Epigenetic Regulation of the Human P53 Gene Promoter by the CTCF Transcription Factor in Transformed Cell Lines

Oncogene (2010) 29, 2217–2227 & 2010 Macmillan Publishers Limited All rights reserved 0950-9232/10 $32.00 www.nature.com/onc ORIGINAL ARTICLE Epigenetic regulation of the human p53 gene promoter by the CTCF transcription factor in transformed cell lines

E Soto-Reyes and F Recillas-Targa

Instituto de Fisiologı´a Celular, Departamento de Gene´tica Molecular, Universidad Nacional Auto´noma de Me´xico, Me´xico D.F., Me´xico

Epigenetic silencing of tumor suppressor gene promoters cataloged as a low, intermediate or high CpG island has become a more frequent phenomenon in cancer than (Weber et al., 2007). High CpG islands have been linked previously anticipated. In this study we addressed the to housekeeping gene promoters that are normally mechanisms involved in the protection of the p53 tumor unmethylated, whereas low CpG islands are associated suppressor gene against epigenetic silencing in human with tissue-specific gene promoters that can be methy- transformed cell lines. We characterized a binding site for lated, apparently without affecting their regulatory the CCCTC-binding factor (CTCF) in the human p53 potential. This classification demands novel interpreta- gene promoter that contributes to its transcriptional tions depending on the nature of the CpG island, as a expression, and has the ability to maintain this regulatory distinct combination of epigenetic silencing mechanisms element in a local open chromatin configuration. In the can now be expected (Weber et al., 2007; Kondo et al., absence of CTCF we observe the incorporation of 2008; Meissner et al., 2008). For example, the high repressive histone marks, such as H3K9me3, H3K27me3 CpG island promoters are more frequently silenced and H4K20me3, in different sub-domains of the upstream by DNA methylation in abnormal conditions, even regulatory sequence. This evidence suggests that CTCF though histone repressive marks, such as H3 lysine 9 protects the p53 gene promoter against repressive histone trimethylation (H3K9me3), can also be incorporated marks. Notably, no apparent direct correlation between (McGarvey et al., 2006; Kondo et al.,2008).Incontrast, repression and DNA hypermethylation has been detected. intermediate and low CpG islands can be silenced Together, we present evidence supporting the relevant role by covalent histone modifications such as H3 lysine 27 of CTCF in the epigenetic regulation of tumor suppressor trimethylation (H3K27me3) (Kondo et al.,2008), genes and cancer. We propose that CTCF is a strategic and not by DNA methylation. Thus, H3K27me3 and component responsible for the maintenance and segrega- DNA methylation can exert an effect independently, and tion of epigenetic traits. their aberrant promoter targets seem to be defined by the Oncogene (2010) 29, 2217–2227; doi:10.1038/onc.2009.509; CpG content (Weber et al., 2007; Kondo et al.,2008). published online 25 January 2010 In this study we assessed the mechanisms of epigenetic silencing of the human p53 tumor suppressor gene in Keywords: tumor suppressor gene; CTCF; epigenetics; cancer cells. On the basis of recently established DNA methylation; p53 human promoter and histone definitions, we consider the human p53 promoter to covalent modifications correspond to an ICP island that is apparently not frequently silenced by DNA methylation (Pogribny et al., 2000; Kang et al., 2001; Amatya et al., 2005). We hypothesize that different classes of CpG islands Introduction might be regulated differently, not only at the level of DNA methylation and/or Polycomb family members From an epigenetic perspective, the study of tumor but also in terms of selective and differential use of suppressor genes has become notably relevant due to the transcription factors. In accordance, in this study we fact that deregulation of these genes is associated with address whether different kinds of CpG island promo- tumorigenic processes (Jones and Baylin, 2007). In ters are epigenetically regulated by alternative mechan- particular, 70% of human genes are linked to promoters isms (De La Rosa-Vela´zquez et al., 2007). We found that contain CpG islands that are the target of abnormal that the multifunctional CCCTC-binding site factor epigenetic events (Antequera, 2003; Issa, 2004). On the (CTCF) is involved in p53 epigenetic regulation by basis of recent proposals, the CpG island can be harboring an open chromatin configuration. Remark- ably, p53 gene promoter epigenetic silencing is not Correspondence: Dr F Recillas-Targa, Instituto de Fisiologıá Celular, dependent on DNA methylation. Instead, repressive Departamento de Gene´tica Molecular, Universidad Nacional Autoń- histone modifications are enriched and represent the oma de Me´xico, Apartado Postal 70-242, Mexico City, D.F., 04510, main cause of silencing in the presence of reduced levels Me´xico. E-mail: [email protected] of CTCF. We propose a model in which CTCF can Received 18 May 2009; revised 3 December 2009; accepted 13 December overcome epigenetic silencing not only by counter- 2009; published online 25 January 2010 acting DNA methylation (as in the case of Rb and other Epigenetic regulation of the p53 tumor suppressor gene E Soto-Reyes and F Recillas-Targa 2218 tumor suppressor gene promoters) but also by blocking Surprisingly, when we performed a sodium bisulfite the incorporation of repressive covalent histone conversion assay and sequencing using primers located modifications. in the core promoter we were not able to detect any DNA methylation (Figure 3a, site 4, and Supplementary Figure 1). On the basis of such unexpected result we decided to survey the DNA methylation status of a Results larger genomic area in T98G cells (Figure 3a). In all, seven DNA sub-fragments were analyzed using sodium Gene expression and epigenetic profiles of the human bisulfite conversion and sequencing, including upstream p53 gene in epithelial cell lines genomic sequences in relation to the p53 transcription p53 On the basis of predicted differences in gene start site and CpG-rich intronic sequences (Figure3a and expression in transformed epithelial cell lines, we Supplementary Figure 1). As positive controls we tested decided to explore these differences and correlate them two unrelated genomic sequences known to possess with their chromatin structural status with the aim of different levels of DNA methylation and in vitro finding a model system for p53 epigenetic silencing. We methylated genomic DNA (Supplementary Figure 2). first characterized the expression profile of the p53 gene One more time, this extended analysis did not allow the using reverse transcriptase PCR (RT–PCR) in SW480, identification of any DNA methylation. These results HeLa, Kb epithelial cell lines and in a primary culture of confirm on one side that p53 gene expression can be human fibroblasts obtained from neonatal foreskin reactivated using the DNA methylation inhibitor in (Figure 1a). We found that the colorectal adenocarci- glioma cell lines, and on the other, that the core noma SW480 cells show the highest levels of expression, promoter and surrounding sequences in a range of followed by HeLa and Kb cell lines, when compared 3 kb are hypomethylated. Therefore, these two glioma with the primary culture of normal fibroblasts. cell lines may represent a cancer cell context in which p53 To analyze the relationship between gene expres- p53 epigenetic silencing can be studied, and whether the sion and its epigenetic entourage, we next evaluated the presence of CTCF contributes to such a process can also DNA methylation status of the p53 gene promoter by be explored. the sodium bisulfite conversion assay (Figure 1b). No DNA methylation was detected at the p53 gene core promoter in any of the cell lines studied. We then In vitro and in vivo binding of CTCF to the upstream evaluated the patterns of histone covalent modifications region of the human p53 gene promoter over the p53 gene promoter. We found that the histone On the basis of our previous report suggesting that H3K4me2 modification and the polyacetylation of CTCF is able to counteract epigenetic silencing events in histone H3 and H4 are drastically enriched in SW480 the human Rb gene promoter, we decided to verify cells (Figure 1c). To corroborate the in situ chromatin whether such a mechanism is conserved in other tumor status of the promoter we performed a restriction suppressor genes, and particularly for p53 (De La Rosa- enzyme accessibility assay (Escamilla-Del-Arenal and Vela´zquez et al., 2007). We found a putative CTCF- Recillas-Targa, 2008) (Figure 1d). The results of these binding motif in a DNA fragment located at B700 bp experiments are in accordance with the previous assays, upstream of the p53 transcription start site (Figure 3a) and they show that the p53 gene promoter has an open (De La Rosa-Vela´zquez et al., 2007; Kim et al., 2007). chromatin conformation in the SW480 cell line, whereas We performed a gel shift analysis using total extracts the HeLa and Kb cell lines show a more compacted from HeLa cells to determine whether CTCF associates chromatin structure (Figure 1d). Taken together, these with this sequence in vitro (Figure 3b). We next carried results suggest that p53 gene expression regulation in out a chromatin immunoprecipitation (ChIP) assay normal and cancer cells can be influenced not only by using an antibody against human CTCF and by using ubiquitous or stage-specific transcription factors, but primers that flank the novel CTCF-binding sequence in also by the chromatin configuration of its promoter. several cell lines. As a negative amplification control we used the exon 27 of the Rb gene, as reported previously Epigenetic silencing model for the p53 gene promoter (De La Rosa-Vela´zquez et al., 2007). Interestingly, we in glioma cell lines observed enrichment of the CTCF immunoprecipitated We next decided to explore other cell types that have fraction in SW480 and HeLa cell lines, but not in the been reported to show DNA methylation over the p53 U87MG and T98G glioma cells lines in which p53 gene gene promoter (Amatya et al., 2005). We first evaluated expression is silenced (Figure 3c). We then repeated the p53 protein abundance by immunofluorescence in T98G ChIP assay by treating the T98G cells with and without and U87MG glioma cell lines (Figure 2a). The absence 5-aza-2’-deoxycytidine and found the reincorporation of of p53 in these two glioma cell lines was confirmed CTCF, consistent with p53 gene expression activation (Figures 2a and b). To evaluate their DNA methylation (Figure 3d). It is noteworthy that in this context CTCF status, cells were treated with the methylation inhibitor, binding does not seem to be methylation sensitive as the 5-aza-2’-deoxycytidine, for 72 h. Immunofluorescence, CpGs present on its binding sequence are not methy- western blotting and quantitative RT–PCR assays lated (Supplementary Figure 1, site 3). Therefore, CTCF showed a marginal reactivation of p53 expression binding perturbation by DNA methylation is probably (Figure 2), most notably in the treated T98G cells. guided by an indirect mechanism. Together, these results

Oncogene Epigenetic regulation of the p53 tumor suppressor gene E Soto-Reyes and F Recillas-Targa 2219

Input Input MBD2MeCP2acH3acH4H3K4me2H3K9me2H3K9me3H4K20me3BeadsIgG Input Input MBD2MeCP2acH3acH4 H3K4me2H3K9me2H3K9me3H4K20me3BeadsIgG

0.6 SW480HeLa Kb Fibroblasts p53 *

0.4 GAPDH ** SW480 Kb

relative expression 0.2 * p53

0 n=6 SW480 HeLa Kb Fibroblast ** HeLa Fibroblast 250 p53 promoter Myc/Mac/USF

AP1 YY1/NF1NFκB Pax 200 SW480

HeLa 150

Fibro 100 SW480 HeLa CpG unmethylated CpG methylated Kb Fold enrichment (IP/input) 50 Fibroblast SW480 HeLa Kb Ctrl Xba I Stu I Ctrl Xba I Stu I Ctrl Xba I Stu I Parental 0 EcoRI - XbaI Probe1 MBD2 acH3 H3K4me2 H3K9me3 Parental MeCP2 acH4 H3K9me2 H4K20me3 Probe2 EcoRI - XbaI Figure 1 Differential chromatin structure and gene expression in distinct epithelial cell lines. (a) Expression profile of the human p53 gene in: SW480, a human colon adenocarcinoma cell line; HeLa, a human cervical cancer cell line; Kb, a human epidermoid carcinoma cell line; and fibroblasts from primary cell culture of human fibroblasts isolated from neonatal foreskin. Duplex RT–PCR was performed and data normalized against GAPDH expression from six independent experiments. (b) DNA methylation status of the core p53 gene promoter in several cell lines. At least eight independent clones were sequenced. Fibro represents primary cell cultures of human neonatal foreskin. Positive controls of the sodium bisulfite transformation of genomic DNA are shown in Supplementary Figure 2. (c) Chromatin immunoprecipitation assay using antibodies that recognize active and repressive histone marks. Two methyl- CpG-binding protein antibodies are incorporated in the study (MBD2 and MeCP2). Semi-quantitative values were determined using radioactive duplex-PCR and a representative gel is shown for each cell type (upper panel). Relative enrichment of histone covalent modifications was plotted and the fold enrichment values of at least two independent immunoprecipitations are shown. Each duplex- PCR was performed in triplicate using primers from the p53 core promoter, and standard error is presented (lower panel). For normalization we used b-actin (*) for the close histone marks and MyoD for open histone marks (**). (d) In situ restriction enzyme accessibility assay. Probe 1 corresponds to an upper band probe and Probe 2 to the opposite strand. The XbaI site is roughly located at the center of the core promoter, and StuI restriction site is used as control for complete enzymatic digestion. This is a representative Southern blot from two independent assays. confirmed CTCF association with the human p53 immunofluorescence assays (data not shown). This promoter region and its dissociation in glioma cells. argues in favor of a local modification or displacement of CTCF by unexplored mechanisms (Figure 3d). Surprisingly, when the DNA methylation status of CTCF and its epigenetic role in glioma cell lines the upstream sequences was analyzed in U87MG and With the aim of further assessing the role of CTCF in T98G cells, we basically found no DNA methylation p53 gene regulation, we performed ChIP assays using (Figure 3a, sites 1–3, and data not shown). It is possible antibodies against active and repressive histone marks in that in glioma cell lines, other and more distal genomic glioma cell lines (Figure 4). We confirmed the dissocia- sequences that are DNA methylated can directly or tion of CTCF binding and the enrichment at the core indirectly be responsible for p53 silencing. Alternatively, promoter of the H4K20me3 and H3K27me3 repressive we do not discard that DNA methylation is affecting the marks (Figure 4). This result is not due to the depletion expression of a co-regulator of CTCF, such as the poly- of CTCF, as in all the cell lines tested, including glioma ADP-ribosyl polymerase 1 (Yu et al., 2004 and see cells, we observed CTCF nuclear localization by Discussion). As shown, histone modifications, in

Oncogene Epigenetic regulation of the p53 tumor suppressor gene E Soto-Reyes and F Recillas-Targa 2220 DAPI p53 Merge

SW480 SW480 T98G T98G+5-azadCU87MG U87MG+5-azadC p53

GAPDH

T98G 14 12 10 8 6 T98G 5-azadC 4 2 0 T98G T98G 5-azadC 1.4 U87MG

relative expression 1.2 1 p53 0.8 0.6 0.4 U87MG 0.2 5-azadC 0 U87MG U87MG 5-azadC Figure 2 DNA methylation of the p53 promoter region in glioma cell lines. (a) Immunoﬂuorescence against the p53 protein in T98G and U87MG glioma cells treated with the DNA methylation inhibitor, 5-aza-2’-deoxycytidine (5-azadC). For comparison, SW480 cells were incorporated in this study. (b) Western blot analysis of the glioma cells incubated or not with 5-azadC. (c) Expression proﬁles of the p53 gene in glioma cells lines treated with and without 5-azadC evaluated using quantitative RT–PCR.

particular H3K27me3, are contributing to p53 silencing cellular integrity (Supplementary Figure 3). We per- in glioma cells. These results are in agreement with formed immunofluorescence and western blot assays to findings by Issa and collaborator (Kondo et al., 2008), in corroborate the reduction of CTCF levels (Figure 5a). which histone H3K27me3 among other repressive We further evaluated the expression patterns of p53 histone marks may have a major role in epigenetic using RT–PCR, and of Rb for comparison, as well as silencing. their peptide products in the CTCF knockdown cell line (Figures 5b and c). We found a drastic reduction in the expression levels of both tumor suppressor genes. With Functional contribution of CTCF to human p53 the aim of obtaining a comparative overview of p53 gene promoter activity expression profiles in the context of the CTCF knock- To evaluate the functional contribution of CTCF to the down cells and cells treated with 5-aza-2’-deoxycytidine regulation of p53 gene expression, we generated a stable and the poly(ADP-ribosyl)-polymerase inhibitor 3- HeLa knockdown cell line against CTCF (HeLa-kd- aminobenzamide we determined the relative abundance CTCF) using a small hairpin RNA (Ishihara et al., of p53 mRNA (Figure 5d). We confirmed the lack of 2006). HeLa cells were chosen because they show an expression in HeLa knockdown and glioma cells. 3- intermediate level of expression, between SW480 cells Aminobenzamide was incorporated to the study based and primary normal fibroblasts (Figure 1a). In addition, on the fact that it is well established that CTCF activity HeLa cells were used in our previous analysis to show can be modulated by poly(ADP-ribosyl)ation (Yu et al., the epigenetic contribution of CTCF to human retino- 2004; Docquier et al., 2009). Importantly, we found that blastoma gene regulation (De La Rosa-Vela´zquez et al., poly(ADP-ribosyl)ation inhibition affects p53 gene 2007). Thus, CTCF knockdown will allow us to perform expression probably perturbing CTCF activity. These a comparative analysis between p53 and Rb gene data correlate with the notable absence of p53 and Rb expression profiles. As a control, we stably transfected proteins synthesis, and it shows the relevant role of HeLa cells with an empty vector and a scramble small CTCF in the regulation of two key tumor suppressor hairpin RNA that exerts no effect on either CTCF or genes.

Oncogene Epigenetic regulation of the p53 tumor suppressor gene E Soto-Reyes and F Recillas-Targa 2221

Figure 3 DNA methylation of the human p53 promoter region and in vitro and in vivo association of the CTCF-binding factor. (a) Scheme representation of the p53 and Wrap53 genomic domains showing the position of promoters, exons and CpG islands. The in vivo CTCF binding sites reported by University of California Santa Cruz (UCSC) Genome Browser are shown (black vertical bars; Barski et al., 2007). P1 represents the main p53 promoter and P2 symbolizes the alternative promoter. Below we incorporated a detailed scheme of the genomic organization of B3 kb upstream regulatory regions and first intron of the human p53 gene is also shown. Vertical lines represent CpG dinucleotides, and DNA methylation, determined by sodium bisulfite conversion in T98G glioma cells, using seven different sets of primers is shown. DNA methylation percentage of each site is plotted as a pie graph (n ¼ 8). Individual CpG sites are shown in the Supplementary Figure 1 and controls in Supplementary Figure 2. (b) A gel shift assay using total cell extracts from HeLa cells (HeLa TE) and a 75-bp labeled probe is shown. The specificity of the interaction was confirmed using the chicken cHS4 b-globin insulator CTCF-binding site and Rb-CTCF binding site as competitors and as non-specific competitor, the consensus sequence for the ubiquitous Sp1 transcription factor. The asterisk defines a nonspecific retarded complex. (c) ChIP assays were carried out on different cell lines, including the two glioma cell lines. As a negative amplification control we used primers from exon 27 of the human retinoblastoma gene (De La Rosa-Vela´zquez et al., 2007). (d) ChIP assays were performed on T98G glioma cells, untreated (T98G mock) and treated with 5-aza-2’-deoxycytidine (5-azadC). Linear range of amplification conditions was determined using the input material (not shown). Beads and an anti-IgG were included as negative controls.

Global effects of distinct histone marks in HeLa Local chromatin structural perturbations in HeLa cells and HeLa CTCF knockdown cells deficient in CTCF Recent evidence has uncovered CTCF as an important We next analyzed the genomic sequences surrounding factor involved in the maintenance of nuclear architec- the CTCF-binding site and the p53 core promoter in ture (Guelen et al., 2008; Williams and Flavell, 2008). terms of histone covalent modifications (Figure 6). Using immunofluorescence assays, we compared the Concerning the chromatin structure of the most up- nuclear distribution of different histone covalent mod- stream area, we found an enrichment of histone ifications in HeLa and HeLa-kd-CTCF cell lines H3K9me3 and H4K20me3 in HeLa knockdown cells, (Supplementary Figure 4). In HeLa cells we observed along with a notable diminishment of histone H3 an enrichment of the speckled-like pattern of H3K9me3, acetylation (Figure 6). Interestingly, when we focused H3K27me3 and H4K20me3 distribution that could in the core promoter, there were no changes in histone correspond to different heterochromatic genomic re- H3 acetylation, but there was a modest increase in gions (Schotta et al., 2004). However, in the CTCF H3K9me3, H4K20me3 and particularly H3K27me3 knockdown cellular context, we observed a clear repressive histone marks (Figure 6). At this point it is redistribution of heterochromatin foci. This general worth mentioning that the histone H3K27me3 mark is chromatin reorganization associated with CTCF reduc- exclusively found to be associated with the core p53 tion may directly or indirectly contribute to abnormal promoter in HeLa knockdown cells and T98G glioma downregulation of p53 and Rb by having a role in the cells (see Figure 4). loss of their higher-order organization inside the These results establish that the p53 promoter seems to nucleus. be organized into different sub-domains in which CTCF

Oncogene Epigenetic regulation of the p53 tumor suppressor gene E Soto-Reyes and F Recillas-Targa 2222

Figure 4 Epigenetic changes induced by CTCF absence from the human p53 promoter in glioma cell lines. ChIP assay showing the absence of CTCF over the p53 promoter in T98G and U87MG glioma cell lines. Horizontal dotted line shows the input value (normalized to 1).

seems to have a delimitating role, and that its absence It seems that CTCF binds to tumor suppressor gene induces the incorporation of differential repressive promoters, such as the p53 or Rb promoters, and more marks, such as the Polycomb-associated histone recently p16INK4a, contributing to their epigenetic integ- H3K27me3 mark, over the p53 core promoter. rity (De La Rosa-Vela´zquez et al., 2007; Witcher and Emerson, 2009). This evidence argues in favor of the association of other factors and co-factors that co- operate with CTCF in different contexts, for example, Discussion poly(ADP-ribose) polymerase 1, brahma-related gene 1 (Su et al., 2009) and chromatin remodeling factors, such In this study we analyzed epigenetic events leading to as histone acetyltransferases and histone methyltrans- the silencing of the p53 gene promoter. We propose that ferases, which counteract repressive and abnormal CTCF has a critical role in p53 gene promoter epigenetic epigenetic signals in a coordinated manner. In contrast, regulation shielding the promoter against the incorpora- the absence of one of these components, but mainly the tion of repressive covalent histone modifications and dissociation or absence of CTCF, induces a rapid that the mechanisms of silencing may be, at least in epigenetic silencing of gene promoters associated with part, dependent on the type of CpG island that is it. Several mechanisms for CTCF dissociation can be present. Thus, CTCF dissociation may induce dramatic envisioned. One possibility comes from CTCF abduc- and anomalous epigenetic defects leading to cancer tion in the cytoplasm as a cause of aberrant DNA development. hypermethylation of the human BRCA1 gene promoter A novel aspect that emerges from our study in in samples from patients with sporadic breast cancer epithelial transformed cell lines is that the human p53 (Butcher and Rodenhiser, 2007). An alternative comes promoter seems to be in a relatively closed chromatin from DNA methylation of a sub-group of CTCF- configuration in normal cells, and that a robust binding motifs that possess CpG dinucleotides that, chromatin structural relaxation is associated with p53 when methylated, cause CTCF dissociation (Recillas- gene expression in some tumor cell lines (Figure 1). This Targa et al., 2006; De La Rosa-Vela´zquez et al., 2007; observation may suggest that in normal conditions p53 Filippova, 2008). Otherwise, it has been postulated that gene expression is in some way negatively regulated phosphorylation and poly(ADP-ribosyl)ation are two through epigenetic mechanisms. Therefore, to respond post-translational CTCF modifications involved in its to different stimuli, on one hand, the p53 promoter functions (Yu et al., 2004; El-Kady and Klenova, 2005). needs to possess specific and efficient procedures to In agreement, poly(ADP-ribosyl)ation of CTCF has remodel its chromatin structure to enable transcription, been shown to have a role in structural and functional and on the other, as clearly established, it can be properties at the mouse p53 locus (Su et al., 2009). More regulated at the protein level (Vazquez et al., 2008; recently, loss of CTCF binding by aberrant poly(ADP- Vousden and Prives, 2009). ribosyl)ation is also responsible for the epigenetic

Oncogene Epigenetic regulation of the p53 tumor suppressor gene E Soto-Reyes and F Recillas-Targa 2223 DAPI CTCF Merge HeLa empty vector

HeLa HeLa-kd-CTCF HeLa-kd-CTCF CTCF

α-actin

DAPI p53 Merge HeLa

HeLa HeLa-kd-CTCF

HeLa-kd-CTCF p53

GAPDH

DAPIRb Merge HeLa

HeLa HeLa-kd-CTCF HeLa-kd-CTCF Rb

GAPDH

HeLa HeLa-kd-CTCFHeLa3-ABAU87MGT98G T98G + 5azadC

p53

β-actin

Figure 5 Effect of a CTCF knockdown on p53 and Rb expression in HeLa cells. (a) A small hairpin RNA that interferes with CTCF production was stably transfected in HeLa cells (HeLa-kd-CTCF) and its effect was evaluated by immunoﬂuorescence and western blot using a-actin antibody as loading control. (b) HeLa-kd-CTCF causes a severe effect on p53 gene expression and protein synthesis. (c) To a lesser extent CTCF knockdown causes a reduction in Rb gene expression. GAPDH primers were used for gene expression normalization. (d) Comparative determination of the relative abundance of p53 mRNA in different cell lines, including the treatment with the DNA methylation inhibitor (5-aza-2’-deoxycytidine (5-azadC)) and the poly(ADP-ribosyl)-polymerase inhibitor 3-aminobenzamide (3-ABA) at 8 mM for 48 h. In this experiment b-actin gene primers are used for gene expression normalization. silencing of the p16INK4a tumor suppressor gene (Witcher 3-aminobenzamide inhibitor and CTCF activity is and Emerson, 2009). These reports are in agreement perturbed (Figure 5d). with our ﬁnding in which p53 gene expression can On the basis of our previous data and the results in be altered when HeLa cells are treated with the this work, we propose a relationship between the nature

Oncogene Epigenetic regulation of the p53 tumor suppressor gene E Soto-Reyes and F Recillas-Targa 2224

Figure 6 Epigenetic consequences of the CTCF knockdown on the p53 promoter region. Comparative chromatin immunoprecipitation assay using antibodies against open and repressive histone marks. HeLa and HeLa knockdown cells for CTCF (HeLa-kd-CTCF) were compared. Horizontal dotted line shows the input value (normalized to 1). of a CpG island and the mechanism of silencing. For the transcript named Wrap53 (Mahmoudi et al., 2009). One retinoblastoma gene promoter, which corresponds to a of its isoforms, overlapping the first exon of p53,canform high CpG island, DNA methylation is mostly involved Wrap53/p53 hybrids and such association has been shown in promoter silencing. In contrast, for the p53 promoter to be critical for p53 normal regulation (Figure 3a). region formed by an intermediate CpG island, DNA Therefore, at this point we cannot discard that the dual methylation is not directly involved but instead location of CTCF and its potential contribution to sub- H3K9me3, H4K20me3 and H3K27me3 histone mod- domains formation can participate in the symbiotic ifications are the main (and probably not the only) regulation through transcriptional activation of p53 and epigenetic signals for promoter silencing. This can now Wrap53, and those repressive epigenetic mechanisms may be interpreted in the context of the recent chromatin be found ‘outside’ of this regulatory sub-domain. structural and functional characterization of the mouse An opposing player could be the paralog of CTCF, p53 locus (Su et al., 2009). In this work, the mouse p53 the brother of the regulator of imprinted sites (BORIS), locus was defined by two domains, in which the first one also known as CTCFL (Klenova et al., 2002; Jelinic is shielded by sequences bound in vivo by CTCF. This et al., 2006). BORIS has been shown to be primarily domain is further depleted in histone H1, it adopts a expressed as a testis-specific gene (Loukinov et al., three-dimensional organization and is enriched in open 2002). BORIS has also shown to be abnormally chromatin marks that extend to the promoter region expressed in a variety of cancers (Hong et al., 2005). and the first intron (Su et al., 2009). Sequence analysis In a recent study on the BAG-1 oncogene promoter, it reveals that the human p53 genomic organization is has been shown that CTCF binding to the BAG-1 gene similar to that of its mouse homolog, as it contains a promoter increases as the Dnmt genes are deleted, second CTCF-binding site in humans (data not shown). whereas BORIS binding increases when Dnmts are We suggest that the genomic organization of the human overexpressed (Sun et al., 2008). This opposing behavior p53 locus resembles its mouse homolog, and that the is further reflected by changes in H3K4me2 and aberrant DNA methylation is incorporated ‘outside’ of H3K9me2 ratio. Thus, we cannot discard the possibility the first domain, that is, upstream and downstream that the hypermethylation of the Rb promoter may relative to the CTCF-binding sites, and that such distal favor BORIS recruitment and CTCF displacement. In genomic regions contribute negatively to p53 expression the case of the p53 gene promoter, BORIS incorporation in glioma cell lines. An alternative interpretation of our seems unlikely based on the hypomethylation state of reactivation results in glioma cells can come from the the promoter. Conversely, it has been shown, at least indirect effect of DNA methylation over the expression in vitro, that BORIS DNA binding can be methylation of p53 regulators or genomic loci directly or indirectly independent only when CTCF is displaced (Nguyen linked to p53 gene regulation. This is an attractive et al., 2008). Hence, BORIS binding to p53 regulatory possibility that can even include antisense RNAs or region could also be envisioned, even in absence of microRNAs that merits to be explored (Le et al., 2009; DNA methylation, causing its epigenetic miss-regula- Mahmoudi et al., 2009). tion. The participation of BORIS in the epigenetic Another aspect that deserves to be mentioned is the silencing of tumor suppressor genes such as Rb and p53 presence of a newly described p53 natural antisense is a research topic that is currently under investigation.

Oncogene Epigenetic regulation of the p53 tumor suppressor gene E Soto-Reyes and F Recillas-Targa 2225 Finally, we envision a structural role for CTCF in tumor ChIP assay suppressor gene promoters. We do not believe that CTCF The ChIP assay was performed as previously reported (Valadez- is always located at the boundaries of promoter regions Graham et al., 2004) with 4 mg of antibodies against acH3, acH4 (Barski et al., 2007; Irizarry et al., 2009; Su et al., 2009), and H3K4me2 antibodies from Upstate (Billerica, MA, USA) and that its intergenic and/or intragenic distribution may and H3K9me3, H3K27me3 and H4K20me3 antibodies kindly provided by Thomas Jenuwein (Max-Planck Institute of also direct an optimal topology of each chromatin domain Immunobiology, Freiburg, Germany). Immunoprecipitated inside the cell nucleus. Therefore, it is attractive to consider DNA was analyzed by PCR using primers speciﬁc for the CTCF as having a key role in tumor suppressor gene human p53 gene promoter. For the semi-quantitative ChIP regulation, through mechanisms of action that probably assay, duplex-PCR was performed as described (Sawado et al., occur at multiple levels. 2001). Primer sequences used for ChIP assays are available by request. For the duplex PCR we used for normalization b-actin for the close histone marks and MyoD for open histone marks (Sawado et al., 2001). For each antibody, at least three Materials and methods independent ChIP experiments were performed.

Cell culture All the cell lines were grown in Dulbecco’s modified Eagle’s Restriction enzyme accessibility assay medium and RPMI-1640 media containing 10% fetal bovine For restriction endonuclease in situ nuclear digestion we serum and 1% penicillin/streptomycin (Invitrogen, Carlsbad, followed the protocol established previously (Escamilla-Del- CA, USA). The primary cell culture of fibroblasts was Arenal and Recillas-Targa, 2008). Data were analyzed using obtained from human neonatal foreskin tissue, and these cells Southern blotting with EcoRI genomic restriction enzyme were kindly provided by Luis Alonso Herrera (Instituto digestion. Two complementary probes were used (probes 1 and 2). Nacional de Cancerologıá, Me´xico, D.F., Me´xico), and they were grown in Dulbecco0s modified Eagle’s medium containing 15% fetal bovine serum, 1% non-essential amino acids and Electrophoretic mobility shift assay 1% penicillin/streptomycin (Invitrogen). The electrophoretic mobility shift assay and nuclear extract preparation were performed as previously described (Schreiber et al., 1989; Valadez-Graham et al., 2004). Competitions were RT–PCR carried out with 200 pmol of gel-purified unlabeled oligonu- For RT–PCR analysis, total cellular RNA was isolated with cleotides. The probes used (showing only the top strand) were Trizol reagent (Invitrogen). First-strand complementary DNA P53CTCF F: 50-CCTACGCTCCCCCTACCGAGTCCCGC was synthesized using 1 mg of RNA per reaction with AMV GGTAATTCTTAAAGCACCTGCACCGCCCCCCCGCCG reverse transcriptase and Oligo-dT (Promega, Madison, WI, CCTGCAGAGGGCG-30. FII (CTCF-binding site of the chick- USA). The primers used for RT–PCR reactions were: en b-globin cHS4 insulator), Rb-CTCF motif and Sp1 primers For p53: P53RTF2: 50-GGAAGACTCCAGTGGTAATC-30 were used as competitors (De La Rosa-Vela´zquez et al., 2007). and P53RTR2: 50-TTCAGGTGGCTGGAGTGAG-30. For human glyceraldehyde-3-phosphate dehydrogenase (GAPDH): GAPDHgF: 50-GGAGTCCACTGGCGTCTTC- DNA methylation analysis 30 and GAPDHgR: 50-GGTTCACACCCATGACGAAC-30. Bisulfite analysis was performed as previously described (Clark Rb RT–PCR was performed as described (De La Rosa- et al., 2006); the sequences of the primers used for amplifica- Vela´zquez et al., 2007). The GAPDH sequence was used as a tion of the bisulfite-treated promoter are shown in the normalizing control together with the p53 primers in a Supplementary Table 1. A second round of PCR amplification radioactive [a-32P]dCTP duplex PCR. The products were was performed using nested sets of primers (Kang et al., 2001). separated on a 5% polyacrylamide gel electrophoresis and The DNA from the second PCR was gel purified, and analyzed using Image Quant 5.2 Software. The p53 expression amplification products were cloned in pGEM-T Easy vector levels were evaluated by six independent experiments. (Promega) for sequencing using the T7 primer. A DNA fragment including 16 CpG dinucleotides of the p53 core promoter and neighboring genomic sequences (sites 1–7) were Western blotting amplified and sequenced in T98G cells and different cell lines Cells were harvested with lysis buffer containing 20 mM (for sites 3 and 4). As controls, DNA from normal human HEPES pH 7.9, 400 mM potassium chloride, 20% glycerol, lymphocytes was methylated in vitro by SssI methyltransferase, 2mM dithiothreitol and protease inhibitors, and freeze-thawed and used as a positive methylated DNA from an Alu repeat twice, and proteins were quantified using the Bradford and the promoter region of the FZD9 gene (see Supplementary assay (Bio-Rad, Philadelphia, PA, USA). After separation Table 1). Bisulfite genomic-sequencing primers were designed using sodium dodecyl sulfate–polyacrylamide gel electropho- using Methyl Primer Express Software (Applied Biosystems, resis, the resolved proteins were transferred to a polyvinylidene Foster City, CA, USA). fluoride membrane (Millipore, Milford, MA, USA). Mem- branes were blocked with 5% non-fat milk for 2 h and then incubated with the appropriate antibody overnight at 4 1C with Stable transfection of small hairpin RNA against CTCF anti-p53 (sc-6243) and anti-CTCF (sc-5916) (Santa Cruz in HeLa cells Biotechnology, Santa Cruz, CA, USA). After washing, the HeLa cells were stably transfected using LipofectAMINE 2000 blots were incubated for 1 h with an appropriate horseradish (Invitrogen) with an small hairpin RNA expression vector peroxidase-conjugated secondary antibody (Santa Cruz targeting CTCF (pCT1) kindly provided by Ko Ishihara Biotechnology), and washed and then detected with a (Institute of Molecular Embryology and Genetics, Kumamoto chemiluminescence substrate according to the manufacturer’s University, Japan) (Ishihara et al., 2006). HeLa cells were instructions (Pierce, Rockford, IL, USA). selected for 3 weeks in the presence of puromycin (1 mg/ml).

Oncogene Epigenetic regulation of the p53 tumor suppressor gene E Soto-Reyes and F Recillas-Targa 2226 Immunofluorescence assays Acknowledgements The cell lines grown on glass coverslips were fixed for 10 min in 1% formaldehyde in phosphate-buffered saline. Cells were We thank Inti Alberto de la Rosa-Vela´zquez, Catherine permeabilized with 0.1% Triton X-100 for 5 min, and succes- Farrell, Mayra Furlan-Magaril, Francisco Antequera, sively incubated with 100 mM of glycine. They were then Abrahan Hernańdez-Hernańdez, Martıń Escamilla-del- incubated with the appropriate primary and secondary anti- Arenal and Hećtor Rincoń-Arano for suggestions and bodies for 1 h at room temperature. They were next mounted constant scientific discussions. We are particularly indebted with Ultracruz for fluorescence with 4,6-diamidino-2-phenyl- with the excellent technical assistance of Georgina indole to visualize the nucleus (Santa Cruz Biotechnology, sc- Guerrero Avendanõ, members of the Fe´lix Recillas- 24941). Primary antibodies used were: anti-CTCF rabbit Targa laboratory, Dr JA Garcıá-Saıńz and the Instituto polyclonal (Valadez-Graham et al., 2004), anti-p53 goat poly- de Fisiologıá Celular, UNAM. We thank L Ongay, clonal, anti-Rb rabbit polyclonal (Santa Cruz Biotechnology) G Codiz and M Mora from the Unidad de Biologıá and the histone acH3 (Upstate), H3K9me3, H3K27me3 and Molecular, IFC-UNAM, for DNA sequencing. This work H4K20me3 antibodies. Primary antibodies bound to antigens was supported by the Direccioń General de Asuntos del were revealed using fluorescein isothiocyanate, or Texas red Personal Acade´mico-Universidad Nacional Autońoma de secondary antibodies. The slides were analyzed using epifluor- Me´xico (IN209403 and IN214407), Consejo Nacional de escence and optical sectioning in an Apotome microscope (Carl Ciencia y Tecnologıá (CONACyT: 42653-Q and 58767) and Zeiss, Thornwood, NY, USA) and using a laser scanning Fundacioń Miguel Alemań, AC. E Soto-Reyes is supported by microscope (Olympus, Center Valley, PA, USA). a PhD fellowship from CONACyT (181389) and Direccioń General de estudios de Posgrado-Universidad Nacional Conflict of interest Autońoma de Me´xico (DGEP). Additional support was provided by the PhD Graduate Program of Doctorado en The authors declare no conflict of interest. Ciencias Biome´dicas.

References

Amatya VJ, Naumann U, Weller M, Ohgaki H. (2005). TP53 Ishihara K, Oshimura M, Nakao M. (2006). CTCF-dependent promoter methylation in human gliomas. Acta Neuropathol 110: chromatin insulator is linked to epigenetic remodeling. Mol Cell 178–184. 23: 733–742. Antequera F. (2003). Structure, function and evolution of CpG island Irizarry RA, Ladd-Acosta C, Wen B, Wu Z, Montano C, Onyango P promoters. Cell Mol Life Sci 60: 1647–1658. et al. (2009). The human colon cancer methylome shows similar Barski A, Cuddapah S, Cui K, Roh TY, Schones DE, Wang Z et al. hypo- and hypermethylation at conserved tissue-specific CpG island (2007). High-resolution profiling of histone methylations in the shores. Nat Genet 41: 178–186. human genome. Cell 129: 823–837. Issa J-P. (2004). CpG island methylator phenotype in cancer. Nat Rev Butcher DT, Rodenhiser DI. (2007). Epigenetic inactivation of Cancer 4: 988–993. BRCA1 is associated with aberrant expression of CTCF and Jelinic P, Stehle JC, Shaw P. (2006). The testis-specific factor CTCFL DNA methyltransferase (DNMT3B) in some sporadic breast cooperates with the protein methyltransferase PRMT7 in H19 tumours. Eur J Cancer 43: 210–219. imprinting control region methylation. PLoS Biol 4: e355. Clark SJ, Statham A, Stirzaker C, Molloy PL, Frommer M. (2006). Jones PA, Baylin SB. (2007). The epigenomics of cancer. Cell 128: DNA methylation: bisulphite modification and analysis. Nat 683–692. Protocols 1: 2353–2364. Kang JH, Kim SJ, Noh DY, Park IA, Choe KJ, Yoo OJ et al. (2001). De La Rosa-Vela´zquez IA, Rincoń-Arano H, Benı´tez-Bribiesca L, Methylation in the p53 promoter is a supplementary route to breast Recillas-Targa F. (2007). Epigenetic regulation of the human carcinogenesis: correlation between CpG methylation in the p53 retinoblastoma tumor suppressor gene promoter by CTCF. Cancer promoter and the mutation of the p53 gene in the progression from Res 67: 2577–2585. ductal carcinoma in situ to invasive ductal carcinoma. Lab Invest 81: Docquier F, Kita GX, Farrar D, Jat P, O’Hare M, Chernukhin I et al. 573–579. (2009). Decreased poly(ADP-ribosyl)ation of CTCF, a transcription Kim TH, Abdullaev ZK, Smith AD, Ching KA, Loukinov DI, Green factor, is associated with breast cancer phenotype and cell RD et al. (2007). Analysis of the vertebrate insulator protein CTCF- proliferation. Clin Cancer Res 15: 5762–5771. binding sites in the human genome. Cell 128: 1231–1245. El-Kady A, Klenova E. (2005). Regulation of the transcription factor, Klenova EM, Morse III HC, Ohlsson R, Lobanenkov VV. (2002). The CTCF, by phosphorylation with protein kinase CK2. FEBS Lett novel BORIS+CTCF gene family is uniquely involved in the 579: 1424–1434. epigenetics of normal biology and cancer. Semin Cancer Biol 12: Escamilla-Del-Arenal M, Recillas-Targa F. (2008). GATA-1 modu- 399–414. lates the chromatin structure and activity of the chicken a-globin 30 Kondo Y, Shen L, Cheng AS, Ahmed S, Boumber Y, Charo C et al. enhancer. Mol Cell Biol 28: 575–586. (2008). Gene silencing in cancer by histone H3 lysine 27 Filippova G. (2008). Genetics and epigenetics of the multifunctional trimethylation independent of promoter DNA methylation. Nat protein CTCF. Curr Top Dev Biol 80: 337–360. Genet 40: 741–750. Guelen L, Pagie L, Brasset E, Meuleman W, Faza MB, Le MT, Teh C, Shyh-Chang N, Xie H, Zhou B, Korzh V et al. (2009). Talhout W et al. (2008). Domain organization of human chromo- MicroRNA-125b is a novel negative regulator of p53. Genes Dev 23: somes revealed by mapping of nuclear lamina interactions. Nature 862–876. 453: 948–951. Loukinov DI, Pugacheva E, Vatolin S, Pack SD, Moon H, Hong JA, Kang Y, Abdullaev Z, Flanagan PT, Pack SD, Chernukhin I et al. (2002). BORIS, a novel male germ-line protein Fischette MR et al. (2005). Reciprocal binding of CTCF and associated with epigenetic reprogramming events, shares the same BORIS to the NY-ESO-1 promoter coincides with derepression 11-zinc-finger domain with CTCF, the insulator protein involved in of this cancer-testis gene in lung cancer cells. Cancer Res 65: reading imprinting marks in the soma. Proc Natl Acad Sci USA 99: 7763–7774. 6806–6911.

Oncogene Epigenetic regulation of the p53 tumor suppressor gene E Soto-Reyes and F Recillas-Targa 2227 Mahmoudi S, Henriksson S, Corcoran M, Me´ndez-Vidal C, Wiman Schotta G, Lachner M, Sarma K, Ebert A, Sengupta R, Reuter G et al. KG, Farnebo M. (2009). Wrap53, a natural p53 antisense transcript (2004). A silencing pathway to induce H3-K9 and H4-K20 required for p53 induction upon DNA damage. Mol Cell 33: trimethylation at constitutive heterochromatin. Genes Dev 18: 462–471. 1251–1262. McGarvey KM, Fahrner JA, Greene E, Martens J, Jenuwein T, Baylin Su CH, Shann YJ, Hsu MT. (2009). p53 chromatin epigenetic domain SB. (2006). Silenced tumor suppressor genes reactivated by DNA organization and p53 transcription. Mol Cell Biol 29: 93–103. demethylation do not return to a fully euchromatic chromatin state. Sun L, Huang L, Nguyen P, Bisht KS, Bar-Sela G, Ho AS et al. (2008). Cancer Res 66: 3541–3549. DNA methyltransferase 1 and 3B activate BAG-1 expression via Meissner A, Mikkelsen TS, Gu H, Wernig M, Hanna J, Sivachenko A recruitment of CTCFL/BORIS and modulation of promoter histone et al. (2008). Genome-scale DNA methylation maps of pluripotent methylation. Cancer Res 68: 2726–2735. and differentiated cells. Nature 454: 766–770. Valadez-Graham V, Razin SV, Recillas-Targa F. (2004). CTCF- Nguyen P, Cui H, Bisht KS, Sun L, Patel K, Lee RS et al. (2008). dependent enhancer blockers at the upstream region of the chicken CTCFL/BORIS is a methylation-independent DNA-binding pro- a-globin gene domain. Nucleic Acids Res 32: 1354–1362. tein that preferentially binds to the paternal H19 differentially Vazquez A, Bond EE, Levine AJ, Bond GL. (2008). The genetics of the methylated region. Cancer Res 68: 5546–5551. p53 pathway, apoptosis and cancer therapy. Nat Rev Drug Discov 7: Pogribny IP, Pogribna M, Christman JK, James SJ. (2000). Single-site 979–987. methylation within the p53 promoter region reduces gene expression Vousden KH, Prives C. (2009). Blinded by the light: the growing in a reporter gene construct: possible in vivo relevance during complexity of p53. Cell 137: 413–431. tumorigenesis. Cancer Res 60: 588–594. Yu W, Ginjala V, Pant V, Chernukhin I, Whitehead J, Docquier F Recillas-Targa F, De La Rosa-Vela´zquez IA, Soto-Reyes E, Benı´tez- et al. (2004). Poly(ADP-ribosyl)ation regulates CTCF-dependent Bribiesca L. (2006). Epigenetic boundaries of tumour suppressor chromatin insulation. Nat Genet 36: 1105–1110. gene promoters: the CTCF connection and its role in carcinogenesis. Weber M, Hellmann I, Stadler MB, Ramos L, Pa¨a¨bo S, Rebhan M J Cell Mol Med 10: 554–568. et al. (2007). Distribution, silencing potential and evolutionary Sawado T, Igarashi K, Groudine M. (2001). Activation of b-major impact of promoter DNA methylation in the human genome. Nat globin gene transcription is associated with recruitment of NF-E2 to Genet 39: 457–466. the b-globin LCR and gene promoter. Proc Natl Acad Sci USA 98: Williams A, Flavell RA. (2008). The role of CTCF in regulating 10226–10231. nuclear organization. J Exp Med 205: 747–750. Schreiber E, Matthias P, Mu¨ller MM, Schaffner W. (1989). Rapid Witcher M, Emerson BM. (2009). Epigenetic silencing of the p16INK4a detection of octamer binding proteins with ‘mini extracts’, prepared tumor suppressor is associated with loss of CTCF binding and a from a small number of cells. Nucl Acids Res 17: 6419. chromatin boundary. Mol Cell 34: 271–284.

Supplementary Information accompanies the paper on the Oncogene website (http://www.nature.com/onc)

Oncogene