCK4 that can be targeted to reverse the aberrant phenotypes SHP1, and SHIP1 were prominent. Although activation of phos- arising because of reduced expression of DOCK4. phatases, SHP1 and SHIP1 leads to dephosphorylation of their targets, overall reduced expression of DOCK4 resulted in phos- Disclosure of Potential Conflicts of Interest phorylation of a large number of proteins due to activation of A. Verma holds ownership interest (including patents) in and is a consultant/ kinases. As result we observed a net gain in global phosphoryla- advisory board member for Stelexis. No potential conflicts of interest were tion when DOCK4 levels were low. Overall, the mechanism of disclosed by the other authors. action of DOCK4 is to act as a negative regulator of protein phosphorylation. LYN kinase, SHP1 and SHIP1 identified in this study are examples of downstream targets of DOCK4. Authors' Contributions Increased cell migration and morphologic changes we observed Conception and design: S. Sundaravel, A. Verma, A. Wickrema Development of methodology: S. Sundaravel, W.-L. Kuo, T.D. Bhagat when DOCK4 levels were low are consistent with functions that Acquisition of data (provided animals, acquired and managed patients, have been ascribed to LYN kinase based on previously published provided facilities, etc.): S. Sundaravel, W.-L. Kuo, J.J. Jeong, work (32–36). Previous studies have also shown that increased G.S. Choudhary, S. Gordon-Mitchell, H. Liu, T.D. Bhagat, K.L. McGraw, HSC migration was consistent with increase in HSC mobiliza- S. Gurbuxani, A.F. List, A. Verma tion (37, 38), which we also observed in -7/(del)7q MDS patient Analysis and interpretation of data (e.g., statistical analysis, biostatistics, blood samples. Our current work seemed to suggest that increased computational analysis): S. Sundaravel, W.-L. Kuo, J.J. Jeong, G.S. Choudhary, T.D. Bhagat, A. Verma, A. Wickrema HSC mobilization is specifically associated with -7/(del)7q MDS Writing, review, and/or revision of the manuscript: S. Sundaravel, because MDS samples with other chromosomal abnormalities S. Gurbuxani, A. Verma, A. Wickrema did not exhibit increased HSC mobilization. Furthermore, our Administrative, technical, or material support (i.e., reporting or organizing current findings showing increased phosphorylation/activation of data, constructing databases): T.D. Bhagat SHIP1 and SHP1 is also consistent with previous findings show- Study supervision: A. Wickrema ing both these phosphatases are substrates for LYN kinase (39, 40). In fact, Lyn-deficient mice exhibit similar phenotypic character- Acknowledgments istics to mice lacking Ship1 and Shp1 (29). On the basis of these This work was supported, in part, by NIH R01 HL16336 (to A. Verma and data we show DOCK4, LYN kinase, SHIP1, and SHP1 are all part A. Wickrema), Leukemia and Lymphoma Society translational research of the same signaling cascade and because deficiency of DOCK4 in program (to A. Verma and A. Wickrema) and NCI F99/K00 CA223044 HSCs impacts all three enzymes one could target this pathway to predoctoral to postdoctoral fellow transition award (to S. Sundaravel). We reverse functional deficiency observed in these HSCs. thank Dr. Linda Van Aelst (Cold Spring Harbor Laboratory) for generously providing the flag-tagged DOCK4 construct and Dr. Aaron Marshall In fact when we evaluated for terminal differentiation of þ (University of Manitoba, Winnipeg, Canada) for generously providing the MDS patient–derived CD34 cells under culture conditions GFP-tagged SHIP1 construct. Proteomics services were performed by that was permissive for erythroid differentiation, cells that were the Northwestern Proteomics Core Facility, generously supported by NCI exposed to the SHP1 inhibitor (TPI-1) showed prodifferentia- CCSG P30 CA060553 awarded to the Robert H. Lurie Comprehensive tion characteristics (increased BFU-Es and hemoglobinization). Cancer Center and the National Resource for Translational and Develop- These results were in agreement with previous studies using mental Proteomics supported by P41 GM108569. healthy cells, which had demonstrated that SHP1 phosphatase – The costs of publication of this article were defrayed in part by the payment of is a negative regulator of erythroid differentiation (41 43). page charges. This article must therefore be hereby marked advertisement in Therefore, by blocking SHP1 activity one can potentially reverse accordance with 18 U.S.C. Section 1734 solely to indicate this fact. anemia in patients with -7/(del)7q MDS. Recent work by Kundu and colleagues (44) have demonstrated that TPI-1 and Received March 27, 2019; revised June 13, 2019; accepted July 10, 2019; its analogues are nontoxic when administered to mice and published first July 25, 2019.

www.aacrjournals.org Clin Cancer Res; 25(18) September 15, 2019 5647

Sundaravel et al.

References 1. Yajnik V, Paulding C, Sordella R, McClatchey AI, Saito M, Wahrer DCR, 22. Wickrema A, Uddin S, Sharma A, Chen F, Alsayed Y, Ahmad S, et al. et al. DOCK4, a GTPase activator, is disrupted during tumorigenesis. Cell Engagement of Gab1 and Gab2 in erythropoietin signaling. J Biol Chem 2003;112:673–84. 1999;274:24469–74. 2. Upadhyay G, Goessling W, North TE, Xavier R, Zon LI, Yajnik V. Molecular 23. Yue X-S, Hummon AB. Combination of multistep IMAC enrichment association between beta-catenin degradation complex and Rac guanine with high-pH reverse phase separation for in-depth phosphoproteomic exchange factor DOCK4 is essential for Wnt/beta-catenin signaling. profiling. J Proteome Res 2013;12:4176–86. Oncogene 2008;27:5845–55. 24. Yoo SK, Starnes TW, Deng Q, Huttenlocher A. Lyn is a redox sensor that 3. Xiao Y, Peng Y, Wan J, Tang G, Chen Y, Tang J, et al. The atypical guanine mediates leukocyte wound attraction in vivo. Nature 2011;480:109–12. nucleotide exchange factor Dock4 regulates neurite differentiation through 25. Pauls SD, Ray A, Hou S, Vaughan AT, Cragg MS, Marshall AJ. FcgRIIB- modulation of Rac1 GTPase and actin dynamics. J Biol Chem 2013;288: independent mechanisms controlling membrane localization of the inhib- 20034–45. itory phosphatase SHIP in Human B Cells. J Immunol 2016;197:1587–96. 4. Yan D, Li F, Hall ML, Sage C, Hu W-H, Giallourakis C, et al. An isoform of 26. Liu Y, Kruhlak MJ, Hao J-J, Shaw S. Rapid T cell receptor-mediated SHP-1 GTPase regulator DOCK4 localizes to the stereocilia in the inner ear and S591 phosphorylation regulates SHP-1 cellular localization and phospha- binds to harmonin (USH1C). J Mol Biol 2006;357:755–64. tase activity. J Leukoc Biol 2007;82:742–51. 5. Kang H, Davis-Dusenbery BN, Nguyen PH, Lal A, Lieberman J, Van Aelst L, 27. Prebet T, Lhoumeau A-C, Arnoulet C, Aulas A, Marchetto S, phane et al. Bone morphogenetic protein 4 promotes vascular smooth muscle Audebert S, et al. The cell polarity PTK7 receptor acts as a modulator of contractility by activating MicroRNA-21 (miR-21), which down-regulates the chemotherapeutic response in acute myeloid leukemia and impairs expression of family of dedicator of cytokinesis (DOCK) proteins. J Biol clinical outcome. Blood 2010;116:2315–23. Chem 2012;287:3976–86. 28. Knapp DJHF, Hammond CA, Aghaeepour N, Miller PH, Pellacani D, Beer 6. Eguchi K, Yoshioka Y, Yoshida H, Morishita K, Miyata S, Hiai H, et al. The PA, et al. Distinct signaling programs control human hematopoietic stem Drosophila DOCK family protein sponge is involved in differentiation of cell survival and proliferation. Blood 2017;129:307–18. R7 photoreceptor cells. Exp Cell Res 2013;319:2179–95. 29. Harder KW, Quilici C, Naik E, Inglese M, Kountouri N, Turner A, et al. 7. Okamoto O, Carvalho ACS, Marti LC, Vêncio RZ, Moreira-Filho CA. Perturbed myelo/erythropoiesis in Lyn-deficient mice is similar to that in Common molecular pathways involved in human CD133þ/CD34þ pro- mice lacking the inhibitory phosphatases SHP-1 and SHIP-1. Blood 2004; genitor cell expansion and cancer. Cancer Cell Int 2007;7:11. 104:3901–10. 8. Yu J-R, Tai Y, Jin Y, Hammell MC, Wilkinson JE, Roe J-S, et al. TGF-b/Smad 30. Kobayashi M, Harada K, Negishi M, Katoh H. Dock4 forms a complex with signaling through DOCK4 facilitates lung adenocarcinoma metastasis. SH3YL1 and regulates cancer cell migration. Cell Signal 2014;26:1082–8. Genes Dev 2015;29:250–61. 31. Ueda S, Negishi M, Katoh H. Rac GEF Dock4 interacts with cortactin to 9. Abraham S, Scarcia M, Bagshaw RD, McMahon K, Grant G, Harvey T, et al. A regulate dendritic spine formation. Mol Biol Cell 2013;24:1602–13. Rac/Cdc42 exchange factor complex promotes formation of lateral filo- 32. O'Laughlin-Bunner B, Radosevic N, Taylor ML, Shivakrupa, DeBerry C, podia and blood vessel lumen morphogenesis. Nat Commun 2015;6: Metcalfe DD, et al. Lyn is required for normal stem cell factor-induced 7286. proliferation and chemotaxis of primary hematopoietic cells. Blood 2001; 10. Debruyne DN, Turchi L, Burel-Vandenbos F, Fareh M, Almairac F, Virolle V, 98:343–50. et al. DOCK4 promotes loss of proliferation in glioblastoma progenitor 33. Orschell CM, Borneo J, Munugalavadla V, Ma P, Sims E, Ramdas B, et al. cells through nuclear beta-catenin accumulation and subsequent miR-302- Deficiency of Src family kinases compromises the repopulating ability of 367 cluster expression. Oncogene 2018;37:241–54. hematopoietic stem cells. Exp Hematol 2008;36:655–66. 11. Kjeldsen E, Veigaard C. DOCK4 deletion at 7q31.1 in a de novo acute 34. Roselov€ a P, Obr A, Holoubek A, Grebenov aD,Kuzelova K. Adhesion myeloid leukemia with a normal karyotype. Cell Oncol 2013;36: structures in leukemia cells and their regulation by Src family kinases. 395–403. Cell Adh Migr 2018;12:286–98. 12. Hiramoto K, Negishi M, Katoh H. Dock4 is regulated by RhoG and 35. Wheeler SE, Morariu EM, Bednash JS, Otte CG, Seethala RR, Chiosea SI, promotes Rac-dependent cell migration. Exp Cell Res 2006;312:4205–16. et al. Lyn kinase mediates cell motility and tumor growth in EGFRvIII- 13. Hiramoto-Yamaki N, Takeuchi S, Ueda S, Harada K, Fujimoto S, Negishi M, expressing head and neck cancer. Clin Cancer Res 2012;18:2850–60. et al. Ephexin4 and EphA2 mediate cell migration through a RhoG- 36. Nakata Y, Tomkowicz B, Gewirtz AM, Ptasznik A. Integrin inhibition dependent mechanism. J Cell Biol 2010;190:461–77. through Lyn-dependent cross talk from CXCR4 chemokine receptors in 14. Zhou L, Opalinska J, Sohal D, Yu Y, Mo Y, Bhagat T, et al. Aberrant normal human CD34 marrow cells. Blood 2006;107:4234–9. epigenetic and genetic marks are seen in myelodysplastic leukocytes and 37. Gur-Cohen S, Itkin T, Chakrabarty S, Graf C, Kollet O, Ludin A, et al. PAR1 reveal Dock4 as a candidate pathogenic gene on chromosome 7q. J Biol signaling regulates the retention and recruitment of EPCR-expressing bone Chem 2011;286:25211–23. marrow hematopoietic stem cells. Nat Med 2015;21:1307–17. 15. Heaney ML, Golde DW. Myelodysplasia. N Engl J Med 1999;340:1649–60. 38. Borneo J, Munugalavadla V, Sims EC, Vemula S, Orschell CM, Yoder M, 16. Sundaravel S, Duggan R, Bhagat T, Ebenezer DL, Liu H, Yu Y, et al. Reduced et al. Src family kinase–mediated negative regulation of hematopoietic DOCK4 expression leads to erythroid dysplasia in myelodysplastic syn- stem cell mobilization involves both intrinsic and microenvironmental dromes. Proc Natl Acad Sci U S A 2015;112:E6359–68. factors. Exp Hematol 2007;35:1026–37. 17. Yu Y, Mo Y, Ebenezer D, Bhattacharyya S, Liu H, Sundaravel S, et al. High 39. Baran CP, Tridandapani S, Helgason CD, Humphries RK, Krystal G, Marsh resolution methylome analysis reveals widespread functional hypomethy- CB. The inositol 50-phosphatase SHIP-1 and the Src kinase Lyn negatively lation during adult human erythropoiesis. J Biol Chem 2013;288: regulate macrophage colony-stimulating factor-induced Akt activity. J Biol 8805–14. Chem 2003;278:38628–36. 18. Madzo J, Liu H, Rodriguez A, Vasanthakumar A, Sundaravel S, Caces DBD, 40. Mkaddem S Ben, Murua A, Flament H, Titeca-Beauport D, Bounaix C, et al. Hydroxymethylation at gene regulatory regions directs stem/early Danelli L, et al. Lyn and Fyn function as molecular switches that control progenitor cell commitment during erythropoiesis. Cell Rep 2014;6: immunoreceptors to direct homeostasis or inflammation. Nat Commun 231–44. 2017;8:246. 19. Jeong JJ, Gu X, Nie J, Sundaravel S, Liu H, Kuo W-L, et al. Cytokine- 41. Bittorf T, Seiler J, Zhang Z, Jaster R, Brock J. SHP1 Protein tyrosine regulated phosphorylation and activation of TET2 by JAK2 in hematopoi- phosphatase negatively modulates erythroid differentiation and suppres- esis. Cancer Discov 2019;9:778–95. sion of apoptosis in J2E erythroleukemic cells. Biol Chem 1999;380: 20. Wickrema A, Krantz SB, Winkelmann JC, Bondurant MC. Differentiation 1201–9. and erythropoietin receptor gene expression in human erythroid progen- 42. Wickrema A, Chen F, Namin F, Yi T, Ahmad S, Uddin S, et al. Defective itor cells. Blood 1992;80:1940–9. expression of the SHP-1 phosphatase in polycythemia vera. Exp Hematol 21. Gilles L, Arslan AD, Marinaccio C, Wen QJ, Arya P, McNulty M, et al. 1999;27:1124–32. Downregulation of GATA1 drives impaired hematopoiesis in primary 43. Sharlow ER, Pacifici R, Crouse J, Batac J, Todokoro K, Wojchowski DM. myelofibrosis. J Clin Invest 2017;127:1316–20. Hematopoietic cell phosphatase negatively regulates erythropoietin-

5648 Clin Cancer Res; 25(18) September 15, 2019 Clinical Cancer Research

Reduced Expression of DOCK4 in Myelodysplasia

induced hemoglobinization in erythroleukemic SKT6 cells. Blood 1997; 46. Zhou L, Nguyen AN, Sohal D, Ying Ma J, Pahanish P, Gundabolu K, et al. 90:2175–87. Inhibition of the TGF- receptor I kinase promotes hematopoiesis in MDS. 44. Kundu S, Fan K, Cao M, Lindner DJ, Zhao ZJ, Borden E, et al. Novel SHP-1 Blood 2008;112:3434–43. inhibitors tyrosine phosphatase inhibitor-1 and analogs with preclinical 47. Zhou L, McMahon C, Bhagat T, Alencar C, Yu Y, Fazzari M, et al. Reduced anti-tumor activities as tolerated oral agents. J Immunol 2010;184: SMAD7 leads to overactivation of TGF-signaling in MDS that can be 6529–36. reversed by a speciﬁc inhibitor of TGF- receptor I kinase. Cancer Res 45. Jiang L, Han X, Wang J, Wang C, Sun X, Xie J, et al. SHP-1 regulates 2011;71:955–63. hematopoietic stem cell quiescence by coordinating TGF-b signaling. J Exp 48. Shastri A, Will B, Steidl U, Verma A. Stem and progenitor cell alterations in Med 2018;215:1337–47. myelodysplastic syndromes. Blood 2017;129:1586–94.

www.aacrjournals.org Clin Cancer Res; 25(18) September 15, 2019 5649

Loss of Function of DOCK4 in Myelodysplastic Syndromes Stem Cells is Restored by Inhibitors of DOCK4 Signaling Networks

Sriram Sundaravel, Wen-Liang Kuo, Jong Jin Jeong, et al.

Clin Cancer Res 2019;25:5638-5649. Published OnlineFirst July 15, 2019.

Updated version Access the most recent version of this article at: doi:10.1158/1078-0432.CCR-19-0924

Supplementary Access the most recent supplemental material at: Material http://clincancerres.aacrjournals.org/content/suppl/2019/07/13/1078-0432.CCR-19-0924.DC1

Cited articles This article cites 48 articles, 25 of which you can access for free at: http://clincancerres.aacrjournals.org/content/25/18/5638.full#ref-list-1

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at Subscriptions [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://clincancerres.aacrjournals.org/content/25/18/5638. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.