Multiple Isoforms of CDC25 Oppose ATM Activity to Maintain Cell Proliferation During Vertebrate Development

Published OnlineFirst September 17, 2012; DOI: 10.1158/1541-7786.MCR-12-0072

Molecular Cancer Cell Cycle, Cell Death, and Senescence Research

Multiple Isoforms of CDC25 Oppose ATM Activity to Maintain Cell Proliferation during Vertebrate Development

Daniel Verduzco1,2, Jennifer Shepard Dovey4, Abhay A. Shukla1,2, Elisabeth Kodym1,2, Brian A. Skaug1,2, and James F. Amatruda1,2,3

Abstract The early development of vertebrate embryos is characterized by rapid cell proliferation necessary to support the embryo's growth. During this period, the embryo must maintain a balance between ongoing cell proliferation and mechanisms that arrest or delay the cell cycle to repair oxidative damage and other genotoxic stresses. The ataxia- telangiectasia mutated (ATM) kinase is a critical regulator of the response to DNA damage, acting through downstream effectors, such as p53 and checkpoint kinases (CHK) to mediate cell-cycle checkpoints in the presence of DNA damage. Mice and humans with inactivating mutations in ATM are viable but have increased susceptibility to cancers. The possible role of ATM in limiting cell proliferation in early embryos has not been fully defined. One target of ATM and CHKs is the Cdc25 phosphatase, which facilitates cell-cycle progression by removing inhibitory phosphates from cyclin-dependent kinases (CDK). We have identified a zebrafish mutant, standstill, with an fi inactivating mutation in cdc25a. Loss of cdc25a in the zebra sh leads to accumulation of cells in late G2 phase. We find that the novel family member cdc25d is essential for early development in the absence of cdc25a, establishing for the first time that cdc25d is active in vivo in zebrafish. Surprisingly, we find that cell-cycle progression in cdc25a mutants can be rescued by chemical or genetic inhibition of ATM. Checkpoint activation in cdc25a mutants occurs despite the absence of increased DNA damage, highlighting the role of Cdc25 proteins to balance constitutive ATM activity during early embryonic development. Mol Cancer Res; 10(11); 1451–61. 2012 AACR.

Introduction In response to genotoxic stress, cells have evolved robust During the early phases of vertebrate embryo develop- networks to detect DNA damage and to arrest or delay cell- ment, rapid cell proliferation is required to support the cycle progression, allowing time for repair of the damage (5, growth of the embryo and organogenesis. Throughout this 6). Testifying to the importance of these mechanisms, time, the developing embryo is exposed to a variety of humans or mice with germline mutations in DNA damage genotoxic stressors. External stressors include environmental response genes display a range of developmental defects, including growth retardation, microcephaly, cerebellar atax- toxins and chemicals as well as radiation, both ionizing and fi ultraviolet (1). Several endogenous sources of DNA damage ia, sterility, bone marrow failure, and immunode ciency as have also been recognized, including oxidants, estrogens, well as predisposition to cancer (1, 4). Among the best alkylators, and the products of lipid peroxidation and met- characterized of these networks is the response to double- strand DNA (dsDNA) breaks, which is coordinated by the abolic pathways (2, 3). Failure to repair the damage due to – these extrinsic and intrinsic agents can lead to mutations that phosphoinositide-3-kinase related protein kinase (PIKK) contribute to cancer, aging, and degenerative diseases (1, 4). family member, ataxia-telangiectasia mutated (ATM; ref. 7). Upon sensing a dsDNA break or other change in chromatin structure, ATM phosphorylates key downstream targets including p53 and the checkpoint kinase 1 (CHK1) and Authors' Affiliations: Departments of 1Pediatrics, 2Molecular Biology, and 3Internal Medicine, University of Texas Southwestern Medical Center, checkpoint kinase 1 (CHK2), which in turn bring about cell- Dallas, Texas; and 4Division of Hematology-Oncology, Children's Hospital, cycle arrest or delay to allow for repair through the homol- Boston, Massachusetts ogous recombination or nonhomologous end joining path- Note: Supplementary data for this article are available at Molecular Cancer ways, or alternatively apoptosis and cell death (7–9). While Research Online (http://mcr.aacrjournals.org/). ATM has clearly been shown to be important for the response Current address for J.S. Dovey: Amgen, Inc., 360 Binney St, Cambridge, to exogenous DNA damage, its possible roles in normal MA 02142. development are less clear. Similar to humans, mice deficient Corresponding Author: James F. Amatruda, University of Texas South- in ATM are viable but display growth retardation, neurologic western Medical Center, 5323 Harry Hines Boulevard, MC 8534, Dallas, TX dysfunction, infertility, defective T-lymphocyte maturation, 75390. E-mail: [email protected]. radiation sensitivity, and increased cancer incidence (10, 11). doi: 10.1158/1541-7786.MCR-12-0072 Exposure to teratogens, such as phenytoin or genotoxic 2012 American Association for Cancer Research. insults, such as gamma radiation, impairs the development

www.aacrjournals.org 1451

Verduzco et al.

of ATM-null embryos, and simultaneous deletion of ATM embryos. ATM is activated in the cdc25a mutants despite the and other DNA damage repair factors including histone absence of widespread DNA double-strand breaks (DSB), H2AX and DNA-dependent protein kinase is embryonic and we present evidence that ATM also impedes cell-cycle lethal in mice (12, 13). However, owing to the relative progression in embryos with wild-type levels of CDC25 inaccessibility of mammalian embryonic development, it is activity. These results emphasize the important balance unclear what roles ATM may play during the course of between mechanisms that favor cell proliferation and the normal embryogenesis. In particular, it is not known to ATM-mediated checkpoint response during early embry- what degree ATM-dependent checkpoint mechanisms may onic development in vertebrates. oppose cell proliferation during early embryogenesis. One of the key targets of the ATM-CHK1/2 network is Materials and Methods the CDC25 family of phosphatases, key regulators of the Fish maintenance cell cycle. Under conditions that favor cell-cycle progression, Zebrafish were maintained according to standard proce- CDC25 removes inhibitory phosphates from cyclin-depen- dures (22). All work with zebrafish was carried out under dent kinases (CDK), allowing cyclin/CDK complexes to protocols approved by the Institutional Animal Care and Use drive cell-cycle transitions (14). In response to dsDNA breaks, Committees at University of Texas Southwestern Medical CHK1 and CHK2 phosphorylate CDC25, targeting it for Center (Dallas, TX), an Association for Assessment and destruction and impeding CDK activation (15). Mammalian Accreditation of Laboratory Animal Care (AAALAC)-accre- cells express 3 different CDC25 genes: CDC25A, CDC25B, dited institution. and CDC25C. CDC25A seems to act alone in controlling fi entry from G1 to S and intra-S progression, whereas all 3 Zebra sh immunohistochemistry and – fl CDC25 genes function in G2 M progression (16). immuno uorescence The developmental roles of Cdc25 have been partially Twenty-four-hour–old embryos were dechorionated, defined. In mice, Cdc25A is essential for embryonic devel- euthanized with tricaine, and fixed in 4% paraformaldehyde opment. Cdc25A / embryos are resorbed at around E6.5 (PFA) in 1 PBS overnight at 4C. Immunohistochemistry due to widespread apoptosis (17). Although Cdc25A / (IHC) was conducted using 1:1,000 anti–phosphohistone mice die early in development, mice lacking Cdc25B and H3 Serine 10 (pH3; Santa Cruz Biotechnology, catalog no. Cdc25C survive with normal cell-cycle progression and sc-8656-R); 1:200 anti-mouse Cdc25A (Santa Cruz Bio- checkpoint function (18). Therefore, Cdc25A likely com- technology, catalog no. sc-97) or 1:1,000 zebrafish-specific pensates for the other Cdc25 genes and may be the most anti–phosphohistone H2AX (23) followed by incubation functionally important mammalian Cdc25. Unlike mam- with 1:350 horseradish peroxidase–conjugated goat anti- mals, zebrafish express a single canonical CDC25, designat- rabbit immunoglobulin G (IgG; Jackson Immunochem- ed cdc25a, during embryogenesis (19). In zebrafish embryos, icals) and staining with diaminobenzidine (DAKO) for overexpression of cdc25a drives cells into mitosis (19) and 10 minutes according to the manufacturer's protocol. For fl blocks cell-cycle lengthening and acquisition of G2 phase as uorescent imaging, secondary antibody was a 1:15,000 early embryonic cell cycles give rise to postmidblastula dilution of Alexafluor-488–conjugated goat anti-rabbit IgG transition, asynchronous cell cycles (20). Zebrafish also (Invitrogen). Terminal deoxynucleotidyl transferase–medi- express a divergent family member, designated cdc25d, ated dUTP nick end labeling (TUNEL) assay was conducted which is homologous to cdc25a but is not present in using the Apoptag Red In Situ Apoptosis Detection Kit mammals (19). cdc25d can rescue a fission yeast cdc25ts (Millipore) as described in ref. (24). Acridine orange staining mutant, but has not been shown to have detectable activity in was conducted as described in ref. (24). Immunoblots were zebrafish (19, 20). It is not known whether the single conducted with rabbit anti–phospho-CHK1 (Ser435) from canonical zebrafish cdc25a is essential for development, or Cell Signaling Technology. The antibody recognizes a whether cdc25a and cdc25d have any redundant roles in cell- protein of 50 kD in lysates of zebrafish embryos, in good cycle regulation, nor is it known if zebrafish cdc25 family agreement with the predicted size of zebrafish chk1 (410 members participate in DNA damage checkpoints. amino acids; Accession: NP_956487.1) and was previously Previously, we conducted a screen for mutations that used to detect activated chk1 protein in lysates of zebrafish affect embryonic cell proliferation in zebrafish (21). Here, tissue (25). Anti–phospho-Rb (Ser 795) is validated for we report the identification of an inactivating mutation in recognition of phosphorylated zebrafish retinoblastoma (Rb) zebrafish cdc25a. cdc25a is essential for zebrafish embryonic protein (www.cellsignal.com/products/9301.html) and was development, and cdc25a-deficient mutants accumulate cells previously shown to recognize phospho-Rb in zebrafish (26). – fi in G2 M phase. The cell-cycle defects of cdc25a-de cient mutants can be partially rescued by cdc25d, showing in vivo Comet assay activity of this divergent family member. We reasoned that Twenty-four or 48-hour zebrafish embryos were disag- this model could help us to understand epistatic relation- gregated to a single-cell suspension as described in ref. (27). ships of CDC25 to other checkpoint genes in a whole Zebrafish cells were embedded in low-melt agarose gels, organism that is not subject to extrinsic genotoxic stress. lysed, and then electrophoresed using the Trevigen Come- We find that chemical or genetic inhibition of ATM rescues tAssay Kit according to the manufacturer's protocol – fi the accumulation of cells in G2 M phase in cdc25a-de cient (Trevigen).

1452 Mol Cancer Res; 10(11) November 2012 Molecular Cancer Research

CDC25 Opposes ATM Activity during Development

Drug treatment primers flanking the cdc25a mutation site (GGTGTTT- Twelve-hour–old embryos were treated with 10 mmol/L GACTCCAATCTGCT and CAACAAGCACAGGCTA- ATM kinase inhibitor KU55933 (Calbiochem) in E3 zebra- ATGG) followed by digestion of the PCR product with fish embryo medium (22) and 1% dimethyl sulfoxide BsiEI (New England Biolabs) and gel electrophoresis. (DMSO) for 12 hours at 28C, then euthanized with tricaine, fixed in 4% PFA/1 PBS overnight at 4C, and Results processed for IHC. To quantify anti-pH3 staining, 12 The standstill mutation causes embryonic cell-cycle images were taken for each treatment and genotype. The accumulation in the G2 phase of the cell cycle pH3-positive cells in an area extending from the end of the Previously, we described a forward-genetic screen to yolk tube extension to the tip of the tail were independently identify mutations that altered embryonic cell proliferation counted for each embryo by 2 observers who were blinded to in the haploid F2 progeny of ENU-mutagenized zebrafish the identity of the samples. All counts were normalized by (21, 30). Using whole-mount IHC with an antibody specific the total area (measured using ImageJ software) to account for the phosphorylated form of histone H3 (to evaluate cell for differing size of the tail regions. proliferation), 7 mutant lines were identified including slycz61, sfdcz213, mybl2cz226, espl1cz280, llgcz3322, sdscz319, and Cell culture and transfection slhcz333 (21). The standstill mutant (sdscz319) was identified The human non–small-cell lung cancer cell line A549 on the basis of a markedly decreased fraction of pH3-positive (kindly provided by Dr. J. Minna, UT Southwestern Med- cells in the mutant embryos (Fig. 1). The standstill mutant ical Center, Dallas, Texas) was maintained in RPMI media morphologic phenotype becomes evident at approximately supplemented with 10% FBS. For overexpression of Cdc25, 24 hours postfertilization (hpf) and includes microcephaly, cells were transfected with pCMV-SPORT6 containing a microphthalmia, abnormal body shape, and reduced pig- full-length Mus musculus Cdc25A cDNA (Accession num- mentation (Supplementary Fig. S1). To further understand ber BC046296, Open Biosystems). Immunoblotting was the cell proliferation defect, we conducted flow cytometric conducted using 1:1,000 pS1981-ATM (Rockland) or DNA content analysis, which showed an accumulation of – 1:500 anti-g-H2AX (Millipore) as described in ref. (28). cells in the G2 M phase of the cell cycle (Fig. 1E). Histone H3 is phosphorylated in late G2 phase, coincident with the Morpholino injections onset of chromatin condensation, and remains phosphory- A total of 0.5 mmol/L Cdc25a 50UTR (TAATCAGC- lated until the chromosomes begin to decondense in ana- CAGGCGCGATTAAGAAC), cdc25a splice site (ATGA- phase (31, 32). Thus, the standstill mutation seems to result CAACCTCACCTCAGCCATGTT), control (CCTCTT- in accumulation of cells in the G2 phase of the cell cycle, ACCTCAGTTACAATTTATA), or cdc25d 50UTR (AAT- before the onset of chromatin condensation (33). CTCCAGCGCATCACCGGCCATT) morpholinos were injected into 1 to 2 cell zebrafish embryos from the AB strain Positional cloning of the standstill gene þ or from offspring of cdc25a / adults. Morpholinos were To understand the molecular nature of the defect in purchased from Gene-Tools. ATM, CDKN1A, and ATR standstill embryos, we used meiotic recombinational map- morpholinos were as described in ref. (23, 29). The geno- ping to identify the mutant locus. We conducted bulk types of injected embryos were confirmed by PCR using segregant analysis (34) followed by intermediate-resolution

ABE

Figure 1. The standstill mutation causes a G2–M cell-cycle accumulation. Phenotypic comparison of wild-type (wt; A and C) and standstill homozygous mutant (B and D) embryos. A and B, Brightﬁeld images of 28 hpf embryos. standstill mutants exhibit pericardial edema, microcephaly, loss of posterior segmentation, and a curved body shape. C and D, anti-pH3 staining of wt (C) and standstill mutants (D) at 28 hpf. Compared with wt embryos (C), standstill embryos (D) exhibit a reduced number of cells in mitosis. E, FACS analysis for DNA content shows accumulation of cells in G2–Minstandstill mutants.

www.aacrjournals.org Mol Cancer Res; 10(11) November 2012 1453

Verduzco et al.

mapping with a panel of 88 mutant embryos to assign To confirm that cdc25a deficiency was responsible for the standstill to zebrafish chromosome 13. For high-resolution standstill phenotype, we designed a morpholino oligonucle- mapping, we assembled a panel of 1,758 phenotypically otide (MO) targeting the splice junction between exon 1 and mutant embryos and localized the mutation to an approx- intron 1 of the cdc25a pre-mRNA. cdc25a MO-injected imately 5 cM interval between microsatellite markers embryos displayed a phenotype identical to the standstill Z6259 and ZJA5 (Fig. 2). The map position was further mutant, including microcephaly, microphthalmia, and bent refined with a combination of known markers and novel tail. Immunohistochemical staining for pH3 showed that microsatellites derived from genomic sequence. The crit- the MO-injected embryos had reduced cell proliferation, ical interval contains a single gene, the zebrafish ortholog phenocopying the standstill mutation (Fig. 2G). We of Cdc25A (19). We sequenced the cdc25a gene from obtained identical results with a translation-blocking MO wild-type and standstill mutant embryos and found that directed against the cdc25a initiating ATG (Supplementary the mutants contain a C to T mutation at codon 206 of Fig. S3). Thus, standstill is encoded by zebrafish cdc25a. the coding sequence, which is predicted to result in a premature stop codon and a truncated protein lacking cdc25d cooperates with cdc25a during embryonic the catalytic domain (Fig. 2B and C). standstill mutant development embryos did not stain with an anti-mouse Cdc25A anti- During the cell cycle, Cdc25 removes inhibitory phos- body (Fig. 2E), and whole-mount in situ hybridization phates from CDKs to allow cell-cycle progression. Despite revealed reduced cdc25a mRNA in standstill mutants, lacking a key cell-cycle regulator, cdc25a / embryos under- consistent with nonsense-mediated decay (Supplementary go gastrulation and relatively normal organogenesis. The Fig. S2). ability of embryos to complete early stages of development

Figure 2. standstill encodes a zebrafish Cdc25 ortholog. Positional cloning of standstill (A). Bulk segregant analysis assigned standstill to zebrafish chromosome 13. Further analysis of 3,456 meioses using microsatellite markers narrowed the critical interval to a 0.1 cM region containing cdc25a. Microsatellite markers are prefixed with the letter "z." CT573293 and BX571943 are 2 adjoining genomic contigs in zebrafish genome assembly Zv9. Arrows indicate the orientation of predicted genes. B and C, electropherograms of fragment of cdc25a exon 7 from wild-type (wt; B) and standstill mutant (C) embryos, showing the codon 206 C-T mutation generating a nonsense allele in the mutant. D and E, whole-mount IHC of wt (D) and standstill/cdc25a / (E) embryos stained with anti–mouse Cdc25a antibody. The mutant embryos have diminished anti- Cdc25a reactivity. F and G, knockdown of cdc25a phenocopies the standstill phenotype. F, injection of wt embryos with a control MO did not affect cell proliferation. G, injection of a splice site MO targeting the cdc25a pre-mRNA exon 1/intron 1 boundary caused a marked reduction in the number of pH3- positive cells.

1454 Mol Cancer Res; 10(11) November 2012 Molecular Cancer Research

CDC25 Opposes ATM Activity during Development

could be due in part to residual maternally supplied wild- pH3-positive cells in a defined area of the tail was 19.3 type cdc25a. However, early development also occurs in 11.3 for cdc25a / embryos and 35.1 13.1 for cdc25a / embryos injected with translation-blocking MO (Supple- embryos injected with cdc25d mRNA; P ¼ 0.059 by 2-tailed mentary Fig. S3), which is predicted to inhibit translation of Student t test). cdc25d mRNA did not increase the number both maternal and zygotic mRNAs. We investigated wheth- of pH3-positive cells in wild-type embryos (118.5 22.3 er cdc25a deficiency is partially compensated by activity of pH3-positive cells in control vs. 131 19.6 in cdc25d cdc25d, the only other identified zebrafish cdc25. cdc25d has mRNA injected; P ¼ 0.39). cdc25d mRNA injection did not been characterized as a highly divergent isoform of cdc25. rescue morphology or survival in cdc25a / embryos. Some Zebrafish cdc25d functionally complements Schizosacchar- caution is warranted in interpreting the cdc25d gain of omyces pombe cdc25 activity (19); however, its function in function experiments, because they relied on overexpression zebrafish has not been established. MO knockdown of and because the rescue was incomplete. However, taken cdc25d alone led to a mild growth defect (Fig. 3C) but together with the loss of function data, these results strongly knockdown of cdc25d in cdc25a / embryos led to a much suggest that cdc25 activity is necessary for early embryonic more significant growth defect (Fig. 3D), as did double development in zebrafish, and that cdc25a and cdc25d are at knockdown of cdc25a and cdc25d in wild-type embryos (Fig. least partially redundant. 3E). These results indicated that cdc25d activity contributes / – cdc25a to the early development of cdc25a embryos. On the Inhibition of ATM allows G2 M transition in basis of these results, we asked whether overexpression of mutants cdc25d might at least partially rescue the cell proliferation While overexpression of cdc25d increased the number of defect of cdc25a / embryos. To test this possibility, we mitotic cells in cdc25a / mutants, endogenous levels of injected cdc25a / embryos with cdc25d mRNA and stained cdc25d activity were unable to rescue cdc25a deficiency, for pH3 (Fig. 3F and G). Embryos injected with cdc25d despite the fact that cdc25d is expressed during early devel- mRNA had a slightly increased number of pH3 foci as opment (19). It is possible that cdc25d activity is simply too compared with control cdc25a / embryos (the number of weak to complement cdc25a deficiency. However, we also

Figure 3. Knockdown of cdc25d leads to synergistic growth defects in the absence of cdc25a. A, control MO-injected wild-type (wt) embryo showing normal morphology. B, control MO-injected cdc25a / embryo. Knockdown of cdc25d in wt embryos (C) causes mild morphologic defects, whereas knockdown of cdc25d severely impairs the growth of cdc25a/ mutants (D). Similar severe growth defects result from simultaneous cdc25a and cdc25d knockdown in wt embryos (E). F, anti-pH3 staining of cdc25a/ mutant. G, anti-pH3 staining of cdc25a/ mutant injected with 25 ng/mL cdc25d mRNA.

www.aacrjournals.org Mol Cancer Res; 10(11) November 2012 1455

Verduzco et al.

considered the possibility that another factor inhibits cell form of CHK1 protein, as would be expected if the repli- proliferation in cdc25a mutants. We noted that the pheno- cation checkpoint were activated (Supplementary Fig. S7E). type of cdc25a / mutant embryos (accumulation in G To test whether the increased proliferation in KU55933- 2 phase before the onset of chromatin condensation as signaled treated cdc25a / embryos was due to a true increase in cell- by pH3 positivity) is also compatible with cell-cycle arrest due cycle progression or merely indicative of a release of the to activation of the G –M checkpoint. The G –M check- G –M checkpoint into mitosis, we conducted fluorescence- 2 2 2 point is dependent on the action of the PIKK family member activated cell sorting (FACS) analysis on cdc25a / embryos ATM; it is present in zebrafish embryos and is robustly and phenotypically wild-type clutchmates treated either activated by DNA-damaging agents, such as gamma radia- with the KU55933 or 1% DMSO (samples 1 and 2, Fig. tion (Supplementary Fig. S4). 4J). While cdc25a / embryos treated with DMSO accu- – / To test whether the G2 M checkpoint is activated in mulated in G2 (sample 3), cdc25a embryos treated with / cdc25a embryos, we treated the embryos with the ATM the ATM inhibitor (sample 4) exhibited a large G1 peak, inhibitor KU55933. To show that KU55933 inhibits zebra- indicating they had resumed the cell cycle. Quantification of fish ATM, we pretreated wild-type embryos with 10 mmol/L the FACS plots revealed the following distributions: / KU55933 for 4 hours, then exposed pretreated embryos to cdc25a in DMSO: 30.6% G1, 17.8% S, 64.6% G2; / 12 Gy ionizing radiation. At 48 hpf, irradiated KU55933- cdc25a in KU55933: 61.5% G1, 31.2% S, and 12.8% treated embryos displayed severe morphologic defects, sim- G2. For comparison, the values for wild-type in DMSO are: ilar to those present in irradiated embryos after MO knock- 49.7% G1, 32.2% S, and 17.6% G2; and wild-type in down of ATM (29; Supplementary Fig. S5). KU55933: 49.7% G1, 36.1% S, and 15.8% G2. The large fi / Having established that KU55933 is active in sh, we fraction of cells in G1 in KU55933-treated cdc25a – / fl next tested whether the G2 M accumulation in cdc25a embryos likely re ects the release of a large number of G2 mutants was the result of activation of the G –M check- cells into mitosis and a subsequent G . þ 2 1 point. We crossed heterozygous cdc25a / fish and treated These results indicated that G –M accumulation in 2 the resulting embryos with KU55933 from 12 to 24 hpf, cdc25a / embryos was largely due to activation of the fi – then xed the embryos and stained for pH3 (Fig. 4). pH3 ATM-dependent G2 M checkpoint, and that cell prolifer- levels were quantified by counting the number of pH3 foci in ation in the mutant embryos could resume once ATM adefined area of the embryo (Fig. 4G). Control DMSO- activity was inhibited. Having shown that cdc25a and treated clutches displayed the expected 25% of embryos cdc25d activities are at least partially redundant (Fig. 3), with a very low number of pH3-positive cells as compared we hypothesized that in KU55933-treated, cdc25a-deficient with wild-type embryos (Fig. 4A, C, and G). In contrast, embryos, cdc25d activity drives the G –M transition. To test 2 cdc25a / embryos treated with KU55933 exhibited a this model, we knocked down cdc25d in cdc25a / embryos marked increase in the number of pH3-positive cells (Fig. and tested whether the cell cycle resumed after ATM 4D and G; P < 0.0001). We obtained identical results by inhibition. We found that, in the absence of expression of inhibiting ATM with caffeine (Supplementary Fig. S6). We either cdc25a or cdc25d, KU55933 treatment failed to rescue confirmed that the embryos with increased cell proliferation the cell proliferation defect (Fig. 4G, J, and K). Thus, in the after KU5593 treatment were genotypically cdc25a / using absence of cdc25a activity, ATM seems to exert its regulatory a restriction fragment length polymorphism specific for the effect on cdc25d. – standstill cdc25a mutant allele (not shown). cdc25 activity is also regulated at the G1 S checkpoint, To rule out an off-target effect of KU55933 and provide principally by p53 and its downstream target p21 (8). To – an independent means of inhibiting ATM, we injected 0.2 determine whether activation of the G1 S checkpoint con- mmol/L control or ATM-specific MOs (29) into offspring of tributed to the cell-cycle phenotype of cdc25a-deficient þ heterozygous cdc25a / fish, and again assessed cell prolif- embryos, we knocked down cdc25a in p53M214K mutants, eration using pH3. Compared with control MO-injected which are deficient in p53-mediated responses (35). We also embryos, ATM MO-injected embryos had increased cell simultaneously knocked down cdc25a and cdkn1a, which proliferation (Fig. 4E and F). Further confirming these encodes p21. Neither p53 deficiency nor p21 deficiency results, we found that cdc25a / embryos contain elevated increases the number of proliferating cells in cdc25a-defi- levels of phospho-Y15-Cdc2, and that inhibition of ATM cient embryos (Supplementary Fig. S7A and S7B). Finally, results in reduction of this inhibitory phosphorylation (Fig. we stained wild-type and cdc25a / embryos for the phos- 4H). We also considered the possibility that the phenotype phorylated form of Rb protein, an indicator of G –S cyclin- 1 of cdc25a / mutants is due at least in part to activation of a Cdk activity. Rb protein was phosphorylated in both wild- fi – replication checkpoint due to replication stress. To test this type cdc25a-de cient embryos, indicating that the G1 S possibility, we knocked down expression of ataxia-telangi- transition was occurring in the mutants (Supplementary Fig. ectasia and rad9-related (atr), another PI3K family member S7C and S7D). that delays or arrests the cell cycle in response to stalled replication forks or other forms of replication stress (25). ATM is activated during normal embryonic Knockdown of atr did not rescue the proliferation defect of developmental cell cycles cdc25a morphants (Fig. 4G). Furthermore, cdc25a mor- Having established that an ATM-dependent G –M 2 phants did not exhibit elevated levels of the phosphorylated checkpoint is present in cdc25a / embryos, we investigated

1456 Mol Cancer Res; 10(11) November 2012 Molecular Cancer Research

CDC25 Opposes ATM Activity during Development

Figure 4. Inhibition of ATM attenuates the cell proliferation defect in cdc25a / embryos. Twenty-four hour wild-type (wt; A and B) and cdc25a / (C and D) embryos treated from 12 to 24 hpf with 1% DMSO (A and C) or 10 mmol/L KU55933 ATM kinase inhibitor (B and D) and stained for pH3. E and F, genetic knockdown of ATM in cdc25a/ embryos. Injection of cdc25a/ embryos with control MO (E) has little effect, whereas injection of an ATM MO (F) leads to increased cell proliferation. G, quantification of the number of pH3 foci present in the tails of embryos under different conditions. (, P < 0.01; , P < 0.001; ns: not significant). Inhibition of ATM significantly increases the number of proliferating cells in wt and cdc25a-deficient embryos. Knockdown of atr slightly increases pH3 number in wt but not cdc25a-deficient embryos. H, immunoblot analysis of total Cdc2 and phospho-tyrosine 15 Cdc2 in wt and cdc25a/ embryos treated with DMSO and KU55933. Inhibition of ATM increases cdc25 phosphatase activity and reduces pCdc2 in cdc25a/ embryos. I, DNA content FACS profiles of wt embryos treated with DMSO (sample 1) or KU55933 (sample 2) and cdc25a/ embryos treated with DMSO (sample 3) or the ATM inhibitor / / (sample 4). Inhibition of ATM in cdc25a embryos rescues progression of the cell cycle, indicated by a larger G1 peak, as compared with cdc25a treated with DMSO. J and K, inhibition of ATM activity in zebrafish does not restore cell proliferation in embryos lacking both cdc25a and cdc25d. Embryos injected with MOs targeting both cdc25a and cdc25d transcripts treated with DMSO (J) or 10 mmol/L KU55933 (K) exhibit no change in mitotic cells (quantified in G). the mechanism of checkpoint activation. We first considered as a positive control, we observed a slight decrease in the possibility that Cdc25a deficiency results in increased spontaneous DNA damage in the cdc25a / mutants (Fig. DNA DSBs in developing embryos. We used the comet 5A–D). While it is possible that the comet assay fails to detect assay to measure the amount of DNA damage on a single-cell minor amounts of DNA damage, these data indicate that loss basis (36). We have recently adapted this method to measure of cdc25a itself does not induce severe DNA damage. The DNA damage in zebrafish cells (24). Conducting the comet observed decrease in comet tail size in cdc25a / mutants assay on 24 hpf cdc25a / embryos, wild-type embryos, or may be due to decreased spontaneous replication-related – wild-type embryos treated with 12 Gy of ionizing radiation DNA damage due to G2 M cell-cycle arrest.

www.aacrjournals.org Mol Cancer Res; 10(11) November 2012 1457

Verduzco et al.

by histone H2AX phosphorylation. The low level of g-H2AX in cdc25a / embryos made it unlikely that widespread DNA damage could account for the observed profound cell-cycle arrest. As a further evidence of this point, we tested whether H2AX phosphorylation precedes the onset of the cell-cycle phenotype in cdc25a / , by staining age- matched embryos for g-H2AX and pH3 (Supplementary Fig. S8). pH3 levels are detectably lower at 90% epiboly stage (about 8 hpf) and continue to progressively decrease. In contrast, H2AX phosphorylation does not become detectable until the 14 somite stage. These data indicate that cell- cycle arrest precedes the increase in apoptotic g-H2AX. The above results indicate that cdc25a deficiency triggers – an ATM-dependent G2 M accumulation in developing embryos, but the accumulation is not attributable to increased DNA DSBs. To account for ATM activity in cdc25a / embryos in the absence of detectable DNA damage, we next considered the possibility that Cdc25A directly regulates ATM via Cdc25's phosphatase activity. To test the possibility that Cdc25A directly dephosphorylates and regulates ATM, we overexpressed mouse Cdc25A in A549 cells for 48 hours, irradiated the cells, and assessed the phosphorylation status of ATM and its target, CHK2, by immunoblotting (Supplementary Fig. S9). Both ATM and CHK2 showed increased phosphorylation status after irradiation, and overexpression of Cdc25A did not decrease the phosphorylation, indicating that Cdc25A does not directly regulate ATM. We also noted increased phospho-ATM in nonirradiated Cdc25A-overexpressing cells consistent with previous findings that overexpression of Cdc25A leads to increased DNA damage (38). Finally, we investigated whether ATM is generally active during early developmental cell cycles, and if its effects on the cell cycle were being unmasked by cdc25a deficiency in the Figure 5. cdc25a deficiency does not increase the level of DNA damage in embryos. A to D, comet assays reveal no detectable DNA damage in cells mutant embryos. Indeed, wild-type embryos treated with / / fi from cdc25a mutant embryos. Cells from wild-type (wt; A), cdc25a KU55933 and quanti ed for the number of mitotic cells (B), or wt treated with 12 Gy (C) embryos were isolated and subjected to a using pH3 as a marker exhibited an increased number of comet assay. D, quantitation of tail moments from 200 cells from A to C; mitotic cells as compared with controls (Fig. 4A, B, and G); (, P < 0.040; , P < 3 10 11). E, immunoblot analysis of phosphohistone however, this effect did not reach statistical significance (P ¼ H2AX (pH2AX) present in cells of unirradiated wt embryos, cdc25a / mutant embryos, or 12 Gy irradiated (IR) wt embryos pretreated with 0.09). These results suggest that, during normal develop- DMSO (lanes 1–3) or KU55933 (4–6). g-H2AX is induced in wt by IR, and ment, ATM is active and may attenuate the percentage of cdc25a/ this effect is blocked by KU55933. However, embryos do not cells progressing from G2 to M phase. On the basis of the exhibit increased levels of g-H2AX. above results, we conclude that ATM is constitutively active during development but does not completely deplete Cdc25 As an alternative approach to detect DNA damage foci in activity. Thus, in wild-type animals, a balance between cell- zebrafish, we developed an anti–phospho-histone H2AX cycle arrest/delay and cell-cycle progression is maintained. fi fi rabbit polyclonal antibody speci c for phosphorylated zeb- cdc25a de ciency unmasks ATM activity, leading to G2 rafish histone H2AX (23). Phosphorylated histone H2AX, accumulation and impaired embryonic development. designated g-H2AX, is present at histone cores flanking In conducting this analysis, we noted that embryos treated DSBs (37). We conducted immunoblot analysis on wild- with 10 mmol/L KU55933 showed some developmental type and cdc25a / embryos to measure g-H2AX levels (Fig. toxicity in the absence of irradiation, suggesting ATM 5E). Compared with wild-type controls, cdc25a / embryos function is necessary for healthy development of zebrafish. have similar to decreased g-H2AX levels. As expected, To explore this possibility further, we knocked down ATM irradiated wild-type embryos exhibit increased g-H2AX, expression with a morpholino and monitored developmental which can be reduced by pretreatment of the embryos with toxicity and survival in the injected embryos (Supplementary KU55933. Therefore, the ATM–g-H2AX axis is present Fig. S10). Compared with control MO-injected embryos, and normally functioning in zebrafish, but cdc25a / ATM morphants displayed increased developmental defects embryos do not exhibit increased DNA damage, as measured and significantly lower survival. This result is consistent with

1458 Mol Cancer Res; 10(11) November 2012 Molecular Cancer Research

CDC25 Opposes ATM Activity during Development

an earlier report of lower survival in ATM morphants (29) interphase cells to DNA damage due to endogenous oxida- and suggests ATM may play an important role in normal tive stress (48–50). In mitotic cells, CAA and H2AX development, even in the absence of exogenous genotoxic phosphorylation have been associated with chromatin con- stress. densation, and postulated to play a role in maintaining mitotic spindle integrity (51, 52). Discussion – Here, we show that a G2 M accumulation is present in ATM was first identified as the protein mutated in the developing cdc25a mutant embryos, as evidenced by loss of clinical syndrome ataxia-telangiectasia, which is character- pH3 positive nuclei and by DNA content profiling. This ized by immune dysfunction, abnormal sensitivity to ion- accumulation is due to activation of ATM and can be izing radiation, cerebellar ataxia, and telangiectases. Subse- partially overcome by inhibiting ATM, so long as cdc25d – quent work revealed that ATM, and the related PIKKs ATR activity is present. The G2 M accumulation is not due to and DNA-PK, are central regulators of the DNA damage increased DNA damage, but seems to be constitutive, as response (39, 40). In response to genotoxic stresses causing inhibiting ATM in wild-type embryos also increases the – – / DNA DSBs, one action of ATM is to mediate G2 M cell- number cells making the G2 M transition. In the cdc25a cycle arrest by acting through the checkpoint kinases CHK1/ mutants, we do not believe that ATM activation results from CHK2 to target Cdc25 for destruction (41–43). In keeping premature chromatin condensation or other mitotic abnor- with this role of ATM in maintaining genomic integrity, malities, because cells in developing mutant embryos ar- people with mutations in the ATM gene are at increased risk rest before the onset of chromatin condensation as evidenced of developing cancer (44, 45). by markedly reduced levels of histone H3 serine 10 phos- More recently, it has become clear that the PIKKs and phorylation. their downstream partners have important roles in main- We hypothesize that a basal level of ATM activity occurs taining normal cell homeostasis, even in the absence of in normal cell cycles. In cdc25a / cells, early embryonic exogenous sources of DNA damage. ATM and ATR control development proceeds fairly normally due to compensatory the timing of replication origin firing, in the absence of DNA phosphatase activity of cdc25d. In cells with normal levels of damage (46). CHK1 localized to the centrosome has been cdc25 activity, the basal level of ATM activity subtly attenu- shown to regulate Cdc25B activity to control the entry into ates cell-cycle progression; however, in cdc25a / embryos, mitosis (47). Constitutive histone H2AX phosphorylation the phosphatase activity of cdc25d is overwhelmed by basal and constitutive ATM activation (CAA) in normal cycling ATM activity, leading to cell-cycle accumulation in the cells has been postulated to occur and has been attributed in absence of marked DNA damage (Fig. 6). Only when ATM

Figure 6. Model of hierarchical Cdc25 function during normal cell cycles and response to stress. In the model, the size of the font indicates the relative abundance of a protein or isoform. A, during a normal cell cycle, ATM is constitutively active but at a low level. The degree of inhibition of Cdc25a and Cdc25d by ATM/CHK1 is insufficient to prevent Cdc25 phosphatase activity. Therefore, inactive cdc2-P is converted to active cdc2 , fostering the G2–M transition. B, in the presence of DNA DSBs, ATM is strongly activated, leading to downregulation of cdc25 activity. Cdc2 remains in the inactive, phosphorylated state, and G2–M progression is inhibited. C, when cdc25a is deficient, cdc25d is present but may be inhibited by ATM. Residual cdc25d activity is too low to fully convert inactive cdc2-P to active cdc2 , resulting in delay of the cell cycle and accumulation in G2. D, inhibition of ATM in cdc25a-deficient cells unmasks the activity of cdc25d. Under these conditions, sufficient cdc2-P is converted to active cdc2 , and G2–M progression is maintained.

www.aacrjournals.org Mol Cancer Res; 10(11) November 2012 1459

Verduzco et al.

activity is genetically or pharmacologically abrogated can ensure the health and genomic stability of the developing cell-cycle activity resume. Thus, we propose that a hierarchy embryo. The results presented here emphasize the delicate of Cdc25 activity is present, such that enough combined balance between cell proliferation and cell-cycle arrest/delay, cdc25 phosphatase activity must be present to overcome the and highlight the competing roles of ATM and Cdc25 family / basal ATM activity to progress the cell from G2 to M phase. members in this process. The cdc25a mutant also pro- Our data do not indicate the mechanism(s) regulating vides a sensitive model of physiologic ATM activity that cdc25d. The sequence of cdc25d is poorly conserved relative could be used to further dissect the genetics of the DNA to other Cdc25 family members (19), and we did not damage response and to screen for novel checkpoint identify conserved consensus phosphorylation sites. inhibitors. – Because of our observation that G2 M accumulation is likely due to basal ATM activity, we sought the mechanism Disclosure of Potential Conflicts of Interest by which Cdc2 is being dephosphorylated in ATM-inhib- No potential conflicts of interest were disclosed. ited embryos. We discovered that zebrafish cdc25d is expressed and is able to mediate cell-cycle progression to Authors' Contributions a modest degree. Knockdown of cdc25d had profound Conception and design: D. Verduzco, J.F. Amatruda / Development of methodology: D. Verduzco, J.F. Amatruda consequences for development in cdc25a or cdc25a Acquisition of data (provided animals, acquired and managed patients, provided knockdown embryos, the first demonstration that cdc25d facilities, etc.): D. Verduzco, J.S. Dovey, B.A. Skaug, J.F. Amatruda fi Analysis and interpretation of data (e.g., statistical analysis, biostatistics, compu- is active in vivo in zebra sh. Ectopic expression of cdc25d led tational analysis): D. Verduzco, E. Kodym, J.F. Amatruda to modest increases in the number of proliferating cells that Writing, review, and/or revision of the manuscript: D. Verduzco, J.F. Amatruda was detectable in cdc25a / embryos. Previous reports Administrative, technical, or material support (i.e., reporting or organizing data, constructing databases): D. Verduzco indicated that cdc25d could rescue a yeast cdc25 mutant Study supervision: E. Kodym but failed to show activity in zebrafish (19, 20). Consistent Other: Conducted Western blot analysis, A.A. Shukla with these results, we did not detect a significant effect in wild-type embryos, suggesting that cdc25a is responsible for Acknowledgments The authors thank Reinhard Kodym for helpful discussions and advice, Nuno the majority of Cdc25 activity during development. Expres- Gomez for assistance with the comet assay, Elizabeth Patton for comments on the sion of cdc25d did not, however, rescue the morphologic manuscript, and Leonard Zon for generously supporting the early phase of this work. phenotype of cdc25a / embryos. This finding may be due to limited ability of cdc25d to oppose ATM activity in Grant Support cdc25a / mutants, or may point to essential roles of cdc25a This study was supported by grants from the Amon G. Carter Foundation and by – grant 1R01CA135731 from the National Cancer Institute to J.F. Amatruda. D. in processes other than G2 M progression. Verduzco was supported by NIH training grant 5 T32 GM08203. The early development of vertebrate embryos requires The costs of publication of this article were defrayed in part by the payment of page rapid and highly regulated cell divisions. Cdc25 phospha- charges. This article must therefore be hereby marked advertisement in accordance with tases are important mediators of this rapid cell-cycle flux. 18 U.S.C. Section 1734 solely to indicate this fact. Balancing this rapid growth is the need to respond to Received February 3, 2012; revised August 21, 2012; accepted August 31, 2012; genotoxic insults from exogenous or endogenous agents to published OnlineFirst September 17, 2012.

References 1. Friedberg EC, McDaniel LD, Schultz RA. The role of endogenous and 10. Barlow C, Hirotsune S, Paylor R, Liyanage M, Eckhaus M, Collins F, exogenous DNA damage and mutagenesis. Curr Opin Genet Dev et al. Atm-deﬁcient mice: a paradigm of ataxia telangiectasia. Cell 2004;14:5–10. 1996;86:159–71. 2. Burcham PC. Internal hazards: baseline DNA damage by endogenous 11. Xu Y, Ashley T, Brainerd EE, Bronson RT, Meyn MS, Baltimore D. products of normal metabolism. Mutat Res 1999;443:11–36. Targeted disruption of ATM leads to growth retardation, chromosomal 3. Xiao W, Samson L. In vivo evidence for endogenous DNA alkylation fragmentation during meiosis, immune defects, and thymic lymphoma. damage as a source of spontaneous mutation in eukaryotic cells. Proc Genes Dev 1996;10:2411–22. Natl Acad Sci U S A 1993;90:2117–21. 12. Zha S, Sekiguchi J, Brush JW, Bassing CH, Alt FW. Complemen- 4. Ames BN. Endogenous DNA damage as related to cancer and aging. tary functions of ATM and H2AX in development and suppression Mutat Res 1989;214:41–6. of genomic instability. Proc Natl Acad Sci U S A 2008;105: 5. Giglia-Mari G, Zotter A, Vermeulen W. DNA damage response. Cold 9302–6. Spring Harb Perspect Biol 2011;3:a000745. 13. Gurley KE, Kemp CJ. Synthetic lethality between mutation in Atm and 6. Kastan MB, Bartek J. Cell-cycle checkpoints and cancer. Nature DNA-PK(cs) during murine embryogenesis. Curr Biol 2001;11:191–4. 2004;432:316–23. 14. Aressy B, Ducommun B. Cell cycle control by the CDC25 phospha- 7. Smith J, Tho LM, Xu N, Gillespie DA. The ATM-Chk2 and ATR-Chk1 tases. Anticancer Agents Med Chem 2008;8:818–24. pathways in DNA damage signaling and cancer. Adv Cancer Res 15. Mailand N, Podtelejnikov AV, Groth A, Mann M, Bartek J, Lukas J. 2010;108:73–112. Regulation of G(2)/M events by Cdc25A through phosphorylation- 8. Siliciano JD, Canman CE, Taya Y, Sakaguchi K, Appella E, Kastan MB. dependent modulation of its stability. EMBO J 2002;21:5911–20. DNA damage induces phosphorylation of the amino terminus of p53. 16. Busino L, Chiesa M, Draetta GF, Donzelli M. Cdc25A phosphatase: Genes Dev 1997;11:3471–81. combinatorial phosphorylation, ubiquitylation and proteolysis. Onco- 9. Matsuoka S, Huang M, Elledge SJ. Linkage of ATM to cell cycle gene 2004;23:2050–6. regulation by the Chk2 protein kinase. Science 1998;282: 17. Lee G, White LS, Hurov KE, Stappenbeck TS, Piwnica-Worms H. 1893–7. Response of small intestinal epithelial cells to acute disruption of cell

1460 Mol Cancer Res; 10(11) November 2012 Molecular Cancer Research

CDC25 Opposes ATM Activity during Development

division through CDC25 deletion. Proc Natl Acad Sci U S A 35. Berghmans S, Murphey RD, Wienholds E, Neuberg D, Kutok JL, 2009;106:4701–6. Fletcher CD, et al. tp53 mutant zebraﬁsh develop malignant peripheral 18. Ferguson AM, White LS, Donovan PJ, Piwnica-Worms H. Normal cell nerve sheath tumors. Proc Natl Acad Sci U S A 2005;102:407–12. cycle and checkpoint responses in mice and cells lacking Cdc25B and 36. Olive PL, Banath JP. The comet assay: a method to measure DNA Cdc25C protein phosphatases. Mol Cell Biol 2005;25:2853–60. damage in individual cells. Nat Protoc 2006;1:23–9. 19. Nogare DE, Arguello A, Sazer S, Lane ME. Zebraﬁsh cdc25a is 37. Rogakou EP, Pilch DR, Orr AH, Ivanova VS, Bonner WM. DNA double- expressed during early development and limiting for post-blastoderm stranded breaks induce histone H2AX phosphorylation on serine 139. cell cycle progression. Dev Dyn 2007;236:3427–35. J Biol Chem 1998;273:5858–68.

20. Dalle Nogare DE, Pauerstein PT, Lane ME. G2 acquisition by tran- 38. Cangi MG, Piccinin S, Pecciarini L, Talarico A, Dal Cin E, Grassi S, scription-independent mechanism at the zebrafish midblastula tran- et al. Constitutive overexpression of CDC25A in primary human sition. Dev Biol 2009;326:131–42. mammary epithelial cells results in both defective DNA damage 21. Shepard JL, Amatruda JF, Stern HM, Subramanian A, Finkelstein D, response and chromosomal breaks at fragile sites. Int J Cancer 2008; Ziai J, et al. A zebrafish bmyb mutation causes genome instability and 123:1466–71. increased cancer susceptibility. Proc Natl Acad Sci U S A 39. Durocher D, Jackson SP. DNA-PK, ATM and ATR as sensors of 2005;102:13194–9. DNA damage: variations on a theme? Curr Opin Cell Biol 2001;13: 22. Westerfield M. The zebrafish book. A guide for the laboratory use of 225–31. zebrafish (Danio rerio). 4th ed. Eugene, OR: University of Oregon Press; 40. Yang J, Yu Y, Hamrick HE, Duerksen-Hughes PJ. ATM, ATR and DNA- 2000. PK: initiators of the cellular genotoxic stress responses. Carcinogen- 23. Sidi S, Sanda T, Kennedy RD, Hagen AT, Jette CA, Hoffmans R, et al. esis 2003;24:1571–80. Chk1 suppresses a caspase-2 apoptotic response to DNA damage 41. Lavin MF, Kozlov S. ATM activation and DNA damage response. Cell that bypasses p53, Bcl-2, and caspase-3. Cell 2008;133:864–77. Cycle 2007;6:931–42. 24. Verduzco D, Amatruda JF. Analysis of cell proliferation, senescence, 42. Chen Y, Poon RY. The multiple checkpoint functions of CHK1 and and cell death in Zebrafish embryos. In: Westerfield M, Zon L, Detrich CHK2 in maintenance of genome stability. Front Biosci 2008;13: HW III, editors. Essential Zebrafish Methods. London, UK: Elsevier; 5016–29. 2009. 43. Reinhardt HC, Yaffe MB. Kinases that control the cell cycle in response 25. Davuluri G, Gong W, Yusuff S, Lorent K, Muthumani M, Dolan AC, et al. to DNA damage: Chk1, Chk2, and MK2. Curr Opin Cell Biol 2009; Mutation of the zebrafish nucleoporin elys sensitizes tissue progeni- 21:245–55. tors to replication stress. PLoS Genet 2008;4:e1000240. 44. Lavin MF. Ataxia–telangiectasia: from a rare disorder to a paradigm for 26. Link BA, Kainz PM, Ryou T, Dowling JE. The perplexed and confused cell signalling and cancer. Nat Rev Mol Cell Biol 2008;9:759–69. mutations affect distinct stages during the transition from proliferating 45. Ahmed M, Rahman N. ATM and breast cancer susceptibility. Onco- to post-mitotic cells within the zebrafish retina. Dev Biol 2001;236: gene 2006;25:5906–11. 436–53. 46. Shechter D, Costanzo V, Gautier J. ATR and ATM regulate the timing of 27. Shepard JL, Stern HM, Pfaff KL, Amatruda JF. Analysis of the cell cycle DNA replication origin firing. Nat Cell Biol 2004;6:648–55. in zebrafish embryos. Methods Cell Biol 2004;76:109–25. 47. Kramer A, Mailand N, Lukas C, Syljuasen RG, Wilkinson CJ, Nigg EA, 28. Kodym E, Kodym R, Choy H, Saha D. Sustained metaphase arrest in et al. Centrosome-associated Chk1 prevents premature activation of response to ionizing radiation in a non–small cell lung cancer cell line. cyclin-B-Cdk1 kinase. Nat Cell Biol 2004;6:884–91. Radiat Res 2008;169:46–58. 48. MacPhail SH, Banath JP, Yu Y, Chu E, Olive PL. Cell cycle-dependent 29. Imamura S, Kishi S. Molecular cloning and functional characterization expression of phosphorylated histone H2AX: reduced expression in

of zebraﬁsh ATM. Int J Biochem Cell Biol 2005;37:1105–16. unirradiated but not X-irradiated G1-phase cells. Radiat Res 2003; 30. Shepard JL, Amatruda JF, Finkelstein D, Ziai J, Finley KR, Stern HM, 159:759–67. et al. A mutation in separase causes genome instability and increased 49. Huang X, Halicka HD, Traganos F, Tanaka T, Kurose A, Darzynkiewicz susceptibility to epithelial cancer. Genes Dev 2007;21:55–9. Z. Cytometric assessment of DNA damage in relation to cell cycle 31. Sauve DM, Anderson HJ, Ray JM, James WM, Roberge M. Phosphor- phase and apoptosis. Cell Prolif 2005;38:223–43.

ylation-induced rearrangement of the histone H3 NH2-terminal domain 50. Tanaka T, Halicka HD, Huang X, Traganos F, Darzynkiewicz Z. Con- during mitotic chromosome condensation. J Cell Biol 1999;145: stitutive histone H2AX phosphorylation and ATM activation, the repor- 225–35. ters of DNA damage by endogenous oxidants. Cell Cycle 2006;5: 32. Xu D, Bai J, Duan Q, Costa M, Dai W. Covalent modiﬁcations of 1940–5. histones during mitosis and meiosis. Cell Cycle 2009;8:3688–94. 51. McManus KJ, Hendzel MJ. ATM-dependent DNA damage-indepen- 33. Kurki P, Vanderlaan M, Dolbeare F, Gray J, Tan EM. Expression of dent mitotic phosphorylation of H2AX in normally growing mammalian proliferating cell nuclear antigen (PCNA)/cyclin during the cell cycle. cells. Mol Biol Cell 2005;16:5013–25. Exp Cell Res 1986;166:209–19. 52. Ichijima Y, Sakasai R, Okita N, Asahina K, Mizutani S, Teraoka H. 34. Bahary N, Davidson A, Ransom D, Shepard J, Stern H, Trede N, et al. Phosphorylation of histone H2AX at M phase in human cells without The Zon laboratory guide to positional cloning in zebraﬁsh. Methods DNA damage response. Biochem Biophys Res Commun 2005;336: Cell Biol 2004;77:305–29. 807–12.

www.aacrjournals.org Mol Cancer Res; 10(11) November 2012 1461

Multiple Isoforms of CDC25 Oppose ATM Activity to Maintain Cell Proliferation during Vertebrate Development

Daniel Verduzco, Jennifer Shepard Dovey, Abhay A. Shukla, et al.

Mol Cancer Res 2012;10:1451-1461. Published OnlineFirst September 17, 2012.

Updated version Access the most recent version of this article at: doi:10.1158/1541-7786.MCR-12-0072

Supplementary Access the most recent supplemental material at: Material http://mcr.aacrjournals.org/content/suppl/2012/09/14/1541-7786.MCR-12-0072.DC1

Cited articles This article cites 50 articles, 15 of which you can access for free at: http://mcr.aacrjournals.org/content/10/11/1451.full#ref-list-1

Citing articles This article has been cited by 1 HighWire-hosted articles. Access the articles at: http://mcr.aacrjournals.org/content/10/11/1451.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at Subscriptions [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://mcr.aacrjournals.org/content/10/11/1451. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.