CD36-Mediated Hematoma Absorption following Intracerebral Hemorrhage: Negative Regulation by TLR4 Signaling

This information is current as Huang Fang, Jing Chen, Sen Lin, PengFei Wang, YanChun of October 2, 2021. Wang, XiaoYi Xiong and QingWu Yang J Immunol 2014; 192:5984-5992; Prepublished online 7 May 2014; doi: 10.4049/jimmunol.1400054 http://www.jimmunol.org/content/192/12/5984 Downloaded from

Supplementary http://www.jimmunol.org/content/suppl/2014/05/07/jimmunol.140005 Material 4.DCSupplemental http://www.jimmunol.org/ References This article cites 32 articles, 11 of which you can access for free at: http://www.jimmunol.org/content/192/12/5984.full#ref-list-1

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists by guest on October 2, 2021

• Fast Publication! 4 weeks from acceptance to publication

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Author Choice Freely available online through The Journal of Immunology Author Choice option Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2014 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

CD36-Mediated Hematoma Absorption following Intracerebral Hemorrhage: Negative Regulation by TLR4 Signaling

Huang Fang,* Jing Chen,* Sen Lin,†,‡ PengFei Wang,* YanChun Wang,* XiaoYi Xiong,* and QingWu Yang*

Promoting hematoma absorption is a novel therapeutic strategy for intracerebral hemorrhage (ICH); however, the mechanism of hematoma absorption is unclear. The present study explored the function and potential mechanism of CD36 in hematoma absorp- tion using in vitro and in vivo ICH models. Hematoma absorption in CD36-deficient ICH patients was examined. Compared with patients with normal CD36 expression, CD36-deficient ICH patients had slower hematoma adsorption and aggravated neurologic deficits. CD36 expression in perihematomal tissues in wild-type mice following ICH was increased, whereas the hematoma absorp- tion in CD362/2 mice was decreased. CD362/2 mice also showed aggravated neurologic deficits and increased TNF-a and IL-1b Downloaded from expression levels. The phagocytic capacity of CD362/2 microglia for RBCs was also decreased. Additionally, the CD36 expression in the perihematoma area after ICH in TLR42/2 and MyD882/2 mice was significantly increased, and hematoma absorption was significantly promoted, which was significantly inhibited by an anti-CD36 Ab. In vitro, TNF-a and IL-1b significantly inhibited the microglia expression of CD36 and reduced the microglia of RBCs. Finally, the TLR4 inhibitor TAK-242 upregulated CD36 expression in microglia, promoted hematoma absorption, increased catalase expression, and decreased the http://www.jimmunol.org/ H2O2 content. These results suggested that CD36 mediated hematoma absorption after ICH, and TLR4 signaling inhibited CD36 expression to slow hematoma absorption. TLR4 inhibition could promote hematoma absorption and significantly improve neu- rologic deficits following ICH. The Journal of Immunology, 2014, 192: 5984–5992.

ematomas form when blood enters the cerebral paren- rologic deficit (5); however, the mechanism underlying hematoma chyma after an intracerebral hemorrhage (ICH); hema- absorption remains unknown. H tomas are the primary cause of neurologic deficits as- Scavenger receptors play important roles in the regulation of sociated with ICH. The early stages of hematoma compression phagocytosis in (6). CD36 is a type II scavenger cause deformation and mechanical injury to local brain tissues. that can bind to modified , symmetric red by guest on October 2, 2021 Secondary neuronal damage is caused by direct toxicity and in- ghosts, or apoptotic neutrophils; this receptor plays an important flammatory responses induced by the components and metabolic role in mediating phagocytosis (7, 8). Cells lacking phagocytic products of late-stage hematomas and aggravates neurologic def- abilities acquire phagocytic functions following transfection with icits (1). Therefore, effective hematoma removal is a goal of ICH CD36 (9, 10). A peroxisome proliferator-activated receptor g ago- treatment, as hematoma removal can relieve mechanical com- nist promotes hematoma absorption following ICH, which signifi- pression, limit inflammatory injury, and promote the recovery of cantly reduces secondary inflammatory damages; the mechanism neuronal function (2–4). Clinically, the rate of hematoma ab- may be associated with the upregulation of CD36 expression in the sorption in patients with ICH correlates with the degree of neu- microglia (2). However, the function of CD36 and the regulatory mechanism underlying the effect of CD36 in hematoma absorption are unclear. *Department of Neurology, Xinqiao Hospital, Third Military Medical University, Chongqing 400037, China; †Department of Development and Regeneration Key TLRs are important components of the innate immune system Laboratory of Sichuan Province, Chengdu Medical College, Chengdu 610083, China; that recognize pathogen- and damaged-associated molecular pat- ‡ and Department of Histoembryology and Neurobiology, Chengdu Medical College, terns that could induce inflammatory responses (11). Many studies Chengdu 610083, China have demonstrated that TLR4 participates in the development of Received for publication January 10, 2014. Accepted for publication April 5, 2014. sterile inflammation and plays an important role in the inflam- This work was supported by National Natural Science Foundation of China Grant 81271283 and National “973” Project Grant 2014CB541605. matory responses of the CNS, such as those that occur in the case of cerebral ischemia and Parkinson’s disease (12). Our previous Address correspondence and reprint requests to Prof. QingWu Yang, Department of Neurology, Xinqiao Hospital, Third Military Medical University, 183 Xinqiao Main studies showed that TLR4 activation following ICH results in Street, Shapingba District, Chongqing 400037, China. E-mail address: yangqwmlys@ NF-kB activation via the MyD88 pathway, resulting in the pro- hotmail.com duction of large quantities of inflammatory factors, such as TNF-a The online version of this article contains supplemental material. and IL-1b; these factors may cause inflammatory damage and ag- Abbreviations used in this article: CT, computerized tomography; GFAP, glial fibril- gravate neurologic deficits (13). Treatment with the TLR4 inhibitor lary acidic ; ICH, intracerebral hemorrhage; mRS, modified Rankin Scale; NDS, neurological deficit score; NIHSS, National Institutes of Health Stroke Scale; ethyl (6R)-6-[N-(2-chloro-4-fluorophenyl)sulfamoyl]-cyclohex-1-ene- TAK-242, ethyl (6R)-6-[N-(2-chloro-4-fluorophenyl)sulfamoyl]cyclohex-1-ene-1- 1-carboxylate (TAK-242; Takeda Pharmaceutical Company, Osaka, carboxylate; WT, wild-type. Japan) decreases secondary inflammatory damage following ICH This article is distributed under The American Association of Immunologists, Inc., (14). Other studies have shown that inflammatory factors such as Reuse Terms and Conditions for Author Choice articles. TNF-a, which is induced by the activation of TLR signaling path- Copyright Ó 2014 by The American Association of Immunologists, Inc. 0022-1767/14/$16.00 ways, downregulate the expression of CD36 in macrophages and www.jimmunol.org/cgi/doi/10.4049/jimmunol.1400054 The Journal of Immunology 5985 affect cellular phagocytic functions that are essential to infection- Collection of human brain tissue related inflammatory responses (15). Additionally, CD36 expression 2/2 Brain tissue samples from ICH patients were collected from the brain bank in perihematomal tissues is significantly upregulated in TLR4 of the Department of Neurosurgery of Xinqiao Hospital of the Third mice subjected to ICH (16). Therefore, we hypothesized that Military Medical University (Chongqing, China). All autopsies had been CD36 mediates hematoma absorption following ICH and that the performed within 24 h of death. The inclusion criteria were as follows: 1) the activation of TLR4 signaling following ICH produces inflam- patient must not have had a previous ICH, and hemorrhage in the basal ganglia was confirmed by CT scan; and 2) the patient had died within 48 h of matory factors such as TNF-a that could downregulate CD36 disease onset. The exclusion criteria were as follows: 1) the patient had expression and mediate hematoma absorption. To understand the a traumatic hemorrhage or a hemorrhage caused by a coagulation dys- involvement of CD36 and TLR4 signaling in hematoma absorp- function; 2) the patient had a history of acute or chronic infection or a known tion following ICH, we modified CD36 expression in the relevant inflammatory or autoimmune disease; and 3) the patient had a tumor, cachexia, or had used immunosuppressive drugs for a prolonged period of cells. The goal of the present study was to further understand the time. Three patients met the inclusion criteria and were enrolled. After the regulatory mechanism underlying hematoma absorption follow- human brain tissues were collected at autopsy, the perihematomal tissues ing ICH to identify treatment options that promote hematoma were used to detect CD36 expression using immunofluorescence. This absorption in patients with ICH. protocol for the clinical study was approved by the Ethics Committee of the Xinqiao Hospital of the Third Military Medical University. All of the subjects or authorized relatives signed informed consent forms. This study Materials and Methods did not have any medical ethics–related issues. Clinical study Animals Certain people have CD36 expression deficiencies that affect the devel-

opment of (17, 18). To evaluate the effect of CD36 defi- C57BL/6 mice (male, 8–10 wk old, 20–24 g) were obtained from the Downloaded from ciency on hematoma absorption and neurologic deficits, we screened Animal Center of the Third Military Medical University. TLR42/2, patients with ICH for CD36 expression. Between July 2012 and June 2013, MyD882/2, and CD362/2 mice were purchased from The Jackson Lab- 209 patients with ICH were identified. The inclusion criteria were as oratory (Bar Harbor, ME). All of the knockout mice had maintained the follows: 1) the patient was identified within 24 h of disease onset; 2) the C57BL/6 genetic background over the course of six generations of hy- patient must not have had a previous ICH, and the hemorrhage in the basal bridization, and all were identified using appropriate methods. The mice ganglia had to be confirmed by cranial computerized tomography (CT); were housed in a clean environment and given ad libitum access to food and 3) the hematoma must not have ruptured into the cerebral ventricles. and water. The experimental protocol was approved by the Animal Man-

The exclusion criteria were as follows: 1) the patient was ,18 y or .80 y agement Committee of the Third Military Medical University. The mice http://www.jimmunol.org/ old; 2) the patient chose to undergo surgical treatment; 3) the patient was were randomly divided into groups, and the investigators were blinded to inacomaordiedwithin48hoftheICH;4)theICHwascausedby the group allocation of the mice. a brain tumor, trauma, drug abuse, coagulation abnormalities, anti- coagulation therapy, or vascular malformations; 5) the patient had had ICH model an obvious inflammatory disease 6 mo prior to enrollment (e.g., acute or chronic infectious diseases, systemic lupus erythematosus, rheu- The establishment of the ICH model has been described previously (14). matism, or rheumatoid disease); 6) the patient had a nosocomial in- Briefly, the mice were anesthetized with 4% chloral hydrate and immo- fection; 7) the patient had an acute myocardial infarction; 8) the patient bilized in a stereotactic apparatus (Stoelting, Wood Dale, IL). Twenty had acute or chronic liver damage; and 9) the patient was not compliant microliters blood was collected from the tail vein, then directly injected with the study protocol or could not undergo all of the tests required by the into the striatum without anticoagulant through stereotactic apparatus at study. A total of 10 patients were excluded from the study, including 3 0.8 mm anterior and 2 mm lateral (on the left side) to the bregma and at by guest on October 2, 2021 patients who died and 7 who were lost to follow-up. A total of 199 patients a depth of 3.5 mm. The blood was injected at a speed of 2 ml/min. The met the inclusion criteria and were enrolled in the study. Upon admission to needle was maintained in place for 10 min until the blood had coagulated; the hospital, 10 ml blood from the median cubital vein was collected to the microinjector was then removed. The skull was sealed with bone wax, ∼ screen for CD36 deficiency. A cranial CT scan was performed on the day of and the scalp was sutured. The rectal was maintained at 37˚C; admission and 7 d after admission, as the hemorrhaged clot is generally after recovery, the mice were given free access to water and food. In hyperdense relative to adjacent healthy cerebral parenchyma in the early parallel, sham mice received 20 ml striatal saline injection and were subacute phase of ICH (19, 20). The hematoma was visualized by CT subjected to the same manipulations as the ICH mice. The success rate of scanning (64-slice CT machine; Siemens, Munich, Germany). Hemorrhage the model was 90%; failed models and dead mice were excluded from volumes were measured via computerized planimetry. The measurement of this study. hemorrhage volume by planimetrics is an established and accurate method that uses computer-assisted image analysis (21). The volumes were expressed Analysis of the neurologic deficit score in cubic centimeters. The volumes of hemorrhages within the ventricular The experiment was performed as described previously (14), and a 28-point system were not measured. The following parameters were used for all CT neurologic deficit scale was adopted. Circling behavior, climbing, front studies: section thickness, 5 mm; gap, 5 mm; pitch, 1; tube current, 304 mA; limb symmetry, and body symmetry were assessed. The scoring was per- and voltage, 120 kV. The hematoma absorption rate (percentage) was cal- formed by two blinded laboratory investigators who were unaware of the 2 culated with the following formula: [(hematoma volume at 7 d hematoma mouse groupings. The average score was the final score of each mouse. volume at admission)/hematoma volume at admission] 3 100. On admission and 7, 14, and 30 d after admission, the patients were evaluated using Hematoma measurement the National Institutes of Health Stroke Scale (NIHSS). Modified Rankin Scale (mRS) scores were used to evaluate neurologic deficits in patients As in our previous report (25), the mice were anesthetized using a lethal 3 mo after the onset of the ICH (22). dose of chloral hydrate. After perfusion and fixation, the brains were re- CD36 screening was performed using a sequence-specific primer PCR moved and sectioned from the frontal lobe to the occipital lobe to prepare assay. CD36 mutant primers were designed using information from previous coronal brain sections with a thickness of 1 mm. The fixed brain sections reports (23, 24). These mutations are the most common mutations that were sequentially arranged, and Image-Pro Plus 5.0 image processing cause CD36 expression defects in Asian populations (Supplemental software (Media Cybernetics, Bethesda, MD) was used to measure the ICH Table I). The patients lacking positive bands in the electrophoretogram volume (cubic millimeters). The hematoma volume was calculated using were considered CD36 deficient (Supplemental Fig. 1A). The mutations the formula V = t 3 (A2+… + An), where V is the hematoma volume, t is were confirmed through sequencing analysis (data not shown). The types the section thickness, and A is the bleeding area. Additionally, the he- of CD36 deficiency were identified through Western blot analysis of moglobin content in the brain tissues was measured to further quantify (Supplemental Fig. 1B). Eleven patients with CD36 deficiency hematoma size (2). Blood (0, 2, 4, 8, 16, and 20 ml) was added to fresh in monocytes were identified (type I deficiency). Eleven patients with brain homogenates, and OD was then measured and recorded at 540 nm normal CD36 expression had similar hematoma volumes at the same sites using a spectrophotometer (Thermo Multiskan, Pittsburgh, PA). The ob- and were selected to form the control group. Both groups of patients had tained values were used to prepare the standard curve. The striatum was similar baseline data. The clinical data of the patients in these two groups removed after the ICH was initiated and dissolved in Drabkin’s reagent. are shown in Supplemental Table II. The supernatant of the homogenate was collected and measured using 5986 CD36-MEDIATED HEMATOMA ABSORPTION a spectrophotometer; the hematoma volume (microliters) was then calcu- luted to a concentration of 108 cells/ml, added to the cultured microglia in lated using the standard curve. 24-well plates at a ratio of 10:1, and cultured for 12 h. The microglia were fixed and stained with rat anti-mouse CD11b (1:400; Millipore) followed Brain water content by Alexa Fluor 594 (1:500, donkey anti-rat; Invitrogen, Carlsbad, CA) and Hoechst nuclear stain (Invitrogen, Eugene, OR). The observed results were As previously described (14), we randomly selected mice from each group to measure the brain water content at 3 d after the model was successfully visualized using confocal microscopy and imaged. The intracellular lo- constructed (n = 6). Briefly, the mice were anesthetized by i.p. injection, calization of RBCs (green fluorescence) was validated by Z-stack fluo- and the cerebral tissues were removed. The samples were divided into five rescence confocal imaging. Briefly, Z-stack images were collected as parts: the ipsilateral cortex, the ipsilateral basal ganglia, the contralateral a series of micrographs derived from different focal planes. Approximately 10 optical sections were captured from the top to the bottom of each cortex, the contralateral basal ganglia, and the cerebellum. The brain water section in our study. The internalized RBCs were observed surrounded by content (percentage) was calculated with the formula [(wet weight 2 dry weight)/wet weight] 3 100. the red fluorescent cytomembrane of microglia when resectioning a Z-stack was performed. Green fluorescent RBCs bound to the surface Immunohistochemical staining were not surrounded by a red cytomembrane. Following our previous methods (13), human and mouse perihematomal Flow cytometry tissues were fixed in 4% paraformaldehyde. The samples underwent gra- dient dehydration, embedding, freezing, and sectioning into 20-mm-thick To detect the specific types of cells expressing CD36 in perihematomal sections; CD36 expression was detected using double fluorescence im- tissues, single-cell suspensions of perihematomal tissues were prepared as munohistochemistry. The following primary Abs were used in this ex- described previously (16, 26). Briefly, after the mice were anesthetized with periment: mouse anti-human CD36 (1:200; LifeSpan, Seattle, WA), rabbit chloral hydrate, cardiac perfusion was performed using cold sterile PBS; the anti-human Iba-1 (1:200; Wako Pure Chemical Industries, Osaka, Japan), left brain was then removed immediately, placed in a C-tube (Miltenyi rabbit anti-human NeuN (1:200; Millipore, Darmstadt, Germany), rabbit Biotec, Bergisch Gladbach, Germany), mixed with lysis buffer, and ground anti-human glial fibrillary acidic protein (GFAP; 1:100; Dako, Glostrup, in a gentleMACS dissociator (Miltenyi Biotec). The brain tissue homoge- Downloaded from Denmark), rabbit anti-mouse CD36 (1:200; Abcam, Cambridge, U.K), rat nate was filtered using a 40-mm sieve and incubated with demyelination anti-mouse CD11b (1:200; Millipore), mouse anti-mouse GFAP (1:100; microbeads at 4˚C for 15 min. An L magnetic column was used to separate Cell Signaling Technology, Danvers, MA), and mouse anti-mouse NeuN the myelin sheath. The suspension that passed through the magnetic column (1:100; Millipore). The secondary Abs included Alexa Fluor 647 (1:200; was used to generate brain tissue single-cell suspensions. To explore the donkey anti-mouse), Alexa Fluor 594 (1:200; donkey anti-rabbit), and expression percentage of CD36 in each type of cell, the cells were stained Alexa Fluor 488 (1:200; donkey anti-rabbit, donkey anti-mouse, and with the relevant surface markers (anti-mouse CD36-PerCP-eFluor 710 donkey anti-rat, all from Invitrogen, Carlsbad, CA). The observed results [1:200; eBioscience, San Diego, CA), anti-mouse CD11b Ab–PE [1:200; http://www.jimmunol.org/ were imaged by confocal microscopy (LSM 780, Carl Zeiss, Jena, Ger- Santa Cruz Biotechnology], and anti-mouse CD45 Ab–FITC (1:200; many, and TCS Sp5, Leica, Mannheim, Germany). eBioscience]) for 30 min and fixed with Fix buffer (BD Biosciences, San Diego, CA) for 30 min at 4˚C. The cells were then incubated with BD Real-time quantitative RT-PCR Cytoperm and buffer for 10 min at room temperature and refixed for 10 min. The cells were then incubated with anti-mouse GFAP–Fluor 660 Tissue and cellular RNA was extracted using the TRIzol reagent (Invitrogen, (1:200; eBioscience) and anti-mouse neuron-specific b-III tubulin PerCP Gaithersburg, MD), and cDNA was synthesized using the iScript cDNA (1:200; R&D Systems, Bingdon, U.K.) for 30 min at 4˚C. The data were synthesis reagent (Bio-Rad, Hercules, CA) according to the manufacturers’ collected with FACSDiva 6.0 flow cytometer software (BD Biosciences) instructions. Real-time quantitative RT-PCR was performed in a 96-well plate and analyzed with FlowJo software (Tree Star, Ashland, OR). The microglia in the Bio-Rad iQ PCR machine (Bio-Rad, Hercules, CA) with the iQ SYBR were marked by CD45intCD11b+, whereas neurons were identified as b-III Green reagent. The primers were purchased from Shanghai Sangon Biotech. + +

tubulin , and astrocytes were identified as GFAP . by guest on October 2, 2021 The primer sequences used in the study are shown in Supplemental Table I. 2 The 2 DDCT method was used to calculate relative expression levels (13). Analysis of phagocytosis of RBCs by microglia using flow Western blot cytometry As in our previous report (14), from perihematomal tissues or Following methods described in the literature (15), RBCs were stained with cultured microglia were resolved by SDS-PAGE and transferred onto CFSE and combined with the cultured microglia at a ratio of 10:1. After polyvinylidene fluoride membranes by electroblotting. The membranes coculturing for 12 h, the microglia were harvested and stained with anti– CD11b Ab-PE for 30 min. The flow cytometry analysis showed that all of were incubated with mouse anti-human CD36 (for human blood, 1:400; + + Wako Chemicals USA, Richmond, VA) or rabbit anti-mouse CD36 (for the microglia were PE . The microglia that had engulfed RBCs were PE CFSE+, and the nonengulfed RBCs in the supernatant were CFSE+. Three perihematomal tissues and cells, 1:400; Abcam) at 4˚C overnight; GAPDH indicators were used to assess the ability of microglia to phagocytize (1:400; Santa Cruz Biotechnology, Dallas, TX) was used as a loading RBCs: 1) the percentage of microglia that had engulfed RBCs (the total control. The membranes were incubated with HRP-conjugated goat anti- + + + mouse secondary Abs (1:2000) or HRP-conjugated goat anti-rabbit sec- number of PE CFSE cells/all PE cells, expressed as percentage), 2) the average CFSE fluorescence intensity of microglia that had engulfed RBCs ondary Abs (1:2000; all from Sigma-Aldrich, St. Louis, MO) at 25˚C for + + + 1.5 h. Bound Abs were visualized using a chemiluminescence detection (PE CFSE ), and 3) the number of nonengulfed RBCs (CFSE ) in the supernatant. Additionally, changes in the microglia that had engulfed system. The signals were measured by scanning densitometry and RBCs were observed using the CD36 Ab (5 mg/ml; Abcam). computer-assisted image analysis. Protein levels were calculated as the ratio of the values corresponding to the band of the detected protein to the values Analysis of changes in microglial CD36 expression using flow corresponding to the GAPDH band. cytometry Microglial culture 2 2 2 2 To investigate the changes of CD36 expression in TLR4 / ,MyD88/ Following methods described in the literature (2), the cells digested from microglia following ICH, CFSE-stained RBCs were added to the different the cerebral hemispheres of postnatal day 1 newborn mice were cultured microglial cultures at a concentration of 1 3 107 cells/ml and incubated for for 2 wk. The loosely adherent microglia were harvested and inoculated 12 h. To explore the different inflammatory factors on the influence of CD36 into six-well plates or on 12-mm coverslips in 24-well plates at a con- expression after ICH, CFSE-stained RBCs were added to the microglial centration of 1 3 105 cells/ml. The experiment was performed on the cultures and incubated for 12 h in the presence of the vehicle, TNF-a following day. The cell purity was confirmed through immunohisto- (100 ng/ml; Life Technologies, Frederick, MD), IL-1b (100 ng/ml; R&D Sys- chemistry using the microglia-specific rat anti-mouse CD11b Ab (1: 500; tems, Minneapolis, MN), and IL-10 (10 ng/ml, BD Biosciences). The microglia Millipore). The purity of the microglia was .95%. were collected and stained with anti-mouse CD36-PerCP-eFluor 710 and anti- mouse CD11b Ab–PE for 30 min; the expression of CD36 and changes in the Phagocytosis in vitro phagocytic ability of microglia were examined by flow cytometry. Following previously described methods (2), we added mouse RBCs to TAK-242 cultures of microglia to model phagocytosis in vitro in a model of human ICH. Mouse RBCs were purified via density gradient centrifugation and TAK-242 (Takeda Pharmaceutical Company) is a TLR4-specific inhibitor labeled with CFSE (Invitrogen, Eugene, OR) for 30 min. RBCs were di- (14). CFSE-stained RBCs were mixed and cocultured with microglia at The Journal of Immunology 5987 a ratio of 10:1 in the presence of TAK-242 (1 mmol/l), TAK-242 (1 mmol/l) plus TNF-a (100 ng/ml), TAK-242 (1 mmol/l) plus IL-1b (100 ng/ml), or vehicle (solution for producing TAK-242) for 12 h. CD36 expression and changes in phagocytosis in microglia were detected using flow cytometry. To observe the effect of TAK-242 on hematoma absorption following ICH, a previously described method was used (14); 6 h after the ICH model was successfully established, the mice were i.p. injected with TAK-242 (3 mg/kg, once per day for 5 d). The mice were divided into four groups: the sham group, the ICH plus vehicle group (the solvent for TAK-242, administered using the same volume as the TAK-242 group), the ICH plus TAK-242 group, and the ICH plus TAK-242 plus TNF-a group(firstinjectingTAK- 242 and then immediately injecting 3 mgTNF-a). The mice were sacrificed 5 d later, and the volume of the hematomas was measured.

Detection of catalase mRNA and H2O2 concentrations Following previously described methods (2), the microglial suspensions were divided into two groups: the vehicle group and the TAK-242 group. RBCs were added at a ratio of 10:1 in the presence of vehicle or TAK-242 (1 mmol/l). After culturing for 12 h, the microglia were collected and the changes in catalase mRNA expression were detected using quantitative PCR. The catalase primer was purchased from Shanghai Sangon Biotech, and the primer detail information is shown in Supplemental Table I. Ad-

ditionally, the culture medium was collected and H2O2 concentrations were Downloaded from measured with a detection (Invitrogen) according to the manufacturer’s instructions. Statistical analyses FIGURE 1. Reduced hematoma absorption and aggravated neurologic deficits in CD36-deficient patients with ICH. (A) Typical cranial CT All of the data are presented as the means 6 SD or the percentage. The analysis images of CD36-normal (n = 11) and CD36-deficient (n = 11) ICH was performed using SPSS 16.0 software. A repeated two-way ANOVA was patients. Original magnification 310. (B) Comparison of hematoma vol- used to evaluate the differences in NIHSS scores for the clinical studies and in umes in the CD36-deficient and CD36-normal groups at admission and 7 d http://www.jimmunol.org/ the neurologic deficit score (NDS) for animal studies between the groups and after the onset of ICH. *p , 0.05 versus the CD36-normal group. (C) time points. The t test for independent samples or the Mann–Whitney U test was used to compare two groups; comparisons among multiple groups were Decreased absorption rate in the CD36-deficient patients relative to the , D examined using one-way ANOVA with a least significant difference post hoc normal group. **p 0.01 versus the CD36-normal group. ( ) NIHSS test. Differences were considered significant when p , 0.05. scores and (E) mRS scores for ICH patients. *p , 0.05 versus the CD36- normal group, **p , 0.01 versus the CD36-normal group. Results CD36 affects hematoma absorption in ICH patients the flow cytometry analysis of cells from the perihematomal tis- The cranial CT images of patients in the CD36-deficient and CD36- sues showed that the expression levels of CD36 in neurons, by guest on October 2, 2021 normal groups on the day of admission and 7 d after admission astrocytes, and microglia were significantly higher in the experi- showed that the hematoma volumes had changed (Fig. 1A). The mental mice at 3 d after the onset of the ICH than in the sham + difference in the hematoma volumes of CD36-deficient and CD36- group; however, microglia became CD36 at a significantly more normal patients was not significant at the onset of ICH; however, rapid rate than did neurons and astrocytes (Fig. 2C). The immu- the hematoma volumes of the patients in the CD36-deficient group nofluorescent staining of perihematomal tissues from ICH patients were larger than those of the patients in the CD36-normal group produced results that were consistent with the results obtained at 7 d after the onset of ICH (Fig. 1B). The hematoma absorption with flow cytometry (Fig. 2D). Similarly, the results of immuno- rate was lower in the CD36-deficient patients than in the CD36- fluorescent staining of the perihematoma of mice at 3 d after ICH normal patients (Fig. 1C). The NIHSS scores of CD36-deficient were consistent with the patients who had experienced ICH patients at 14 and 30 d were significantly higher than the scores of (Supplemental Fig. 1D). As the resident phagocytes of the brain, the CD36-normal patients (Fig. 1D); the mRS scores of the defi- microglia were involved in regulating the inflammatory response cient patients at 90 d were also significantly higher than those of that occurs following ICH. Our results showed that CD36 was the normal patients (Fig. 1E). The results show that the hematoma abundantly and mainly expressed in the microglia surrounding the absorption rate in CD36-deficient patients was reduced and that perihematomal tissues following ICH, suggesting that CD36 plays the neurologic deficits of these patients significantly aggravated a role in the pathological processes associated with ICH. their condition. This finding suggests that CD36 plays an impor- CD36-mediated hematoma absorption following ICH tant role in promoting hematoma absorption in patients with ICH. The ICH model was used to evaluate the role of CD36 in the CD36 expression following ICH process of hematoma absorption. The absorption and the volume of Changes in CD36 expression in the perihematomal region were hematomas were lower and larger, respectively, in CD362/2 mice observed using a mouse ICH model. At the corresponding time than in wild-type (WT) mice (Fig. 3A, 3B). Additionally, the NDS points, perihematomal tissues were collected (the field selections and the brain water content of CD362/2 mice were significantly are shown in Supplemental Fig. 1C). The levels of CD36 mRNA higher than those of the mice in the sham group (Fig. 3C, 3D); the and protein in the perihematomal tissues were significantly higher mRNA levels of TNF-a and IL-1b were also higher in the peri- in the mice subjected to ICH than in the mice of the sham group. hematomal tissues of the CD362/2 mice than in the mice of the The expression levels peaked at 3 d after the onset of the ICH and sham group. In contrast, IL-10 expression levels were significantly then gradually decreased; on 7 d, the expression levels were still lower in the deficient mice than in the mice of the sham group higher in the treated mice than in the sham mouse group (Fig. 2A, (Fig. 3E). 2B). No time-dependent alterations in CD36 expression were To further confirm the involvement of CD36 in the promotion observed in the sham group mice (data not shown). The results of of hematoma absorption, we observed the phagocytosis of RBCs 5988 CD36-MEDIATED HEMATOMA ABSORPTION

FIGURE 3. CD36-mediated hematoma absorption in mice with ICH. (A) Serial coronal sections of mouse brain tissues 5 d after the onset of ICH. Original magnification 31.5. (B) Comparison of hematoma volumes between WT and CD362/2 mice. The data in the left and right panels are Downloaded from the Image-Pro Plus and hemoglobin detection results, respectively. **p , FIGURE 2. Enhanced CD36 expression in perihematomas following 0.01 versus the WT group, n =6.(C) The NDS of WT and CD362/2 mice A ICH. ( ) Detection of CD36 mRNA expression in mice subjected to ICH at 1, 3, 5, and 7 d after the onset of ICH. *p , 0.05 versus the WT group at using real-time quantitative RT-PCR. The data are expressed as fold the corresponding time points, n =6.(D) Brain water content and (E) , B increases relative to naive animals. **p 0.01 versus sham, n =6.( ) mRNA expression of inflammatory factors 3 d after the onset of ICH. The Detection of CD36 protein expression in mice subjected to ICH using data in (E) were assessed by real-time quantitative RT-PCR and were Western blot. **p , 0.01 versus sham, n =6.(C) Detection of CD36 , expressed as fold increases relative to naive animals. *p 0.05 versus the http://www.jimmunol.org/ expression in astrocytes, neurons, and microglia in the perihematomal WT group; **p , 0.01 versus the WT group, n = 6. Cereb, cerebellum; tissues of mice using flow cytometry at 3 d after ICH. The left panel is the Cont BG, contralateral basal ganglia; Cont CX, contralateral cortex; Ipsi representative flow cytometry plot and the lower right panel is the per- BG, ipsilateral basal ganglia; Ipsi CX, ipsilateral cortex. centage of CD36+ cells in neurons, astrocytes, and microglia. Microglia were marked by CD45intCD11b+, whereas neurons were identified as b-III 2 2 tubulin+, and astrocytes were identified as GFAP+.**p , 0.01 versus CD36 expression in the perihematoma of the MyD88 / and 2 2 sham, ##p , 0.01 versus astrocytes or neurons, n =3.(D) Detection of TLR4 / mice was significantly increased at 3 d after the onset of CD36 expression in human perihematomal tissues of ICH patients using ICH, as observed in the Western blot (Fig. 5A), and in the in vitro fluorescence immunohistochemistry; CD36 expression was labeled with ICH model significantly increased CD36 expression was also a CD36 Ab (red), astrocytes, neurons, and microglia were labeled with detected in the MyD882/2 and TLR42/2 microglia by flow cyto- by guest on October 2, 2021 GFAP (green), Neun (green), and Iba-1 (green), respectively. The merged metry (Fig. 5B). Moreover, the significantly decreased hema- images of the overlay of CD36 together with astrocytes, neurons, and 2 2 2 2 toma volumes were found in the MyD88 / and TLR4 / mice microglia were shown as yellow, and the nuclei were stained with DAPI (blue). 2/2 The arrows indicate positive cells. Scale bars, 80 mm. (Fig. 5C), and flow cytometry showed that the MyD88 and TLR42/2 groups had more PE+CFSE+ microglia than did the WT group in vitro (Fig. 5D). The average CFSE fluorescence intensity + + 2/2 by different microglia in a simulated in vitro ICH model (2). was higher in PE CFSE microglia from the MyD88 and 2/2 Representative images showing the number of RBCs engulfed by TLR4 groups than in the microglia of the WT group (Fig. 5E), microglia showed that significantly fewer RBCs were engulfed in and significantly fewer RBCs were nonphagocytosed in the 2/2 2/2 the CD362/2 group than in the WT group. The ability to phago- MyD88 and TLR4 groups (Fig. 5F). The phagocytic 2/2 2/2 cytize RBCs was decreased in WT microglia treated with a CD36 capacity of MyD88 and TLR4 microglia treated with anti- Ab, whereas no change in the phagocytic ability of WT microglia CD36 Abs was significantly inhibited; in contrast, the phagocytic 2/2 2/2 treated with IgG was observed (Fig. 4A). Flow cytometry was capacity of MyD88 and TLR4 microglia treated with IgG conducted to analyze the ability of microglia to phagocytize was not affected (Fig. 5D–F). These results indicate that TLR4 RBCs; the CD362/2 group had significantly fewer PE+CFSE+ signaling may downregulate CD36 expression and inhibit hema- microglia that engulfed RBCs than did the WT group (Fig. 4B). toma absorption. Additionally, the average fluorescence intensity of CFSE in the The effect of inflammatory molecules released downstream of PE+CFSE+ microglia was significantly decreased in the CD362/2 TLR4 signaling (such as TNF-a) on the phagocytic capacity of group (Fig. 4C). Accordingly, the number of nonengulfed RBCs in microglia was investigated. Western blot analysis showed that the the supernatant was higher in the CD362/2 group than in the WT addition of RBCs to microglial cultures in the presence of TNF-a group (Fig. 4D). Similar results were observed when the microglia and IL-1b significantly decreased CD36 expression; in contrast, were treated with anti-CD36 Abs; in contrast, the phagocytosis of the addition of IL-10 significantly upregulated CD36 expression RBCs by microglia in the WT group was not significantly affected (Fig. 6A). The microglia CD36 expression levels observed using by treatment with IgG (Fig. 4B–D). These results suggest that flow cytometry were consistent with the above results (Fig. 6B). + + CD36 plays an important role in promoting hematoma absorption. The percentage of PE CFSE microglia in the TNF-a– and IL- 1b–treated groups was lower than in the vehicle-treated group TLR4/MyD88 signaling inhibits CD36 expression and (Fig. 6C); additionally, the average fluorescence intensity of CFSE decreases hematoma absorption in PE+CFSE+ microglia was decreased (Fig. 6D) and the number The effect of TLR4 signaling on CD36 expression and hematoma of nonphagocytosed RBCs was increased (Fig. 7E) in the treated absorption was explored using in vitro and in vivo ICH models. groups. In contrast, in the IL-10–treated group, the percentage of The Journal of Immunology 5989

microglia and promote RBC phagocytosis. In the TAK-242 plus TNF-a group and the TAK-242 plus IL-1b group, the percentage of PE+CFSE+ microglia and average fluorescence intensity of CFSE were reduced; however, the number of RBCs remaining in the supernatant was increased (Fig. 7C–E), and the effect of TNF-a was more apparent. These results suggest that the TLR4 signaling pathway regulates CD36 expression and its function via inflammatory factors, especially TNF-a. In the in vitro ICH model, the expression of catalase mRNA was significantly in- creased (Fig. 7F), and the H2O2 content was significantly de- creased (Fig. 7G) in the microglia of the TAK-242 group. Finally, when TAK-242 was applied 6 h after the onset of the in vivo ICH models, the hematoma volume in treated mice was significantly lower than in mice of the vehicle control group 5 d after the onset of the hematoma. Because TNF-a had an inhibiting effect of CD36 expression in vitro, after the first injection of TAK-242, we immediately injected TNF-a, which showed that the protective effect could be weakened by TNF-a (Fig. 7H). Downloaded from Discussion Clinical trials evaluating the surgical removal of hematomas have FIGURE 4. CD36-mediated engulfment of RBCs by microglia. (A) not achieved the expected results (27). The promotion of hema- Observation of the phagocytosis of RBCs (CFSE-labeled, green) by toma absorption in cerebral tissues represents a new potential microglia (Alexa Fluor 594–labeled, red) using confocal microscopy. The treatment option for patients with ICH (2, 3). However, the reg- nuclei were stained with Hoechst. Serial sections along the z-axis were ulatory mechanism underlying hematoma absorption is still un- acquired and compiled as images. The x–z-axis is below, and the y–z-axis is clear. The present study showed that CD36-mediated hematoma http://www.jimmunol.org/ on the right. The arrows indicate the RBCs engulfed by microglia. Scale bars, absorption occurs in ICH patients and that this absorption is sig- 40 mm. Detection of changes in the phagocytic ability of microglia using nificantly associated with patient prognosis. The results of in vitro flow cytometry is shown. Microglia were stained with anti-mouse CD11b-PE and in vivo experiments related to ICH further confirmed that and RBCs were stained with CFSE. (B) Representative flow cytometry plot (left panel) and the percentage of PE+CFSE+ microglia that had engulfed CD36 promotes hematoma absorption. After the onset of ICH, RBCs (right panel). (C) Average fluorescence intensity of CFSE in the PE+ inflammatory factors induced by the activation of the TLR4 sig- CFSE+ microglia. (D) The number of nonphagocytosed RBCs in the super- naling pathway downregulate CD36 expression and inhibit he- natant. **p , 0.01 versus the WT microglia group, n = 6 for all graphs. matoma absorption. The application of TLR4 inhibitors could

upregulate CD36 expression and increase hematoma absorption. by guest on October 2, 2021 PE+CFSE+ microglia and the average fluorescence intensity of To our knowledge, our study is the first to clarify the mechanism CFSE in PE+CFSE+ microglia increased and the number of non- underlying hematoma absorption in patients with ICH; the results phagocytosed RBCs decreased (Fig. 6C–E). These results suggest of this study provide reliable experimental data that may con- that molecules released downstream of TLR4 signaling (such as tribute to the development of clinical treatments that promote TNF-a and IL-1b) can inhibit hematoma absorption following hematoma absorption in patients with ICH. ICH by downregulating CD36 expression. Two types of CD36 expression deficiency exist: patients with a type I deficiency have deficient CD36 expression in monocytes TAK-242 increases CD36 expression, promotes hematoma and , and patients with a type II deficiency have deficient absorption, and increases catalase expression expression in platelets only (28). The cells from patients with Our previous studies showed that TAK-242 could reduce secondary a type I CD36 deficiency have a reduced ability to phagocytize injury caused by ICH by inhibiting TLR4 signaling (14). To ob- oxidatively modified low-density ; these patients often serve the effect of TAK-242 on hematoma absorption, CD36 ex- experience complications such as insulin resistance, , pression levels were measured in microglia cocultured with RBCs and the aggravation of atherosclerosis. Additionally, the incidence in the presence of TAK-242, TAK-242 plus TNF-a, TAK-242 plus of coronary artery disease is three times higher in patients with IL-1b, or vehicle (solution for TAK-242) for 12 h. Western blot a type I CD36 deficiency than in normal individuals (17). CD36 analysis showed that CD36 expression levels were higher in the expression deficiencies are rarely encountered among European TAK-242 group than in the vehicle group, whereas the TAK-242– and American whites; however, .2% of Asians and Africans are promoted expression of CD36 was weakened by TNF-a and IL- afflicted with a CD36 deficiency, and the prevalence of this defi- 1b;TNF-a had an apparent effect in this process (Fig. 7A). ciency in Japan ranges from 3 to 11% (29, 30). We used a se- However, when the microglia were treated with TAK-242 only, quence-specific primer PCR assay to detect CD36 expression CD36 expression levels did not change significantly (data not deficiencies in ICH patients. Sequencing and Western blot anal- shown). The CD36 expression changes determined by flow yses identified 11 patients with a type I deficiency from among cytometry were consistent with the Western blot results (Fig. 7B). 199 patients (5.5%). The high prevalence of this deficiency in our Flow cytometry showed that the percentage of PE+CFSE+ patient population may be due to regional differences, small microglia in the TAK-242 group was increased (Fig. 7C); addi- sample sizes, and the fact that only patients with ICH were se- tionally, the average fluorescence intensity of CFSE in PE+CFSE+ lected. We found that type I CD36–deficient ICH patients had microglia was increased (Fig. 7D), and the number of RBCs hematomas that were less well absorbed, and they had signifi- remaining in the supernatant was decreased (Fig. 7E). These cantly more severe neurologic deficits than did patients with findings suggest that TAK-242 can upregulate CD36 expression in normal CD36 expression. These results suggest that CD36 pro- 5990 CD36-MEDIATED HEMATOMA ABSORPTION

FIGURE 5. TLR4 signaling downregulates CD36 expression and increases hematoma absorption. (A) Detection of CD36 expression in perihematomal tissues 3 d after the onset of ICH using Western blot. **p , 0.01 versus the WT group, n =6.(B) Detection of microglia CD36 expression using flow cytometry. **p , 0.01 versus the WT group, n =6.(C) Five days after the onset of ICH, the hematoma volume was smaller in MyD882/2 and TLR42/2 mice than in WT

mice. Measurement of hematoma volume using Image- Downloaded from Pro Plus (left panel) and hemoglobin detection (right panel) are shown. **p , 0.01 versus the WT group, n = 6. Detection of changes in the phagocytic capacity of microglia using flow cytometry is depicted. Microglia were stained with anti-mouse CD11b-PE, and RBCs were stained with CFSE. (D) Representative flow + cytometry plot (left panel) and the percentage of PE http://www.jimmunol.org/ CFSE+ microglia that had engulfed RBCs (right panel); (E) average fluorescence intensity of CFSE in PE+ CFSE+ microglia; (F) number of nonphagocytosed RBCs in the supernatant. **p , 0.01 versus the WT microglia group, ##p , 0.01 versus the groups with anti-CD36 Abs, n = 6 for all flow cytometry graphs. by guest on October 2, 2021

motes hematoma absorption after ICH and confirm that the rate at signaling can regulate the expression of CD36 in macrophages which the hematoma is absorbed positively correlated with patient that are very important in infection-related inflammatory responses prognosis. The destruction of the blood–brain barrier following (15). This suggests that the activation of TLR4 signaling following ICH can allow peripheral mononuclear macrophages to enter ICH may have a negative regulatory effect on CD36 expression. Our perihematomal tissues (16); therefore, it has been suggested that study showed three significant results. First, CD36 expression was the CD36+ peripheral mononuclear macrophages that enter into significantly upregulated in perihematomal tissues in TLR42/2 and the perihematomal tissues participate in hematoma absorption. MyD882/2 mice. Second, hematoma absorption was significantly Microglia are resident brain mononuclear macrophages; our data increased in TLR42/2 and MyD882/2 mice. The microglia of showed that CD36 was mainly expressed in microglia near the TLR42/2 and MyD882/2 mice engulfed more RBCs than did perihematomal tissues following ICH and that microglial CD36 WT microglia; however, after treatment with anti-CD36 Abs, the played an important role in enabling hematoma absorption. These phagocytic ability of TLR42/2 and MyD882/2 microglia was two types of cells are thought to play important roles in hematoma significantly decreased, suggesting that TLR4 signaling regulated absorption; however, further studies are required to determine hematoma absorption through CD36. Third, the inflammatory which cell type is more important. Additionally, because our study factors TNF-a and IL-1b that were induced by the activation of was conducted at a single center with a small sample size, our TLR4 signaling downregulated microglial CD36 expression and conclusions must be confirmed in multicenter studies with larger inhibited hematoma absorption. These results suggest that CD36 sample sizes. The relevant studies are currently in progress. mediates hematoma absorption; however, the activation of TLR4 We found that CD36 significantly promotes hematoma ab- signaling following ICH can activate NF-kB via the MyD88 sorption following ICH; however, the regulatory mechanism un- pathway, resulting in the production of large amounts of TNF-a derlying this process remains unclear. Studies have shown that and IL-1b (13). TNF-a and IL-1b can inhibit CD36 expression and inflammatory factors such as TNF-a that are induced by TLR slow hematoma absorption. Sansing et al. (16) reported that CD36 The Journal of Immunology 5991 Downloaded from http://www.jimmunol.org/

FIGURE 6. Effects of TNF-a, IL-1b, and IL-10 on CD36 expression and phagocytosis in microglia. (A) Detection of changes in microglial CD36 protein levels using Western blot. *p , 0.05 versus the vehicle , B group, **p 0.01 versus the vehicle group, n =6.() Detection of FIGURE 7. TAK-242 (TAK) increases CD36 expression and promotes , microglial CD36 expression using flow cytometry. **p 0.01 versus the hematoma absorption. (A) Detection of CD36 protein expression using vehicle group, n = 6. Detection of changes in the phagocytic ability of Western blot. **p , 0.01 versus the vehicle group, #p , 0.05 versus the microglia using flow cytometry. Microglia were stained with anti-mouse TAK group, ##p , 0.01 versus the TAK group, n =6.(B) Detection of by guest on October 2, 2021 CD11b-PE, and RBCs were stained with CFSE. (C) Representative flow , + + microglia CD36 expression using flow cytometry. **p 0.01 versus the cytometry plot (left panel) and the percentage of PE CFSE microglia that vehicle group, ##p , 0.01 versus the TAK group, n = 6. Detection of , had engulfed RBCs (right panel). **p 0.01 versus the vehicle group, changes in the phagocytic capacity of microglia using flow cytometry. D + + n =6.( ) Average fluorescence intensity of CFSE in PE CFSE Microglia were stained with anti-mouse CD11b-PE, and RBCs were , E microglia. **p 0.01 versus the vehicle group, n =6.( ) Number of stained with CFSE. (C) A representative flow cytometry plot (left panel) , nonphagocytosed RBCs in the supernatant. *p 0.05 versus the vehicle displaying the percentage of PE+CFSE+ microglia (right panel) that had , group, **p 0.01 versus the vehicle group, n =6. engulfed RBCs. **p , 0.01 versus the vehicle group, ##p , 0.01 versus the TAK group, n =6.(D) The average fluorescence intensity of CFSE in PE+CFSE+ microglia. **p , 0.01 versus the vehicle group, ##p , 0.01 expression was upregulated in the TLR4 knockout mice follow- versus the TAK group, n =6.(E) The number of nonphagocytosed RBCs in ## ing ICH, suggesting that TLR4 may have participated in the the supernatant. **p , 0.01 versus the vehicle group, p , 0.01 versus the F CD36 regulation, which was consistent with our results that TAK group, n =6.( ) Detection of microglial catalase expression using TLR4 regulated the CD36 expression in the ICH. However, recent real-time quantitative RT-PCR. The data are expressed as fold increases relative to the vehicle group. **p , 0.01, n =6.(G) The changes in H O research suggests that under the stimulation of oxidized low- 2 2 content in the supernatant were measured. The results are presented as fold density lipoprotein and amyloid-b, CD36 functions as a TLR4/ changes relative to vehicle group. **p , 0.01, n =6.(H) Changes in TLR6 coreceptor and participated in the early inflammatory hematoma volume in mice at 5 d after the onset of ICH. Measurement of mediators expression in atherosclerosis and Alzheimer disease hematoma volume using Image-Pro Plus (left panel) and detection of (31). The reasons for differing results may be related to using hemoglobin (right panel). **p , 0.01 versus the ICH plus vehicle group, different models, and CD36 may have different functions varying #p , 0.05 versus the ICH plus TAK plus TNF-a group, n =6. among diseases. Moreover, our results suggest that IL-10 can promote CD36 expression and enhance the ability of microglia to phagocytize RBCs; however, IL-10 levels were not obviously Our recent studies have shown that the TLR4 inhibitor TAK-242 increased 1 and 3 d after ICH (32), suggesting that the protective significantly relieves inflammatory injury after ICH and improves role of IL-10 during the acute phase of cerebral hemorrhage was neurologic deficits (14). The present study further showed that limited. Therefore, residual blood components activated TLR4 TAK-242 upregulated CD36 expression in microglia, increasing signaling and produced inflammatory injury, thus initiating an the phagocytic capacity of microglia and improving hematoma inflammatory cascade reaction and aggravating neurologic defi- absorption in ICH mice. However, simultaneous use of TNF-a and cits. The inhibition of the activation of TLR4 signaling could IL-1b could weaken the ability of TAK-242 to upregulate CD36 therefore inhibit inflammatory responses and promote hematoma expression. This finding suggests that the TAK-242–mediated absorption. mechanism underlying the relief of inflammatory injury in mice 5992 CD36-MEDIATED HEMATOMA ABSORPTION with ICH was associated with the promotion of hematoma ab- 13. Lin, S., Q. Yin, Q. Zhong, F. L. Lv, Y. Zhou, J. Q. Li, J. Z. Wang, B. Y. Su, and Q. W. Yang. 2012. Heme activates TLR4-mediated inflammatory injury via sorption. The specific neuroprotection induced by TAK-242 was MyD88/TRIF signaling pathway in intracerebral hemorrhage. J. Neuro- associated with the inhibition of TLR4 signaling and the upreg- inflammation 9: 46. ulation of CD36 expression. 14. Wang, Y. C., P. F. Wang, H. Fang, J. Chen, X. Y. Xiong, and Q. W. Yang. 2013. Toll-like receptor 4 antagonist attenuates intracerebral hemorrhage-induced Phagocytosis is essential for hematoma absorption. However, the brain injury. Stroke 44: 2545–2552. injury to perihematomal cells caused by inflammatory factors and 15. Zamora, C., E. Canto´, J. C. Nieto, M. Angels Ortiz, C. Juarez, and S. Vidal. oxygen-free radicals released during the phagocytosis of RBCs 2012. Functional consequences of CD36 downregulation by TLR signals. Cy- tokine 60: 257–265. requires further attention (2). Our results show that TAK-242 16. Sansing, L. H., T. H. Harris, F. A. Welsh, S. E. Kasner, C. A. Hunter, and promoted phagocytosis, increased catalase expression, and re- K. Kariko. 2011. Toll-like receptor 4 contributes to poor outcome after intra- cerebral hemorrhage. Ann. Neurol. 70: 646–656. duced H2O2 production. Therefore, the promotion of hematoma 17. Janabi, M., S. Yamashita, K. Hirano, N. Sakai, H. Hiraoka, K. Matsumoto, absorption by TAK-242 did not result in a concomitant increase in Z. Zhang, S. Nozaki, and Y. Matsuzawa. 2000. Oxidized LDL-induced NF-kB the production of free radicals or damage to perihematomal tis- activation and subsequent expression of proinflammatory are defective in -derived macrophages from CD36-deficient patients. Arterioscler. sues. This finding confirms that TAK-242 represents a potentially Thromb. Vasc. Biol. 20: 1953–1960. viable treatment option for patients with ICH. Because TLR4 18. Yuasa-Kawase, M., D. Masuda, T. Yamashita, R. Kawase, H. Nakaoka, plays an important role in the immune response, complete inhi- M. Inagaki, K. Nakatani, K. Tsubakio-Yamamoto, T. Ohama, A. Matsuyama, et al. 2012. Patients with CD36 deficiency are associated with enhanced ath- bition of TLR4 would not be appropriate for all scenarios. Our erosclerotic cardiovascular diseases. J. Atheroscler. Thromb. 19: 263–275. research moderately regulated TLR4 to restrain excessive in- 19. Kidwell, C. S., and M. Wintermark. 2008. Imaging of intracranial haemorrhage. Lancet Neurol. 7: 256–267. flammation; subsequent research regarding the regulation of the 20. Kazui, S., H. Naritomi, H. Yamamoto, T. Sawada, and T. Yamaguchi. 1996. TLR4 signaling pathway is under way. Enlargement of spontaneous intracerebral hemorrhage. Incidence and time course. Stroke 27: 1783–1787. Downloaded from 21. Kothari, R. U., T. Brott, J. P. Broderick, W. G. Barsan, L. R. Sauerbeck, Disclosures M. Zuccarello, and J. Khoury. 1996. The ABCs of measuring intracerebral The authors have no financial conflicts of interest. hemorrhage volumes. Stroke 27: 1304–1305. 22. Lyden, P. D., A. Shuaib, K. R. Lees, A. Davalos, S. M. Davis, H. C. Diener, J. C. Grotta, T. J. Ashwood, H. G. Hardemark, H. H. Svensson, et al; CHANT Trial Investigators. 2007. Safety and tolerability of NXY-059 for acute intrace- References rebral hemorrhage: the CHANT Trial. Stroke 38: 2262–2269.

1. Keep, R. F., Y. Hua, and G. Xi. 2012. Intracerebral haemorrhage: mechanisms of 23. Rac´, M. E., K. Safranow, and W. Poncyljusz. 2007. Molecular basis of human http://www.jimmunol.org/ injury and therapeutic targets. Lancet Neurol. 11: 720–731. CD36 gene mutations. Mol. Med. 13: 288–296. 2. Zhao, X., G. Sun, J. Zhang, R. Strong, W. Song, N. Gonzales, J. C. Grotta, and 24. Kashiwagi, H., Y. Tomiyama, S. Nozaki, T. Kiyoi, S. Tadokoro, K. Matsumoto, J. Aronowski. 2007. Hematoma resolution as a target for intracerebral hemor- S. Honda, S. Kosugi, Y. Kurata, and Y. Matsuzawa. 2001. Analyses of genetic rhage treatment: role for peroxisome proliferator-activated receptor g in abnormalities in type I CD36 deficiency in Japan: identification and cell bio- microglia/macrophages. Ann. Neurol. 61: 352–362. logical characterization of two novel mutations that cause CD36 deficiency in 3. Zhao, X., J. Grotta, N. Gonzales, and J. Aronowski. 2009. Hematoma resolution man. Hum. Genet. 108: 459–466. as a therapeutic target: the role of microglia/macrophages. Stroke 40(3, Suppl. 25. Yang, Q. W., F. L. Lu, Y. Zhou, L. Wang, Q. Zhong, S. Lin, J. Xiang, J. C. Li, 1): S92–S94. C. Q. Fang, and J. Z. Wang. 2011. HMBG1 mediates ischemia-reperfusion injury 4. Fang, H., P. F. Wang, Y. Zhou, Y. C. Wang, and Q. W. Yang. 2013. Toll-like by TRIF-adaptor independent Toll-like receptor 4 signaling. J. Cereb. Blood receptor 4 signaling in intracerebral hemorrhage-induced inflammation and in- Flow Metab. 31: 593–605. jury. J. Neuroinflammation 10: 27. 26. Loftspring, M. C., H. L. Johnson, R. Feng, A. J. Johnson, and J. F. Clark. 2011.

5. Nyquist, P. 2010. Management of acute intracranial and intraventricular hem- Unconjugated bilirubin contributes to early inflammation and edema after in- by guest on October 2, 2021 orrhage. Crit. Care Med. 38: 946–953. tracerebral hemorrhage. J. Cereb. Blood Flow Metab. 31: 1133–1142. 6. Husemann, J., J. D. Loike, R. Anankov, M. Febbraio, and S. C. Silverstein. 2002. 27. Mendelow, A. D., B. A. Gregson, E. N. Rowan, G. D. Murray, A. Gholkar, and Scavenger receptors in neurobiology and neuropathology: their role on microglia P. M. Mitchell; STICH II Investigators. 2013. Early surgery versus initial con- and other cells of the nervous system. Glia 40: 195–205. servative treatment in patients with spontaneous supratentorial lobar intracere- 7. Fadok, V. A., M. L. Warner, D. L. Bratton, and P. M. Henson. 1998. CD36 is bral haematomas (STICH II): a randomised trial. Lancet 382: 397–408. required for phagocytosis of apoptotic cells by human macrophages that use 28. Yamamoto, N., N. Akamatsu, H. Sakuraba, H. Yamazaki, and K. Tanoue. either a phosphatidylserine receptor or the vitronectin receptor (avb3). J. 1994. glycoprotein IV (CD36) deficiency is associated with the ab- Immunol. 161: 6250–6257. sence (type I) or the presence (type II) of glycoprotein IVon monocytes. Blood 8. McGilvray, I. D., L. Serghides, A. Kapus, O. D. Rotstein, and K. C. Kain. 2000. 83: 392–397. Nonopsonic monocyte/ phagocytosis of - 29. Aitman, T. J. 2001. CD36, insulin resistance, and coronary heart disease. Lancet parasitized erythrocytes: a role for CD36 in malarial clearance. Blood 96: 3231– 357: 651–652. 3240. 30. Yamamoto, N., H. Ikeda, N. N. Tandon, J. Herman, Y. Tomiyama, T. Mitani, 9. Febbraio, M., D. P. Hajjar, and R. L. Silverstein. 2001. CD36: a class B scav- S. Sekiguchi, R. Lipsky, U. Kralisz, and G. A. Jamieson. 1990. A platelet enger receptor involved in , atherosclerosis, inflammation, and membrane glycoprotein (GP) deficiency in healthy blood donors: Naka- platelets . J. Clin. Invest. 108: 785–791. lack detectable GPIV (CD36). Blood 76: 1698–1703. 10. Ren, Y., R. L. Silverstein, J. Allen, and J. Savill. 1995. CD36 gene transfer 31. Stewart, C. R., L. M. Stuart, K. Wilkinson, J. M. van Gils, J. Deng, A. Halle, confers capacity for phagocytosis of cells undergoing apoptosis. J. Exp. Med. K. J. Rayner, L. Boyer, R. Zhong, W. A. Frazier, et al. 2010. CD36 ligands 181: 1857–1862. promote sterile inflammation through assembly of a Toll-like receptor 4 and 6 11. Takeuchi, O., and S. Akira. 2010. Pattern recognition receptors and inflamma- heterodimer. Nat. Immunol. 11: 155–161. tion. Cell 140: 805–820. 32. Wasserman, J. K., X. Zhu, and L. C. Schlichter. 2007. Evolution of the in- 12. Okun, E., K. J. Griffioen, and M. P. Mattson. 2011. Toll-like receptor signaling in flammatory response in the brain following intracerebral hemorrhage and effects neural plasticity and disease. Trends Neurosci. 34: 269–281. of delayed minocycline treatment. Brain Res. 1180: 140–154. Supplementary TableⅠ Primers used in the CD36 gene mutant site identification and qPCR experiments Gene Primer Produce Size(bp) C268T (gene F: 5'-TATTCTGGCTGACTCAAGGC-3' 296 identification) R: 5'-ATGGTCAAGGTAAGAGTGTCTCA-3'

329-330del(gene F: 5'–TAAGACCCCTTCTCGTTAGTTT-3' 487 identification) R: 5'–CCAAATGACCATGCCTCC-3'

619-624ins(gene F: 5'-CATTTGAGTAACCAGTGATTGAGA-3' 338 identification) R: 5'-CAGAACAGGAGTTTCCAGAGC-3'

949ins(gene F: 5'–CTTGGCTATTGAGTTTTAGTATGTG-3' 576 identification) R: 5'–TGCCACCATTCTTTCTTCTG-3'

1228-1239del(gene F: 5'–GAGTCATTACAGGAACAAAATCAAA-3' 290 identification) R: 5'–TGGGTAATGGAAATACATATAGCTT-3'

CD36(qPCR) F: 5'- GCTGGATTAGTGGTTAGGAGTCA -3' 124 R: 5'- AGGAGAGGCGGGCATAGTA -3'

TNF-α(qPCR) F: 5'- CCACCATCAAGGACTCAAATG -3' 100 R 5'- GAGACAGAGGCAACCTGACC -3'

IL-1β(qPCR) F: 5'- TCAGCACCTCACAAGCAGAG -3' 104 R: 5'- GCCCATACTTTAGGAAGACACG -3'

IL-10(qPCR) F: 5'- GGGAAGAGAAACCAGGGAGA -3' 211 R: 5'- TGCTACAAAGGCAGACAAACA -3'

Catalase(qPCR) F:5'- GATACTCCAAGGCAAAGGTGTT -3' 111 R: 5'- GAGGGTCACGAACTGTGTCAG -3'

β-actin(qPCR) F:5'- GTGCTATGTTGCTCTAGACTTCG-3', 174 R:5'- ATGCCACAGGATTCCATACC -3' C268T:the C substitution T at 268 site; 329-330del：the deletion GC at 329-330 site; 619-624ins: the deletion ACTGCA and the insertion AAAC at 619-624 site;949ins: the insertion A at 949 site; 1228-1239del: the deletion ATTGTGCCTATT at 1228-1239 site.

1

Supplementary TableⅡ: Clinical, biochemical, and radiological characteristics by subjects CD36 Normal CD36 Deficiency P-value (n=11) (n=11) Age, yr 60.2(5) 61.3(6) NS Sex (M/F, %) 61.5 63.6 NS Time from onset to 7.5(4-12) 8(3-11) NS admission, hr History of vascular risk factors (%) Hypertension 76.9 81.8 NS 38.5 45.4 NS Smoking habit 30.7 27.3 NS (current) lipid metabolism 23.1 18.2 NS disorder Alcohol consumption 23.1 27.3 NS Prior with Lipid-lowering drugs 15.4 18.2 NS Platelet inhibitors 30.8 36.4 NS Antidiabetic drugs 38.5 36.4 NS Vital signs Systolic blood 172（45） 168（43） NS pressure, mmHg Diastolic blood 108（16） 102（15） NS pressure, mmHg Maximal SBP in 24 hr, 198(22) 192(26) NS mmHg Maximal DBP in 24 114(10) 109(18) NS hr, mmHg Body temperature, 36.7 (0.64) 36.4(0.50) NS ( C°) Glasgow scale at 13(12-16) 14(11-16) NS baseline NIHSS at baseline 17.5(1.87) 17.7(2.73) NS Neuroimaging findings ICH volume at 27.2(10.0) 30.1(12.0) NS baseline, cm3 Mass effect, % 46.2% 54.5 NS Laboratory parameters Serum glucose, mg/dL 132 (25) 127(33) NS Platelet count, 185(55) 194(26) NS ×1000/mmc

2

Leukocyte count, 8.4(0.8) 8.8(1.2) NS ×1000/mmc

Values are presented as proportions, mean (SD), or median (quartiles). DBP: diastolic blood pressure; SBP: systolic blood pressure; NIHSS: National Institute of Health Stroke Scale; mRS: modified Rankin scale; mmc: cubic millimeter.

3

Supplementary figure 1.

Supplementary figure 1 legends

A. Typical SSP-PCR images of CD36 deficiency screening. Arrows indicate deficiency of C268T in human CD36 gene. B. The western blot analysis the expression of CD36 in monocytes. 1,2: CD36-deficiency（Type I）; 3,4: CD36-normal. C. Coronal sections showing the selection of fields for the view of immunohistochemical observation and collection of cerebral tissues from the perihematomal region. D. Detection of CD36 expression in mouse perihematomal tissues after ICH using fluorescence immunohistochemistry; arrows indicate positive cells, Scale bar=80µm.

4