DOCSLIB.ORG

Molecular Cloning of the Human Eosinophil-Derived Neurotoxin: a Member of the Ribonuclease Gene Family (Neutrophils/Cationic Proteins/Angiogenin) HELENE F

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Molecular Cloning of the Human Eosinophil-Derived Neurotoxin: a Member of the Ribonuclease Gene Family (Neutrophils/Cationic Proteins/Angiogenin) HELENE F Proc. Natd. Acad. Sci. USA Vol. 86, pp. 4460-4464, June 1989 Biochemistry Molecular cloning of the human eosinophil-derived neurotoxin: A member of the ribonuclease gene family (neutrophils/cationic proteins/angiogenin) HELENE F. ROSENBERG*t, DANIEL G. TENENt, AND STEVEN J. ACKERMAN* Divisions of *Infectious Diseases and tHematology/Oncology, Department of Medicine, The Beth Israel Hospital and Harvard Medical School, Boston, MA 02215 Communicated by Seymour J. Klebanoff, March 30, 1989 ABSTRACT We have isolated a 725-base-pair cDNA clone sequence showed 67% identity with the amino-terminal se- for human eosinophil-derived neurotoxin (EDN). EDN is a quence ofthe related eosinophil granule protein, ECP, as well distinct cationic protein of the eosinophil's large specific gran- as 29% identity with the sequence of human pancreatic ule known primarily for its ability to induce ataxia, paralysis, ribonuclease (HPR), and was shown to be identical to the and central nervous system cellular degeneration in experi- amino-terminal sequences of both a nonsecretory ribonucle- mental animals (Gordon phenomenon). The open reading ase isolated from human urine (HNSR) (8) and human liver frame encodes a 134-amino acid mature polypeptide with a ribonuclease (HLR) (9). Slifman et al. (10) and Gullberg et al. molecular mass of 15.5 kDa and a 27-residue amino-terminal (11) have shown that both EDN and ECP have ribonuclease hydrophobic leader sequence. The sequence of the mature activity. The significance of this ribonuclease activity as well polypeptide is identical to that reported for human urinary as the physiologic role of EDN in eosinophil function remain ribonuclease [Beintema, J. J., Hofsteenge, J., Iwama, M., unknown. Morita, T., Ohgi, K., Irie, M., Sugiyama, R. H., Schieven, We report the isolation of a 725-base-pair (bp) cDNA clone G. L., Dekker, C. A. & Glitz, D. G. (1988) Biochemistry 27, for EDN and have found that the complete amino acid 4530-4538] and to the amino-terminal sequence of human liver sequence of EDN is identical to that of HNSR (8).§ Analysis ribonuclease [Sorrentino, S., Tucker, G. K. & Glitz, D. G. of EDN mRNA in various hematopoietic cells suggests that (1988) J. Biol. Chem. 263, 16125-16131]; the cDNA encodes a there may also be a protein in neutrophils that is identical or tryptophan in position 7, which was previously unidentified in very closely related to EDN. the amino acid sequences of EDN or the urinary and liver ribonucleases. Both EDN and the related granule protein, eosinophil cationic protein, have ribonucleolytic activity; se- METHODS quence similarities among EDN, eosinophil cationic protein, cDNA Library Screening. cDNA clones for EDN were ribonucleases from liver, urine, and pancreas, and angiogenin isolated from a Agtll library prepared from poly(A)+ RNA derme a ribonuclease multigene family. mRNA encoding EDN purified from the peripheral mononuclear cells of a patient was detected in uninduced HL-60 cells and was up-regulated in with eosinophilic leukemia (12). Screening was done with a cells induced toward eosinophilic differentiation with B-cell 17-base 32-fold-degenerate oligonucleotide (Fig. 1) synthe- growth factor 2/interleukin 5 and toward neutrophilic differ- sized on an Applied Biosystems model 381 DNA synthesizer entiation with dimethyl sulfoxide. EDN mRNA was detected in and radiolabeled on the 5' end using [y-32P]ATP and T4 mature neutrophils even though EDN-like neurotoxic activity is polynucleotide kinase (13) or on the 3' end with [a-32P]dCTP not found in neutrophil extracts. These results suggest that and terminal deoxynucleotidyltransferase (International Bio- neutrophils contain a protein that is closely related or identical technologies). Prehybridization, hybridization, and washing to EDN. was done as described (15), except for a washing procedure that included two washes at room temperature in 6x SSC (1 x The human eosinophil granule contains a number of distinct, SSC = 0.015 M sodium citrate/0.15 M NaCl, pH 7.0) arginine-rich cationic proteins that have been purified and followed by a 1-min final wash in 6-x SSC at 37°C. Positive extensively characterized (1, 2). One ofthese, the eosinophil- recombinants were purified and the inserts were subcloned derived neurotoxin (EDN), is a glycosylated, low molecular into M13 phage for dideoxynucleotide sequencing (16). Se- mass protein (1, 3) found in the matrix of the eosinophil's quence evaluation was done with the assistance of BIONET large specific granule (4). Whereas other eosinophil granule- and DNASTAR (DNASTAR, Inc., Madison, WI) sequence derived proteins, such as eosinophil cationic protein (ECP) analysis software. and major basic protein, display potent cytotoxic and hel- Purification of RNA from Peripheral Blood Cells. Peripheral minthotoxic activities (2), the only known biological activity blood granulocytes obtained by leukapheresis of a patient of EDN is its ability to induce ataxia and paralysis and to with the hypereosinophilic syndrome were washed twice in damage myelinated neurons when injected intrathecally or cold Hanks' balanced salt solution (HBSS) and the erythro- intracerebrally into experimental animals (3, 5, 6) [the Gor- cytes were lysed by brief suspension in ice-cold lysis buffer don phenomenon (7)]. Human EDN purified from eosinophil (100 mM potassium carbonate/150 mM ammonium chloride/ granule extracts migrates as two bands with apparent mo- 0.1 mM EDTA, pH 7.2) followed by another wash with cold lecular masses of 18.6 and 20.1 kDa when analyzed by HBSS. The resuspended cell pellet was layered over a SDS/PAGE; digestion with endoglycosidase F results in a shift to a single band with a molecular mass of approximately Abbreviations: EDN, eosinophil-derived neurotoxin; ECP, eosino- 16 kDa (6). Fifty-three amino-terminal residues of purified phil cationic protein; HPR, human pancreatic ribonuclease; HNSR, EDN have been sequenced directly (6); the amino-terminal human non-secretory ribonuclease; HLR, human liver ribonu- clease; BCGF-2, B-cell growth factor 2; IL-5, interleukin 5; DMSO, dimethyl sulfoxide. The publication costs of this article were defrayed in part by page charge tTo whom reprint requests should be addressed. payment. This article must therefore be hereby marked "advertisement" §The sequence reported in this paper has been deposited in the in accordance with 18 U.S.C. §1734 solely to indicate this fact. GenBank data base (accession no. M24157). 4460 Downloaded by guest on September 23, 2021 Biochemistry: Rosenberg et al. Proc. Natl. Acad. Sci. USA 86 (1989) 4461 HL-60 GCTGGATCAGTTCTCACAGGAGCTACAGCGCGGAGACTGGG CATG 50 subline of committed to eosinophilic differentiation MV -2 !6 (19) grown in the absence of inducing agents or in the presence of 10o (vol/vol) B-cell growth factor 2/interleukin 10 Io P K L F T S Q I C LL L L L G L L - 9 5 (BCGF-2/IL-5) (Cellular Products) for 72 hr. 10 Northern Blotting and Hybridization. Total RNA samples TGGCTGTGGAGGGCTCACTCCATGTCAAACCTCCACAGTTTACCTGGGCT 151 (10 ,ug), extracted and purified as described above, were A V E G S L H V k f f8 p p q t W a analyzed by agarose/formaldehyde gel electrophoresis, CAATGGTTTGAAACCCAGCACATCAATATGACCTCCCAGCAATGCACCAA 20(0 ethidium-stained to ensure equivalent RNA loading, and q w f e t q h i n m t s q q c t n 2!5 #73 blotted onto nylon membranes (ICN) in lOx SSC (13). The TGCAATGCAGGTCATTAACAATTATCAACGGCGATGCAAAAACCAAAATA 25(0 EDN cDNA probe (bases 171-725) was labeled with [a- a m q v i n n y q r r c k n q n t 4 2 32P]dCTP by the random hexamer priming method (20). CTTTCCTTCTTACAACTTTTGCTAACGTAGTTAATGTTTGTGGTAACCCA 3030 Filters were prehybridized for at least 4 hr in a solution f 1 1 t t f a n v v n v c g n p 538 containing Sx SSC, 50% (vol/vol) formamide, 5x Den- AATATGACCTGTCCTAGTAACAAAACTCGCAAAAATTGTCACCACAGTGG 35Sn hardt's solution (13), 0.05 M sodium phosphate (pH 6.5), 1% n m t c p s n k t r k n c h h s g 755 glycine, 0.1% SDS, and sheared denatured salmon sperm EI DNA (250 at 420C. Hybridization was done in a AAGCCAGGTGCCTTTAATCCACTGTAACCTCACAACTCCAAGTCCACAGA 40C0 ;Lg/,.l) S q v p 1 i h C n 1 t t p S p q n 92 solution containing 50% formamide, 5 x SSC, 1 x Denhardt's solution, 0.02 M sodium phosphate (pH 6.5), and denatured ATATTTCAAACTGCAGGTATGCGCAGACACCAGCAAACATGTTCTATATA 450C s n c r a t a n m f 108 radiolabeled probe (106 cpm/ml) at 420C for at least 12 hr (13). i y q p y i Hybridized filters were washed twice at room temperature in GTTGCATGTGACAACAGAGATCAACGACGAGACCCTCCACAGTATCCGGT 50O 2x SSC and once for 30 min at 55°C in 0.2x SSC; washed v a c d n r d q r r d p p q y p v 125 filters were exposed for 48 hr to Kodak XAR film with a single GGTTCCAGTTCACCTGGATAGAATCATCTAAGCTCCTGTATCAGCACTCC 550 intensifying screen at -80°C. RNA size standards (0.16-1.77 V p v h 1 d r i i 134 kilobases) were purchased from Bethesda Research Labora- TCATCATCACTCATCTGCCAAGCTCCTCAATCATAGCCAAGATCCCATCT 600 tories. CTCCATATACTTTGGGTATCAGCATCTGTCCTCATCAGTCTCCATACCCC 650 RESULTS Isolation and Sequencing of the cDNA Clone. Primary TTCAGCTTTCCTGAGCTGAAGTGCCTTGTGAACCCTGCAATAAACTGCTT 700 screening ofthe eosinophil leukemia Agtll cDNA library with the 32-fold-degenerate oligonucleotide 73 (Fig. 1) yielded a TGCAAATTCAAAAAAAAAAAAAAAA 725 554-bp cDNA clone (with the 5' end at nucleotide 171). Subsequent screening of400,000 recombinant phage with the FIG. 1. Nucleotide sequence ofthe 725-base coding strand ofthe EDN cDNA with translation of the open reading frame (161 amino cDNA isolate yielded 20 positive recombinants (frequency acids), potential N-linked glycosylation sites (underlined), and loca- 0.005%). Fig. 1 shows the nucleotide sequence of the cDNA tion of the 32-fold degenerate (oligonculeotide 73) 17-base oligonu- for EDN.
Load more

Recommended publications
  • Stem Cells Cloning Prons & Cons
    & Trans g ge in n n e s o l i s C Cloning and Transgenesis Kalodimou, Clon Transgen 2014, 3:3 ISSN: 2168-9849 DOI: 10.4172/2168-9849.1000127 Short Communication Open Access Stem Cells Cloning Prons & Cons Vasiliki E Kalodimou* Research and Regenerative Medicine Department, IASO Maternity Hospital, Athens, Greece *Corresponding author: Vasiliki E Kalodimou, Head of Flow Cytometry-Research and Regenerative Medicine Department, IASO Maternity Hospital, Athens, Greece, Tel: 0030-210-618-5; E-mail: [email protected] Rec date: May 16, 2014; Acc date: Jun 30, 2014; Pub date: July 2, 2014 Copyright: © 2014 Kalodimou VE. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Stem Cell Cloning the target cell. In principle, this may be dangerous, because the gene therapy vector can potentially modify the activity of neighboring genes Over the last several decades, the ideas of both stem cell research (positively or negatively) in close proximity to the insertion site or and cloning have received significantly more attention than ever even inactivate host genes by integrating into them [6]. These before; currently there are 23 open/completed clinical trials, together phenomena may contribute to the malignant transformation of the with a great deal of controversy. This new advances in medical targeted cells, ultimately resulting in cancer. Another major limitation technology had provide scientific with a new view of potential to help of using adult stem cells is that it is relatively difficult to maintain the people suffering from various diseases as well as to help them recover stem cell state during ex vivo manipulations.
    [Show full text]
  • Human Cloning: Must We Sacrifice Medical Research in the Name of a Total Ban?
    S. HRG. 107–812 HUMAN CLONING: MUST WE SACRIFICE MEDICAL RESEARCH IN THE NAME OF A TOTAL BAN? HEARING BEFORE THE COMMITTEE ON THE JUDICIARY UNITED STATES SENATE ONE HUNDRED SEVENTH CONGRESS SECOND SESSION FEBRUARY 5, 2002 Serial No. J–107–55 Printed for the use of the Committee on the Judiciary ( U.S. GOVERNMENT PRINTING OFFICE 83–684 PDF WASHINGTON : 2002 For sale by the Superintendent of Documents, U.S. Government Printing Office Internet: bookstore.gpo.gov Phone: toll free (866) 512–1800; DC area (202) 512–1800 Fax: (202) 512–2250 Mail: Stop SSOP, Washington, DC 20402–0001 VerDate Feb 1 2002 09:13 Jan 16, 2003 Jkt 083684 PO 00000 Frm 00001 Fmt 5011 Sfmt 5011 C:\HEARINGS\83684.TXT SJUD4 PsN: CMORC COMMITTEE ON THE JUDICIARY PATRICK J. LEAHY, Vermont, Chairman EDWARD M. KENNEDY, Massachusetts ORRIN G. HATCH, Utah JOSEPH R. BIDEN, JR., Delaware STROM THURMOND, South Carolina HERBERT KOHL, Wisconsin CHARLES E. GRASSLEY, Iowa DIANNE FEINSTEIN, California ARLEN SPECTER, Pennsylvania RUSSELL D. FEINGOLD, Wisconsin JON KYL, Arizona CHARLES E. SCHUMER, New York MIKE DEWINE, Ohio RICHARD J. DURBIN, Illinois JEFF SESSIONS, Alabama MARIA CANTWELL, Washington SAM BROWNBACK, Kansas JOHN EDWARDS, North Carolina MITCH MCCONNELL, Kentucky BRUCE A. COHEN, Majority Chief Counsel and Staff Director SHARON PROST, Minority Chief Counsel MAKAN DELRAHIM, Minority Staff Director (II) VerDate Feb 1 2002 09:13 Jan 16, 2003 Jkt 083684 PO 00000 Frm 00002 Fmt 5904 Sfmt 5904 C:\HEARINGS\83684.TXT SJUD4 PsN: CMORC C O N T E N T S STATEMENTS OF COMMITTEE MEMBERS Page Brownback, Hon.
    [Show full text]
  • MPO) in Inflammatory Communication
    antioxidants Review The Enzymatic and Non-Enzymatic Function of Myeloperoxidase (MPO) in Inflammatory Communication Yulia Kargapolova * , Simon Geißen, Ruiyuan Zheng, Stephan Baldus, Holger Winkels * and Matti Adam Department III of Internal Medicine, Heart Center, Faculty of Medicine and University Hospital of Cologne, 50937 North Rhine-Westphalia, Germany; [email protected] (S.G.); [email protected] (R.Z.); [email protected] (S.B.); [email protected] (M.A.) * Correspondence: [email protected] (Y.K.); [email protected] (H.W.) Abstract: Myeloperoxidase is a signature enzyme of polymorphonuclear neutrophils in mice and humans. Being a component of circulating white blood cells, myeloperoxidase plays multiple roles in various organs and tissues and facilitates their crosstalk. Here, we describe the current knowledge on the tissue- and lineage-specific expression of myeloperoxidase, its well-studied enzymatic activity and incoherently understood non-enzymatic role in various cell types and tissues. Further, we elaborate on Myeloperoxidase (MPO) in the complex context of cardiovascular disease, innate and autoimmune response, development and progression of cancer and neurodegenerative diseases. Keywords: myeloperoxidase; oxidative burst; NETs; cellular internalization; immune response; cancer; neurodegeneration Citation: Kargapolova, Y.; Geißen, S.; Zheng, R.; Baldus, S.; Winkels, H.; Adam, M. The Enzymatic and Non-Enzymatic Function of 1. Introduction. MPO Conservation Across Species, Maturation in Myeloid Progenitors, Myeloperoxidase (MPO) in and its Role in Immune Responses Inflammatory Communication. Myeloperoxidase (MPO) is a lysosomal protein and part of the organism’s host-defense Antioxidants 2021, 10, 562. https:// system. MPOs’ pivotal function is considered to be its enzymatic activity in response to doi.org/10.3390/antiox10040562 invading pathogenic agents.
    [Show full text]
  • Multipotent Cell Types in Primary Fibroblast Cell Lines Used to Clone Pigs Using Somatic Cell Nuclear Transfer Sharon J
    & Trans Harrison et al., Clon Transgen 2015, 4:2 g ge in n n e DOI: 10.4172/2168-9849.1000136 s o l i s C Cloning & Transgenesis ISSN: 2168-9849 Research Article Open Access Multipotent Cell Types in Primary Fibroblast Cell Lines Used to Clone Pigs using Somatic Cell Nuclear Transfer Sharon J. Harrison, Luke F.S. Beebe, Ivan Vassiliev, Stephen M. McIlfatrick and Mark B. Nottle* Reproductive Biotechnology Group, Centre for Stem Cell Research, Robinson Institute School of Paediatrics and Reproductive Health, University of Adelaide, Adelaide, South Australia, 5005, Australia Abstract We have previously demonstrated that the use of porcine mesenchymal stem cells (MSCs) isolated from the bone marrow can increase the proportion of somatic cell nuclear transfer (SCNT) embryos that develop to the blastocyst stage compared with adult fibroblasts obtained from the same animal. The aim of the present study was to determine if MSCs are also present in primary cultures of adult fibroblasts which are commonly used for cloning live animals. To do this we chose a primary culture of adult fibroblasts that we had previously used to clone pigs. Single cell clones were isolated using low-density plating. After seven days of culture 63% of colonies displayed typical fibroblast morphology, while the remainder appeared cobblestone-like in appearance. Two of the 57 clones that displayed fibroblast morphology differentiated into adipocytes but not chondrocytes or osteocytes (uni-potent clones). Three of the 33 cobblestone-like clones differentiated into chondrocytes only, while 3 differentiated into adipocytes and chondrocytes but not osteocytes (bi-potent clones). One of the bi-potent cobblestone-like clones was then used for SCNT and in vitro development compared with a fibroblast-like clone which did not differentiate.
    [Show full text]
  • Eosinophil-Derived Neurotoxin (EDN/Rnase 2) and the Mouse Eosinophil-Associated Rnases (Mears): Expanding Roles in Promoting Host Defense
    Int. J. Mol. Sci. 2015, 16, 15442-15455; doi:10.3390/ijms160715442 OPEN ACCESS International Journal of Molecular Sciences ISSN 1422-0067 www.mdpi.com/journal/ijms Review Eosinophil-Derived Neurotoxin (EDN/RNase 2) and the Mouse Eosinophil-Associated RNases (mEars): Expanding Roles in Promoting Host Defense Helene F. Rosenberg Inflammation Immunobiology Section, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD 20892, USA; E-Mail: [email protected]; Tel.: +1-301-402-1545; Fax: +1-301-480-8384 Academic Editor: Ester Boix Received: 18 May 2015 / Accepted: 30 June 2015 / Published: 8 July 2015 Abstract: The eosinophil-derived neurotoxin (EDN/RNase2) and its divergent orthologs, the mouse eosinophil-associated RNases (mEars), are prominent secretory proteins of eosinophilic leukocytes and are all members of the larger family of RNase A-type ribonucleases. While EDN has broad antiviral activity, targeting RNA viruses via mechanisms that may require enzymatic activity, more recent studies have elucidated how these RNases may generate host defense via roles in promoting leukocyte activation, maturation, and chemotaxis. This review provides an update on recent discoveries, and highlights the versatility of this family in promoting innate immunity. Keywords: inflammation; leukocyte; evolution; chemoattractant 1. Introduction The eosinophil-derived neurotoxin (EDN/RNase 2) is one of the four major secretory proteins found in the specific granules of the human eosinophilic leukocyte (Figure 1). EDN, and its more highly charged and cytotoxic paralog, the eosinophil cationic protein (ECP/RNase 3) are released from eosinophil granules when these cells are activated by cytokines and other proinflammatory mediators [1,2].
    [Show full text]
  • Human Cathelicidin LL-37 Is a Chemoattractant for Eosinophils and Neutrophils That Acts Via Formyl-Peptide Receptors
    Original Paper Int Arch Allergy Immunol 2006;140:103–112 Received: January 3, 2005 Accepted after revision: December 19, 2005 DOI: 10.1159/000092305 Published online: March 24, 2006 Human Cathelicidin LL-37 Is a Chemoattractant for Eosinophils and Neutrophils That Acts via Formyl-Peptide Receptors a a b G. Sandra Tjabringa Dennis K. Ninaber Jan Wouter Drijfhout a a Klaus F. Rabe Pieter S. Hiemstra a b Departments of Pulmonology, and Immunohematology and Blood Transfusion, Leiden University Medical Center, Leiden , The Netherlands Key Words ting using antibodies directed against phosphorylated Eosinophils Neutrophils Chemotaxis Antimicrobial ERK1/2. Results: Our results show that LL-37 chemoat- peptides Innate immunity Lung infl ammation tracts both eosinophils and neutrophils. The FPR antag- onistic peptide tBoc-MLP inhibited LL-37-induced che- motaxis. Whereas the FPR agonist fMLP activated ERK1/2 Abstract in neutrophils, LL-37 did not, indicating that fMLP and Background: Infl ammatory lung diseases such as asth- LL-37 deliver different signals through FPRs. Conclu- ma and chronic obstructive pulmonary disease (COPD) sions: LL-37 displays chemotactic activity for eosinophils are characterized by the presence of eosinophils and and neutrophils, and this activity is mediated via an FPR. neutrophils. However, the mechanisms that mediate the These results suggest that LL-37 may play a role in in- infl ux of these cells are incompletely understood. Neu- fl ammatory lung diseases such as asthma and COPD. trophil products, including neutrophil elastase and anti- Copyright © 2006 S. Karger AG, Basel microbial peptides such as neutrophil defensins and LL- 37, have been demonstrated to display chemotactic activity towards cells from both innate and adaptive im- Introduction munity.
    [Show full text]
  • Instant Notes: Immunology, Second Edition
    Immunology Second Edition The INSTANT NOTES series Series Editor: B.D. Hames School of Biochemistry and Molecular Biology, University of Leeds, Leeds, UK Animal Biology 2nd edition Biochemistry 2nd edition Bioinformatics Chemistry for Biologists 2nd edition Developmental Biology Ecology 2nd edition Immunology 2nd edition Genetics 2nd edition Microbiology 2nd edition Molecular Biology 2nd edition Neuroscience Plant Biology Chemistry series Consulting Editor: Howard Stanbury Analytical Chemistry Inorganic Chemistry 2nd edition Medicinal Chemistry Organic Chemistry 2nd edition Physical Chemistry Psychology series Sub-series Editor: Hugh Wagner Dept of Psychology, University of Central Lancashire, Preston, UK Psychology Cognitive Psychology Forthcoming title Physiological Psychology Immunology Second Edition P.M. Lydyard Department of Immunology and Molecular Pathology, Royal Free and University College Medical School, University College London, London, UK A. Whelan Department of Immunology, Trinity College and St James’ Hospital, Dublin, Ireland and M.W. Fanger Department of Microbiology and Immunology, Dartmouth Medical School, Lebanon, New Hampshire, USA © Garland Science/BIOS Scientific Publishers Limited, 2004 First published 2000 This edition published in the Taylor & Francis e-Library, 2005. “To purchase your own copy of this or any of Taylor & Francis or Routledge’s collection of thousands of eBooks please go to www.eBookstore.tandf.co.uk.” Second edition published 2004 All rights reserved. No part of this book may be reproduced or
    [Show full text]
  • Rapid Publication
    Rapid Publication Monocyte-Chemotactic Activity of Defensins from Human Neutrophils Mary C. Territo,* Tomas Ganz,** Michael E. Selsted,*1 and Robert Lehrer*II Departments of*Medicine and §Pathology, and * Will Rogers Institute Pulmonary Research Laboratory, Centerfor the Health Sciences, University ofCalifornia, Los Angeles, California 90024; and IlDepartment ofMedicine, Veterans Administration Medical Center, West Los Angeles, California 90073 Abstract Methods We investigated the monocyte-chemotactic activity of frac- Leukocytes for chemotactic studies were obtained from heparinized tionated extracts of human neutrophil granules. Monocyte- peripheral blood by Ficoll-Hypaque density separation to obtain chemotactic activity was found predominantly in the defensin- mononuclear cells, followed by dextran sedimentation to obtain neu- trophils (5). Cells were washed and resuspended at 106 monocytes or containing fraction of the neutrophil granules. Purified prepa- neutrophils/ml in HBSS containing 0.1% BSA (Calbiochem-Behring rations of each of the three human defensins (HNP-1, HNP-2, Corp., La Jolla, CA). HNP-3) were then tested. HNP-1 demonstrated significant Granule-rich fractions were prepared from neutrophils from single chemotactic activity for monocytes: Peak activity was seen at donor leukophoresis packs (Hemacare, Van Nuys, CA) containing 1-3 HNP-1 concentrations of 5 X 10' M and was 49±20% X 10'° cells, of which > 90% were viable PMN. After suspension in (mean±SE, n = 9) of that elicited by 10-8 M FMLP. HNP-2 HBSS (pH 7.4) with 2.5 mM MgCl2, the cell suspension was sealed in a (peak activity at 5 X i0' M) was somewhat less active, yield- nitrogen "bomb" (Parr Instrument Co., Moline, IL) and pressurized to ing 19±10% (n = 11).
    [Show full text]
  • The Lactoferrin Receptor May Mediate the Reduction of Eosinophils in the Duodenum of Pigs Consuming Milk Containing Recombinant Human Lactoferrin
    Biometals DOI 10.1007/s10534-014-9778-8 The lactoferrin receptor may mediate the reduction of eosinophils in the duodenum of pigs consuming milk containing recombinant human lactoferrin Caitlin Cooper • Eric Nonnecke • Bo Lo¨nnerdal • James Murray Received: 11 February 2014 / Accepted: 16 July 2014 Ó Springer Science+Business Media New York 2014 Abstract Lactoferrin is part of the immune system effects of consumption of milk containing recombi- and multiple tissues including the gastrointestinal (GI) nant human lactoferrin (rhLF-milk) on small intestinal tract, liver, and lung contain receptors for lactoferrin. eosinophils and expression of eosinophilic cytokines. Lactoferrin has many functions, including antimicro- In addition, LFR localization was analyzed in duode- bial, immunomodulatory, and iron binding. Addition- num and circulating eosinophils to determine if the ally, lactoferrin inhibits the migration of eosinophils, LFR could play a role in lactoferrin’s ability to inhibit which are constitutively present in the GI tract, and eosinophil migration. In the duodenum there were increase during inflammation. Lactoferrin suppresses significantly fewer eosinophils/unit area in pigs fed eosinophil infiltration into the lungs and eosinophil rhLF-milk compared to pigs fed control milk migration in -vitro. Healthy pigs have a large popu- (p = 0.025); this was not seen in the ileum lation of eosinophils in their small intestine and like (p = 0.669). In the duodenum, no differences were humans, pigs have small intestinal lactoferrin recep- observed in expression of the LFR, or any eosinophil tors (LFR); thus, pigs were chosen to investigate the migratory cytokines, and the amount of LFR protein was not different (p = 0.386).
    [Show full text]
  • Replication Study: Wnt Activity Defines Colon Cancer Stem Cells and Is
    REPLICATION STUDY Replication Study: Wnt activity defines colon cancer stem cells and is regulated by the microenvironment Anthony Essex1, Javier Pineda1, Grishma Acharya2, Hong Xin2, James Evans1, Reproducibility Project: Cancer Biology* 1PhenoVista Biosciences, San Diego, United States; 2Explora BioLabs Inc, San Diego, United States Abstract As part of the Reproducibility Project: Cancer Biology we published a Registered Report (Evans et al., 2015), that described how we intended to replicate selected experiments from the paper ‘Wnt activity defines colon cancer stem cells and is regulated by the microenvironment’ (Vermeulen et al., 2010). Here, we report the results. Using three independent primary spheroidal colon cancer cultures that expressed a Wnt reporter construct we observed high Wnt activity was associated with the cell surface markers CD133, CD166, and CD29, but not CD24 and CD44, while the original study found all five markers were correlated with high Wnt activity (Figure 2F; Vermeulen et al., 2010). Clonogenicity was highest in cells with high Wnt activity and clonogenic potential of cells with low Wnt activity were increased by myofibroblast-secreted factors, including HGF. While the effects were in the same direction as the original study (Figure 6D; Vermeulen et al., 2010) whether statistical significance was reached among the different conditions varied. When tested in vivo, we did not find a difference in tumorigenicity between high and low Wnt activity, while the original study found cells with high Wnt activity were more effective in inducing tumors (Figure 7E; Vermeulen et al., 2010). Tumorigenicity, however, was increased with *For correspondence: myofibroblast-secreted factors, which was in the same direction as the original study (Figure 7E; [email protected]; Vermeulen et al., 2010), but not statistically significant.
    [Show full text]
  • Specific Granule Deficiency Karen J
    Selective Defect in Myeloid Cell Lactoferrin Gene Expression in Neutrophil Specific Granule Deficiency Karen J. Lomax,* John 1. Gallin,* Daniel Rotrosen,* Gordon D. Raphael,* Michael A. Kaliner,* Edward J. Benz, Jr.,* Laurence A. Boxer,§ and Harry L. Malech* *Bacterial Diseases Section and Allergic Diseases Section, Laboratory of Clinical Investigation, National Institute ofAllergy and Infectious Diseases, National Institutes ofHealth, Bethesda, Maryland 20892; tDepartment ofMedicine, Yale University, New Haven, Connecticut 06510; and §Department ofPediatrics, University ofMichigan, Ann Arbor, Michigan 48109 Abstract After subcellular fractionation of the granule components of SGD neutrophils on a sucrose gradient, the primary granule Neutrophil specific granule deficiency (SGD) is a congenital fraction is seen as a single broad band that is less dense than disorder associated with an impaired inflammatory response normal and the band of the expected density for specific gran- and a deficiency of several granule proteins. The underlying ules is absent (3-5). These abnormal banding patterns are as- abnormality causing the deficiencies is unknown. We exam- sociated with the absence or deficiency of a subset of neutro- ined mRNA transcription and protein synthesis of two neutro- phil secretory proteins that may not be limited to those usually phil granule proteins, lactoferrin and myeloperoxidase in SGD. found in specific granules such as lactoferrin and vitamin Metabolically labeled SGD nucleated marrow cells produced B- 12-binding protein. Other granule proteins, such as the pri- normal amounts of myeloperoxidase, but there was no detect- mary granule protein, defensin (6), and the tertiary granule able synthesis of lactoferrin. Transcripts of the expected size protein, gelatinase (2, 7) are also deficient.
    [Show full text]
  • Fecal Eosinophil Granule-Derived Proteins Reflect Disease Activity In
    THE AMERICAN JOURNAL OF GASTROENTEROLOGY Vol. 94, No. 12, 1999 © 1999 by Am. Coll. of Gastroenterology ISSN 0002-9270/99/$20.00 Published by Elsevier Science Inc. PII S0002-9270(99)00699-1 Fecal Eosinophil Granule-Derived Proteins Reflect Disease Activity in Inflammatory Bowel Disease Osamu Saitoh, M.D., Keishi Kojima, M.D., Kazunori Sugi, M.D., Ryoichi Matsuse, Ph.D., Kazuo Uchida, Ph.D., Kazue Tabata, Ph.D., Ken Nakagawa, M.D., Masanobu Kayazawa, M.D., Ichiro Hirata, M.D., and Ken-ichi Katsu, M.D. Second Department of Internal Medicine, Osaka Medical College, Takatsuki, and Kyoto Medical Science Laboratory, Kyoto, Japan OBJECTIVES: The aims of this study were: 1) to examine peroxidase (EPO). These proteins have potent cytotoxic whether the fecal levels of eosinophil granule-derived pro- action and are released from the cells after activation and teins reflect disease activity in inflammatory bowel disease stimulation of the cells (3). Intestinal mucosa of the patients (IBD); and 2) to examine the extracellular release of these with inflammatory bowel disease (IBD) is characterized by proteins from eosinophils and their stability in feces by an in epithelial cell damage and infiltration of various inflamma- vitro study. tory cells. The inflammatory cells include neutrophils, lym- phocytes, plasma cells, macrophages, and eosinophils. Neu- METHODS: We investigated 42 patients with ulcerative co- trophils contain various proteins such as lactoferrin, PMN litis (UC), 37 patients with Crohn’s disease (CD), and 29 (PMN)-elastase, myeloperoxidase, and lysozyme in their control subjects. The stool samples were collected at 4°C granules. We previously reported that the fecal levels of over 48 h and were homogenized.
    [Show full text]