Research Article Future For reprint orders, please contact [email protected] Medicinal

7 Chemistry Research Article 2015-05-28 Organogermanium compound, Ge-132, forms complexes with adrenaline, ATP and other physiological cis-diol compounds

Future Med. Chem. Background: In mammals, adrenaline and ATP are life-essential vicinal diol and cis-diol Takashi Nakamura*,1, functional groups. Here, we show that interactions between a safe organogermanium Yasuhiro Shimada1,2, compound and these cis-diol compounds have the potential to regulate physiological Tomoya Takeda1, 1 functions. In addition, we represent a possible new druggable target for controlling Katsuyuki Sato , Mitsuo Akiba3 the action of cis-diol compounds. Results: We analyzed a single crystal structure of & Haruhiko Fukaya3 organogermanium 3-(trihydroxygermyl)propanoic acid (THGPA), a hydrolysate of 1Asai Germanium Research Institute Co., safe Ge-132, in complex with catecholamine (adrenaline and noradrenaline), and Ltd. Suzuranoka, Hakodate, Hokkaido evaluated the affinity between severalcis -diol compounds and THGPA by NMR. 042-0958, Japan An in vitro study using normal human epidermal keratinocytes was performed to 2The United Graduate School of investigate the inhibition of cis-diol compound-stimulated receptors by THGPA. At Agricultural Science, Iwate University, Morioka, Iwate 020-8550, Japan high concentration, THGPA inhibited the calcium influx caused by adrenaline and 3Tokyo University of Pharmacy & Life ATP. Conclusion: This study demonstrates that THGPA can modify cis-diol-mediated Sciences, Horinouchi, Hachioji, Tokyo cell-to-cell signaling. 192-0392, Japan *Author for correspondence: Tel.: +81 138 32 0032 The element germanium belongs to the matory, antiosteoporosis and antihyperten- Fax: +81 138 31 0132 group 14 carbon family and generally exhib- sive effects, among others [5–10]. Our group [email protected] its 4 covalent bonds when incorporated into previously revealed that Ge-132 induces chemical compounds. Germanium is a met- antioxidant production and promotes heme alloid and can act as a semiconductor. The synthesis [11,12]. Ge-132 was developed for

inorganic germanium compound GeO2 medical use and has undergone multiple exhibits an erythropoietic effect, as reported clinical evaluations. However, more recently, by Hammett and Nowrey [1] and Ham- it has been categorized as a food supplement mett et al. [2] in 1922. However, inorganic in Japan. Thus, Ge-132 is now mainly used germanium can be hazardous. In the 1990s, to supplement food and cosmetics in Japan, 10 GeO2 erroneously sold as organogermanium China, Korea and USA. led to deaths by renal toxicity [3]. Sanai et al. When Ge-132 is used as a medical cream

described the toxicity of GeO2 and deemed for peripheral burn care, pain decreases very Ge-132, poly-trans-[(2-carboxyethyl) ger- quickly after treatment. Therefore, we were 2015 masesquioxane], safe to consume [4]. Exces- interested in the action of Ge-132 in the

sive GeO2 intake leads to lethal nephropathy peripheral pain signaling system. Although via accumulation in the nephrons of kidneys. the nociceptive effect of Ge-132 has been

Limited amounts of GeO2 have physiological described using the acetic acid writhing functions, while an abundance can be lethal. method [13] and the tail–flick method [14] in Ge-132 is a water-soluble organogerma- mice, the mechanism of this pain inhibition nium compound that has been deemed safe remains unclear. In the recent literature, an in multiple toxic evaluations [5]. An acute extracellular ATP, a cis-diol compound, is toxicity test in male dogs revealed an LD50 well known as a nociceptive factor that can of 8500 mg/kg bodyweight. Ge-132 affects cause pain in the peripheral and central nerve multiple physiological systems, including systems [15] . When skin tissue is damaged by the immune response, and has anti-inflam- a peripheral burn, large quantities of ATP are part of

10.4155/FMC.15.62 © 2015 Future Science Ltd Future Med. Chem. (2015) 7(10), 1233–1246 ISSN 1756-8919 1233 Research Article Nakamura, Shimada, Takeda, Sato, Akiba & Fukaya

Key terms can regulate the function of neurotransmitters and hormones possessing cis-diol structures. Ge-132: Water-soluble organogermanium compound In this study, we evaluated chelate formation poly-trans-[(2-carboxyethyl)germasesquioxane] (IUPAC name) is known by several names. In addition, between Ge-132 and adrenaline, the most well-known 2-carboxyethylgermanium sesquioxide has been used in catecholamine. Crystals of the chelate complex were previous research reports. Ge-132 is one polymer form of prepared, and structural analyzes were performed by (3-trihydroxygermyl)propanoic acid. Another polymer type X-ray diffraction and NMR. The rate of chelate forma- is known as propagermanium, which differs from Ge-132 in function and use. Propagermanium is used as a drug tion between Ge-132 and several cis-diol compounds, component for treating chronic hepatitis. Repagermanium such as catecholamines (accurately vicinal diol; how- is the name of Ge-132 as a cosmetic use. ever in this study we also express about chatechol as cis- Cis-diols: Two vicinal surface OH groups are oriented in the diol) and nucleotides, was studied. We also evaluated same direction from a plane of bonding carbon in a ring the effect of Ge-132 on the application of adrenaline structure. Sugars possess many cis-diol structures (and/ and ATP to human skin keratinocytes. Here, we dem- or trans-diol structures). However, the hydroxyl groups of catechol and catechin are located on the flat plane of the onstrate that the chelation of cis-diol neurotransmit- benzene ring plate. For convenience in this article, we also ters may regulate homeostasis and neurotransmission defined these flat diol structures as cis-diols. through the adjustment of receptor binding activity. Hypervalent : In addition to transition metals, other types This is the first report of a direct reaction between an of atoms can possess extraordinary electron orbitals. In organogermanium compound and active biological general, small atoms can form from one to four chemical compounds based on structural information. bonds. However, large atoms with extraordinary orbitals can bind with more than five atoms. A molecule that contains these types of high coordinate bonds is known Results as a hypervalent coordinate molecule. In the case of Complex of organogermanium with organogermanium compounds, the molecule, which catecholamine contains a germanium atom, can form between five Ge-132 is a water-soluble organogermanium com- and seven coordinate bonds. Such molecules are known as penta-, hexa- and hepta-coordinated germanium pound and is a polymer of 3-(trihydroxygermyl)pro- compounds, respectively. panoic acid, THGPA (Figure 1). THGPA can interact with cis-diol structures through its trihydroxy groups, leaked from the injured cells. We believe that the inter- and here, we evaluated the ability of THGPA to inter- action between Ge-132 and leaked ATP can suppress act with several physiological cis-diol compounds. the pain signal resulting from the burn. First, we evaluated the crystal formation of THGPA, Germanate interacts with d-fructose to promote a safe form of organogermanium, which possesses a the isomerization of d-glucose to d-fructose [16,17]. trihydroxy structure, and adrenaline complexes. Equi- Recently, we reported an interaction between Ge-132 molar aqueous solutions of THGPA and adrenaline

and certain monosaccharides [18]. GeO2 also reacts with were combined. The resulting mixture had a pH of ∼4. phenylfluorone, which contains a catechol skeleton, Other solutions were pH adjusted with NaOH or HCl

and this reaction is employed in GeO2 analyzes [19] . and did not form crystals of the desired complex. At

Complex formation between GeO2 and catechol com- lower pH values, as adjusted with HCl, only Ge-132 pounds has also been detected [20–22]. Furthermore, crystals were formed. The crystals of the THGPA phenylfluorone can be used to detect Ge-132. Thus, and adrenaline complex were planar and colorless Ge-132 can be chelated by catechol and other cis-diol (Supplementary Figure 1). We speculated that THGPA compounds. Catechol compounds have important and adrenaline were dehydrolyzed at their hydroxyl functions in humans. Specifically, some catechol- moieties. Moreover, we predicted that a pentacoordi- amines act as neurotransmitters or hormones [23–27]. nate structure had formed via lactone ring formation Previously, Ge-132 was found to relieve the suppres- (Figure 1). Crystals of THGPA/dl-adrenaline and sive effect of catecholamines against intestinal peristal- THGPA/l-noradrenaline were analyzed using X-ray sis [28]. This effect might be due to the formation of a diffraction, and their structures were determined chelate between Ge-132 and catecholamines. Cis-diol (ORTEP in Figure 2A–D). The molecular formulae

element-containing compounds are very important in of the two complex compounds are C12 H17Ge N O6

mammals, particularly as components of some neu- (Mw. 343.9) and C11 H15Ge N O6 (Mw. 329.9), respec- rotransmitters. Several separation technics for cis-diol tively. Dehydration resulted in bonding between the biomaterials have recently been reported based on a THGPA and adrenaline molecules. Two hydroxyl moi- similar interaction by some organoboronates [29–31] . eties from each compound formed a ring composed

Every purified cis-diol biomolecule has been shown to of C–C–O–Ge–O–. Moreover, two H2O molecules be important to life. Therefore, we predict that Ge-132 were formed (Figure 2B & D). Note that the complex

1234 Future Med. Chem. (2015) 7(10) future science group Ge-132 forms complexes with physiological cis-diol compounds Research Article atoms were hypervalent (pentacoordinate). The THGPA OH propanoic group originating from THGPA formed a H O lactone ring (butyrolactone) and formed a coordinate N OH HO bond with the vacant d-orbital of germanium, result- Ge OH OH HO ing in the formation of a pentacoordinate germanium OH Adrenaline (V) atom. We speculated that a proton originating from the lactone ring might be found neighboring the Vacant d-orbital germanium atom (Figure 1); however, the proton was actually bound to the nitrogen atom (Figure 2A & C). -2 H O These data suggest that these complex molecules may 2 have an electric polarization within each individual compound because germanium is negatively charged by the formation of a lactone ring; in addition, the OH + protonation to nitrogen gives the germanium a posi- H H tive charge. The THGPA and dl-adrenaline com- N O - Ge pounds formed a complex with reverse chirality O O O (d-form and l-form), found in an antiparallel posi- OH tion. This might originate from the polarization described above. The complex compounds lie in two Figure 1. Structural scheme of 3-(trihydroxygermyl) layers (Supplementary Figure 3A), based on stacked propanoic acid/dl-adrenaline complex. A schematic illustration of complex formation between benzene rings (Supplementary Figure 3B) that might 3-(trihydroxygermyl)propanoic acid (THGPA) and form pi bonds. The distance between the two planes adrenaline is shown. The germanium atom has a is 3.345 Å. For the complex formed by THGPA and vacant d-orbital, and we predicted that the complex l-noradrenaline, the 3D configuration of two complex compound would have a lactone ring. (Figure 2D) molecules was twisted . Two H2O molecules and adrenaline exist as a mixture of the complex and its were observed per complex molecule. parental molecules. The NMR spectrum of THGPA

The IR spectra of the THGPA and adrenaline crys- and adrenaline in deuterium oxide (D2O) is shown in tals were measured by the KBr method. The spec- Figure 3A. The red signals in the proton NMR analysis trum of the pentacoordinate compound was differ- originated from adrenaline, and the blue signals origi- ent from the spectra of the two original compounds nated from THGPA. Upon formation of the complex, (Supplementary Figure 4A). The strong absorbance at the chemical shifts resembled the original shifts but in 800 cm-1 that originated from Ge–O–Ge in Ge-132 different environments. The signals of complex com- did not exist in the newly formed complex. Moreover, pounds are typically broader. The methylene neigh- the strong absorbance at 1686 cm-1 that originated boring the germanium gave three triplet signals at 1.7, from C=O of a carboxyl radical in Ge-132 was shifted 1.5 and 1.3 ppm that corresponded to complex a, the to 1622 cm-1. The shift may be related to the formation original and complex b, respectively. The ratio of the of a lactone ring. areas of these signals can be used to quantify com- The crystals of THGPA and adrenaline were soluble plex formation. Many important cis-diol compounds in methanol. However, their solubility in water was exist that can interact with THGPA (Figure 3B). The very low at room temperature. The dehydration of four affinities between THGPA and somecis -diol com- hydroxyl moieties in the two original compounds led pounds are shown in Figure 3C. The complex forma- to a reduction of hydrophilicity. Therefore, structural tion ratio was very high for the catecholamines, where studies and stability evaluations were conducted by dis- noradrenaline had the highest, followed by adrena- solution in D3-methanol. The 1H- and 13C-NMR CH- line. The complex formation ratios of the ribose com- COSY spectra are shown in Supplementary Figure 4B. pounds adenosine and ATP were lower than those of These signals did not change after 2 or 4 months, the catecholamine compounds. Lower concentrations suggesting that this complex is stable at ambient decreased the resulting amount of complex forma- conditions. tion. Due to the low concentrations of THGPA in our bodies, oral intake of Ge-132 is safe, although Affinity between organogermanium our experiments confirmed that interactions between & catecholamine & mono nucleic acid THGPA and cis-diol compounds can occur. We uti- Using NMR, we investigated the interactions between lized the inactive form of the compound 3-(trimeth- THGPA and other physiologically relevant cis-diol ylgermyl)propanoic acid (TMGPA) for affinity evalua- compounds. At physiological pH (∼7.4 –7.6), THGPA tion (Supplementary Figure 2). However, TMGPA did

future science group www.future-science.com 1235 Research Article Nakamura, Shimada, Takeda, Sato, Akiba & Fukaya

A

C8 C9 C12 04 C4 C11 N1 C7 01 C10 02 C3 C6 C5 Ge1 C6 C2 C1 05 03

01S B

C9 C8 C12 04C4 C11 N1 01 C7 C10 02 C3 C5C6 C2 C1 Ge1 03 06 05

N1 C11 C C10 C6 C1 C7 03

C2 C5 06 Ge1

05 C8 C4 C3 04 01 C9 02

D 01S

C1 N1 C11 C2 03 C5 C10 C3 C6 C8 02 01 C7 Ge1 06 04 05 C4 C9 Figure 2. ORTEP diagram of 3-(trihydroxygermyl)propanoic acid/catecholamine complexes. (A) ORTEP diagram of the crystal obtained from a mixed solution of THGPA and dl-adrenaline. The structure of one molecule is drawn,

and the X-ray analysis revealed the lactone ring and NH2. (B) The complex compound had two crystallized water molecules. The symmetry of the complex compounds resulting from D formation and L formation is shown. (C) ORTEP figure of the crystal obtained from a mixed solution of THGPA andl -noradrenaline. (D) 3D diagram of the THGPA and l-noradrenaline complex compounds. The configuration of the two complex molecules was twisted. Two water molecules were present per complex molecule. THGPA: 3-(trihydroxygermyl)propanoic acid.

1236 Future Med. Chem. (2015) 7(10) future science group Ge-132 forms complexes with physiological cis-diol compounds Research Article

A Original

Complex a Complex b

OH H2 N O H C + - 3 Ge O O O OH

HOD

75 31

Chemical shift (ppm)

B C O HO O NA Ge O - 80 AD O Ado R ATP X X R 60 TMGPA + ATP Cis-diol compounds mation (% )

Adrenaline r Noradrenaline

x fo 40 Dopamine Adenosine ATP Comple ADP 20 NAD TMGPA + ATP etc.

0 0.01 0.1 110100 1000 Concentration (mmol/l)

Figure 3. Complex formations of 3-(trihydroxygermyl)propanoic acid with cis-diol compounds. (A) NMR spectrum dl of THGPA and -adrenaline in D2O. The pH was adjusted to 7.4 with NaOD. The signals revealed that a mixture of complex compound and parental compounds was present. The complex formation rate was calculated from the ratio of the areas of the complexed and free compounds. (B) The complex formation pattern of THGPA and the cis-diol compound. Typical biological cis-diol compounds are aligned. (C) The ratio of complex formation between THGPA and four types of biological cis-diol compounds is shown. Noradrenaline exhibits a high affinity for THGPA. However, TMGPA did not exhibit any complex formation with ATP. AD: Adrenaline; Ado: Adenosine; NA: Noradrenaline; THGPA: 3-(trihydroxygermyl)propanoic acid.

future science group www.future-science.com 1237 Research Article Nakamura, Shimada, Takeda, Sato, Akiba & Fukaya

A B Adrenaline or ATP 1. 5 Medium

Actb + THGPA (0 to 10 mM) 1. 0

atio against Ca2+ 0.5 ession r N.D

Expr 0.0 p2x3 p2y1 p2y2 NHEK(F) cell Purinergic receptor subtype

C D

Control (without THGPA) ensity Ca ion influx

THGPA escent int Fluor

03060 90 120150 180 ATP addition 0 s ATP addition 15 s Time (s) E F Adrenaline ATP

60 ** (n = 6) 120 ** (n = 8) 100 * escence (%) escence (%) 40 80 luor luor 60 20 40 20 easing in f easing in f 0 0 Incr Incr 0 mM 2.5 mM 5 mM 0 mM 1 mM 10 mM THGPA THGPA THGPA THGPA THGPA THGPA

Figure 4. Inhibition of calcium signaling by cis-diol binding by 3-(trihydroxygermyl)propanoic acid in NHEK cells. (A) The gene expression level of purinergic receptor subtypes in NHEK cells was evaluated by quantitative PCR. (B) The suppressive effect of THGPA on the signaling of adrenaline and ATP by human keratinocytes, NHEKs, was evaluated. A calcium ion indicator was incorporated into the cells, and calcium ion influx was measured by the acceptance of adrenaline and ATP. (C) NHEKs incorporated fluo-8AM responded to ATP stimulation. (D) Calcium ion influx was suppressed by the addition of THGPA. (E) The calcium ion influx triggered by adrenaline was suppressed with THGPA treatment. A high concentration of THGPA (5 mM) yielded significant suppression. (F) The calcium ion influx triggered by ATP was suppressed by THGPA treatment. A high concentration of THGPA (10 mM) suppressed calcium ion influx significantly. All data are displayed as mean ± SEM and were analyzed using ANOVA and Tukey’s test. *p < 0.05; **p < 0.01. ANOVA: Analysis of variance; NHEK: Normal human epidermal keratinocyte; SEM: Standard error of the mean; THGPA: 3-(trihydroxygermyl)propanoic acid.

1238 Future Med. Chem. (2015) 7(10) future science group Ge-132 forms complexes with physiological cis-diol compounds Research Article

not form complexes with ATP at a high concentration Key term (100 mM), suggesting that the trihydroxy form is essential for this interaction. Cell–cell communication: Multicellular eukaryotes form complex organisms based on many cell types. The cells rely on many kinds of signals to inform each other of their Inhibition effect of THGPA addition for calcium various conditions. The cell-to-cell signal ligand binds to ion influx by cis-diols receptors on the cell surface, and the signal transits to Normal human epidermal keratinocytes (NHEKs) another signal molecule within the cytoplasm, allowing the cell to respond to the outside condition. The cells have β-adrenergic receptors and P2X2/3 recep- utilize crosstalk for communication with each other, where tors. These receptors are G-protein coupled recep- ligands are used as signal molecules and specific receptors. tors and Ca2+ ion channels, respectively. It is known that NHEKs also contain P2Y1 and P2Y2 receptors, We confirmed that organogermanium can form com- which are also categorized as G-protein coupled recep- plexes with important cis-diol compounds, including tors. We evaluated the expression levels of P2 recep- hormonal compounds such as adrenaline, noradrena- tors. The mRNA expression levels of P2X3, P2Y1 and line and ATP. Today, many current drugs of clinical P2Y2 in NHEKs in normal culture conditions are value are used to target receptors. Furthermore, most shown in Figure 4A. P2X3 was not detected, whereas drugs act by blocking binding sites, thus acting as the expression of P2Y1 and P2Y2 was confirmed. The antagonists. Many cis-diol compounds have impor- cell response to adrenaline and ATP administration tant roles in human physiology, including neurotrans- was monitored with the calcium ion indicator Fluo-8 mitters such as catecholamines, ATP and adenosine, AM. To evaluate the effect of THGPA, the influx of hormones such as catecholamines, genetic informa- calcium ions triggered by either adrenaline or ATP was tion such as RNA and coenzymes such as NAD and measured (Figure 4B). Calcium influx by ATP addition NADP (Figure 3B). These molecules share common to NHEKs was visualized and is shown in Figure 4C. fundamental structures such as catechol and ribose. The cells exhibited green fluorescence after ATP addi- Catecholamines are known as stress hormones, and tion. The addition of adrenaline to the cells led to an they are released from the adrenal gland during psy- influx of calcium ions, and THGPA inhibited this chological stress; moreover, an induction of hypergly- response (Figure 4D). Treatment with 1 μM adrena- cemia by adrenaline has been reported [32]. Recently, line triggered calcium ion influx into NHEK cells. the structures of β-adrenergic receptors bound to ago- The response times of calcium influx after the addi- nists were revealed [33]. Similarly, ATP is one of the tion of ATP and adrenaline were different. After the most important components for life and is known as ATP addition, 15 s was a sufficient response time for a biological energy compound [34,35]. However, the emission (Figure 4C). However, the addition of adrena- extracellular concentration of ATP is extremely low. line required a longer response time, and the maximal Purine receptors have many roles, and some of these lighting by calcium influx was observed from a half receptors sense the release of purines from punctured minute to 1 min later (Figure 4D). THGPA inhibited cells during pain signaling. ATP can act as a signal for the fluorescence intensity in a dose-dependent manner cell damage. Extracellular ATP serves as a nocicep- (Figure 4E). The percentage increases in fluorescence tive signal in peripheral and central neuronal signaling for the addition of 0, 2.5 and 5 mM THGPA were through interactions with P2X2/3 and P2X3 or with 41, 27 and 13%, respectively. Calcium ion influx was P2X4, respectively [15,36–39]. Notably, the functions of significantly inhibited by 5 mM THGPA (p < 0.01). both catecholamine and ATP are related to stress, and Similar results were observed with the addition of ATP organogermanium, Ge-132, can interact with cis-diol (Figure 4F). The increased fluorescence values obtained compounds that have stress-related physiological func- with THGPA additions of 0, 1 and 10 mM were 97, tions. In general, a receptor is depolarized by ligand 75 and 32%, respectively. THGPA suppressed the cal- binding. Therefore, an excess of ligand compounds cium ion influx activated by ATP in a dose-dependent decreases the intensity of the cellular response. Hence, manner, and the difference between 0 and 10 mM was spontaneous stress and cell damage may decrease the significant (p < 0.01). The difference between 1 and ability of the cell to respond. We evaluated interac- 10 mM was also significant (p < 0.05). THGPA sup- tions between THGPA and cis-diol compounds and pressed the cell response to the acceptance of cis-diols whether ligand trapping by complex formation with at the high concentration. THGPA suppressed binding and cell response. We crystallized the complexes of THGPA with adrenaline Discussion and noradrenaline (Figure 2). The crystals contained This study supposes novel targets for the control of pentacoordinated germanium with a lactone ring. Ger- cell–cell communication by cis-diol compounds. manium compounds have a carboxyethyl moiety that

future science group www.future-science.com 1239 Research Article Nakamura, Shimada, Takeda, Sato, Akiba & Fukaya

Key term action of THGPA with cis-diol compounds is of great interest because many kinds of cis-diol compounds are Purinergic receptors: Extracellular ATP occurs in very essential in mammals. low concentrations in extracellular spaces, and when it leaks from cells, the molecule plays a role in danger THGPA is a water-soluble compound and may not signaling. Purinergic receptors of the P2 type are receptors be readily incorporated into intercellular compart- for ATP binding and mediate intercellular ATP signaling. ments. Therefore, a higher proportion of THGPA P2 receptors are categorized into two types: the P2X may be present in the extracellular space than in the type includes calcium ion channels, and P2Y, as G protein coupled receptors. Many subtypes exist for both of P2X intracellular fluid. For biological application, we dem- and P2Y. onstrate the inhibition of adrenaline and ATP binding to the receptors in Figure 4E & F. In this study, NHEKs can form a lactone ring with pentacoordinated germa- expressed both P2Y1 and P2Y2 receptors in normal cul- nium in the formation of complexes. Moreover, if elec- ture conditions. Mechanical stimulation evokes Ca2+ tron-donating groups exist on the delta position of the waves mediated by ATP signaling through P2Y2 recep- organogermanium compound (e.g., lactamo-N-methyl tors, and Koizumi et al. reported that these Ca2+ waves, ligands), a cyclic structure with pentacoordinated ger- as pain signals, are transmitted to sensory neurons [45]. manium can form. NMR analyzes in deuterium oxide Therefore, THGPA may suppress this Ca2+ wave sig- (Figure 3A) suggest an equilibrium state between tetra- naling via ATP to peripheral neurons. In reality, the coordinate (THGPA) and pentacoordinate (THGPA/ acute pain of a burn wound is blocked by the applica- catecholamine complex). However, X-ray analysis tion of THGPA. A similar inhibition is expected for revealed that complexes with cis-diol structures only other cis-diol compounds in the extracellular space if have pentacoordinated atoms. Therefore, we speculate THGPA is distributed within the area at high concen- that triols bonded to germanium are close to a diol tration. The receptors for catecholamine and purines when the pentacoordinate is formed (Figure 2). The are rich in variety and can be found in multiple cell distances of triols are estimated at 2.78–2.95 Å for the types. For example, adrenergic receptors α1, 2 and tetracoordinate. However, the distance of cis-diol for β1–3 and purine receptors P2X1–12 and P2Y1–13 have the THGPA/adrenaline complex was 2.57 Å in this been known. These subtypes have different functions study, which is a shorter distance than in the other against the same compounds. When the cell membrane compounds. Therefore, the pentacoordinate position is harmed, ATP leakage occurs. Similarly, psychologi- may be suitable for this short distance. cal or cold stress triggers the release of catecholamine. These types of complexes are usually hydrolyzed THGPA binds these cis-diol compounds and suppresses under hydrophobic conditions. Therefore, an equi- their binding to receptors. Ho et al. have reported that librium state exists between the complex and sub- the intraperitoneal administration of Ge-132 lowered strates. If the complex formation is extremely strong, the mean arterial pressure in a dose-dependent manner the signal transduction of the adrenaline and ATP in rat [46]. They supposed that Ge-132 acts by mediat- ligands is reduced by Ge-132 intake. However, this ing the catecholamines in the brain. In this study, we equilibrium may simulate a decrease in ligand con- evaluated Ge-132 by using the NHEK model; how- centration. Although neurotransmitter and hormone ever, the same mechanism will be applicable to vas- signal transductions are essential molecules, an excess cular smooth muscle cells. We speculate one aspect of these signals is not conducive to normal cell func- of Ge-132’s mechanism cis-diol compound mediation tion. In this case, Ge-132 may change the apparent in our body, illustrating this concept schematically signal concentration in the receptors. In this study, in Figure 5. Peripheral pain due to leaked ATP from we mainly focused on adrenaline and ATP. Previous injured cells is suppressed by THGPA trapping due to reports indicate that Ge-132 can relieve the effect of equilibrium complex formation. However, the forma- catecholamine in the intestine [28]. Moreover, Ge-132 tion of complexes between THGPA and chatechol- is useful for pain relief, and Ge-132 decreased pain in amines inhibits vasoconstriction mediating α1 recep- terminal cancer patients in double-blind clinical tri- tors. Moreover, it has been reported that noradrenaline als [40]. Extracellular ATP, adenosine, and catechol- enhanced P2X3 expression in dosal root ganglia in amine function in central or peripheral pain signal rat [43]. In this system, the pain signal mediates two transduction or nociception [38,41–44]. Furthermore, in different cis-diol molecules (noradrenaline and ATP), our previous study, THGPA suppressed a nociception and both of them can interact with THGPA; therefore, threshold mediated P2X purinergic receptor by THGPA treatment of peripheral skin may be beneficial ATP signaling in mice (unpublished data). These facts for peripheral nociceptive pain. In addition, complex suggest that interactions between THGPA and these formation with adenosine, a metabolite of ATP, may compounds are involved in this pain relief. The inter- inhibit its metabolism to inosine by adenosine deami-

1240 Future Med. Chem. (2015) 7(10) future science group Ge-132 forms complexes with physiological cis-diol compounds Research Article

Layer of keratin Epiderm EKC

O Ge

ATP O Leaked ATP

ATP

Terminal Cell injury P2Y2 sensory neuron

P2X3

C9 C8 C12 04 C4 C11 N1 C7 01 C10 02 C3 C6 Pain signal C5 Ge1 C6 C2 C1 05 03

α1 VMC VEC

Blood O Inhibit CA Ge vasoconstriction O

Figure 5. Image illustrating cis-diol trapping by Ge-132. The Ge-132 monomer, 3-(trihydroxygermyl)propanoic acid, can interact with catecholamines and nucleotides. The suppression of pain by leaking ATP signaling and the inhibition of acute high blood pressure by catecholamines are expected after 3-(trihydroxygermyl)propanoic acid application or intake. EKC: Epidermal keratinocyte; VEC: Vascular epithelial cell; VMC: Vascular muscle cell. nase. Multiple Ge-132 physiological functions have It has been suggested that the affinity for epigallocat- been reported, but the mechanism behind its action has echin gallate can be explained by its interaction with not been determined. Differentiated cells have differ- cis-diols in the body. However, Bortezomib exhibits ent receptor subtypes, and the same ligand can lead to several severe side effects, and some boronic acids and different functions. Thus, the interaction of THGPA GeO2 are also reportedly toxic. Therefore, the affinity

(Ge-132) with various cis-diol compounds may affect of borate or GeO2 for cis-diols may be too strong for homeostasis, thereby explaining some of the functions use in physiological applications. THGPA has an equi- of Ge-132. We anticipate that interactions with cis-diol librium interaction with cis-diol compounds in hydro- compounds might be important. Different compounds philic conditions (in water). This equilibrium is shown can interact with cis-diol compounds, for example, such as different spectra of 1H-NMR for the THGPA and Supplementary Figure 4B as phenyl borate and GeO2. One borate compound, adrenaline complex in (part of Figure 3A Bortezomib, is used to inhibit the proteasome in mul- CH COSY in D3-methanol) and (in D2O). tiple myeloma. Recently, the inhibition of Bortezomib The proton signals from 1.5 to 2.5 ppm originated from activity by epigallocatechin gallate was reported [47]. THGPA and were detected as different triplet signals

future science group www.future-science.com 1241 Research Article Nakamura, Shimada, Takeda, Sato, Akiba & Fukaya

related to either free or complexed THGPA (Figure 3A). chased from Merck, and D3-methanol was purchased This hydrolysis equilibrium condition is related to the from Isotec Laboratories, Inc. (Champaign, IL, USA). safety of Ge-132. THGPA possesses a second type of polymer structure, propagermanium, relative to Preparation of the adrenaline & Ge-132 chelate Ge-132. Propagermanium is a CCR2 antagonist and complex crystal is used as a drug for the treatment of chronic hepatitis. Equal moles each of adrenaline or noradrenaline and Recently, Yumimoto et al. revealed a cancer metastasis THGPA (0.5 mol of Ge-132) were reacted in 10 ml mechanism and the strong inhibition of cancer metas- of pure water at room temperature. The solution was tasis via propagermanium intake [48]. Although the incubated at 4°C for several days. Single crystals began structural mechanism of this inhibition has not been to form after half of a day. The crystals were observed demonstrated, the interaction between THGPA and with an optical microscope, and digital photographs biological cis-diol compounds may affect CCR2 inhi- were taken with a Moticam 2000 digital CCD scope bition by propagermanium. (Shimadzu Corporation, Kyoto, Japan). The crystals Although this study suggests that the physiological were removed from the mother liquor, rinsed with pure function of Ge-132 may be related to the interaction water and dried. The crystals were subsequently used with bio active cis-diol compounds, the concentration for structural analysis. needed for effectiveness was considerable. Therefore, a micro regional distributional study of THGPA in vivo Structural analyzes of the complex crystal will be important. Recently, our group has developed X-ray structural analysis a micro analysis method of THGPA with structural A single crystal (∼0.2 mm) was used for X-ray struc- information by LC/MS/MS [49]. We expect to carry tural analysis with a Smart APEX II (Bruker AXS cor- out further studies on the affinity of THGPA andcis - porations, Billerica, MA, USA), which is a single crys- diol compounds in detail using this LC/MS/MS anal- tal X-ray diffractometer with CCD detection. The data ysis method. In addition, we performed NHEK cell were processed with the APEX II software for reduc- analyzes in normal conditions; therefore, a deviation tion and cell refinement. X-ray diffraction analyzes from treatment by the complexes among THGPA and were deposited with the Cambridge Crystallographic cis-diol compounds would be interesting to study in the Data Centre. Deposition numbers are CCDC- 894300 future. In microglial cells of allodynia, the expression for Ge-132/dl-adrenaline and CCDC-894301 for of P2X4 is very high [50]; hence, the effect of THGPA Ge-132/l-noradrenaline. Free copies of the data can in such a model should also be revealed in the future. be obtained via the Cambridge Crystallographic Data Centre website [51] or from the Cambridge Crystal- Experimental lographic Data Centre, 12 Union Road, Cambridge, Chemicals & reagents CB2 1EZ, UK (Fax: +44 1223 336033; e-mail: Ge-132 (Lot 006316A; purity over 99%), also known [email protected]). as poly-trans-([2-carboxyethyl]germasesquioxane), was synthesized at the manufacturing plant of Asai FTIR analysis of the complex crystals Germanium Research Institute Co., Ltd. The synthe- The spectra were measured using an IR 4000 spec- sis procedure for Ge-132 used by the Asai Germanium trometer (Shimadzu) with the potassium bromide Research Institute is as follows. Ingots of germanium (KBr) method. A tablet was formed by adding 2 mg (purity greater than 99.9999%) were milled in powder. of pulverized crystals and 0.2 g of KBr to a press. The The powdered germanium was reacted with hydrochlo- FTIR spectra were scanned from 4600 to 400 cm-1. ride gas at high temperature, and trichlorogermane was produced. Next, the trichlorogermane was reacted with NMR analysis of the complex crystals acrylic acid to form THGPA. The obtained 3-(trichlo- Proton and 13C-NMR analyzes were conducted at rogermyl)propanoic acid was hydrolyzed to THGPA 300 Hz (1H) and 75 MHz (13C) using a Gemini 300 and dried to a polymer, Ge-132. An inactive form of spectrometer (Varian, Agilent Technologies, Inc., Santa the compound, TMGPA, was synthesized by Toru Clara, CA, USA). Crystals of the THGPA and adrena- Yoshihara at Asai Germanium Research Institute Co., line complex were dissolved in 800 μl of D3-methanol Ltd. Adenosine, dl-epinephrine (adrenaline), l-nor- at saturation. The methanol signal was adjusted to adrenaline and l-dopa (3-(3,4-dihydroxyphenyl)-l- 3.4 ppm in the 1H-NMR study. Measurements were alanine) were purchased from Wako Pure Chemical acquired at 25°C, with 16 transients for 1H analyzes Industrial Co., Ltd. (Osaka, Japan). ATP was pur- and 40,000 transients for 13C analyzes. CH-COSY and chased from Oriental Yeast Co., Ltd. (Tokyo, Japan). DEPT analyzes were used to assign each signal. The 1 D4-methanol and deuterium oxide (D2O) were pur- complex stability was evaluated by the collection of H-

1242 Future Med. Chem. (2015) 7(10) future science group Ge-132 forms complexes with physiological cis-diol compounds Research Article

NMR spectra over time. The assigned δ H signals are Application for cellular study using human reported as follows (refer to Supplementary Figure 4B). keratinocytes in vitro A broad triplet at 1.77 ppm corresponds to a methy- Gene expression analysis of P2 receptor in human lene (C1) neighboring germanium. A sharper triplet at keratinocytes 2.56 ppm confirms a methylene (C2) neighboring the NHEK cells were obtained from KURABO (Osaka, ketone. Because Ge-132 does not dissolve in methanol, Japan). The cells were cultured in Humedia KB-2 we posit that these are specific signals originating from (Kurabo) supplemented with insulin, hEGF, bovine THGPA incorporated into the complex with adrena- pituitary extract and hydrocortisol. The purinergic line. One other methylene (C11), originally from adren- receptor expression of NHEK cells was confirmed by aline, exhibits a doublet signal at 3.25 ppm. The bond quantitative PCR analysis. The cells were cultured in between a methyl (C12) and the amine was detected as 12-well plates in Humedia KB-2. Confluent cells were a singlet at 2.84 ppm. The hydrogen bonded to C10 was lysed with 1 ml of Isogen (Nippon Gene Co., Tokyo, detected as a triplet signal at 4.88 ppm. Two hydrogen Japan), and then total RNA was extracted using the atoms bonded to C6 and C9 were detected at 6.75 ppm manufacturer’s protocol. One microgram of extracted as a multiplet signal. The hydrogen bonded to C8 was total RNA was used as a template for cDNA synthe- detected at 6.88 ppm as a doublet signal. The assigned sis via reverse transcription with an oligo dT primer signals (refer to Supplementary Figure 4B) of δC are as and Super Script III (Invitrogen, Carlsbad, CA, USA). follows: 16.6 (C1), 30.0 (C2), 33.8 (C12), 57.0 (C11), The synthesized cDNA was used for quantitative PCR 70.4 (C10), 110.6 (C6), 112.5 (C9), 117.2 (C8), 131.5 analysis. Quantitative real-time PCR was performed (C7), 150.9 (C4), 151.4 (C5) and 181.2 (C3) ppm. The for P2X3, P2Y1 and P2Y2 as target genes and for signals were assigned based on the known chemical β-actin (ACTB) as a housekeeping gene. The PCR shifts of adrenaline from the SDBS spectral database of primer sets for each gene are listed in Table 1. The organic compounds [52] (National Institute of Advanced cDNA was amplified using SYBR Premix ExTaq II Industrial Science and Technology, November 13 (Takara Bio, Ohtsu, Japan) on an Opticon 2 (Bio-Rad 2014). Changes in spectral patterns were determined Laboratories, Hercules, CA, USA), which was pro- by comparing spectra acquired after 2 and 4 months at grammed for 95°C for 30 s, followed by 40 cycles of room temperature without inactive gas. denaturation (95°C for 5 s), annealing and extension (60°C for 30 s). Each expression value was calculated NMR analysis for affinity evaluation according to the threshold cycle value, and the data For the affinity studies, each of adenosine, ATP,dl - are displayed as the ratio of expression of each gene to adrenaline and l-noradrenaline, and THGPA were β-actin. evaluated at equal molar amounts (0.25, 0.5, 1, 2.5, 5,

10, 25, 50, 100, 250 and 500 mmol/l each) in D2O. ATP Calcium influx measurement in human and TMGPA were also evaluated in D2O at 100 mmol/l keratinocytes concentration each. For adrenaline, the 250 and 500 A fluorescent reagent was used to measure the influx mmol/l solutions were too high (insoluble) to analyze. if calcium ions into cells. NHEK cells were cultured The solution was adjusted to pH 7.4 with NaOD. Mea- according to the supplier’s recommendations, as surements were acquired at 25°C, with 16 transients for described above. The cells were harvested after treat- 1H analyzes. The complex formation rates (CFR as%) ment with trypsin and were prepared as a suspen- were determined by the following formula (Equation 1): sion in culture medium to a final concentration of 6 × 105 cells/ml. Each well of a 96-well cell culture (areas of complex signals) × 100 CFR (%) = plate (black plate, catalog No.165305, Nunc, Thermo (area of original signal +areas of complex signals) Fisher Scientific K.K., Yokohama, Japan) received Equation 1 100 μl of cell solution. The cells were cultured for

Table 1. Primer sets for quantitative polymerase chain reactions for P2 receptor expression analysis. GenBank accession Target gene Amplicon size Sense primer Antisense primer no. (bp) NM_002559.3 P2X3 109 5′-accaagtcggtggttgtgaaga-3′ 5′-aatggctgtgtcccgtacctg-3′ NM_002563.3 P2Y1 150 5′- cctgagttcaagcagaatggagata -3′ 5′-ctaagtgtggatgtgggcatttcta -3′ NM_176072.2 P2Y2 146 5′-tcgcctgcttaattgaatgctc-3′ 5′-gggctgtagcatcaccaggaa-3′ NM_001101.3 ACTB 96 5′-ccaaccgcgagaagatga-3′ 5′-ccagaggcgtacagggatag-3′

future science group www.future-science.com 1243 Research Article Nakamura, Shimada, Takeda, Sato, Akiba & Fukaya

4 days and subsequently used for calcium ion influx trations necessary to achieve significant inhibition measurements in HHBS (1X Hank’s balanced salt were considerably high; therefore, whether effective solution with 20 mM HEPES buffer, pH 7.0). The cis-diol trapping can be achieved by THGPA may calcium indicator reagent Fluo-8 AM (ABD Bioquest, be highly restricted. Even so, the complex formed Inc. CA, USA) was added to each well, followed by between THGPA and catecholamine may be benefi- incubation at 37°C to permit the incorporation of the cial for antioxidation applications in terms of mela- reagent. After 30 min, the solution was removed, and nin formation via catechol to quinone. Although the the wells were rinsed with phosphate-buffered saline. complex compound with an unstable catechol struc- HHBS containing (3-trihydroxygermyl)propano- ture, the crystals of THGPA/adrenaline were very ate (THGPNa) (final concentration of 0, 2.5 and 5 stable at conventional atmosphere for a few months, mM) was added to the cells, which were incubated and the associated NMR spectrum did not change. for 5 min at 37°C. Fluorescence was recorded at 490 nm excitation and 530 nm emission with a micro- Future perspective injector equipped with an ARVO3 (Perkin Elmer, The organogermanium compound, Ge-132, may Inc., Waltham, MA, USA). Each well received 10 represent a leading candidate for interaction with cis- μl of adrenaline by injection (final concentration of diols toward establishing a novel type of medicine. 1 μM), and fluorescence was recorded each second In all likelihood, the affinity of Ge-132 with tar- after injection for 5 min. The effect of sodium THG- geted cis-diols is too weak for use a strong, effective PNa addition was evaluated 1 min after the addition drug. However, when we see the various physiologi- of adrenaline. Calcium influx after the addition of cal effects of THGPA and its polymers, we estimate ATP was evaluated in the same way. The final ATP that controlling cis-diol compounds with specific concentration was 10 μM, and the concentrations of interactions has potential as a novel drug target. In THGPNa were 0, 1 and 10 mM. the future, we anticipate that novel medicines will modulate receptor binding via complex formation Statistical tests with cis-diols. We expect advances in the study of The data are presented as the mean ± standard error the biological application of organogermanium com- of the mean (SEM). Statistical significance was eval- pounds, standing on the points of relation to cis-diol uated for the in vitro study using a one-way analysis compounds. of variance (ANOVA) with Tukey’s multiple com- parisons, and p < 0.01 and p < 0.05 were considered Supplementary data significant for the cell experiments. To view the supplementary data that accompany this pa- per please visit the journal website at: www.future-science. Conclusion com/10.4155/FMC.15.62 The structural details of the interaction between an organogermanium compound and active biologi- Financial & competing interests disclosure cal compounds were presented for the first time in The authors, excluding M Akiba and H Fukaya, were em- this study. This finding accounts for the numerous ployed by the Asai Germanium Research Institute Co., Ltd. physiological functions of Ge-132 while exhibiting The authors have no other relevant affiliations or financial low toxicity. Ge-132 is safe, and its effects are not involvement with any organization or entity with a finan- potent. The low toxicity of THGPA may originate cial interest in or financial conflict with the subject matter from its existence in equilibrium between bound or materials discussed in the manuscript apart from those and free ligand states. Moreover, we confirmed the disclosed. inhibition of receptor binding of adrenaline and ATP No writing assistance was utilized in the production of by THGPA in vitro. However, the THGPA concen- this manuscript.

Executive summary • The biological cis-diol compounds are very important for life. • Safe organogermanium compound Ge-132, a polymer of 3-(trihydroxygermyl)propanoic acid (THGPA), can interact with bioactive cis-diol compounds. • The affinities of THGPA and catecholamine are higher than that of THGPA and mono nucleic acids. • The complex crystal of THGPA/catecholamine has pentacoordinate germanium (V) and a lactone ring structure of the propanoic moiety. • THGPA inhibits cell signaling mediating receptor for cis-diols by ligand trapping at high concentration. • The cell–cell signaling control by the ligand with cis-diol structure trapping may be a novel draggable target.

1244 Future Med. Chem. (2015) 7(10) future science group Ge-132 forms complexes with physiological cis-diol compounds Research Article

References 15 Inoue K. P2 receptors and chronic pain. Purinergic Signal Papers of special note have been highlighted as: 3(1–2), 135–144 (2007). • of interest; •• of considerable interest •• Review of P2 receptors and the mechanism of P2X4 1 Hammett FS, Nowrey JE, Muller JH. The erythropoietic mediating chronic pain are shown. action of germanium dioxide. J. Exp. Med. 35(2), 173–180 16 Pelmore H, Somers PJ. Effect of oxyanions on the glucose (1922). isomerase catalysed equilibrium: 1. Complexes of d-glucose 2 Hammett FS, Nowrey JE. The erythropoietic action of and d-fructose with germanate. Enzyme Microb. Tech. 4(6), germanium dioxide: II. The source of the erythrocythemia 390–394 (1982). produced by germanium dioxide in the albino rat. J. Exp. 17 Barker SA, Pelmore H, Somers PJ. Effect of oxyanions on Med. 35(4), 507–513 (1922). the d-glucose isomerase catalysed equilibrium: 2. Effect of 3 Tao SH, Bolger PM. Hazard assessment of germanium germanate on the equilibrium of d-glucose and d-fructose supplements. Regul. Toxicol. Pharm. 25(3), 211–219 (1997). with immobilized d-glucose isomerase. Enzyme Microb. Tech. 5(2), 121–124 (1983). 4 Sanai T, Okuda S, Onoyama K et al. Chronic tubulointerstitial changes induced by germanium dioxide 18 Shimada Y, Sato K, Tokuji Y, Nakamura T. Nuclear magnetic in comparison with carboxyethylgermanium sesquioxide. resonance studies of the interactions between the organic Kidney Int. 40(5), 882–890 (1991). germanium compound Ge-132 and saccharides. Carbohydr. Res. 407(0), 10 –15 (2015). 5 Aso H, Suzuki F, Yamaguchi T, Hayashi Y, Ebina T, Ishida N. Induction of interferon and activation of NK cells and 19 Fukuoka HR. Phenylfluorone, a new staining agent with macrophages in mice by oral administration of Ge-132, an higher selectivity for tin. Basic Appl. Histochem. 34(3), organic germanium compound. Microbiol. Immunol. 29(1), 229–236 (1990). 65–74 (1985). 20 Cerveau G, Chuit C, Corriu RJP, Reye C. Reactions of 6 Suzuki F, Pollard RB. Prevention of suppressed interferon nucleophilic reagents with dianionic hexacoordinated gamma production in thermally injured mice by germanium complexes. Organometallics 7, 786–787 (1988). administration of a novel organogermanium compound, Ge- 21 Cerveau G, Chuit C, Corriu RJP, Reye C. Reactivity of 132. J. Interferon Res. 4(2), 223–233 (1984). dianionic hexacoordinate germanium complexes toward 7 Suzuki F, Brutkiewicz RR, Pollard RB. Ability of sera from organometallic reagents. Organometallics 10, 1510 –1515 mice treated with Ge-132, an organic germanium compound, (1991). to inhibit experimental murine ascites tumours. Br. J. Cancer 22 Chiang HC, Hwang SF, Ueng CH. Bis(1,2-benzenediolato) 52(5), 757–763 (1985). dimethanolgermanium(IV). Acta Crystallogr. Sect. C-Cryst. 8 Aso H, Suzuki F, Ebina T, Ishida N. Antiviral activity of Struct. Commun. 52, 31–33 (1996). carboxyethylgermanium sesquioxide (Ge-132) in mice 23 Song YH, Mardh S, Nyren O, Loof L. Adrenaline stimulates infected with influenza virus. J. Biol. Response Modif. 8(2), acid production in isolated pig and human parietal cells. 180–189 (1989). Scand. J. Gastroenterol. 23(1), 35–41 (1988). 9 Fujii A, Kuboyama N, Yamane J, Nakao S, Furukawa 24 Sigola LB, Zinyama RB. Adrenaline inhibits macrophage Y. Effect of organic germanium compound (Ge-132) on nitric oxide production through beta1 and beta2 adrenergic experimental osteoporosis in rats. Gen. Pharmacol. 24(6), receptors. Immunology 100(3), 359–363 (2000). 1527–1532 (1993). 25 Delfs JM, Zhu Y, Druhan JP, Aston-Jones G. Noradrenaline 10 Brutkiewicz RR, Suzuki F. Biological activities and in the ventral forebrain is critical for opiate withdrawal- antitumor mechanism of an immunopotentiating induced aversion. Nature 403(6768), 430–434 (2000). organogermanium compound, Ge-132 (review). In Vivo 1(4), 26 Simons FER, Simons KJ. Epinephrine (adrenaline) in 189–203 (1987). anaphylaxis. In: Chemical Immunology and Allergy. Ring J 11 Nakamura T, Nagura T, Akiba M et al. Promotive effects of (Ed.), Karger, Basel, Switzerland, 211–222 (2010). the dietary organic germanium poly-trans-[(2-carboxyethyl) 27 Devos D, Defebvre L, Bordet R. Dopaminergic and non- germasesquioxane](Ge-132) on the secretion and dopaminergic pharmacological hypotheses for gait disorders antioxidative activity of bile in rodents. J. Health Sci. 56(1), in Parkinson’s disease. Fundam. Clin. Pharmacol. 24(4), 72–80 (2010). 407–421 (2010). 12 Nakamura T, Saito M, Shimada Y, Fukaya H, Shida Y, 28 Tamura T, Fujii A, Ohnishi T. General pharmacological Tokuji Y. Induction of aminolevulinic acid synthase gene study of carboxyethylgermanium sesquioxide (Ge-132). expression and enhancement of metabolite, protoporphyrin Yakuri to Chiryou (in Japanese) 14(5), 3209–3218 (1986). IX, excretion by organic germanium. Eur. J. Pharmacol. 653(1–3), 75–81 (2011). 29 Li H, Liu Y, Liu J, Liu Z. A Wulff-type boronate for boronate affinity capture of cis-diol compounds at medium acidic pH 13 Suzuki S, Taguchi K. Pharmacological studies of condition. Chem. Commun. (Camb.) 47(28), 8169–8171 carboxyethylgermanium sesquioxide (Ge-132) (1). Oyo (2011). Yakuri (in Japanese) 26, 803–810 (1983). 30 Li H, Wang H, Liu Y, Liu Z. A benzoboroxole-functionalized 14 Hachisu M, Takahashi H, Koeda T, Sekizawa Y. Analgesic monolithic column for the selective enrichment and effect of novel organogermanium compound, GE-132. separation of cis-diol containing biomolecules. Chem. J. Pharmacobiodyn. 6(11), 814–820 (1983). Commun. (Camb.) 48(34), 4115–4117 (2012).

future science group www.future-science.com 1245 Research Article Nakamura, Shimada, Takeda, Sato, Akiba & Fukaya

31 Liu Y, Ren L, Liu Z. A unique boronic acid functionalized 43 Tan Y, Sun L, Zhang Q. Noradrenaline enhances ATP monolithic capillary for specific capture, separation and P2X3 receptor expression in dorsal root ganglion neurons of immobilization of cis-diol biomolecules. Chem. Commun. rats. Neuroscience 176, 32–38 (2011). (Camb.) 47(17), 5067–5069 (2011). •• Two different cis-diol signal of noradrenaline and ATP 32 Gerich JE, Lorenzi M, Tsalikian E, Karam JH. Studies relate to nociceptive pain signalling in the peripheral on the mechanism of epinephrine-induced hyperglycemia neuron system. in man. Evidence for participation of pancreatic glucagon 44 Goldman N, Chen M, Fujita T et al. Adenosine A1 receptors secretion. Diabetes 25(1), 65–71 (1976). mediate local anti-nociceptive effects of acupuncture. Nat. 33 Warne T, Moukhametzianov R, Baker JG et al. The Neurosci. 13(7), 883–888 (2010). structural basis for agonist and partial agonist action on a 45 Koizumi S, Fujishita K, Inoue K, Shigemoto-Mogami Y, beta(1)-adrenergic receptor. Nature 469(7329), 241–244 Tsuda M. Ca2+ waves in keratinocytes are transmitted to (2011). sensory neurons: the involvement of extracellular ATP and 34 Wang H, Oster G. Energy transduction in the F1 motor of P2Y2 receptor activation. Biochem. J. 380(Pt 2), 329–338 ATP synthase. Nature 396(6708), 279–282 (1998). (2004). 35 Elston T, Wang H, Oster G. Energy transduction in ATP • Extracellular ATP signals as nociceptive signals mediating synthase. Nature 391(6666), 510–513 (1998). skin keratinocytes to peripheral sensory neurons are 36 Tsuda M, Koizumi S, Kita A, Shigemoto Y, Ueno S, Inoue K. discussed. Mechanical allodynia caused by intraplantar injection of P2X 46 Ho CC, Chern YF, Lin MT. Effects of organogermanium receptor agonist in rats: involvement of heteromeric P2X2/3 compound 2-carboxyethyl germanium sesquioxide receptor signaling in capsaicin-insensitive primary afferent on cardiovascular function and motor activity in rats. neurons. J. Neurosci. 20(15), RC90–RC90 (2000). Pharmacology 41(5), 286–291 (1990). 37 Giniatullin R, Sokolova E, Nistri A. Modulation of 47 Golden EB, Lam PY, Kardosh A et al. Green tea polyphenols P2X3 receptors by Mg2+ on rat DRG neurons in culture. block the anticancer effects of bortezomib and other boronic Neuropharmacology 44(1), 132–140 (2003). acid-based proteasome inhibitors. Blood 113(23), 5927–5937 38 Kawate T, Michel JC, Birdsong WT, Gouaux E. Crystal (2009). structure of the ATP-gated P2X(4) ion channel in the closed 48 Yumimoto K, Akiyoshi S, Ueo H et al. F-box protein state. Nature 460(7255), 592–598 (2009). FBXW7 inhibits cancer metastasis in a non-cell- 39 Stanchev D, Blosa M, Milius D et al. Cross-inhibition autonomous manner. J. Clin. Invest. 125(2), 621–635 between native and recombinant TRPV1 and P2X(3) (2015). receptors. Pain 143(1–2), 26–36 (2009). 49 Yamaguchi H, Shimada Y, Takeda T, Nakamura T, Mano 40 Konno K, Motomiya M, Oizumi K et al. Results of N. A novel extraction method based on a reversible chemical multicenter placebo-controlled study on organogermanium conversion for the LC/MS/MS analysis of the stable compound in the treatment of unresectable lung cancer. organic germanium compound Ge-132. Anal. Chem. 87(4), Biotherapy (in Japanese) 4, 1053–1063 (1990). 2042–2047 (2015). 41 Tsuzuki K, Kondo E, Fukuoka T et al. Differential 50 Inoue K, Tsuda M, Koizumi S. ATP receptors in pain regulation of P2X(3) mRNA expression by peripheral nerve sensation: Involvement of spinal microglia and P2X(4) injury in intact and injured neurons in the rat sensory receptors. Purinergic Signal 1(2), 95–100 (2005). ganglia. Pain 91(3), 351–360 (2001). 51 Cambridge Crystallographic Data Centre. 42 Waldron JB, Sawynok J. Peripheral P2X receptors and www.ccdc.cam.ac.uk/conts/retrieving.html nociception: interactions with biogenic amine systems. Pain 52 SDBSWeb. 110(1–2), 79–89 (2004). http://sdbs.db.aist.go.jp •• The roles of peripheral P2X receptors for nociception signals are described.

1246 Future Med. Chem. (2015) 7(10) future science group