DOCSLIB.ORG

Identification of the Chromosomal Origins of Replication (Oricrsi Oricrsii) in R

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

Identification of the Chromosomal Origins of Replication (oriCRSI oriCRSII) in R. sphaeroides 2.4.1 Tim Johnson, Randi Harbour, Kristina Hernandez, Lin Lin, and Madhusudan Choudhary Department of Biological Sciences, Sam Houston State University, Huntsville, Texas 77341 INTRODUCTION RESULTS AND DISCUSSION Rhodobacter sphaeroides belongs to the α-3 subdivision of the Proteobacteria. This organism is The advantage of the program used in this study is that it offers a progressive search and it also allows the metabolically versatile, and it grows under a variety of growth conditions, such as aerobic, semi-aerobic, processing of an entire genome at once whereas many currently available web-based programs only allow (a) and photosynthetic growth conditions. R. sphaeroides possesses a complex genome, which is comprised for a small number sequences, which is very time consuming and even providing limited information. of two chromosomes (CI and CII) and five endogenous plasmids (1). CI and CII are ~3.0Mbp and However, an alternative approach through ARTMIS used in this study further validated the result as ~0.9Mbp in size, respectively (2). Analysis of the R. sphaeroides genome reveals that genes for a wide shown in Figure 2. Furthermore, the efficacy and the accuracy of this program was tested using the entire variety of essential functions are dispersed between the two chromosomes. Recently, it has also been genomic sequences of Caulobacter cresentus and Sinirhizobium meliloti, and the program was able to demonstrated that CI and CII have been both essential and ancient partners within the R. sphaeroides identify all putative origins including the one which is biologically functional. genome since its separation from its ancestor lineage (3). The output of both search programs provided 3013 and 336 nucleotide sequence files of Chromosome I Unlike eukaryotes, prokaryotic cell lacks mitosis or mitosis like apparatus. The existence of multiple and Chromosome II, respectively. After matching the overlapping regions, there were a total 125 CI- and chromosomes in bacteria may require a well coordinated chromosomal replication and chromosomal 16 CII-specific sequences remained. Following through the protein database search, there were 37 CI- and segregation to distribute the chromosomes equally in the two daughter cells. Therefore, in order to 9 CII-specific sequences were chosen to be analyzed further. These regions of putative origins were then understand the process of DNA replication, the origin of chromosomal replication must first be further analyzed to determine the presence of known cis-elements to which the DnaA and other replication identified. The origin of replication (referred as oriC in E. coli) is the specific region in the chromosome proteins bind as shown in Figure 3. Each of the total 13 DNA regions (as shown in Table 1) along with where the DNA double helix will begin to denature allowing replication of the chromosome to initiate the 300 nucleotide upstream and the down stream sequences was then analyzed for 21 different conserved (4). This region varies 40-80 base pairs in length among different bacterial species, and usually remains boxes for oriC, DnaA, RepABC1, and RepABC2 (5). Many of these sequences contain 2 to 5 of these very AT rich (70 to 80%) as the bonds between adenine and thymine are more easily denatured than the conserved binding boxes as shown in Figure 3. Based on the %AT content and the number of binding bonds between guanine and cytosine. There are cis-elements located within and around this region, boxes, 13 possible origin of replication were identified in R. sphaeroides’ chromosomes. which are recognized by a set of proteins including DnaA, RepABC, and other proteins associated with Comparison of the genome sequences of Caulobacter crescentus and Rickettsia prowazekii revealed that chromosomal replication that bind to the specific DNA sequences in this region and facilitate the both species shared a conserved cluster of genes in the hemE-hemH region that overlapped the established initiation of the chromosomal replication. origin of replication in C. cresecentus and the putative origin of replication in R. prowazekii (6). The origin of replication of the S. meliloti chromosome has also been predicted as well as experimentally In order to identify the putative origins on CI and CII in R. sphaeroides, a silico-approach was employed confirmed to be approximately 400 kb from dnaA and adjacent to hemE (5). A putative origin of to search CI- and CII-specific genomic sequences both with variable sequence length and %GC replication of CI in R. sphaeroides is located ~40 kb from hemE but it remains uncertain until it will be composition. Two different computer programs, which search either overlapping or discrete segments of confirmed experimentally. Like R. sphaeroides, Vibrio cholerae possesses two chromosomes and the DNA sequence, were used to search the entire chromosome specific sequences. All the sequences of 50 origin of replication of the two chromosomes (oriCIvc and oriCIIvc), has been experimentally studied (7). to 100 nucleotides in length with >65% AT content were selected for further analysis. These sequences Thus, the identification of chromosomal origins in R. sphaeroides may further facilitate the mechanism of were then analyzed for the presence of cis-elements using the conserved consensus sequence found in chromosomal replication in bacterial species which possess multiple chromosomes. Sinorhizobium meliloti (5), which is closely related species to R. sphaeroides and which also belong to the α-3 subgroup of proteobacteria. METHODS Silico-approach for the identification of the origin of replication: To identify the chromosomal origin of replication in Rhodobacter sphaeroides 2.4.1, a computer program was designed in order to Chromosome I Chromosome II search the A-T rich regions within CI and CII sequence. Further, the sequence was analyzed for the ~69% GC ~69% GC presence of the consensus cis-elements which are necessary for the initiator proteins to start the replication. The algorithm was developed as such that it searches both variable nucleotide lengths (50- 100 nucleotide range) and varying %AT composition (65 % to 80%) in an overlapping and progressive manner as shown in Figure 1. The program was applied on each of the chromosomal sequence of R. sphaeroides in the fasta format, which were directly obtained from the NCBI server. For efficient use of memory and input-output loading, each sequence is analyzed sequentially in a a b Figure 3. DnaA and RepABC box biding sites for the origin of replication. a) A G+C content graph of a ~6kb region buffer. The analysis is performed by using the %AT calculation for each candidate sequence and then encompassing in the possible region for origin of replication in R. sphaeroides. b) The sequence of possible regions for checking if the nucleotide composition of the sequence is above a chosen threshold value. If a Figure 2. The G+C content and possible sites for origin of replication in CI and CII in R. sphaeroides 2.4.1 origin of replication. c) DnaA and RepABC biding sites that match the DnaA and RepABC box consensus sequences. d) sequence is shown to be above the chosen threshold value, it is then sent to the output data files. In (purple-below average; yellow-over average). a) G+C content and two possible sites for origin of The sequences of the putative DnaA and RepABC boxes. (* Biding sites for multiple box consensus sequences ) addition, ARTIMIS was also used to calculate the %GC composition within each of the discrete 120 replication in Chromosome I. b) G+C content and 9 possible sites for origin of replication in Chromosome nucleotide s long sequence along each of the two chromosomal sequences as shown in Figure 2. II. FUTURE WORKS Identification of the conserved DNA sequence boxes in the origin region: The sequences, All thirteen putative chromosomal origins of R. sphaeroides 2.4.1 will be cloned into the suicide vector (pLO1 or however, overlapped each other as was the nature of the program and as such had to be combined to Table 1. The possible regions for origin of replication in Chromosome I and Chromosome II pSUP202). The resulting recombinant plasmid will be tested biologically if one of these origins allow the suicide plasmid eliminate analyzing the same region twice. The assembled sequences were searched against the to autonomously replicate in R. sphaeroides. This work is currently in progress. protein database of the R. sphaeroides in order to identify if any of these sequences encode for the A+T content for A-T rich Locations protein. Finally, the remaining sequences were further analyzed using the DNADynamo to determine Coordinates Sequences (with A-T rich region marked as red) region TCGCATCGCCCCTCCCGCTTCGTTGAACATTTTGGCCGATTAAATTCATTTTTTTGCCGACCATCAACGTTTATTTTCTTTTTG whether they contain the consensus boxes as they were previously identified in the chromosomal 2380028-2380181 ATGAAGATTTCCAGATTTACTTTCAGTTTTTCCATGCTTATGCCTTGGAAACTGGCAGTTTCCCGTTGGC 69.32% CI origin of S. meliloti (5). The program was downloaded through the internet from the publically GGAGTGACTGAATGAAAGGCAACGATGTATCAATCATGAGATCGGAACATGAGTCTGCTCTCGAATAGAGTGAGATCAGG 1700865-1701165 ATTTAAGACAAAGTAAACATTTTTGGTATTCTTAAGTGATTGATTTTATTGAATAAATCAAGGGTGTCATATGGATTTGTTTT 72.58% CI REFERENCES available website. The program performs the searches both in forward and reverse complement TCTTAAGAAATCGTTTAATGATTGATTTATTGATTTATTAAGAAATGGATGAATCGAGATTTGATGTTCATGGTTCTTGAATG
Recommended publications

  • A Chloroplast Gene Is Converted Into a Nucleargene

    Proc. Nati. Acad. Sci. USA Vol. 85, pp. 391-395, January 1988 Biochemistry Relocating a gene for herbicide tolerance: A chloroplast gene is converted into a nuclear gene (QB protein/atrazine tolerance/transit peptide) ALICE Y. CHEUNG*, LAWRENCE BOGORAD*, MARC VAN MONTAGUt, AND JEFF SCHELLt: *Department of Cellular and Developmental Biology, 16 Divinity Avenue, The Biological Laboratories, Harvard University, Cambridge, MA 02138; tLaboratorium voor Genetica, Rijksuniversiteit Ghent, B-9000 Ghent, Belgium; and TMax-Planck-Institut fur Zuchtungsforschung, D-500 Cologne 30, Federal Republic of Germany Contributed by Lawrence Bogorad, September 30, 1987 ABSTRACT The chloroplast gene psbA codes for the the gene for ribulose bisphosphate carboxylase/oxygenase photosynthetic quinone-binding membrane protein Q which can transport the protein product into chloroplasts (5). We is the target of the herbicide atrazine. This gene has been have spliced the coding region of the psbA gene isolated converted into a nuclear gene. The psbA gene from an from the chloroplast DNA of the atrazine-resistant biotype atrazine-resistant biotype of Amaranthus hybridus has been of Amaranthus to the transcriptional-control and transit- modified by fusing its coding region to transcription- peptide-encoding regions of a nuclear gene, ss3.6, for the regulation and transit-peptide-encoding sequences of a bona SSU of ribulose bisphosphate carboxylase/oxygenase of pea fide nuclear gene. The constructs were introduced into the (6). The fusion-gene constructions (designated SSU-ATR) nuclear genome of tobacco by using the Agrobacteium tumor- were introduced into tobacco plants via the Agrobacterium inducing (Ti) plasmid system, and the protein product of tumor-inducing (Ti) plasmid transformation system using the nuclear psbA has been identified in the photosynthetic mem- disarmed Ti plasmid vector pGV3850 (7).
  • DNA Microarrays (Gene Chips) and Cancer

    DNA Microarrays (Gene Chips) and Cancer

    DNA Microarrays (Gene Chips) and Cancer Cancer Education Project University of Rochester DNA Microarrays (Gene Chips) and Cancer http://www.biosci.utexas.edu/graduate/plantbio/images/spot/microarray.jpg http://www.affymetrix.com Part 1 Gene Expression and Cancer Nucleus Proteins DNA RNA Cell membrane All your cells have the same DNA Sperm Embryo Egg Fertilized Egg - Zygote How do cells that have the same DNA (genes) end up having different structures and functions? DNA in the nucleus Genes Different genes are turned on in different cells. DIFFERENTIAL GENE EXPRESSION GENE EXPRESSION (Genes are “on”) Transcription Translation DNA mRNA protein cell structure (Gene) and function Converts the DNA (gene) code into cell structure and function Differential Gene Expression Different genes Different genes are turned on in different cells make different mRNA’s Differential Gene Expression Different genes are turned Different genes Different mRNA’s on in different cells make different mRNA’s make different Proteins An example of differential gene expression White blood cell Stem Cell Platelet Red blood cell Bone marrow stem cells differentiate into specialized blood cells because different genes are expressed during development. Normal Differential Gene Expression Genes mRNA mRNA Expression of different genes results in the cell developing into a red blood cell or a white blood cell Cancer and Differential Gene Expression mRNA Genes But some times….. Mutations can lead to CANCER CELL some genes being Abnormal gene expression more or less may result
  • The Novel Protein DELAYED PALE-GREENING1 Is Required For

    The Novel Protein DELAYED PALE-GREENING1 Is Required For

    www.nature.com/scientificreports OPEN The novel protein DELAYED PALE-GREENING1 is required for early chloroplast biogenesis in Received: 28 August 2015 Accepted: 21 April 2016 Arabidopsis thaliana Published: 10 May 2016 Dong Liu, Weichun Li & Jianfeng Cheng Chloroplast biogenesis is one of the most important subjects in plant biology. In this study, an Arabidopsis early chloroplast biogenesis mutant with a delayed pale-greening phenotype (dpg1) was isolated from a T-DNA insertion mutant collection. Both cotyledons and true leaves of dpg1 mutants were initially albino but gradually became pale green as the plant matured. Transmission electron microscopic observations revealed that the mutant displayed a delayed proplastid-to-chloroplast transition. Sequence and transcription analyses showed that AtDPG1 encodes a putatively chloroplast- localized protein containing three predicted transmembrane helices and that its expression depends on both light and developmental status. GUS staining for AtDPG1::GUS transgenic lines showed that this gene was widely expressed throughout the plant and that higher expression levels were predominantly found in green tissues during the early stages of Arabidopsis seedling development. Furthermore, quantitative real-time RT-PCR analyses revealed that a number of chloroplast- and nuclear-encoded genes involved in chlorophyll biosynthesis, photosynthesis and chloroplast development were substantially down-regulated in the dpg1 mutant. These data indicate that AtDPG1 plays an essential role in early chloroplast biogenesis, and its absence triggers chloroplast-to-nucleus retrograde signalling, which ultimately down-regulates the expression of nuclear genes encoding chloroplast- localized proteins. The chloroplast is an essential organelle in plant cells and plays important roles in primary metabolism, such as CO2 fixation, manufacture of carbon skeletons and fatty acids, and synthesis of amino acids from inorganic nitrogen1.
  • Gene Therapy Glossary of Terms

    Gene Therapy Glossary of Terms

    GENE THERAPY GLOSSARY OF TERMS A • Phase 3: A phase of research to describe clinical trials • Allele: one of two or more alternative forms of a gene that that gather more information about a drug’s safety and arise by mutation and are found at the same place on a effectiveness by studying different populations and chromosome. different dosages and by using the drug in combination • Adeno-Associated Virus: A single stranded DNA virus that has with other drugs. These studies typically involve more not been found to cause disease in humans. This type of virus participants.7 is the most frequently used in gene therapy.1 • Phase 4: A phase of research to describe clinical trials • Adenovirus: A member of a family of viruses that can cause occurring after FDA has approved a drug for marketing. infections in the respiratory tract, eye, and gastrointestinal They include post market requirement and commitment tract. studies that are required of or agreed to by the study • Adeno-Associated Virus Vector: Adeno viruses used as sponsor. These trials gather additional information about a vehicles for genes, whose core genetic material has been drug’s safety, efficacy, or optimal use.8 removed and replaced by the FVIII- or FIX-gene • Codon: a sequence of three nucleotides in DNA or RNA • Amino Acids: building block of a protein that gives instructions to add a specific amino acid to an • Antibody: a protein produced by immune cells called B-cells elongating protein in response to a foreign molecule; acts by binding to the • CRISPR: a family of DNA sequences that can be cleaved by molecule and often making it inactive or targeting it for specific enzymes, and therefore serve as a guide to cut out destruction and insert genes.
  • GENOME GENERATION Glossary

    GENOME GENERATION Glossary

    GENOME GENERATION Glossary Chromosome An organism’s DNA is packaged into chromosomes. Humans have 23 pairs of chromosomesincluding one pair of sex chromosomes. Women have two X chromosomes and men have one X and one Y chromosome. Dominant (see also recessive) Genes come in pairs. A dominant form of a gene is the “stronger” version that will be expressed. Therefore if someone has one dominant and one recessive form of a gene, only the characteristics of the dominant form will appear. DNA DNA is the long molecule that contains the genetic instructions for nearly all living things. Two strands of DNA are twisted together into a double helix. The DNA code is made up of four chemical letters (A, C, G and T) which are commonly referred to as bases or nucleotides. Gene A gene is a section of DNA that is the code for a specific biological component, usually a protein. Each gene may have several alternative forms. Each of us has two copies of most of our genes, one copy inherited from each parent. Most of our traits are the result of the combined effects of a number of different genes. Very few traits are the result of just one gene. Genetic sequence The precise order of letters (bases) in a section of DNA. Genome A genome is the complete DNA instructions for an organism. The human genome contains 3 billion DNA letters and approximately 23,000 genes. Genomics Genomics is the study of genomes. This includes not only the DNA sequence itself, but also an understanding of the function and regulation of genes both individually and in combination.
  • Completion of DNA Replication in Escherichia Coli

    Completion of DNA Replication in Escherichia Coli

    Completion of DNA replication in Escherichia coli Brian M. Wendel1, Charmain T. Courcelle, and Justin Courcelle Department of Biology, Portland State University, Portland, OR 97201 Edited by Philip C. Hanawalt, Stanford University, Stanford, CA, and approved September 29, 2014 (received for review August 5, 2014) The mechanism by which cells recognize and complete replicated would generate a third copy of the chromosomal region where the regions at their precise doubling point must be remarkably efficient, event occurs. Thus, over-replication may be inherent and pro- occurring thousands of times per cell division along the chromo- miscuous during the duplication of genomes. If true, then to somes of humans. However, this process remains poorly understood. ensure that each sequence of the genome replicates once, and Here we show that, in Escherichia coli, the completion of replication only once, per generation, cells must encode an enzymatic system involves an enzymatic system that effectively counts pairs and limits that is essentially able to count in pairs and efficiently degrade cellular replication to its doubling point by allowing converging rep- odd or over-replicated regions until the two nascent end pairs of lication forks to transiently continue through the doubling point replication events can be joined. before the excess, over-replicated regions are incised, resected, and The model organism E. coli is particularly well-suited to dis- joined. Completion requires RecBCD and involves several proteins sect how this fundamental process occurs. In E. coli, the com- associated with repairing double-strand breaks including, ExoI, pletion of replication occurs at a defined region on the genome, SbcDC, and RecG.
  • Mapping Major Replication Origins on the Rice Plastid DNA

    Mapping Major Replication Origins on the Rice Plastid DNA

    27 Original Paper Plant Biotechnotogy, 19 (1), 27- 35 (2002) Mapping Major Replication Origins on the Rice Plastid DNA Ying WANG1, Kohya TAMURA2, Yasushi SAITOHl'2, Tadashi SAT03 Soh HIDAKA4 and Ken- ichi TSUTSUM11,2,* lUnited Graduate School ofAgricultural Sciences and -~Cryobiosystem Research Center, lwate University, Ueda, Morioka. Iwate 020- 8550, Japan 3Department of Ecology and Evolutionary Biology, Graduate School ofLlfe Science, Tohoku University, Katahira. Sendai, Miyagi 980- 8577, Japan dDepartment of Crop Breeding, National Agricultural Research Center for Tohoku Region, Shimokuriyagawa, Morioka, Iwate 020-0123, Japan. *Corresponding author E-mail address: kentsu@iwate- u.ac.jp Received 5september 2001; accepted 15 october 2001 Abstract To maintain and to differentiate into various plastid lineages, replication of the plastid DNA (ptDNA) and division of the plastid must take place. However, replication initiation of the ptDNA has been less understood. The present study describes identification of the initiation region (origin) of ptDNA replication in the rice cultured cells. RNA- primed newly replicated DNA strands pulse - Iabeled with fractionated. of these strands the bromodeoxyuridine were isolated and size - Locations nascent on ptDNA determined the two major origin regions around the 3' region of each 23S rDNA in the inverted gel electrophoresis of the replication intermediates repeats (IRA and IRB). Two - dimensional agarose suggested that replication from each origin proceeds bidirectionally. This contrasted to replication
  • Γboris: Identification of Origins of Replication In

    Γboris: Identification of Origins of Replication In

    bioRxiv preprint doi: https://doi.org/10.1101/597070; this version posted April 2, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. γBOriS: Identification of Origins of Replication in Gammaproteobacteria using Motif-based Machine Learning Theodor Sperlea1, Lea Muth1, Roman Martin1, Christoph Weigel2, Torsten Waldminghaus3, and Dominik Heider1, 1Faculty of Mathematics and Computer Science, Philipps-Universität Marburg, D-35043 Marburg, Germany 2Institute of Biotechnology, Faculty III, Technische Universität Berlin (TUB), Straße des 17. Juni 135, D-10623 Berlin, Germany 3Chromosome Biology Group, LOEWE Center for Synthetic Microbiology (SYNMIKRO), Philipps-Universität Marburg, D-35043 Marburg, Germany The biology of bacterial cells is, in general, based on the infor- All currently available computational methods for the iden- mation encoded on circular chromosomes. Regulation of chro- tification of oriC sequences in bacterial chromosomes rely mosome replication is an essential process which mostly takes on nucleotide disparities on the leading and lagging strand place at the origin of replication (oriC). Identification of high of the DNA double helix (13–17). As replication usually ex- numbers of oriC is a prerequisite to enable systematic stud- tends from oriC bidirectionally, it is one of two chromoso- ies that could lead to insights of oriC functioning as well as mal sites where the leading and lagging strand switch places. novel drug targets for antibiotic development. Current meth- The most frequently used disparity, the GC skew, usually as- ods for identyfing oriC sequences rely on chromosome-wide nu- cleotide disparities and are therefore limited to fully sequenced sumes a V- or inverted V-shape with its minimum indicating genomes, leaving a superabundance of genomic fragments un- the presence of the origin of replication (18, 19).
  • Basic Genetic Terms for Teachers

    Basic Genetic Terms for Teachers

    Student Name: Date: Class Period: Page | 1 Basic Genetic Terms Use the available reference resources to complete the table below. After finding out the definition of each word, rewrite the definition using your own words (middle column), and provide an example of how you may use the word (right column). Genetic Terms Definition in your own words An example Allele Different forms of a gene, which produce Different alleles produce different hair colors—brown, variations in a genetically inherited trait. blond, red, black, etc. Genes Genes are parts of DNA and carry hereditary Genes contain blue‐print for each individual for her or information passed from parents to children. his specific traits. Dominant version (allele) of a gene shows its Dominant When a child inherits dominant brown‐hair gene form specific trait even if only one parent passed (allele) from dad, the child will have brown hair. the gene to the child. When a child inherits recessive blue‐eye gene form Recessive Recessive gene shows its specific trait when (allele) from both mom and dad, the child will have blue both parents pass the gene to the child. eyes. Homozygous Two of the same form of a gene—one from Inheriting the same blue eye gene form from both mom and the other from dad. parents result in a homozygous gene. Heterozygous Two different forms of a gene—one from Inheriting different eye color gene forms from mom mom and the other from dad are different. and dad result in a heterozygous gene. Genotype Internal heredity information that contain Blue eye and brown eye have different genotypes—one genetic code.
  • Transcription Study Guide This Study Guide Is a Written Version of the Material You Have Seen Presented in the Transcription Unit

    Transcription Study Guide This Study Guide Is a Written Version of the Material You Have Seen Presented in the Transcription Unit

    Transcription Study Guide This study guide is a written version of the material you have seen presented in the transcription unit. The cell’s DNA contains the instructions for carrying out the work of the cell. These instructions are used by the cell’s protein-making machinery to create proteins. If the cell’s DNA were directly read by the protein-making machinery, however, it could be damaged and the process would be slow and cumbersome. The cell avoids this problem by copying genetic information from its DNA into an intermediate called messenger RNA (mRNA). It is this mRNA that is read by the cell’s protein-making machinery. This process is called transcription. Components In this section you will be introduced to the components involved in the process of RNA synthesis, called transcription. This process requires an enzyme that uses many nucleotide bases to copy the instructions present in DNA into an intermediate messenger RNA molecule. RNA What is RNA? · Like DNA, RNA is a polymer made up of nucleotides. · Unlike DNA, which is composed of two strands of nucleotides twisted together, RNA is single-stranded. It can also sometimes fold into complex three-dimensional structures. · RNA contains the same nucleotides as DNA, with the substitution of uraciluridine (U) for thymidine (T). · RNA is chemically different from DNA so that the cell can easily tell the two apart. · In this animation, you will see one type of RNA, messenger RNA, being put together. · There are three types of RNA: mRNA, which you will read more about; tRNA, which is used in the translation process, and rRNA, which acts as a structural element in the ribosome (a translation component).
  • Basic Genetic Concepts & Terms

    Basic Genetic Concepts & Terms

    Basic Genetic Concepts & Terms 1 Genetics: what is it? t• Wha is genetics? – “Genetics is the study of heredity, the process in which a parent passes certain genes onto their children.” (http://www.nlm.nih.gov/medlineplus/ency/article/002048. htm) t• Wha does that mean? – Children inherit their biological parents’ genes that express specific traits, such as some physical characteristics, natural talents, and genetic disorders. 2 Word Match Activity Match the genetic terms to their corresponding parts of the illustration. • base pair • cell • chromosome • DNA (Deoxyribonucleic Acid) • double helix* • genes • nucleus Illustration Source: Talking Glossary of Genetic Terms http://www.genome.gov/ glossary/ 3 Word Match Activity • base pair • cell • chromosome • DNA (Deoxyribonucleic Acid) • double helix* • genes • nucleus Illustration Source: Talking Glossary of Genetic Terms http://www.genome.gov/ glossary/ 4 Genetic Concepts • H describes how some traits are passed from parents to their children. • The traits are expressed by g , which are small sections of DNA that are coded for specific traits. • Genes are found on ch . • Humans have two sets of (hint: a number) chromosomes—one set from each parent. 5 Genetic Concepts • Heredity describes how some traits are passed from parents to their children. • The traits are expressed by genes, which are small sections of DNA that are coded for specific traits. • Genes are found on chromosomes. • Humans have two sets of 23 chromosomes— one set from each parent. 6 Genetic Terms Use library resources to define the following words and write their definitions using your own words. – allele: – genes: – dominant : – recessive: – homozygous: – heterozygous: – genotype: – phenotype: – Mendelian Inheritance: 7 Mendelian Inheritance • The inherited traits are determined by genes that are passed from parents to children.
  • Decoding Non-Coding DNA: Trash Or Treasure?

    Decoding Non-Coding DNA: Trash Or Treasure?

    GENERAL ARTICLE Decoding Non-Coding DNA: Trash or Treasure? Namrata Iyer Non-coding DNA, once thought of as ‘junk’, represents a very large portion of an organism’s genome. However, recent research has brought to light many functional elements present within non-coding DNA sequences and unravelled a fascinat- ing array of functions performed by these elements. These findings have highlighted the nature of the evolutionary forces that led to the accumulation and retention of non-coding Namrata Iyer is a PhD DNA. In this article, the various elements present within non- student in the Department of Microbiology and Cell coding DNA, their functional relevance to the cell and the Biology, Indian Institute of changing perspective of the scientific community towards this Science, Bangalore. Her so-called ‘junk’ DNA have been described. research interest is the molecular basis of host– Since the dawn of time, man has always been plagued by the pathogen interactions in question of the origin of life. What are the forces that govern the human diseases. course of evolution? What are the elements that separate man from other forms of life? The discovery of DNA (deoxyribo- nucleic acid) as the genetic material in 1944 opened up new avenues to answer these questions. Surprisingly, the language of DNA comprises of only 4 letters, i.e., A,T,G,C which when read in groups of three (triplets) encode the information for the synthe- sis of proteins (by a process known as translation) which are the work-horses of a cell. Before translation can begin, the informa- tion on DNA is first copied into an intermediate known as mRNA (by a process known as transcription).