Intersection of FOXO- and RUNX1-Mediated Gene Expression

Home , Progesterone receptor

Intersection of FOXO- and RUNX1-mediated gene PNAS PLUS expression programs in single breast epithelial cells during morphogenesis and tumor progression

Lixin Wanga,1, Joan S. Bruggeb, and Kevin A. Janesa,1,2

aDepartment of Biomedical Engineering, University of Virginia, Charlottesville, VA 22908; and bDepartment of Cell Biology, Harvard Medical School, Boston, MA 02115

Edited by Yoshiaki Ito, Institute of Molecular and Cell Biology, Singapore, and accepted by the Editorial Board July 28, 2011 (received for review March 3, 2011) Gene expression networks are complicated by the assortment of be obtained with conventional oligonucleotide microarrays after regulatory factors that bind DNA and modulate transcription PCR-based amplification of cDNA from 10 microdissected cells combinatorially. Single-cell measurements can reveal biological (2, 22, 23). By surveying hundreds of cells overall, stochastic pro- mechanisms hidden by population averages, but their value has filing captures the most reproducible cell to cell expression het- not been fully explored in the context of mRNA regulation. Here, erogeneities in a cell population. Individual transcripts that are we adapted a single-cell expression profiling technique to exam- nonuniformly expressed are then organized by the pattern of their ine the gene expression program downstream of Forkhead box O expression fluctuations to reveal coordinated single-cell programs. (FOXO) transcription factors during 3D breast epithelial acinar mor- In this work, we report a detailed analysis centering around phogenesis. By analyzing patterns of mRNA fluctuations among one class of transcription factors—the FOXOs—whose expres- individual matrix-attached epithelial cells, we found that a subset sion was found to be strongly nonuniform in our initial study of FOXO target genes was jointly regulated by the transcription (2). FOXO proteins are a subgroup of the Forkhead family of factor Runt-related transcription factor 1 (RUNX1). Knockdown of transcriptional regulators that play important roles in cell cycle RUNX1 causes hyperproliferation and abnormal morphogenesis, arrest, stress responses, and cell death (24). All FOXO isoforms both of which require normal FOXO function. Down-regulating recognize a common (A/G)TAAA(T/C)A DNA consensus, which RUNX1 and FOXOs simultaneously causes widespread oxidative is frequently observed in the extended promoters of many genes stress, which arrests proliferation and restores normal acinar mor- (SI Appendix, Table S1) (25, 26). However, FOXOs are often phology. In hormone-negative breast cancers lacking human epi- not redundant, and isoform-specific functions have been widely HER2 fi fi dermal growth factor receptor 2 ( ) ampli cation, we nd that documented (27–29). FOXO transcriptional activity is regulated RUNX1 down-regulation is strongly associated with up-regulation both positively and negatively by phosphorylation and ubiquiti- of FOXO1, which may be required to support growth of RUNX1- nation (30–34). Although FOXOs predominantly function as tran- negative tumors. The coordinate function of these two tumor sup- scriptional activators, they may also act as repressors in certain pressors may provide a failsafe mechanism that inhibits cancer- SYSTEMS BIOLOGY contexts (35). Last, FOXOs can interact with at least a dozen progression. other transcription factors, resulting in altered binding specificity and transcriptional activity (SI Appendix, Table S2) (36). Thus, in heterogeneity | triple-negative | stochastic | systems biology many ways, FOXO proteins are an archetype for the complexity that lies between signal transduction and gene expression. enetically identical mammalian cells often display patterns Here, we asked whether a focused examination of endogenous – Gof gene protein expression that are profoundly different (1 FOXOs by stochastic profiling would yield insights into their 3). Cell to cell heterogeneity has been recognized in cancer for function at the network level. Instead of using constitutively nearly half a century (4, 5). However, only lately have heteroge- active FOXO alleles to homogenize signaling (SI Appendix, neous cell populations been exploited as a means for uncover- Table S3), we quantified fluctuations in FOXO expression and – ing new mechanisms of biological regulation (6 8). With recently activity that occur naturally during 3D organotypic culture of developed techniques that can interrogate single-cell states, we breast epithelial cells (2, 37). By mapping these fluctuations onto are now poised to embrace heterogeneity rather than average it – a panel of FOXO target genes, we discovered that the measured out (9 11). FOXO expression signature divides into two groups with distinct Nonuniformities emerge at the earliest steps of gene expression – single-cell patterns. One of these groups receives a key second (12 14). Therefore, measurements of mRNA expression hetero- input from another transcription factor, RUNX1, which is var- geneity may help to uncover new biology if combined with systems iably active. RUNX1 is required for the proper timing of pro- approaches for analysis (11). This possibility offers a particularly liferative suppression in 3D spheroids, and its stable knockdown rich opportunity for unraveling transcriptional networks, where results in abnormal hyperproliferative acinar structures. In- complex combinations of factors work together to mediate pro- terestingly, this phenotype requires native single-cell regulation grams of gene expression (15). Early pioneering studies initially focused on describing the fundamental kinetics and statistics of transcription in single cells (1, 12–14, 16–19). Now, an open question is how methods that provide single-cell information Author contributions: L.W., J.S.B., and K.A.J. designed research; L.W. and K.A.J. performed should be applied to help understand the coordination of tran- research; L.W., J.S.B., and K.A.J. analyzed data; and J.S.B. and K.A.J. wrote the paper. scriptional programs and their role in cell phenotype (20, 21). The authors declare no conflict of interest. For this purpose, we recently developed a technique called This article is a PNAS Direct Submission. Y.I. is a guest editor invited by the Editorial Board. stochastic profiling (2). Stochastic profiling does not attempt to 1L.W. and K.A.J. contributed equally to this work. quantify mRNA levels in single cells but instead, gleans single- 2To whom correspondence should be addressed. E-mail: [email protected]. cell information by analyzing the statistical fluctuations in 15–20 See Author Summary on page 16499. repeated measurements of 10 cells. The increased amount of This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. starting material allows high-quality, transcriptome-wide data to 1073/pnas.1103423108/-/DCSupplemental.

www.pnas.org/cgi/doi/10.1073/pnas.1103423108 PNAS | October 4, 2011 | vol. 108 | no. 40 | E803–E812 Downloaded by guest on September 29, 2021 of FOXO function to withstand the increased oxidative stress expressed was the transcription factor FOXO1. The pattern of caused by RUNX1 knockdown. Combined inhibition of RUNX1 single-cell FOXO1 expression correlated with many transcripts and FOXO leads to an acute state of oxidative stress that induces that had been previously linked to oxidative stress and proliferative proliferation arrest and restores normal 3D morphology. In a suppression, suggesting a coordinated cellular response. Because large study of estrogen receptor (ER)-, progesterone receptor FOXO family transcriptional activity is itself linked to oxidative (PR)-, and HER2-negative breast cancers, we find that reduced stress and proliferation arrest (38, 39), we chose to investigate the RUNX1 expression correlates with FOXO1 up-regulation, which interplay between the expression of FOXOs and FOXO-dependent presumably enables tumor progression. Our results illustrate target genes. how careful single-cell analysis of gene expression can reveal The MCF10A clone 5E (MCF10A-5E) used for 3D culture functional interactions within transcriptional networks that are expresses not only FOXO1 but also FOXO3 (SI Appendix, Fig. important for cancer-relevant cell phenotypes. S1), and we found that both FOXO proteins were heterogeneously expressed and localized in individual acini during mor- Results phogenesis (Fig. 1A). Together with the two FOXOs, we mon- Dissecting Single-Cell FOXO Coregulation by Stochastic Sampling. We itored time-dependent changes in the levels of 18 transcripts previously cataloged the transcriptional heterogeneities that during morphogenesis: eight genes were validated or reported emerge among individual matrix-attached breast epithelial cells FOXO targets (BTG1, CAV1, CDKN1A, FBXO32, SEMA3C, during acinar morphogenesis in a 3D culture model (2, 37). One SESN1, SOD2, and SOX4)(SI Appendix, Table S3), five genes gene that was predicted with high confidence to be nonuniformly were constitutively expressed (GAPDH, HINT1, PRDX6, S100A6,

AB) FOXO1 FOXO3 BTG1 CDKN1A FBXO32 SOD2 SESN1 CAV1 SEMA3C SOX4 10 FOXO1 FOXO3 1

-1 Validated FOXO target

d induction (log Reported FOXO target

Fol 4 6 8 1012 4 6 8 1012 4 6 8 1012 4 6 8 1012 4 6 8 1012 4 6 8 1012 4 6 8 1012 4 6 8 1012 4 6 8 1012 4 6 8 1012

E-cadherin DAPI ) PRDX6 HDPAG HINT1 S100A6 UBC CDKN1C KRT10 1BNCC BCL2L13 CCNI 10 1

-1 Loading controls

d induction (log Other

Fol 4 6 8 1012 4 6 8 1012 4 6 8 1012 4 6 8 1012 4 6 8 1012 4 6 8 1012 4 6 8 1012 4 6 8 1012 4 6 8 1012 4 6 8 1012 Day of morphogenesis

C D p E Log10 (homogeneously expressed) 0 -4 -8 -12 -16 CCNB1 CCNB1 3 KRT10 3 SOD2 Candidate SOD2 BCL2L13 heterogeneities KRT10 2 2 CCNI FBXO32 SOX4 SESN1 FOXO1 1 1 CDKN1C FOXO3 BTG1 CDKN1A CCNI 0 0 FOXO3 BCL2L13 FOXO1 CDKN1A -1 CAV1 -1 FBXO32 CAV1 UBC

change from geometric mean SOX4 2 -2 GAPDH -2 SEMA3C BTG1

Log False-discovery rate PRDX6 CDKN1C

-3 HINT1 Standard deviations from geometric mean -3 S100A6 SESN1 61 11 9 3412 14 7813 5618 71 12 1015 123456789101112131415161718 10-cell stochastic samplings 10-cell stochastic samplings

Fig. 1. Focused stochastic sampling of a FOXO expression dichotomy in 3D breast epithelial cultures. (A) Heterogeneous expression and localization of FOXO1 and FOXO3 proteins at day 10 of morphogenesis. Frozen sections were stained with the indicated antibodies and imaged by wide-field immunofluorescence. (Scale bar: 25 μm.) (B) Time-dependent induction of a FOXO gene panel during morphogenesis. MCF10A-5E cells were placed under morphogenesis conditions for the indicated times, and population-level mRNA measurements were performed by qPCR. Validated and reported FOXO target genes are shown in red and orange, respectively. Loading controls for qPCR normalization are shown in gray, and genes not previously implicated as FOXO targets are shown in black. Data are shown as the mean ± SEM of triplicate biological samples. (C) Stochastic sampling and qPCR profiling of the FOXO gene panel in matrix-attached cells at day 10 of morphogenesis. qPCR cycle thresholds for the indicated genes were mean-centered, scaled by their amplification efficiency, and clustered by Euclidean distance with average linkage. Samplings are numbered according to their organization in E.(D) Identification of candidate heterogeneities by stochastic sampling. Local gene neighborhoods were compared against a log-normal distribution with 30% coefficient of variation at a false discovery rate equal to 0.05 (yellow) as described (2). Note the clear distinction between genes predicted to be heterogeneously expressed (purple) and those genes whose fluctuations are consistent with background biological variation (gray). (E) Candidate coexpression groups organized by stochastic sampling. Sampling data from the candidate heterogeneities identified in D were scaled to unit log-normal variance and clustered by Euclidean distance with Ward’s linkage.

E804 | www.pnas.org/cgi/doi/10.1073/pnas.1103423108 Wang et al. Downloaded by guest on September 29, 2021 and UBC), two genes had nonuniform expression that correlated reveal more subtle nonuniformities and coregulatory patterns PNAS PLUS with FOXO1 at the single-cell level (BCL2L13 and CCNI) (2), that were overlooked by the global method (2). and three genes were positively (CDKN1C and KRT10) or neg- We exponentially amplified cDNA from 18 groups of 10 ma- atively (CCNB1) correlated with the time-dependent induction trix-attached cells and quantified expression fluctuations for the of many FOXO genes but have not been reported to be regu- 20-gene panel (Fig. 1C). SEMA3C (a reported FOXO target lated by FOXOs (Fig. 1B). We found that most FOXO target gene) (35) and all of the constitutively expressed genes showed genes were up-regulated together with FOXO1 and FOXO3, small sampling to sampling fluctuations that were not distin- peaking at around day 10, whereas others showed delayed ki- guishable from estimated biological variability (30% log-normal fi netics or were modestly down-regulated. This finding suggested coef cient of variation) (41). However, the remaining 14 genes fl that the gene panel could be induced by FOXOs and per- showed much larger uctuations than could be explained by haps, also modulated by other transcriptional inputs during 3D background variability, suggesting that these transcripts were D morphogenesis. heterogeneously expressed (Fig. 1 ). We next sought to isolate the genes in the panel that showed Next, we standardized the qPCR measurements of the candi- strong expression heterogeneities in matrix-attached cells at day date heterogeneities to have uniform variance and clustered B these genes based on the pattern of their fluctuations (Fig. 1E). 10 near the peak of presumed FOXO activity (Fig. 1 ). We SOD2 adopted a stochastic profiling approach that involves quantita- (a validated FOXO gene) (42, 43) and two of the genes with no reported connection to FOXO fell outside the major tive gene expression measurements in random samplings of 10 cluster that contained both FOXO transcripts along with nine microdissected cells (2). The global profiling method that origi- other genes. SOD2 expression is also controlled by NF-κB (44, nally identified FOXO1 is useful to broadly survey expression 45), and our previous global analysis had shown SOD2 to cluster heterogeneities in cell populations (2). However, it is less pow- at the single-cell level with several other NF-κB inducers and erful for a focused study, in which a modest collection of genes target genes (2), suggesting an explanation for its distinct fluc- must be analyzed with high sensitivity and quantitative accuracy. tuation pattern. Together, these findings reduced our 20-gene Therefore, the stochastic-sampling principle was adapted to panel to 11 transcripts with strong single-cell heterogeneities that gene expression measurements obtained by real-time quantita- were associated with FOXO expression and activity. tive PCR (qPCR). The sensitivity of qPCR allowed us to omit the secondary reamplification step required for oligonucleotide FOXO Genes Show Two Distinct Patterns of Expression in Single Cells. microarrays, and the resulting measurements were quantitatively To validate the proposed organization of the gene panel (Fig. accurate across dozens of genes with differing abundances (SI 1E), we developed a three-color RNA FISH procedure for Appendix, Fig. S2) (2). Combined with the superior dynamic quantifying the extent of coexpression between genes in single range of qPCR (40), we expected that these modifications would cells. We improved on two-color RNA FISH (2) by adding

A B

FBXO32 CAV1 BTG1 CAV1 SYSTEMS BIOLOGY

Fig. 2. Three-color RNA FISH reveals two groups of FOXO genes with decoupled single-cell expression patterns. (A–C) Multicolor RNA FISH provides a semiquantitative means for characterizing (A) strong, (B) weak, and (C)nocor- egulation of gene pairs within individual cells. Hapteny- Rsingle cell = 0.77 Rsingle cell = 0.47 lated riboprobes complementary to the indicated genes 1.4 1.4 loading loading were hybridized to day 10 frozen sections of MCF10-5E acini and imaged by wide-field immunofluorescence. CAV1 Fluorescence intensities for the individual genes were Acinus pseudocolored (Upper), and a mixture of three house- #1 #1 keeping genes was used as a loading control (Lower Left). #2 #2 Normalized #3 Normalized CAV1 #3 (Scale bar: 25 μm.) The loading-normalized fluorescence 0.7 0.7 intensities of each gene pair were correlated for single cells 0.6 1.4 0.6 1.4 Normalized FBXO32 Normalized BTG1 of three independent acini to quantify the extent of cor-

egulation (Rsingle cell; Lower Right). (D) FOXO genes are C E coregulated at the single-cell level within groups 1 and 2 D CCNB1 FOXO group 1 distribution FBXO32 CDKN1C 0.8 but not between groups. Pairwise single-cell correlations SOD2 Log-normal distribution (Rsc) measured by RNA FISH were analyzed as in A–C and KRT10 Group 1 compared with the dendrogram derived from stochastic FOXO FBXO32 Heavy sampling (Fig. 1E). The complete RNA FISH dataset is shown FOXO1 tails quantiles in SI Appendix, Fig. S3.(E and F) Single-cell distributions of p FOXO3 Log observed < 0.001 RNA FISH intensities from FOXO groups 1 and 2 are heavy n = 1856 CCNI –0.6 tailed, indicating two expression dichotomies. The data –4 4 from SI Appendix, Fig. S3 are shown as a quantile–quantile R = 0.17 BCL2L13 Standard normal quantiles 1.3 single cell plot displaying the observed RNA FISH quantiles (after log loading CDKN1A F FOXO group 2 distribution transformation) vs. the quantiles of a standard normal Group 1 CAV1 0.8 Log-normal distribution. If the data are consistent with a log-normal CDKN1C SOX4 distribution Group 2 Group 2 distribution, the quantiles will plot as a straight line, which BTG1 #1 was observed for the RNA FISH intensities for the homo- #2 CDKN1C Heavy geneously expressed gene UBC (SI Appendix, Fig. S3T).

#3 quantiles tails Normalized SESN p ﬁ 0.7 Log observed < 0.001 Both FOXO groups deviated signi cantly from a log-nor- 0.6 1.4 Strong (R > 0.6) n = 960 mal distribution because of more frequent than expected Low High Normalized FBXO32 sc –0.6 Weak (0.4 < R ≤ 0.6) ﬂ Rel. expression sc –4 4 observations of very high and very low RNA FISH uores- None (R ≤ 0.4) Standard normal quantiles sc cence (P < 0.001 by Jarque–Berra test).

Wang et al. PNAS | October 4, 2011 | vol. 108 | no. 40 | E805 Downloaded by guest on September 29, 2021 a third ﬂuorescence reading from an equal mixture of probes the clustering dendrogram, the boundary was consistent with the against GAPDH, HINT1, and PRDX6 (Methods). These three overall dendrogram organization (46). We also retroactively genes were uniformly expressed (Fig. 1 B and C) and collectively inspected the original dataset and identiﬁed multiple 10-cell provided an internal control, which could account for cell to cell samplings, which indicated that the two FOXO groups were not differences in probe penetration and total RNA levels. Nor- expressed concordantly (Fig. 1E, samplings 1, 9, and 13). By malizing the two-color RNA FISH data to the loading control compiling the measured RNA FISH intensities from thousands allowed us to distinguish pairs of genes with strong, weak, or no of single cells, we found that neither group conformed to a log- coexpression among matrix-attached cells (Fig. 2 A–C). normal distribution expected for background biological variation Using RNA FISH, we systematically evaluated the extent of (Fig. 2 E and F and SI Appendix, Fig. S3T) (47, 48). Genes from coexpression between gene pairs based on the organization the two FOXO groups instead showed increased frequencies of proposed by stochastic sampling (SI Appendix, Fig. S3 A–S). As high and low expression, which were presumably the cell states expected, many pairs within the large FOXO cluster were tightly detected by stochastic sampling. The results from stochastic correlated, and their coexpression with genes outside the cluster sampling and RNA FISH together suggested that the FOXO was weak or nonexistent (Fig. 2 A and D). More surprising was genes in the panel were subject to one of two modes of acute the clear partition of the FOXO cluster into two groups (Fig. single-cell regulation. 2D). Genes within each FOXO group were coexpressed, but between group correlations were measurably weaker or un- Control of FOXO Group 1 Genes by the Transcription Factor RUNX1. detectable (Fig. 2 B–D). Although the split between the two The simplest explanation for the distinction between FOXO FOXO groups did not exactly coincide with a branch point on groups 1 and 2 was that one group was receiving an inducible

A B C D

Group 1 discriminatory motif 25 2 High

RUNX2 20 Fig. 3. Heterogeneous RUNX1 signaling decouples FOXO 1 ﬁ bits TG groups 1 and 2. (A) MEME analysis identi es a discrimina- GG TGGTGGTG 15 CA 0 RUNX1 p-RUNX1 tory motif for group 1 genes that contains a consensus 2 10 binding site for RUNX family transcription factors; 5 kb upstream and 1 kb downstream of the transcription start 1 5 bits TGT GT Relative expression site for the genes in the two FOXO groups were analyzed C C G A C G

AA AA 0 C 0 n.d. Low for discriminative motif discovery by MEME (50). The DAPI DAPI RUNX consensus Copy number relative to TRANSFAC database was then searched for aligning con- p < 0.005 E-cadherin E-cadherin sensus sites by TOMTOM, with the motif P value shown for RUNX1RUNX2RUNX3 RUNX (89). A similarly informative motif was not identified for FOXO group 2. (B) Relative mRNA copy numbers of E F ChIP-validated binding sites FBXO32 RUNX family members in MCF10A-5E cells. Levels of en- FOXO RUNX1 FBXO32 dogenous RUNX1, RUNX2, and RUNX3 were compared FOXO1 4 4 FOXO1 4 2 with a universal genomic DNA standard and normalized to FOXO3 FOXO3 3 4 measured RUNX2 expression. HeLa cells, which express all CCNI 5 5 CCNI BCL2L13 4 5 RUNX family members, were used as a positive control. Group 1 CDKN1A 3 2 Data are shown as the mean ± SEM of triplicate biological BCL2L13 CAV1 3 3 n.s. p < 0.01 samples. n.d., not detected. (C and D) RUNX1 protein is CDKN1A SOX4 2 1 homogeneously expressed but heterogeneously phos- BTG1 8 1 CAV1 CDKN1C 3 1 phorylated at day 10 of morphogenesis. Frozen sections Group 2 SESN1 3 0 were stained with the indicated antibodies and imaged SOX4 by wide-field immunofluorescence. (Scale bar: 25 μm.) (E) BTG1 G ChIP-based survey of FOXO and RUNX1 promoter occu- CDKN1C shGFP shRUNX1 shGFP shRUNX1 pancy for the genes in the two FOXO groups. FOXO and RUNX1 RUNX2 RUNX1 consensus sites within 5 kb on either side of the SESN1 transcription start site are shown in green and yellow, re- qPCR amplicon FOXO consensus (RTAAAYA) tubulin tubulin spectively; 150- to 200-bp qPCR amplicons used in the study RUNX consensus (TGYGGT) 800 bp DNA fragment are shown flanked by 800-bp whiskers indicating the extent of chromatin shearing and thus, the region conceiv- H shGFP I shRUNX1 ably detected by each amplicon. (F) Summary of FOXO BCL2L13 CDKN1C BCL2L13 CDKN1C and RUNX binding sites validated by ChIP. Binding sites were considered validated if their median enrichment over a control IgG ChIP was twofold or more across four independent ChIPs. The number of binding sites between groups was compared by Wilcoxon rank sum test. Similar results were obtained when a more redundant RUNX consensus site, YGYGGTY (91), was used. (G) Knockdown of

Rsingle cell = 0.30 Rsingle cell = 0.62 endogenous RUNX1 without compensatory changes in 1.6 1.6 loading (0.13-0.45) loading (0.48-0.73) RUNX2. MCF10A-5E cells were infected with the indicated viral hairpins, and RUNX levels were determined by immunoblotting. β-tubulin was used as a loading control. (H and I) RUNX1 knockdown causes the two FOXO groups to BCL2L13 BCL2L13 Normalized Normalized become coregulated. Representative genes from FOXO Acinus Acinus groups 1 (BCL2L13) and 2 (CDKN1C) were analyzed by RNA #1 #2 #3 #1 #2 #3 0.6 0.6 FISH as described in Fig. 2 A–C. Single-cell correlations 0.7 1.4 0.7 1.4 Low High (R ) across three independent acini are shown with Normalized CDKN1C Normalized CDKN1C single cell Relative expression 90% conﬁdence intervals in parenthesis. (Scale bar: 20 μm.)

E806 | www.pnas.org/cgi/doi/10.1073/pnas.1103423108 Wang et al. Downloaded by guest on September 29, 2021 input from a transcription factor other than FOXO. The N ter- A B PNAS PLUS mini of FOXOs can bind various other transcription factors (24), Control shRUNX1 raising the possibility that a specific FOXO heterodimer might be important to one FOXO group. However, for no reported FOXO dimerization partner were we able to find a pattern of Control shRUNX1Runx1 addback consensus sites within 5 kb of the transcription start that could RUNX/ discriminate FOXO groups 1 and 2 (SI Appendix, Tables S1 and Runx1 S2) (49). This finding suggested that the second input might be tubulin pRb entirely independent of FOXO localization and activity, thereby DAPI explaining the uncoupled regulation of the two FOXO groups. C p < 0.001 D Runx1 addback To identify candidate inputs, we used the bioinformatics al- 55 65 gorithm multiple expectation maximization for motif elicitation * (MEME) to search for recurring sequence motifs in upstream promoter regions that discriminated the two FOXO groups (50). A guanine-thymine-rich motif was uncovered specifically among n.s. group 1 genes, which aligned with the TG(T/C)GGT consensus pRb Percent pRb positive Percent pRb positive Runx1 20 30 binding site for the RUNX family of transcription factors (Fig. DAPI A shRUNX1 – + – + shRUNX1 – + + 3 ). Other RUNX family members have been implicated in Roscovitine – – + + Runx1 – – + breast cancer as oncogenes (RUNX2) or tumor suppressors (RUNX3) (51–54). By contrast, RUNX1 has been mostly in- EF vestigated in hematopoietic cells (55), where it also acts as a Control shRUNX1 shRUNX1 – + – + tumor suppressor whose function is commonly disrupted in DN-FOXO1 – – + + RUNX1 leukemias (56, 57). Very recently, however, the genomic RUNX1 locus was shown to be lost in one malignant variant of the parental MCF10A line used for 3D culture in our study (58). This HA report also found that high-grade breast tumors have decreased tubulin pRb RUNX1 mRNA levels compared with lower-grade tumors, al- DAPI RUNX1 though the functional consequences of down-regulation G 60 DN-FOXO1 shRUNX1+DN-FOXO1 were not examined. Finally, multiple RUNX isoforms have been shown to interact with a constitutively active FOXO3 when overexpressed (59, 60). Using qPCR with a shared genomic RUNX1 DNA standard, we found that mRNA was expressed at p < 0.001 >15-fold higher levels compared with RUNX2, and RUNX3 was * absent (Fig. 3B). Taken together with our bioinformatics analy- Percent pRb positive 35 DN-FOXO1 sis, these studies suggested that RUNX1-mediated gene ex- shRUNX1 – + – + DN-FOXO1 negative DN-FOXO1 – – + +

pression might have a role in acinar morphogenesis and could SYSTEMS BIOLOGY possibly intersect with FOXOs. Fig. 4. RUNX1 knockdown causes proliferative and morphogenetic defects In our earlier global survey of expression heterogeneities that are blocked by homogenization of FOXO activity. (A) Add back of during 3D morphogenesis, we detected RUNX1 mRNA but did RUNX1 levels in shRUNX1 cells with murine RNAi-resistant Runx1. MCF10A- not predict that its expression would be nonuniform among 5E cells stably expressing murine Runx1 (lane 3) or vector control (lanes 1 and matrix-attached cells (2). At day 10 when stochastic sampling was 2) were infected with shGFP (lane 1) or shRUNX1 (lanes 2 and 3), and RUNX1/ β performed, we observed homogeneous expression of RUNX1 Runx1 levels were determined by immunoblotting. -tubulin was used as fl C fi fi a loading control. (B) RUNX1 knockdown delays growth arrest and causes protein by immuno uorescence (Fig. 3 ). This nding con rmed abnormally shaped acinar structures. MCF10A-5E acini were fixed at day 14, the prediction of our earlier survey and suggested that group 1 stained for pRb and HA-tagged murine Runx1 (Runx1), and analyzed by nonuniformities could not be caused by heterogeneities in confocal immunofluorescence. (C) Delayed growth arrest caused by RUNX1 RUNX1 expression. RUNX1 activity is also modulated post- knockdown is blocked by the CDK inhibitor roscovitine. MCF10A-5E acini translationally by proline-directed kinases such as ERK1/2 and were treated with 5 μM roscovitine on day 10, fixed at day 14, and stained cyclin-dependent kinases (CDKs) (61–63). We consequently for pRb. The percentage of acini with five or greater pRb-positive cells was stained for RUNX1 phosphorylated at S276 (p-RUNX1) and quantified in >200 acini per replicate. (D) pRb quantification of the RUNX1 found highly variable immunoreactivity among matrix-attached knockdown and add-back experiment described in B.(E) Overexpression of cells (Fig. 3D). p-RUNX1 levels were strongly reduced when acini a DN-FOXO1 in the context of RUNX1 knockdown. MCF10A-5E cells stably expressing an HA-tagged DN-FOXO1 (lanes 3 and 4) or vector control (lanes were treated with the CDK inhibitor roscovitine, but the staining 1 and 2) were infected with shRUNX1 (lanes 2 and 4) or shGFP control (lanes pattern was unaffected by treatment with U0126 to inhibit ERK1/ SI Appendix 1 and 3), and RUNX1 levels were determined by immunoblotting. Expression 2 activation ( , Fig. S5). Thus, cell to cell differences of the DN-FOXO1 was verified by HA expression, and β-tubulin was used as in p-RUNX1 downstream of CDKs (63) could conceivably pro- a loading control. (F and G) DN-FOXO1 restores normal acinar shape and vide the basis for a second heterogeneity that could decouple the growth arrest in acini derived from shRUNX1 cells. Acini from the MCF10A- group 1 FOXO genes in the panel. 5E lines described in E were fixed at day 14, stained for pRb and HA-tagged Although a RUNX1-containing motif discriminated FOXO DN-FOXO1, and analyzed by confocal immunofluorescence as described in B group 1 from group 2 (Fig. 3A), RUNX1 consensus sites were and C. Note that acini lacking DN-FOXO1 (orange) remain hyperproliferative ± located throughout the promoters of all genes in the panel (Fig. and are misshapen. For C, D, and G, data are shown as the mean SEM of quadruplicate 3D cultures at day 14. Significance of the interaction between 3E). To distinguish actual RUNX1 and FOXO binding events, fi shRUNX1 and DN-FOXO1 in F was determined by two-way ANOVA. (Scale we used ChIP with antibodies speci c for endogenous RUNX1, bar: B and F,25μm.) FOXO1, or FOXO3 (Methods). An important technical hurdle was to reconcile the typical sample requirements for ChIP (∼107 cells) with the typical 3D morphogenesis sample at day 10 protein gel that is used in 3D morphogenesis assays (37). Re- (∼250,000 cells). As a substitute for 3D culture, we seeded markably, we found that long-term 2D culture under these MCF10A-5E cells on tissue culture plastic overlaid with a diluted conditions mimicked the observed 3D gene expression kinetics concentration of the same reconstituted basement membrane for the FOXO gene panel (SI Appendix, Fig. S4). The overall

Wang et al. PNAS | October 4, 2011 | vol. 108 | no. 40 | E807 Downloaded by guest on September 29, 2021 FOXO expression program, therefore, did not require standard FOXO1 Protects Cells from Oxidative Stress Caused by RUNX1 Loss 3D culture explicitly and could be examined at the ChIP scale by and Permits Disruption of Epithelial Function. The observed FOXO 2D culture under these conditions. requirement for shRUNX1-mediated escape from proliferative For ChIP, we designed qPCR primers scanning nearly the en- suppression seems paradoxical, because FOXO itself can induce tire 5-kb promoter region of each gene after considering the size many growth arrest genes (38). However, other FOXO genes of the input chromatin fragments (∼800 bp) (Fig. 3E). Binding may be more important for proliferation in the context of sites were scored as ChIP-validated if their median enrichment RUNX1 knockdown. For example, FOXO also regulates a pro- from four independent ChIPs was at least twofold above a paired gram of genes that protect against oxidative stress (39), and if IgG control. The summary of the resulting 1,128 qPCR meas- RUNX1 knockdown were to cause oxidative stress, then pro- urements indicated a signiﬁcant enrichment for RUNX1 binding liferation of knockdown cells could be contingent on proper events in the promoters of group 1 genes compared with group 2 FOXO function. genes (P < 0.01 by Wilcoxon rank sum test) (Fig. 3F). Conversely, To examine the redox state of MCF10A-5E cells during FOXO binding was observed for all genes in the panel, and there morphogenesis, we stained live 3D cultures with the oxidation- was no discrimination between groups based on the total number sensitive dye, chloromethyl-2′,7′-dichloroﬂuorescein diacetate of binding sites. The heterogeneous activation of RUNX1 (Fig. (DCFDA). In early control cultures (day 6), we consistently ob- 3D) together with its selective promoter occupancy on group 1 served a fraction of acini whose matrix-attached cells stained genes (Fig. 3F) strongly supported RUNX1 as the second input heterogeneously for DCFDA, indicating nonuniform levels of to the FOXO gene panel. reactive oxygen species (ROS) (Fig. 5 A and B). This observation If RUNX1 activity is indeed critical for decoupling FOXO differs from an earlier report showing no DCFDA staining in groups 1 and 2, then removing RUNX1 should cause the two matrix-attached cells at this point during MCF10A morphogen- groups to become coexpressed in single cells. We tested this esis (65). We attribute the discrepancy to our use of the 5E clone hypothesis by stably knocking down RUNX1 and quantifying (2), which behaves somewhat differently in this context compared whether coexpression between the two FOXO groups was af- with the parental MCF10A line (SI Appendix, Fig. S9). Notably, fected. We validated a lentiviral shRNA that uniformly reduced RUNX1 protein without compensatory changes in RUNX2 levels (Fig. 3G and SI Appendix, Fig. S6) and generated 3D ac- ROS, d6 Heterogeneous Homogeneous inar structures with cells stably expressing shRUNX1. For two A Control shRUNX1 B

+ p DCFDA 50 25 < 0.0005 intergroup gene pairings that showed weak to no correlation in * DRAQ-5 p < control acini (BCL2L13–CDKN1C and CAV1–BTG1), we found 0.05 that single-cell coregulation increased significantly with RUNX1 * knockdown (P < 0.05 by Fisher z-transformed confidence inter- H I SI Appendix Percent DCFDA 0 vals) (Fig. 3 and and , Fig. S7). These data DCFDA shRUNX1 – + – + – + – + strongly support the conclusion that RUNX1 is the dominant RFP DN-FOXO1 – – + + – – + + second input that uncouples the single-cell expression of FOXO DN-FOXO1 shRUNX1+DN-FOXO1 No Trolox 50 µM Trolox C 70 n.s. genes as first detected by stochastic sampling. +

FOXO1 and RUNX1 Jointly Coordinate Proliferative Arrest In Breast p < 10-5

Percent Rb * Epithelial Acini. Aside from the perturbation of gene expression in 30 DCFDA FOXO groups 1 and 2, we did not observe any changes in pro- RFP- shRUNX1 – + – + – + – + DN-FOXO1 liferation, apoptosis, or polarity of MCF10A-5E acini with DN-FOXO1 – – + + – – + +

RUNX1 knockdown at day 10 of morphogenesis. By day 14, No Trolox 50 µM Trolox however, there was a clear distinction between shRUNX1 cells D Control shRUNX1 E Control shRUNX1 and controls. Whereas most control cultures had reduced proliferation by day 14 based on phospho-Rb (pRb) staining, acini derived from shRUNX1 cells were still actively proliferating (Fig. 4 A and B). Proliferative suppression was restored with roscovitine, implying that CDK activity was sustained in shRUNX1 acini pRb pRb C fi DAPI DAPI (Fig. 4 ). This phenotype was speci c to RUNX1, because add DN-FOXO1 shRUNX1+DN-FOXO1 DN-FOXO1 shRUNX1+DN-FOXO1 back of RNAi-resistant murine Runx1 restored proliferative suppression (Fig. 4D). Besides sustained proliferation, acini derived from shRUNX1 cells were also often larger and abnormally shaped by day 14 (Fig. 4B). This finding suggested an inappropriate coordination of proliferation and arrest in developing acini at the DN-FOXO1 single-cell level. DN-FOXO1 negative DN-FOXO1 Because RUNX1 down-regulation induced coordinate ex- Fig. 5. Dual inhibition of RUNX1–FOXO function causes oxidative stress that pression of the two FOXO groups (Fig. 3 H and I) as well as es- B D leads to proliferative suppression. (A and B) RUNX1 knockdown plus DN- cape from growth arrest (Fig. 4 and ), we asked whether FOXO1 synergistically increases global ROS levels in MCF10A-5E acini at day FOXO was necessary for the shRUNX1-induced hyperpro- 6. Cells expressing shRUNX1 or an RFP-tagged DN-FOXO1 (Inset, red) were liferative phenotype. To address this question, we coexpressed labeled with DCFDA (green) as described in Methods and counterstained shRUNX1 and a truncated FOXO1 that acts as a dominant with DRAQ-5 (blue) to label nuclei. The percentage of acini staining het- negative (Fig. 4E and SI Appendix, Fig. S8) (64). In the context of erogeneously or homogeneously for DCFDA on a cell by cell basis is shown in RUNX1 knockdown, dominant-negative FOXO1 (DN-FOXO1) B. The remaining acini were negative for DCFDA staining. (C–E) Treatment restored the normal proliferative suppression and shape of ma- with the antioxidant Trolox restores hyperproliferation in shRUNX1 + DN- F G FOXO1 cells. Acini from the MCF10A-5E lines described in Fig. 4E were fixed turing acini (Fig. 4 and ). Surprisingly, overexpression of DN- at day 14, stained for pRb and HA-tagged DN-FOXO1, and analyzed by FOXO1 alone had no effect on growth arrest or acinar mor- confocal immunofluorescence as described in Fig. 4 B and C. For B and C, data phology, suggesting that the genes induced by heterogeneous are shown as the mean ± SEM of quadruplicate 3D cultures at (B)day6or(C) FOXO signaling become critical only when RUNX1 function day 14. Significance of the interaction between shRUNX1 and DN-FOXO1 is impaired. was determined by two-way ANOVA. (Scale bar: A,20μm; D and E,25μm.)

E808 | www.pnas.org/cgi/doi/10.1073/pnas.1103423108 Wang et al. Downloaded by guest on September 29, 2021 however, both the 5E clone and parental line showed heteroge- A B PNAS PLUS neous DCFDA staining in matrix-attached cells at day 10 when Triple-negative breast cancers RUNX1 levels FOXO1 levels 3 they were proﬁled for heterogeneities (SI Appendix, Fig. S9). This 3 ﬁnding suggests that the timing of nonuniform ROS accumula- 90–100% 2 tion may be accelerated in the 5E clone, but the heterogeneity

itself is a property of 3D MCF10A culture. levels mRNA R = –0.4 1 In MCF10A-5E acini at day 6, we found that RUNX1 knock- 0 down or DN-FOXO1 individually did not affect the frequency of 0 RUNX1 * heterogeneous DCFDA-positive acini. However, shRUNX1

cells showed a noticeable increase in baseline ROS levels, and 0–10% from mean Std. dev. –1 the extent of cell to cell heterogeneity DN-FOXO1 cells was p –2 * < 0.005 clearly exaggerated. In striking contrast, combined expression of –3 Standardized 90–100% 0–10% 90–100% 0–10% shRUNX1 and DN-FOXO1 significantly increased the number –5 0 5 Standardized FOXO1 mRNA levels Measured RUNX1 percentile of acini that stained strongly and homogeneously for DCFDA (Fig. 5 A and B). This finding indicates that dual inhibition of Fig. 6. Low RUNX1 expression is associated with high FOXO1 expression in RUNX1 and FOXO1 synergistically causes widespread oxidative triple-negative breast cancer specimens. (A) RUNX1 and FOXO1 mRNA ex- stress during 3D morphogenesis in vitro. pression is anticorrelated in triple-negative breast cancers. Correlated probe Sublethal oxidative stress causes proliferative suppression in sets from the Gene Expression Omnibus accession no. GSE6861 dataset were many cell types, suggesting a mechanism for the observed 3D standardized as z scores and averaged to give the estimated relative levels of phenotype (Fig. 4 F and G) (66–68). To determine whether RUNX1 and FOXO1. The 10th and 90th percentiles of RUNX1 expression (dashed boxes) were further analyzed in B.(B) Tumors with the lowest ROS levels were important for growth inhibition in shRUNX1+ RUNX1 mRNA expression have the highest FOXO1 mRNA expression. Box DN-FOXO1 cells, we used the synthetic antioxidant Trolox. and whisker plots from the samples in the dashed boxes in A are shown with Prolonged 3D culture in Trolox had no effect on proliferation in notches to indicate 90% nonparametric confidence intervals. Significance control cultures at day 14 but eliminated suppression observed in for the increase in FOXO1 expression was determined by the Wilcoxon rank shRUNX1+DN-FOXO1 acini (Fig. 5 C–E). Thus, normal FOXO sum test. function is required to dampen elevated levels of ROS caused by RUNX1 knockdown. suppressors in endothelial and myeloid cells (56, 69) but converge Loss of RUNX1 Expression Correlates with FOXO1 Up-Regulation in during morphogenesis and tumor progression in breast epithelia. Human Breast Cancers. Both RUNX1 and FOXOs are known to Our results suggest an isoform-specific role for RUNX1 in tumor act as tumor suppressors in different contexts (56, 69). However, suppression, because others have shown that RUNX2 can col- our in vitro results suggested that loss of RUNX1 or FOXO1 in laborate with the MYC oncogene to promote tumorigenesis (75). breast cancer could be mutually exclusive, in that FOXO activity The connection discovered between FOXOs and RUNX1 was would be required to stabilize transformed cells with low RUNX1 made possible by an in depth fluctuation analysis of single-cell expression. To test this prediction, we retrospectively analyzed gene expression in a tissue-like context. This work illustrates how a high-quality microarray study that included ER-, PR-, and biological mechanisms can be revealed simply by observing SYSTEMS BIOLOGY HER2-negative breast cancers (Gene Expression Omnibus ac- complex molecular patterns in situations where spurious corre- cession no. GSE6861). This triple-negative subset enriches for lations are unlikely (76). basal-like cancers, which have a molecular expression profile that is similar to the MCF10A lineage (70, 71). We used FOXO1 High-Sensitivity Analysis of Single-Cell Expression Heterogeneity by mRNA to read out both FOXO1 levels and overall FOXO ac- Focused Stochastic Sampling. Combining the principle of stochastic tivity as a target gene (72, 73) and examined the relative levels of sampling with qPCR rather than microarrays was advantageous expression averaged across two distinct probe sets. The chosen for the FOXO gene panel, because it allowed higher-sensitivity study was uniquely reliable in its estimates of RUNX1 and detection of transcriptional heterogeneity. Although indispens- FOXO1 (R > 0.4 between probes for the same gene), possibly able for global analyses, microarrays tend to dampen expression because the microarrays used were explicitly optimized for differences compared with when the same samples are analyzed clinical specimens. by qPCR (40). Indeed, one-half of the genes scored as hetero- Across 89 triple-negative breast cancers, we found a signifi- geneous in this study were missed by our earlier microarray- cant anticorrelation between FOXO1 expression and RUNX1 based survey (2). All of these genes had been clearly detected on expression (Fig. 6A)(P < 0.0005, Student t test). The relation- the microarray platform and showed observable 10-cell fluctua- ship between FOXO1 and RUNX1 was notable, because negative tions. However, the magnitude of sampling to sampling variation correlations are, in general, less likely to be spurious and can was deemed insignificant when tested amid the thousands of often suggest functional connections (74). Among the 10% of other genes on the array. The improved sensitivity and reduced tumors with the highest and lowest expression of RUNX1,we false discovery of qPCR-based sampling make it an attractive observed significant differences in FOXO1 levels: low RUNX1 alternative to microarrays for a focused study. expression was associated with high FOXO1 expression and vice versa (Fig. 6B)(P < 0.005, Wilcoxon rank sum test). The strong Molecular and Functional Interactions Between FOXOs and RUNX1. anticorrelation and reciprocal differences between RUNX1 and During segmentation in Drosophila, the RUNX ortholog Runt FOXO1 were not observed in the subset of 71 breast cancers that interacts genetically with various transcriptional modulators to were not triple negative (SI Appendix, Fig. S10). Taking these activate or repress expression of pair-rule genes (77). The ge- clinical data together with our in vitro studies, we predict that netic interactions that we observed between FOXOs and FOXO1 expression and activity is critical for triple-negative RUNX1 raise the question of whether these transcription factors breast cancers with low RUNX1 expression. might interact at the molecular level. FOXO3 has been reported to bind to RUNX1 and a related family member at the BCL2L11 Discussion promoter (59, 60). However, these earlier studies overexpressed The results of this study point to an unanticipated coupling be- RUNX proteins together with a constitutively active FOXO3 tween gene expression programs mediated by FOXOs and mutant. Despite repeated attempts, we were unable to coim- RUNX1. These transcription factors act as standalone tumor munoprecipitate endogenous RUNX1 with endogenous FOXOs,

Wang et al. PNAS | October 4, 2011 | vol. 108 | no. 40 | E809 Downloaded by guest on September 29, 2021 even when using modified lysis conditions with chemical cross- GAAACTCGAGTTTCTGCCGATGTCTTCGAGGTTTTT, where the 21-mer se- linking and gentle detergents. Furthermore, among the qPCR quence targeting human RUNX1 is underlined. pLKO.1 puro and pLKO.1 amplicons with measurable enrichment in our ChIP experiments, shGFP puro (Addgene) have been described previously (87). Lentiviruses we found that only 33% were simultaneously enriched in anti- were prepared and used to infect MCF10A-5E cells by the standard approaches described in SI Appendix, SI Methods. FOXO ChIPs and anti-RUNX1 ChIPs. Of these amplicons, 75% had DNA binding sites for both FOXO and RUNX1, consistent Retroviral Overexpression. Retroviruses were prepared in 293T cells (ATCC) by with two separate binding events. Together, these observations double transfection of the pBabe construct together with pCL ampho suggest that a direct FOXO–RUNX1 interaction might occur (Addgene) according to standard procedures. Viral particles were collected at only when RUNX1 expression or FOXO activity is very high. 48 h and passed through a 0.45-μm filter before use. MCF10A-5E cells were Instead, we favor a mechanism in which FOXOs and RUNX1 infected as described in SI Appendix, SI Methods. converge on a common set of genes to promote transcription inde- pendently. Thousands of genes have tandem FOXO–RUNX1 Immunoblotting. MCF10A-5E cells expressing the indicated constructs were binding sites that are conserved across mammals (78, 79). Those lysed in radioimmunoprecipitation assay (RIPA) buffer (50 mM Tris, pH 8.0, sites with the closest spacing (<35 bp) are enriched for vari- 150 mM NaCl, 5 mM EDTA, 1% Nonidet P-40, 0.1% SDS, 0.5% sodium deoxycholate); 20–30 μg clarified extract were separated on an 8% or 10% ous gene ontologies associated with development or signaling SI Appendix SDS/PAGE gel and transferred to PVDF (Millipore). Membranes were blocked ( , Table S4). Secondary functional interactions are with 5% nonfat skim milk in Tris-buffered saline-Tween (TBS-T) (20 mM Tris, also likely to exist. For example, CDK-mediated phosphorylation pH 7.6, 150 mM NaCl, 0.1% Tween-20), washed one time in TBS-T, and in- of RUNX1 (SI Appendix, Fig. S5) would be subject to indirect cubated overnight at 4 °C in 5% BSA (Sigma) containing one of the fol- regulation through CDK inhibitors, such as CDKN1A and lowing primary antibodies: anti-AML1/RUNX1 (1:1,000; Cell Signaling), anti- CDKN1C. Transcription of these inhibitors may, in turn, depend RUNX1 (1:1,000; Abcam), anti-RUNX2 (1:1,000; MBL), or anti-HA (clone 3F10, on FOXOs and RUNX1 (Fig. 3F). Dual FOXO–RUNX1 co- 1:500; Roche). Membranes were washed three times for 5 min each in TBS-T ordination may be important in developmental contexts where and incubated for 1 h at room temperature in 5% nonfat skim milk in TBS-T rapid but precise expansion of cells is required, such as during containing HRP-conjugated goat anti-rabbit or goat anti-rat secondary an- tibody (1:5,000, Santa Cruz). Membranes were washed three times for 5 min 3D epithelial acinar morphogenesis. each in TBS-T and imaged by chemiluminescence on an LAS-3000 detection system (FujiFilm). Implications for Breast Cancer Progression and Therapy. The inverse FOXO1 RUNX1 relationship that we observed between and Frozen Sectioning, Laser Capture Microdissection, and Small-Sample mRNA levels in triple-negative breast tumors raises general questions Quantification. Embedding, sectioning, microdissection, and small-sample about oncogenesis and cancer therapy. First, why is loss of mRNA amplification were performed at day 10 of 3D morphogenesis exactly RUNX1 function so commonly associated with acute myeloid as described elsewhere (2). leukemia (AML) (80)? This finding would seem to contradict the codependency between RUNX1 and FOXOs proposed here, qPCR. qPCR was performed on amplified small-sample material or with pu- because FOXOs are absent or excluded from the nucleus in rified RNA as described elsewhere (2, 88). Primer sequences are available nearly all AML patients (81). Because ROS levels are high in on request. AML cells (82), one could speculate based on our studies that fl fl AML cells have adopted other mechanisms for tolerating oxi- Immuno uorescence. Immuno uorescence in frozen sections was performed as described elsewhere (2) using the following primary antibodies: FOXO1 dative stress. In support of this possibility, AML cells show (1:100 dilution; Cell Signaling), FOXO3 (1:200 dilution; Upstate), E-cadherin substantial up-regulation of superoxide dismutases (SODs), (1:500 dilution; BD Biosciences), AML1/RUNX1 (1:100 dilution; Cell Signaling), which neutralize ROS (83). Interestingly, our earlier data in 3D phospho-AML1/RUNX1 [S249 (S276 in the longer splice variant), 1:500 dilution; cultures suggest that the manganese SOD gene (SOD2) is pre- Cell Signaling], phospho-Rb (S807/811, 1:200 dilution; Cell Signaling and T821, dominantly controlled by NF-κB rather than FOXO (2), and 1:1,000 dilution; Epitomics), anti-HA (clone 3F10, 1:500 dilution; Roche), and AML cells often show constitutive NF-κB activation (84). The phospho-ERK1/2 (T202/Y204, 1:200 dilution; Cell Signaling). Immunofluores- tissue specificity of RUNX1 as a tumor suppressor may derive cence on coverslips was performed as described in SI Appendix, SI Methods. from the other aberrations in AML cells that allow them to Whole-mount immunofluorescence of day 14 acini was performed es- × withstand oxidative stress in the absence of FOXO activity. sentially as described previously (37), except that 1 Western Blocking Re- fl agent (Roche) was substituted for 10% goat serum in the primary block How then might this in uence therapy for breast cancers in solution and the secondary block was omitted. which RUNX1 loss depends on FOXO activity? We predict that supplementary antioxidants would be particularly detrimental, Multicolor RNA FISH. Multicolor RNA FISH was performed as described else- because they would relieve the FOXO requirement and facilitate where (2) with the addition of a mixture of Alexa 647-labeled probes tumor progression that would not otherwise occur (65). One (GAPDH, HINT1, and PRDX6 used in combination as a loading control) sup- unconventional strategy might be to try evoking an oxidative plemented to the hybridization mixture at a concentration of 200 ng/mL. To catastrophe by acutely disrupting FOXOs and possibly, NF-κB. prepare this probe mixture, aminoallyl-labeled riboprobes were first syn- Blocking endogenous antioxidant responses may be most effec- thesized with 80% aminoallyl-UTP (Ambion) and 20% unlabeled UTP as tive at forestalling aggressive tumors that are proliferating rap- described previously (2). Fluorescent labeling of aminoallyl-labeled ribop- idly, which is the case in breast cancers with triple-negative status robes was performed with Alexa 647 reactive dye (Invitrogen) as recom- mended by the manufacturer. After purification on a Purelink PCR column (85). Encouragingly, targeted methods for increasing ROS levels (Invitrogen), labeled riboprobes were ethanol-precipitated, resuspended in in solid tumors are already under development (86). RNase-free water to 0.2 μg/mL, and stored at −80 °C. By spectrophotometry, riboprobes were determined to contain 2–3 Alexa 647 dye molecules Methods per probe. Plasmids. pBabe DN-FOXO1-HA neo, pBabe RFP-DN-FOXO1-HA neo, and pBabe HA-Runx1-neo were constructed by PCR or subcloning with standard ChIP. MCF10A-5E cells were plated at 12,500 cells/cm2 in 15-cm dishes and approaches. Cloning details are available in SI Appendix, SI Methods. cultured in morphogenesis medium (assay medium + 2% matrigel + 5 ng/mL EGF) for 10 d according to 3D culture conditions (37). Cells were fixed for Cell Lines. The MCF10A-5E clone was previously reported (2) and was cultured 5 min at room temperature by adding formaldehyde to the culture medium to in 3D as described for MCF10A cells (37). a final concentration of 1% (wt/vol), which was later quenched for 5 min at room temperature with 1/20 volume of 2.5 M glycine. Cells were washed two Lentiviral RNAi. pLKO.1 shRUNX1 puro was obtained through the RNAi times in cold PBS, lysed in 300 μL lysis buffer [1% (wt/vol) SDS, 5 mM EDTA, Consortium and contained the hairpin CCGGCCTCGAAGACATCGGCA- 50 mM Tris·Cl, pH 8.0, 1× protease inhibitors], and transferred to a micro-

E810 | www.pnas.org/cgi/doi/10.1073/pnas.1103423108 Wang et al. Downloaded by guest on September 29, 2021 centrifuge tube. Lysates were incubated on ice for 10 min and then soni- positive, or homogeneously positive for DCFDA fluorescence; 100–200 acini PNAS PLUS cated at 4 °C on a Bioruptor (Diagenode) for six 8-min rounds of 25-s pulses were scored per replicate for four independent morphogenesis cultures. followed by 35-s intervals. After centrifugation at 12,000 × g for 20 min, the supernatant was collected, and 20 μL soluble chromatin were kept as the Bioinformatics Analysis. To identify discriminatory motifs between the two input fraction. Soluble chromatin was diluted 10-fold in dilution buffer (1% FOXO groups, 5 kb upstream and 1 kb downstream of the transcription start Triton X-100, 2 mM EDTA, 150 mM NaCl, 20 mM Tris·Cl, pH 8.0, 1× protease site of each gene were analyzed by using MEME (http://meme.nbcr.net/) (50) inhibitor) and then precleared by incubating 1 mL diluted chromatin with in discriminative mode. Enriched DNA motifs were then fed into TOMTOM protein A-Sepharose (50 μL 50% slurry in 10 mM Tris·Cl, pH 8.1, 1 mM EDTA) (89) to search the TRANSFAC database for similar transcription factor for 2 h at 4 °C. ChIP-grade anti-FOXO1 (Abcam), anti-FOXO3 (Abcam), anti- binding motifs. AML1/RUNX1 (Abcam), or an equivalent amount of normal rabbit IgG was For clinical bioinformatics, probe sets for FOXO1 (g9257221_3p_a_at added to the diluted chromatin and incubated overnight at 4 °C with agi- and Hs.170133.0.A1_3p_s_at) and RUNX1 (g1932819_3p_a_at and μ tation; 50 L protein A-Sepharose were added to the immune complexes and g1932819_3p_x_at) were extracted from the triple-negative breast cancer – incubated for 2 4 h at 4 °C. Sepharose beads were collected and washed samples in Gene Expression Omnibus accession no. GSE6861. Each probe set sequentially for 10 min each in RIPA (1×), RIPA plus 500 mM NaCl (3×), LiCl was standardized as a z score, and the mean z score across two probe sets buffer (0.25 M LiCl, 1% Nonidet P-40, 1% deoxycholate, 10 mM Tris·Cl, 1 mM was used to estimate the relative expression level per sample. EDTA; 2×), and Tris-EDTA buffer (2×). DNA from the beads and the input fraction was eluted by reversing methylene cross-links with 500 μL elution Statistical Analyses. Hypothesis testing for single-cell heterogeneities was buffer [0.5% (wt/vol) SDS, 200 mM NaCl, 10 mM Tris·Cl, 1 mM EDTA] at 65 °C performed by the χ2 goodness of fit test on the binned sampling data at overnight. Samples were treated with 100 μg/mL RNase for 30 min at 37 °C a false discovery rate of 5% as previously described (2). The RNA FISH data and 200 μg/mL proteinase K for 90 min at 50 °C, followed by extraction with were tested for log normality by log-transforming the normalized, median- phenol-chloroform. The aqueous fraction was ethanol-precipitated, washed scaled measurements and using the Jarque–Berra test, which is a χ2 test one time in 70% ethanol, air dried, and dissolved in nuclease-free water. qPCR with genome-specific primers was used to amplify the ChIP-enriched based on a weighted sum of statistical moments estimated from the distri- DNA. Primer sequences are available on request. bution (90). Pairwise testing of ChIP binding sites and differences in FOXO1 expression in triple-negative breast cancers were performed using the Wil- coxon rank sum test. Confidence intervals for R were calculated by ROS Imaging. At day 6 of 3D morphogenesis, acini were washed one time for 5 single cell the Fisher z transformation. Phenotypic interactions for the shRUNX1 + DN- min in PBS and incubated with 5 μM DCFDA (freshly prepared as a 1,000× FOXO1 experiments were examined by two-way ANOVA. The significance of stock in DMSO, Invitrogen) and 2.5 μM DRAQ5 (Cell Signaling) for 1 h at 37 °C. The acini were then washed one time for 5 min in PBS and fixed with 2% the anticorrelation between RUNX1 and FOXO1 expression in triple-negative breast cancers was evaluated by the t test after the following transformation: PFA for 20 min at room temperature. After three 5-min washes in PBS, slides sffiffiffiffiffiffiffiffiffiffiffiffiffiffi were mounted with Prolong antifade medium (Invitrogen) and sealed with − ρ ¼ ρ n 2 ; nail polish after curing. t 1 − ρ2

ρ ρ Image Segmentation and Quantification. Single cells from RNA FISH images where is the initial Pearson correlation of n samples and t is the trans- were segmented by hand based on wheat-germ agglutinin staining (DAPI formed value. All tests were performed at α = 0.05. channel). Traced image segments were then applied to the digoxigenin- and dinitrophenyl-labeled riboprobe stainings (FITC and Cy3 channels) as well as ACKNOWLEDGMENTS. We thank Deirdre O’Toole for help with the cloning the loading control staining (Cy5 channel). Mean fluorescence intensities per of the RNA FISH riboprobes, Silvia LaRue for cryosectioning, Laura Selfors for cell for each riboprobe were normalized to the mean fluorescence intensity assistance with the tumor sample bioinformatics, and Dr. Richard Iggo for fl comments on the microarray data from the European Organisation for Re- of the loading control for that cell. This normalized uorescence intensity SYSTEMS BIOLOGY search and Treatment of Cancer 10994 clinical trial (GSE6861). This work was was used as a relative measure of transcript abundance for quantifying supported by National Institutes of Health Grant 5-R01-CA105134 (to J.S.B.), single-cell coregulatory patterns of gene expression. National Institutes of Health Director’s New Innovator Award Program 1- Acini in whole-mount specimens were scored positive for pRb staining if DP2-OD006464 (to K.A.J.), the Mary Kay Ash Charitable Foundation (K.A.J.), the structure contained at least five pRb-positive cells. For ROS imaging, acini the Pew Scholars Program in the Biomedical Sciences (K.A.J.), and the David were scored based on whether they stained negative, heterogeneously and Lucile Packard Foundation (K.A.J.).

1. Levsky JM, Shenoy SM, Pezo RC, Singer RH (2002) Single-cell gene expression 16. Zenklusen D, Larson DR, Singer RH (2008) Single-RNA counting reveals alternative profiling. Science 297:836–840. modes of gene expression in yeast. Nat Struct Mol Biol 15:1263–1271. 2. Janes KA, Wang CC, Holmberg KJ, Cabral K, Brugge JS (2010) Identifying single-cell 17. Chubb JR, Trcek T, Shenoy SM, Singer RH (2006) Transcriptional pulsing of a molecular programs by stochastic profiling. Nat Methods 7:311–317. developmental gene. Curr Biol 16:1018–1025. 3. Singh DK, et al. (2010) Patterns of basal signaling heterogeneity can distinguish 18. Elf J, Li GW, Xie XS (2007) Probing transcription factor dynamics at the single- cellular populations with different drug sensitivities. Mol Syst Biol 6:369. molecule level in a living cell. Science 316:1191–1194. 4. Fidler IJ, Kripke ML (1977) Metastasis results from preexisting variant cells within 19. Janicki SM, et al. (2004) From silencing to gene expression: Real-time analysis in single – a malignant tumor. Science 197:893–895. cells. Cell 116:683 698. 5. Southam CM, Brunschwig A (1961) Quantitative studies of autotransplantation of 20. Gandhi SJ, Zenklusen D, Lionnet T, Singer RH (2011) Transcription of functionally – human cancer. Cancer 14:971–978. related constitutive genes is not coordinated. Nat Struct Mol Biol 18:27 34. 6. Loo LH, et al. (2009) Heterogeneity in the physiological states and pharmacological 21. Raj A, Rifkin SA, Andersen E, van Oudenaarden A (2010) Variability in gene expression underlies incomplete penetrance. Nature 463:913–918. responses of differentiating 3T3-L1 preadipocytes. J Cell Biol 187:375–384. 22. Iscove NN, et al. (2002) Representation is faithfully preserved in global cDNA 7. Sharma SV, et al. (2010) A chromatin-mediated reversible drug-tolerant state in amplified exponentially from sub-picogram quantities of mRNA. Nat Biotechnol 20: cancer cell subpopulations. Cell 141:69–80. 940–943. 8. Spencer SL, Gaudet S, Albeck JG, Burke JM, Sorger PK (2009) Non-genetic origins of 23. Emmert-Buck MR, et al. (1996) Laser capture microdissection. Science 274:998–1001. cell-to-cell variability in TRAIL-induced apoptosis. Nature 459:428–432. 24. Greer EL, Brunet A (2005) FOXO transcription factors at the interface between 9. Brock A, Chang H, Huang S (2009) Non-genetic heterogeneity—a mutation- longevity and tumor suppression. Oncogene 24:7410–7425. independent driving force for the somatic evolution of tumours. Nat Rev Genet 10: 25. Pierrou S, Hellqvist M, Samuelsson L, Enerbäck S, Carlsson P (1994) Cloning and – 336 342. characterization of seven human forkhead proteins: Binding site specificity and DNA 10. Niepel M, Spencer SL, Sorger PK (2009) Non-genetic cell-to-cell variability and the bending. EMBO J 13:5002–5012. – consequences for pharmacology. Curr Opin Chem Biol 13:556 561. 26. Xuan Z, Zhang MQ (2005) From worm to human: Bioinformatics approaches to 11. Altschuler SJ, Wu LF (2010) Cellular heterogeneity: Do differences make a difference? identify FOXO target genes. Mech Ageing Dev 126:209–215. – Cell 141:559 563. 27. Kwon ES, Narasimhan SD, Yen K, Tissenbaum HA (2010) A new DAF-16 isoform 12. Golding I, Paulsson J, Zawilski SM, Cox EC (2005) Real-time kinetics of gene activity in regulates longevity. Nature 466:498–502. individual bacteria. Cell 123:1025–1036. 28. Zhao Y, et al. (2010) Cytosolic FoxO1 is essential for the induction of autophagy and 13. Raj A, Peskin CS, Tranchina D, Vargas DY, Tyagi S (2006) Stochastic mRNA synthesis in tumour suppressor activity. Nat Cell Biol 12:665–675. mammalian cells. PLoS Biol 4:e309. 29. Hosaka T, et al. (2004) Disruption of forkhead transcription factor (FOXO) family 14. Yu J, Xiao J, Ren X, Lao K, Xie XS (2006) Probing gene expression in live cells, one members in mice reveals their functional diversification. Proc Natl Acad Sci USA 101: protein molecule at a time. Science 311:1600–1603. 2975–2980. 15. Komili S, Silver PA (2008) Coupling and coordination in gene expression processes: A 30. van der Horst A, et al. (2006) FOXO4 transcriptional activity is regulated by systems biology view. Nat Rev Genet 9:38–48. monoubiquitination and USP7/HAUSP. Nat Cell Biol 8:1064–1073.

Wang et al. PNAS | October 4, 2011 | vol. 108 | no. 40 | E811 Downloaded by guest on September 29, 2021 31. Huang H, et al. (2005) Skp2 inhibits FOXO1 in tumor suppression through ubiquitin- 61. Zhang Y, Biggs JR, Kraft AS (2004) Phorbol ester treatment of K562 cells regulates mediated degradation. Proc Natl Acad Sci USA 102:1649–1654. the transcriptional activity of AML1c through phosphorylation. J Biol Chem 279: 32. Plas DR, Thompson CB (2003) Akt activation promotes degradation of tuberin and 53116–53125. FOXO3a via the proteasome. J Biol Chem 278:12361–12366. 62. Tanaka T, et al. (1996) The extracellular signal-regulated kinase pathway phos- 33. Essers MA, et al. (2004) FOXO transcription factor activation by oxidative stress phorylates AML1, an acute myeloid leukemia gene product, and potentially regulates – mediated by the small GTPase Ral and JNK. EMBO J 23:4802 4812. its transactivation ability. Mol Cell Biol 16:3967–3979. 34. Brunet A, et al. (1999) Akt promotes cell survival by phosphorylating and inhibiting 63. Biggs JR, Peterson LF, Zhang Y, Kraft AS, Zhang DE (2006) AML1/RUNX1 phos- a Forkhead transcription factor. Cell 96:857–868. phorylation by cyclin-dependent kinases regulates the degradation of AML1/RUNX1 35. Ramaswamy S, Nakamura N, Sansal I, Bergeron L, Sellers WR (2002) A novel by the anaphase-promoting complex. Mol Cell Biol 26:7420–7429. mechanism of gene regulation and tumor suppression by the transcription factor 64. Nakae J, Kitamura T, Silver DL, Accili D (2001) The forkhead transcription factor Foxo1 FKHR. Cancer Cell 2:81–91. (Fkhr) confers insulin sensitivity onto glucose-6-phosphatase expression. J Clin Invest 36. van der Vos KE, Coffer PJ (2008) FOXO-binding partners: It takes two to tango. – Oncogene 27:2289–2299. 108:1359 1367. 37. Debnath J, Muthuswamy SK, Brugge JS (2003) Morphogenesis and oncogenesis of 65. Schafer ZT, et al. (2009) Antioxidant and oncogene rescue of metabolic defects caused – MCF-10A mammary epithelial acini grown in three-dimensional basement membrane by loss of matrix attachment. Nature 461:109 113. cultures. Methods 30:256–268. 66. Russo T, et al. (1995) A p53-independent pathway for activation of WAF1/CIP1 38. Ho KK, Myatt SS, Lam EW (2008) Many forks in the path: Cycling with FoxO. expression following oxidative stress. J Biol Chem 270:29386–29391. Oncogene 27:2300–2311. 67. Clopton DA, Saltman P (1995) Low-level oxidative stress causes cell-cycle specific arrest 39. Gross DN, van den Heuvel AP, Birnbaum MJ (2008) The role of FoxO in the regulation in cultured cells. Biochem Biophys Res Commun 210:189–196. of metabolism. Oncogene 27:2320–2336. 68. Wiese AG, Pacifici RE, Davies KJ (1995) Transient adaptation of oxidative stress in 40. Shi L, et al. (2006) The MicroArray Quality Control (MAQC) project shows inter- and mammalian cells. Arch Biochem Biophys 318:231–240. intraplatform reproducibility of gene expression measurements. Nat Biotechnol 24: 69. Paik JH, et al. (2007) FoxOs are lineage-restricted redundant tumor suppressors and 1151–1161. regulate endothelial cell homeostasis. Cell 128:309–323. 41. Newman JR, et al. (2006) Single-cell proteomic analysis of S. cerevisiae reveals the 70. Neve RM, et al. (2006) A collection of breast cancer cell lines for the study of architecture of biological noise. Nature 441:840–846. functionally distinct cancer subtypes. Cancer Cell 10:515–527. 42. Kops GJ, et al. (2002) Forkhead transcription factor FOXO3a protects quiescent cells 71. Rakha EA, Reis-Filho JS, Ellis IO (2008) Basal-like breast cancer: A critical review. J Clin – from oxidative stress. Nature 419:316 321. Oncol 26:2568–2581. 43. Tothova Z, et al. (2007) FoxOs are critical mediators of hematopoietic stem cell 72. Essaghir A, Dif N, Marbehant CY, Coffer PJ, Demoulin JB (2009) The transcription of – resistance to physiologic oxidative stress. Cell 128:325 339. FOXO genes is stimulated by FOXO3 and repressed by growth factors. J Biol Chem 44. Das KC, Lewis-Molock Y, White CW (1995) Thiol modulation of TNF alpha and IL-1 284:10334–10342. induced MnSOD gene expression and activation of NF-kappa B. Mol Cell Biochem 148: 73. Al-Mubarak B, Soriano FX, Hardingham GE (2009) Synaptic NMDAR activity 45–57. suppresses FOXO1 expression via a cis-acting FOXO binding site: FOXO1 is a FOXO 45. Karin M, Ben-Neriah Y (2000) Phosphorylation meets ubiquitination: The control of target gene. Channels (Austin) 3:233–238. NF-[kappa]B activity. Annu Rev Immunol 18:621–663. 74. Fox MD, et al. (2005) The human brain is intrinsically organized into dynamic, 46. Janes KA, Yaffe MB (2006) Data-driven modelling of signal-transduction networks. anticorrelated functional networks. Proc Natl Acad Sci USA 102:9673–9678. Nat Rev Mol Cell Biol 7:820–828. 75. Blyth K, et al. (2006) Runx2 and MYC collaborate in lymphoma development by 47. Bengtsson M, Ståhlberg A, Rorsman P, Kubista M (2005) Gene expression profiling in – single cells from the pancreatic islets of Langerhans reveals lognormal distribution of suppressing apoptotic and growth arrest pathways in vivo. Cancer Res 66:2195 2201. mRNA levels. Genome Res 15:1388–1392. 76. Hu K, Ji L, Applegate KT, Danuser G, Waterman-Storer CM (2007) Differential – 48. Warren L, Bryder D, Weissman IL, Quake SR (2006) Transcription factor profiling in transmission of actin motion within focal adhesions. Science 315:111 115. individual hematopoietic progenitors by digital RT-PCR. Proc Natl Acad Sci USA 103: 77. Wheeler JC, Shigesada K, Gergen JP, Ito Y (2000) Mechanisms of transcriptional 17807–17812. regulation by Runt domain proteins. Semin Cell Dev Biol 11:369–375. 49. Keshava Prasad TS, et al. (2009) Human Protein Reference Database—2009 update. 78. Ovcharenko I, Nobrega MA (2005) Identifying synonymous regulatory elements in Nucleic Acids Res 37:D767–D772. vertebrate genomes. Nucleic Acids Res 33:W403–W407. 50. Bailey TL, Elkan C (1994) Fitting a mixture model by expectation maximization to 79. Lin YC, et al. (2010) A global network of transcription factors, involving E2A, EBF1 and discover motifs in biopolymers. Proc Int Conf Intell Syst Mol Biol 2:28–36. Foxo1, that orchestrates B cell fate. Nat Immunol 11:635–643. 51. Lau QC, et al. (2006) RUNX3 is frequently inactivated by dual mechanisms of protein 80. Osato M (2004) Point mutations in the RUNX1/AML1 gene: Another actor in RUNX mislocalization and promoter hypermethylation in breast cancer. Cancer Res 66: leukemia. Oncogene 23:4284–4296. 6512–6520. 81. Chapuis N, et al. (2010) IκB kinase overcomes PI3K/Akt and ERK/MAPK to control 52. Pratap J, et al. (2006) Regulatory roles of Runx2 in metastatic tumor and cancer cell FOXO3a activity in acute myeloid leukemia. Blood 116:4240–4250. interactions with bone. Cancer Metastasis Rev 25:589–600. 82. Zhou FL, et al. (2010) Involvement of oxidative stress in the relapse of acute myeloid 53. Pratap J, et al. (2009) Ectopic runx2 expression in mammary epithelial cells disrupts leukemia. J Biol Chem 285:15010–15015. formation of normal acini structure: Implications for breast cancer progression. 83. Kato M, et al. (2003) Superoxide radical generation and Mn- and Cu-Zn superoxide – Cancer Res 69:6807 6814. dismutases activities in human leukemic cells. Hematol Oncol 21:11–16. 54. Shore P (2005) A role for Runx2 in normal mammary gland and breast cancer bone 84. Guzman ML, et al. (2001) Nuclear factor-kappaB is constitutively activated in primitive metastasis. J Cell Biochem 96:484–489. human acute myelogenous leukemia cells. Blood 98:2301–2307. 55. Okuda T, van Deursen J, Hiebert SW, Grosveld G, Downing JR (1996) AML1, the target 85. Schneider BP, et al. (2008) Triple-negative breast cancer: Risk factors to potential of multiple chromosomal translocations in human leukemia, is essential for normal targets. Clin Cancer Res 14:8010–8018. fetal liver hematopoiesis. Cell 84:321–330. 86. Fang J, Seki T, Maeda H (2009) Therapeutic strategies by modulating oxygen stress in 56. Silva FP, et al. (2003) Identification of RUNX1/AML1 as a classical tumor suppressor cancer and inflammation. Adv Drug Deliv Rev 61:290–302. gene. Oncogene 22:538–547. 87. Moffat J, et al. (2006) A lentiviral RNAi library for human and mouse genes applied to 57. Miyoshi H, et al. (1991) t(8;21) breakpoints on chromosome 21 in acute myeloid – leukemia are clustered within a limited region of a single gene, AML1. Proc Natl Acad an arrayed viral high-content screen. Cell 124:1283 1298. Sci USA 88:10431–10434. 88. Miller-Jensen K, Janes KA, Brugge JS, Lauffenburger DA (2007) Common effector fi – 58. Kadota M, et al. (2010) Delineating genetic alterations for tumor progression in the processing mediates cell-speci c responses to stimuli. Nature 448:604 608. MCF10A series of breast cancer cell lines. PLoS One 5:e9201. 89. Gupta S, Stamatoyannopoulos JA, Bailey TL, Noble WS (2007) Quantifying similarity 59. Yamamura Y, Lee WL, Inoue K, Ida H, Ito Y (2006) RUNX3 cooperates with FoxO3a to between motifs. Genome Biol 8:R24. induce apoptosis in gastric cancer cells. J Biol Chem 281:5267–5276. 90. Sheskin DJ (2007) Handbook of Parametric and Nonparametric Statistical Procedures 60. Wildey GM, Howe PH (2009) Runx1 is a co-activator with FOXO3 to mediate (Chapman & Hall, New York), 4th Ed. transforming growth factor beta (TGFbeta)-induced Bim transcription in hepatic cells. 91. Melnikova IN, Crute BE, Wang S, Speck NA (1993) Sequence specificity of the core- J Biol Chem 284:20227–20239. binding factor. J Virol 67:2408–2411.

E812 | www.pnas.org/cgi/doi/10.1073/pnas.1103423108 Wang et al. Downloaded by guest on September 29, 2021