GAPVD1 and ANKFY1 Mutations Implicate RAB5 Regulation in Nephrotic Syndrome

BASIC RESEARCH www.jasn.org

Tobias Hermle,1,2 Ronen Schneider,1 David Schapiro,1 Daniela A. Braun,1 Amelie T. van der Ven,1 Jillian K. Warejko,1 Ankana Daga,1 Eugen Widmeier,1 Makiko Nakayama,1 Tilman Jobst-Schwan,1 Amar J. Majmundar,1 Shazia Ashraf,1 Jia Rao,1 Laura S. Finn,3 Velibor Tasic,4 Joel D. Hernandez,5 Arvind Bagga,6 Sawsan M. Jalalah,7 Sherif El Desoky,8 Jameela A. Kari,8 Kristen M. Laricchia,9 Monkol Lek,9 Heidi L. Rehm,9 Daniel G. MacArthur,9 Shrikant Mane,10 Richard P. Lifton,10,11 Shirlee Shril,1 and Friedhelm Hildebrandt1

Due to the number of contributing authors, the afﬁliations are listed at the end of this article.

ABSTRACT Background Steroid-resistant nephrotic syndrome (SRNS) is a frequent cause of CKD. The discovery of monogenic causes of SRNS has revealed specific pathogenetic pathways, but these monogenic causes do not explain all cases of SRNS. Methods To identify novel monogenic causes of SRNS, we screened 665 patients by whole-exome sequencing. We then evaluated the in vitro functional significance of two genes and the mutations therein that we discovered through this sequencing and conducted complementary studies in podocyte-like Drosophila nephrocytes. Results We identified conserved, homozygous missense mutations of GAPVD1 in two families with early- onset NS and a homozygous missense mutation of ANKFY1 in two siblings with SRNS. GAPVD1 and ANKFY1 interact with the endosomal regulator RAB5. Coimmunoprecipitation assays indicated interaction between GAPVD1 and ANKFY1 proteins, which also colocalized when expressed in HEK293T cells. Silencing either protein diminished the podocyte migration rate. Compared with wild-type GAPVD1 and ANKFY1, the mutated proteins produced upon ectopic expression of GAPVD1 or ANKFY1 bearing the patient-derived mutations exhibited altered binding affinity for active RAB5 and reduced ability to rescue the knockout-induced defect in podocyte migration. Coimmunoprecipitation assays further demonstrated a physical interaction between nephrin and GAPVD1, and immunofluorescence revealed partial colocalization of these proteins in rat glomeruli. The patient-derived GAPVD1 mutations reduced nephrin-GAPVD1 binding affinity. In Dro- sophila,silencingGapvd1 impaired endocytosis and caused mistrafficking of the nephrin ortholog. Conclusions Mutations in GAPVD1 and probably in ANKFY1 are novel monogenic causes of NS. The discovery of these genes implicates RAB5 regulation in the pathogenesis of human NS.

J Am Soc Nephrol 29: 2123–2138, 2018. doi: https://doi.org/10.1681/ASN.2017121312

Received December 21, 2017. Accepted May 24, 2018.

Steroid-resistant nephrotic syndrome (SRNS) is T.H. and R.S. contributed equally to this work. characterized by edema, nephrotic-range protein- Published online ahead of print. Publication date available at uria, and hyperlipidemia. Mutations in approxi- www.jasn.org. mately 45 different genes have been discovered as Correspondence: Prof. Friedhelm Hildebrandt, Boston Child- 1–38 monogenic causes of SRNS (Supplemental ren’s Hospital, Harvard Medical School, Enders 561, 300 Long- Figure 1A) and our understanding of the patho- wood Avenue, Boston, MA 02115. Email: friedhelm. physiology of SRNS and podocyte biology in gen- [email protected] eral has been formed by the pathways delineated by Copyright © 2018 by the American Society of Nephrology

J Am Soc Nephrol 29: 2123–2138, 2018 ISSN : 1046-6673/2908-2123 2123 BASIC RESEARCH www.jasn.org discovery of these genes (Supplemental Figure 1A).1,3 The first Significance Statement gene to be found was nephrin (NPHS1), which encodes a ma- jor constituent of the slit diaphragm.4 Subsequently, muta- A number of single gene mutations have been identified as causes of tions of several proteins associated with the slit diaphragm nephrotic syndrome (NS). This paper describes the discovery of two GAPVD1 complex were identified. Linking the slit diaphragm to the new monogenic genes with mutations associated with NS, , with definite evidence for causality, and ANKFY1, as probably actin cytoskeleton to maintain the complex podocyte mor- causal. The genes are the first endosomal regulators and known phology seems essential because actin-binding and -regulating RAB5 interactors implicated in NS. Both proteins interact and affect proteins form the most numerous group among the mono- podocyte migration rate. GAPVD1 also interacts with the slit di- 1,3 aphragm protein nephrin. The mutations of GAPVD1 observed in genic causes of SRNS. More recently, mutations in CoQ10- biosynthesis genes,14–16 nucleoporins,39–41 and the KEOPS patients affect binding to nephrin and RAB5. Silencing the ortholog of GAPVD1 in the podocyte-like Drosophila nephrocytes results in 42 complex have been discovered as further monogenic causes mistrafficking of fly nephrin. These findings implicate RAB5 regu- of SRNS. This opened new avenues toward a better under- lation as a novel pathogenetic pathway of NS, potentially critical for standing of the complex pathogenesis of SRNS. nephrin trafficking. A role of endocytosis for podocyte biology has previously been proposed: The slit diaphragm protein nephrin is subject to endo- constructs were generated by PCR. Primers are shown in Sup- cytosis utilizing different branches of the endocytosis pathway.43–48 plemental Table 1. ANKFY1 rescue constructs were obtained In mice, phosphoinositide 3-kinases49,50 and effectors of vesicular by introduction of two synonymous mutations within the fission and clathrin uncoating are essential for the glomerular shRNA target sequences. filtration barrier. Knockout of the murine isoforms of dynamin, The following expression vectors were used: pRK5-N-Myc, synaptojanin, or endophilin each resulted in severe protein- pCDNA6.2-N-GFP,pQCXIPmCherry,andpSirenRetroQ. uria.51,52 In humans, no direct endosomal regulator has previ- Clones reflecting the mutations identified in individuals with ously been implicated in nephrotic syndrome. nephrotic syndrome were introduced into the cDNA constructs using Quik change II XL site-directed mutagenesis kit (Agilent Technologies). The following constructs were obtained from METHODS addgene: mCherry-Rab5CAQ79L (#35138), mCherry-Rab5DNS34N (#35139), mCh-Rab5 (#49201), pRK5myc Rac1 wt (#37030), and Study Approval pSpCas9(BB)-2A-GFP (PX458) (#48138). Approval for human subject research was obtained from the The GAPVD1-andANKFY1-specific and control scram- University of Michigan and the Boston Children’sHospital bled siRNAs were purchased from GE Dharmacon. Institutional Review Boards. All participants or their guard- Overexpression experiments were performed in HEK293T ians provided written informed consent. cells (ATCC biologic resource center). Immortalized human podocytes were a gift from Dr. Moin Saleem (University of Study Participants Bristol, Bristol, UK). After informed consent, clinical data and blood samples were HEK cells were maintained in DMEM, supplemented with obtained from individuals with nephrotic syndrome. Clinical 10% FBS, 50 IU/ml penicillin, and 50 mg/ml streptomycin. data were obtained using an established questionnaire (http:// Podocytes were maintained in RPMI 1640 plus GlutaMAX-I www.renalgenes.org). The diagnosis of NS was made by (pe- (Gibco) supplemented with 10% FBS, 50 IU/ml penicillin/ diatric) nephrologists, on the basis of standardized clinical and 50 mg/ml streptomycin, and insulin-transferrin-selenium-X. renal histologic criteria. Renal biopsy samples were evaluated Plasmids and siRNAs were transfected into HEK293T cells at 37° by renal pathologists. C or podocytes grown at the permissive temperature of 33°C using Lipofectamine 2000 or Lipofectamine RNAiMax, respectively (In- Homozygosity Mapping, Whole-Exome Resequencing, vitrogen). Knockdown in human podocyte cell lines employed and Mutation Calling pSirenRetroQ with 2–3 independent shRNAs directed against hu- Homozygosity mapping, whole-exome resequencing, and mu- man GAPVD1 or ANKFY1 for retroviral transduction. Puromycin tation calling were performed as described previously.22 was used to select transduced cells. Knockdown efficiency was confirmed for all experiments, shRNA targets are shown in Supple- Plasmids, siRNAs, Cell Culture, and Transfection mental Table 1. For rescue experiments, knockdown podocytes Human full-length GAPVD1 cDNA was subcloned after PCR underwent a transient transfection using murine Gapvd1 or hu- from human full-length cDNA (GenBank BC114937; GE man ANKFY1 constructs that are resistant to shRNA. Dharmacon). Mouse Gapvd1 was subcloned after PCR from murine full-length cDNA (RefSeq NM_025709) that was a gift from Dr. Alan Saltiel53 (University of California, San Diego). Immunoblotting, Immunoprecipitation, Pull-Down Human ANKFY1 isoform 1 cDNA (GenBank BC152991.1) Assay, and Immunofluorescence Staining and human NPHS1 cDNA (GenBank: BC156935.1) were ob- Immunoblotting, immunoprecipitation, and immunofluores- tained from the Harvard PlasmID Repository. Truncation cence staining were performed as described previously.39

2124 Journal of the American Society of Nephrology J Am Soc Nephrol 29: 2123–2138, 2018 www.jasn.org BASIC RESEARCH

Briefly, HEK293T cells were lysed and precleared using rec- Drosophila Studies Protein A-Sepharose 4B Conjugate (Life Technologies) over- Drosophila melanogaster stable RNAi stocks Gapvd1-RNAi 1 night. Then, equal amounts of protein were incubated with (#108453) and Gapvd1-RNAi 2 (#19649) were obtained from the EZview Red Anti-c-Myc Affinity Gel (Sigma-Aldrich) or Vienna Drosophila Resource Center. Prospero-GAL454 was used to GFP-nAb (Allele Biotechnology). Coimmunoprecipitation control expression in garland cell nephrocytes; actin-GAL4 (#3954; (co-IP) experiments were performed in three independent Bloomington stock) was used for ubiquitous expression. experiments. Immunoblotting was performed using rabbit Fluorescent tracer uptake in nephrocytes was performed as anti-GAPVD1 (#A302–116; Bethyl Laboratories), mouse previously described.55 Briefly, nephrocytes were dissected in anti-ANKFY1 (sc-393353; Santa Cruz Biotechnology), mouse PBS and incubated with FITC-albumin (Sigma) for 30 seconds. anti–c-Myc (sc-40; Santa Cruz Biotechnology), rabbit anti–c-Myc After a fixation of 5 minutes in 8% paraformaldehyde, cells were (sc-789; Santa Cruz Biotechnology), mouse anti-GFP (sc-9996; rinsed in PBS and exposed to Hoechst 33342 (1:1000) for 20 Santa Cruz Biotechnology), rabbit anti-GFP (sc-8334; Santa Cruz seconds and mounted in Antifade Diamond. Cells were imaged Biotechnology), and rabbit anti-mCherry (ab167452; Abcam). using a Leica SP5X confocal microscope. Quantitation of fluo- Immunofluorescence of ANKFY1 was performed with mouse rescent tracer uptake was performed with ImageJ software. The anti-ANKFY1 (sc-393353). Rabbit anti-murine GAPVD1 was a results are expressed as a ratio to a control experiment with kind gift from Dr. Alan Saltiel.53 Other antibodies used were EGFP-RNAi that was done in parallel. guinea pig anti-NPHS1 (GP-N2; Progen) and rabbit anti-RAB5 For immunohistochemistry, nephrocytes were dissected, (#ab18211; Abcam). Paraffin-embedded human tissue sections fixed for 15 minutes in PBS containing 4% paraformaldehyde, (HP-901; amsbio) were deparaffinized in xylene for 10 minutes, andstainedaccordingto the standardprocedure. The following rehydrated, and antigen retrieval was performed by incubating primary antibodies were used: rabbit anti-sns56 (1:500, gift the slides for 40 minutes at 95°C in citrate buffer, pH 6.0. from S. Abmayr) and guinea pig anti-Kirre57 (1:200, gift Fluorescent images were obtained with a Leica SP5X or a from S. Abmayr). For imaging, a Leica SP5X confocal micro- Zeiss LSM 880 laser scanning microscope. scope was used. Image processing was done by ImageJ and Adobe Photoshop CS4 software. RAB5 Assay For transmission electron microscopy (TEM), nephrocytes RAB5 activity assay was performed using the Rab5 Activation were dissected and fixed in 4% formaldehyde and 0.5% glutaral- Assay Kit (#83701; NewEast Biosciences) according to the dehyde in 0.1 M cacodylate buffer, pH 7.4. TEM was carried out manufacturer’s instructions. Protein concentrations were de- usingstandardtechniques.Onecompletediameterofsixcellsfrom termined by Lowry’s method and equal amounts of protein three different animals was analyzed for ectopic slit diaphragms. were exposed to the RAB5-GTP–specific antibody. Areas where the labyrinthine channels are cut obliquely are rec- ognizable by elongated stretches of higher electron density along Podocyte Dextran Internalization Assay the cell surface. These areas were excluded from the quantitation. Human podocytes were exposed to culture medium containing 500 ng/ml Texas-Red-dextran 10 kD (ThermoFisher) for 30 Quantitative Real-Time PCR minutes at 37°C. Afterward, cells were rinsed twice with ice- Total RNA was isolated using TRIzol (Invitrogen) and purified cold PBS, fixed in 4% paraformaldehyde for 15 minutes in the withtheQiagenRNeasyMiniKitaccordingtothemanufacturer’s presence of Hoechst 33342 (1:1000), and mounted in Antifade instructions. Real-time PCR was performed using Taqman Diamond (ThermoFisher). Cells were imaged using a Leica probes (ThermoFisher Scientific). The RPL39 gene was used SP5X confocal microscope and uptake was quantified using to normalize expression data. ImageJ software in maximized intensity projections after thresholding. Statistical Analyses Paired t test was used to determine the statistical significance be- Podocyte Migration Assay tween two interventions. ANOVAfollowed by Dunnett’scorrection Real-time migration assay was performed using the IncuCyte (unless otherwise indicated) was used for multiple comparisons videomicroscopy system (Essen Bioscience) in 96-well plates (GraphPad Prism software). Asterisks indicate significance as fol- according to the manufacturer’s instructions. Briefly, 24 hours lows: *P,0.05, **P,0.01, ***P,0.001. A statistically significant after transfection scratch wounds were made using a 96-pin difference was defined as P,0.05. Error bars indicate SD. tool (WoundMaker) as per protocol. Cells were monitored automatically via live cell imaging and time-lapse images. Wound confluency was automatically acquired hourly and RESULTS recorded by the IncuCyte software (ZOOM). Data processing and analysis for migration assay were performed using the Mutations in GAPVD1 and ANKFY1, Two RAB5 IncuCyte 96-well Kinetic Cell Migration and Invasion Assay Interactors, in Families with Nephrotic Syndrome software module. Results are presented as time versus wound To discover novel monogenic causes of SRNS, we performed confluency. whole-exome sequencing (WES) in a cohort of 665 patients.

J Am Soc Nephrol 29: 2123–2138, 2018 GAPVD1 Is a Nephrotic Syndrome Gene 2125 BASIC RESEARCH www.jasn.org

Figure 1. WES identifies recessive disease-causing mutations in GAPVD1 and ANKFY1 in families with early-onset nephrotic syndrome. (A) Schematic of GAPVD1 cDNA with the corresponding protein including its functional domains. Arrows indicate the positions of two recessive mutations of GAPVD1 that were identified by WES in two families (B1391 and A4619) with nephrotic syndrome. (B) Schematic of ANKFY1 cDNA with the corresponding protein including its functional domains. Arrow indicates the position of one recessive missense mutation of ANKFY1 that was identified by WES in two individuals from family B1027 with nephrotic syndrome. (C) Alignment of GAPVD1 aa sequences for Homo sapiens, Mus musculus, Gallus gallus, Xenopus tropicalis, Danio rerio,andCiona intestinalis shows conservation of the residue Leucine 414. (D) Alignment of aa sequence of GAPVD1 for H. sapiens, M. musculus, G. gallus, X. tropicalis, D. rerio,andC. intestinalis shows conservation of the residue Arginine 937. (E) Alignment of aa sequence of ANKFY1 for H. sapiens, M. musculus, G. gallus, X. tropicalis, D. rerio, C. intestinalis, C. elegans,andD. melanogaster shows conservation of the residue Arginine 95. (F) Renal histology (trichrome staining) of patient A4619 with the Leu414Val mutation of GAPVD1 shows mesangial hypercellularity and expansion of the extracellular matrix (asterisks). (G) Renal histology (Jones silver stain) of patient A4619 confirms extracellular matrix expansion (asterisk). (H) Renal histology of patient B1027 (HE staining) reveals FSGS. (I and J) Electron microscopy image shows podocyte foot process effacement (arrow heads) in (I) A4619 and (J) B1391. (K) Renal ultrasound image of B1391 shows increased echogenicity with renal echogenicity equal to liver echogenicity. aa, amino acid.

2126 Journal of the American Society of Nephrology J Am Soc Nephrol 29: 2123–2138, 2018 www.jasn.org BASIC RESEARCH

We identiﬁed two homozygous missense mutations (p.Leu414Val and p.Arg937Gln) of the gene GTPase Activating Protein And VPS9 Domains 1 (GAPVD1) in two individuals Renal Biopsy Mesangial (A4619 and B1391) with early-onset nephrotic syndrome hypercellularity hypercellularity (Figure 1A, Supplemental Figures 1, B–D, G–J, and 2, A and b B, Table 1). The respective amino acid residues are conserved Renal normal Mesangial to C. intestinalis for both mutations (Figure 1, A, C, and D, Function Table 1) and causative mutations are located within a homo-

a zygosity peak (Supplemental Figure 2, A and B). The families were of Mexican and Arabic descent, respectively (Table 1). Onset Age of One patient (A4619) showed the unusual clinical course of (Proteinuria) congenital nephrotic syndrome with spontaneous remission after 18 months (Table 1), whereas nephrotic syndrome to persisted in the other case after 2 years of observation. Spon- Steroids Response taneous remission of congenital nephrotic syndrome has previously been described in certain alleles of nephrin (NPHS1).58–63 Neither patient exhibited extrarenal manifes- tations. The histology in both cases was characterized by Parental mesangial hypercellularity with expansion of the extracellular Consanguinity matrix (Figure 1, F and G, Supplemental Figure 1, G–J). This uncommon histologic pattern is suggestive of glomerular injury Ethnic Origin and is frequently observed with mutations of nephrin.64,65 TEM revealed foot process effacement (Figure 1, I and J). Renal ultrasound of both cases showed increased echogenicity (Figure 1K, Table 1). GAPVD1 has been described as an endosomal regulator that interacts with RAB5.53,66–71 GAPVD1 harbors both a GTPase activating and an inactivating domain, the RasGAP and VPS9 domains, respectively (Figure 1A). An activating

ExAC gnomAD Sex role as a guanine nucleotide exchange factor (GEF) for

0/13/121,408 0/25/277,226 F Arabic yes SRNS 18 mo normal RAB5 has been suggested.66,70 In an unbiased approach by WES, we further identified a . 0 0 F Indian not known not done 8 yr normal ND . 0 0 M Indian not known SRNS 11 yr normal FSGS (11 yr) ; M, male; ND, no data. . 0/27/120,882 0/71/272,940 F Mexican yes not done 2 mo homozygous mutation of the gene Ankyrin Repeat And FYVE C.i. C.i D.m D.m Domain Containing 1 (ANKFY1) in two siblings of a family with to Species Conserved Amino Acid FSGS and proteinuria (Figure 1B, Table 1). Similar to GAPVD1, ANKFY1 interacts with RAB5, serving as a versatile RAB5 effec- – D. melanogaster tor.72 75 The identified mutation (p.Arg95Leu) is conserved to ., D. melanogaster and locates within a homozygosity peak that is D.m shared between both siblings (Supplemental Figure 2, C and D). Renal biopsy revealed FSGS (Figure 1H). Renal ultrasound was without pathologic findings (Supplemental Figure 1F). Sanger sequencing of parental DNA confirmed segregation ANKFY1 , in four individuals from three families with SRNS of the mutations according to the status of affection for the

and families B1391 and B1027, whereas parental DNA could not be Zygosity Exon PPH2 SIFT MT obtained for A4619 (Supplemental Figure 1). WES detected no other likely causative mutations in our patients. Acid ; F, female; Del, deleteriousness; GAPVD1

Amino We thus identify mutations of GAPVD1 as a novel mono- Change genic cause of early-onset nephrotic syndrome, and ANKFY1 A p.Arg937Gln Hom 16 0, 99 Tol DC G p.Leu414Val Hom 5 0, 99 Tol DC T p.Arg95Leu Hom 2 1 Del DC T p.Arg95Leu Hom 2 1 Del DC . . most likely shares this role. Interestingly, both encoded pro- . . teins play a regulatory role for RAB5. Change Ciona intestinalis Nucleotide Mutations in , GAPVD1 and ANKFY1 Are Interaction Partners and

C.i. Colocalize in HEK293T Cells All genes that may cause monogenic SRNS in humans are expressed B1027_22 c.284 G B1391 c.2810 G A4619 c.1240 C B1027_21 c.284 G Family_ Kidneys enlarged on renal ultrasound. Proteinuria spontaneously resolved age 18 mo.

Individual 3 PPH2, PolyPhen-2 prediction score (http://genetics.bwh.harvard.edu/pph2/);ExAC, Exome SIFT, Aggregation Sorting Consortium Tolerant databasecausing; From (http://exac.broadinstitute.org); Intolerant prediction gnomAD, Genome score Aggregation (http://sift.jcvi.org/); Database MT, (http://gnomad.broadinstitute.org); Mutation Taster Hom, (http://www.mutationtaster.org/); homozygous; Tol, tolerated; DC, disease Table 1. GAPVD1 ANKFY1 a b in podocytes. Immunoblotting revealed expression of GAPVD1

J Am Soc Nephrol 29: 2123–2138, 2018 GAPVD1 Is a Nephrotic Syndrome Gene 2127 BASIC RESEARCH www.jasn.org

Figure 2. GAPVD1 and ANKFY1 proteins are expressed in a podocyte cell line and are interaction partners. (A) Transient, siRNAi- mediated silencing of GAPVD1 (arrow head) in human podocytes is demonstrated by immunoblot. This indicates endogenous expression of GAPVD1 in immortalized podocytes. (B) Transient, siRNAi-mediated silencing of ANKFY1 (arrow head) in human podocytes is demonstrated by immunoblot. This indicates endogenous expression of ANKFY1 in immortalized podocytes. (C) Western blot shows CRISPR/Cas9-mediated knockdown of GAPVD1 in HEK293T cells for two independent gRNAs (arrow head). This indicates

2128 Journal of the American Society of Nephrology J Am Soc Nephrol 29: 2123–2138, 2018 www.jasn.org BASIC RESEARCH and ANKFY1 in immortalized podocytes (Figure 2, A and B) and colocalized (Supplemental Figure 4, G–G’’). The extent of co- also in HEK293T cells (Figure 2, C and D). localization of GAPVD1 and ANKFY1 thus appears cell-type Next, we explored the subcellular localization of GAPVD1. dependent. Overexpression constructs of GAPVD1, including constructs We hypothesized that GAPVD1 and ANKFY1 proteins representing the patient mutations, predominantly localized interact. Using co-IP, we demonstrated interaction between to the cytosol (Figure 2E, Supplemental Figure 3, A–C). Trun- GFP-GAPVD1 and Myc-ANKFY1 (Figure 2M). Reciprocally, cations of GAPVD1 lacking the RasGAP domain localized to GFP-ANKFY1 precipitates Myc-GAPVD1 (Supplemental (RAB5-positive) vesicles (Supplemental Figure 3, D–F), Figure 5A). Introducing the mutations of GAPVD1 that although deleting the VPS9 domain had no overt effect caused nephrotic syndrome reduced binding of GAPVD1 (Supplemental Figure 3G). Eight different antibodies detected to ANKFY1 (Figure 2N, quantitation Figure 2O). These mu- overexpressed GAPVD1 in podocytes using immunofluores- tations thus weaken the interaction of GAPVD1 with cence but never the endogenous protein (data not shown). ANKFY1. We analyzed the subcellular localization of ANKFY1 in podocytes using a conditional CRISPR/Cas approach.76 ANKFY1 GAPVD1 Interacts with Nephrin was observed in intracellular vesicles that were absent from the Nephrin is subject to endocytosis51 and IQGAP1, another gRNA/GFP-expressing cells (Figure 2, F and F’). Applying RasGAP domain protein, interacts with nephrin.77 We there- Airyscan technology for enhanced resolution in human tissue fore hypothesized that GAPVD1 might interact with nephrin. sections, we confirmed a vesicular staining pattern of ANKFY1 Performing co-IP experiments in HEK293T cells, we found in podocytes that was absent in the control (Figure 2, G–H’’). that Myc-nephrin precipitated with GFP-GAPVD1 (Figure GFP-tagged overexpression constructs of ANKFY1 localized 3A). The reverse experiment confirmed this finding (Supple- to vesicles in cultured human podocytes that in turn fully mental Figure 5B). colocalized with mCherry-RAB5 (Supplemental Figure 4, Analyzing the GAPVD1 patient mutations R937Q and A–B’’), whereas endogenous RAB5 and ANKFY1 showed par- L414V, we observed a significantly reduced binding to tial colocalization (Supplemental Figure 4, C–C’’). The dele- Myc-nephrin for cDNA constructs reflecting these mutation of the FYVE domain of ANKFY1 abrogated vesicular tions (Figure 3B, quantitation Figure 3C). The mutations localization of overexpressed ANKFY1 (Supplemental Figure of GAPVD1 that cause nephrotic syndrome thus affect the 4, D and E), whereas the patient mutation ANKFY1-R95L interaction with nephrin. showed no overt mislocalization (Supplemental Figure 4F). Tomap the interactingdomains on GAPVD1, we performed We conclude that the SRNS-causing mutation does not alter truncation mapping by co-IP and found that the RasGAP do- endosomal localization of ANKFY1. main of GAPVD1 (aa 1–458) and the VPS9 domain of Studying HEK293T cells, we noted that overexpressed GAPVD1 (aa 1355–1460) were precipitated by full-length GFP-ANKFY1 and mCherry-GAPVD1 colocalize completely nephrin, whereas the large interjacent domain of GAPVD1 (Figure 2, I and J), whereas Mock-mCherry (Figure 2, K and (aa 458–1355) was not (Figure 3, D and F). Each of the func- L) showed partial colocalization. In cultured podocytes, tional domains of GAPVD1 seem to be sufficient for interac- tagged overexpression constructs of both proteins partially tion with nephrin (Figure 3, D and F).

endogenous expression of GAPVD1 in HEK293T cells and confirms the efficiency of the gRNAs. (D) Western blot shows CRISPR/ Cas9-mediated silencing of ANKFY1 in HEK293T cells for two independent gRNAs (arrow head). This indicates endogenous expression of ANKFY1 in HEK293T cells and confirms the efficiency of the gRNAs. (E) Overexpressed N-GFP-GAPVD1 localizes to the cytosol in cultured podocytes. (F and F’) CRISPR/Cas9 mediated silencing of ANKFY1 in human podocytes is marked by coexpression of GFP (shown in [F]) and abrogates the signal from small, cytosolic vesicles using an anti-ANKFY1 antibody (gRNA-expressing cells are outlined by dashed line and marked by arrow heads in [F’]). (G and H) Staining human renal tissue sections with anti-ANKFY1 results in (G and G’’) a diffuse signal that was more intense than (H and H’’) the control signal (secondary antibody alone). Enhanced resolution microscopy by Airyscan technology revealed (insets G–G’’) fine vesicles in all glomerular cells including podocytes, whereas (H–H’’) no vesicular pattern was detected in the control. Nephrin staining is shown in (G’ and G’’)and(H’ and H’’). Scale bars represent 10 mm. (I and J) Overexpressed GFP- ANKFY1andmCherry-GAPVD1colocalizeinHEK293Tcells(I–I’’). (J) Colocalization of GFP-ANKFY1 and mCherry-GAPVD1 is confirmed by a scatter plot and a high Pearson’scoefficient (0.98). (K and L) Colocalization of GFP-ANKFY1 and an mCherry control appears incomplete (K–K’’). (L) Pearson coefficient is 0.35. (M) Upon overexpression and co-IP N-Myc–tagged GAPVD1 precipitates GFP-ANKFY1, but not Mock-GFP, in HEK293T cells. (N) Upon overexpression and co-IP with anti-GFP antibody, GFP- tagged GAPVD1 precipitates Myc-ANKFY1, but not Mock-GFP, in HEK293T cells. GAPVD1 cDNA constructs that reflect the mutations from patients B1391 (asterisk) and A4619 (dagger) show reduced binding affinity to Myc-ANKFY1. (O) Quantitation of density from (N) shows a significantly reduced affinity of mutant GAPVD1 (R937Q and L414V) to Myc-ANKFY1. Densitometry results from (N) were expressed as ANKFY1/GAPVD1wild type/mutant (n=3, P,0.05 for R937Q and P,0.01 for L414V). contr, control; IP, immunoprecipitation; PC, Pearson’scoefficient; scra, scrambled; wt/mut, wild type/mutant.

J Am Soc Nephrol 29: 2123–2138, 2018 GAPVD1 Is a Nephrotic Syndrome Gene 2129 BASIC RESEARCH www.jasn.org

Figure 3. The N-terminal cytosolic domain of nephrin interacts with the RasGAP and VPS9 domains of GAPVD1 and both proteins partially colocalize in neonatal rat kidney. (A) Upon overexpression in HEK293T cells and co-IP, GFP-tagged GAPVD1, but not

2130 Journal of the American Society of Nephrology J Am Soc Nephrol 29: 2123–2138, 2018 www.jasn.org BASIC RESEARCH

We similarly employed truncation mapping for nephrin. published findings (Figure 4C, quantitation in Figure 4D). The N-terminal half of the cytosolic domain (intracellular Evaluating the mutants R937Q and L414V in this fashion, domain, ICD) of nephrin (nephrin aa 1084–1160) was pre- we observed a significantly higher ratio indicating an cipitated by Myc-GAPVD1, whereas Mock-GFP or the increased binding of mutant GAPVD1 to active RAB5. The C-terminal half of the ICD (aa 1160–1241) were not (Figure 3, mutations that cause nephrotic syndrome thus impair the E and G). Consequently, we found that a nephrin lacking the specificity of GAPVD1 for inactive RAB5. Further, we last 82 aa (R1160Stop) shows robust interaction with GAPVD1 observed strongly reduced binding of the mutant ANKFY1- (Supplemental Figure 5C). We conclude that a domain of 76 R95L to active RAB5 (Figure 4E, quantitation Figure 4F). The residues located at the N-terminal half of the ICD of nephrin patient mutations of both genes thus alter RAB5-binding. (aa 1084–1160) is sufficient for GAPVD1 interaction. To analyze the functional consequence of the altered RAB5 interaction of the GAPVD1 mutations, we used a RAB5 activity GAPVD1 and Nephrin Partially Colocalize in Newborn assay that employs a RAB5-GTP–specific antibody. We ob- Rat Glomeruli served an increase of active RAB5 compared with wild-type To analyze the localization of GAPVD1 in vivo together with GAPVD1 for mutation R937Q but not L414V (Supplemental nephrin, we stained newborn rat kidney sections using anti- Figure 6A, quantitation Supplemental Figure 6B). In this assay, bodies directed against nephrin and murine Gapvd1.53 The we observed a relative increase of mutant GAPVD1 precipi- control staining (Figure 3, H–I’’) resulted in virtual absence tating with active RAB5 (Supplemental Figure 6A). This sug- of a fluorescent signal, whereas the antibody recorded at iden- gests increased binding to endogenous RAB5-GTP. tical confocal settings revealed expression of GAPVD1 in RAB5 is an essential regulator of endocytosis. To evaluate podocytes and mesangial cells. Interestingly, GAPVD1 and endocytic activity in podocytes, we applied Texas-Red-dextran nephrin partially colocalize in podocytes, further (10 kD). The extent of tracer endocytosis reflects fluid-phase supporting a functional connection between these proteins. endocytosis. We observed reduced tracer uptake upon CRISPR/ Cas-mediated loss of function of GAPVD1 (Figure 4, G–I). Mutations of GAPVD1 that Cause Nephrotic Syndrome GAPVD1 thus appears to promote endocytic activity. Surpris- Increase Binding to Active RAB5 ingly, overexpression of GAPVD1 did not result in increased RAB5 exists in a GTP-bound active state and a GDP-bound RAB5 activity or increased uptake of dextran (Supplemental inactive state (Figure 4A). As is characteristic for a GEF, Figure 6, A–E). GAPVD1 was shown to specifically bind to inactive RAB5.53,66,70 To test if the GAPVD1 mutations alter the Analysis of Podocyte Migration Rate Indicates RAB5 interaction, we performed co-IP using constitutively Functional Significance of the Patient Mutations of active and dominant negative cDNA constructs of RAB5. GAPVD1 and ANKFY1 These RAB5 derivatives with substitution of a single amino The evaluation of podocyte migration rate is an established acid are locked in the active and inactive state, respectively functional assay in podocyte cell lines and has been exten- (Figure 4B). We quantified the relative density of the respective sively used to characterize the deleteriousness of monogenic RAB5 constructs that precipitated with GAPVD1. The low mutations in SRNS genes.2,7,14,22,24,32,38 To analyze the role active/inactive RAB5 ratio of wild-type GAPVD1 confirms the of GAPVD1, we generated stable shRNA-expressing human

Mock-GFP, precipitates Myc-tagged nephrin, yielding only the lower of two bands (arrow head). (B) GAPVD1 cDNA constructs that reflect the mutations from patients A4619 (p.Leu414Val) and B1391 (p.Arg937Gln) exhibit reduced binding affinity to nephrin. (C) Quantitation of density from (B) shows a significantly reduced affinity of GAPVD1 mutants to nephrin. Densitometry results from (B) were expressed as nephrin/GAPVD1wild type/mutant (n=3, P,0.05). (D) Schematic of truncation constructs of GAPVD1 and their ability to interact with nephrin (indicated by “+” versus “–,” also see below). (E) Schematic of truncation constructs of nephrin and their ability to interact with GAPVD1 (indicated by “+” versus “–,” also see below). (F) Upon overexpression and co-IP, full-length nephrin does not precipitate GFP-tagged GAPVD1 that lacks both functional domains (DRasGAP, DVPS9), whereas full-length nephrin precipitates the respective GAPVD1 constructs that contain the RasGAP or the VPS9 domain alone. This suggests that both functional domains of GAPVD1 show affinity for nephrin independently. (G) Mock-GFP and a truncated cDNA construct of nephrin (aa 1160–1241) that reflects the C-terminal half of the ICD of nephrin do not interact with GFP-GAPVD1. A GFP-tagged truncation construct (aa 1084–1160) that represents the N-terminal half of the ICD of nephrin interacts with Myc-tagged GAPVD1 (asterisk). This suggests that this subdomain of 76 aa mediates binding to GAPVD1. (H–I’’) Frozen sections of neonatal rat kidney were stained with anti-nephrin (red) and anti-GAPVD1 (green) or control. Nuclei are marked by Hoechst 33342 in blue. (I–I’’) Nephrin and GAPVD1 colocalize partially in newborn rat kidney. GAPVD1 is not restricted to podocytes but localizes to mesangial cells as well. (H–H’’) The third elution fraction obtained during the antibody purification of the GAPVD1 antibody (that contains only traces of antibody) was used as control and shows virtually no GAPVD1 signal. All images were recorded with identical confocal settings. Scale bars represent 10 mm. aa, amino acid; IP, immunoprecipitation; term., terminal.

J Am Soc Nephrol 29: 2123–2138, 2018 GAPVD1 Is a Nephrotic Syndrome Gene 2131 BASIC RESEARCH www.jasn.org

podocyte lines and measured the podocyte migration rate using the IncuCyte videomicroscopy system. Two independent shRNAs caused a reduced podocyte migration rate (Supplemental Figure 7, A–G). Transient expression of a murine wild-type Gapvd1 cDNA construct rescued the reduced migration rate, whereas constructs corresponding to the patient mutations resulted in a partial rescue. This indicates a hypomorphic function of these alleles re- garding podocyte migration rate (Figure 5, A–E, quantitation in Figure 5F). Knockdown and expression of the rescue constructs was confirmed by immunoblotting (Supplemen- tal Figure 7, A and B). To analyze a role of ANKFY1 for podocyte migration, we generated shRNA directed against human ANKFY1 and confirmed efficient silencing (Supplemental Figure 8A). Upon knockdown of ANKFY1,we observed a significantly reduced podocyte migration rate for three independent shRNAs (Supplemental Figure 8, C–G). ANKFY1, similar to GAPVD1, is thus required for podocyte migration. Transient expression of shRNA-resistant ANFKY1 completely rescued the reduced migration, whereas introducing the mutation R95L into the rescue construct abrogated the Figure 4. Mutations of GAPVD1 that cause nephrotic syndrome increase the affinity to ability to rescue. This indicates a pro- active RAB5, and GAPVD1 promotes dextran endocytosis. (A and B) Schematic showing nounced functional effect of this mutation that (A) RAB5 shuttles between active and inactive states dependent on binding to GTP/ (Figure 5, G–J, quantitation Figure 5K). GDP, whereas (B) dominant negative and constitutively active RAB5 constructs are The expression of the rescue constructs was clamped to active and inactive states, respectively. (C) Overexpression and co-IP of verified by immunoblotting (Supplemental mCherry-tagged RAB5 dominant negative (RAB5 dom. neg.) and constitutively active Figure 8B). (RAB5 const. act.) constructs together with Myc-GAPVD1 reflecting the wild-type (WT) sequence or mutations causing nephrotic syndrome (R937Q and L414V). WT and mutant Silencing the Drosophila Ortholog of GAPVD1 interact with active and inactive RAB5. The mutant constructs of GAPVD1 show GAPVD1 Impairs Nephrocytes and a stronger affinity to constitutively active RAB5 (asterisks) compared with WT GAPVD1 († Results in Mislocalization of Fly sign). (D) Quantitation of density from precipitates analogous to (C) normalized to respectively precipitated RAB5 construct for co-IPs and shown as a ratio of RAB5 const. act. Nephrin divided by RAB5 dom. neg. (n=4, P,0.05 or 0.01, respectively). (E) Overexpression and To further validate a causative role of co-IP of mCherry-tagged constitutively active RAB5 together with Myc-ANFKY1 reflect- GAPVD1 for hereditary nephrotic syn- ing the WT sequence or the R95L mutation shows strongly reduced amounts of RAB5 drome, we employed the Drosophila model. precipitating with the mutant ANKFY1 (asterisk), indicating a reduced binding affinity. (F) Garland cell nephrocytes are podocyte-like Quantitation of density from precipitates of RAB5 protein analogous to (E) normalized to cells that are an established model for glo- respectively precipitated Myc-ANKFY1 WT or mutant protein (n=3, P,0.05). (G–H’) merular disease,54,78 including monogenic Human podocytes transfected with plasmids expressing gRNA, Cas9, and GFP are ex- SRNS.55 In nephrocytes, the ortholog of posed to Texas-Red-dextran (10 kD) for 30 minutes. Nuclei are marked by Hoechst 33342 nephrin forms autocellular slit diaphragms ’ in blue. (G and G ) Podocytes expressing control gRNA exhibit comparable Texas-Red- across membrane invaginations called lab- dextran endocytosis to the neighboring cells, whereas (H and H’) podocytes expressing a yrinthine channels.54,55,78 gRNA targeting GAPVD1 exhibit reduced tracer endocytosis. Scale bars represent 10 fi mm. (I) Quantitation of results from (G–H’). For both control gRNA or GAPVD1 targeting By sequence analysis, we identi ed the gRNA fluorescence intensity ratio is shown between gRNA-expressing cells and their uncharacterized Drosophila gene CG1657 nontransfected neighboring cells (n=2, approximately 25 cells each, P,0.001). as the ortholog of human GAPVD1 (Figure 6A). This gene encodes a protein of 1712 aa

2132 Journal of the American Society of Nephrology J Am Soc Nephrol 29: 2123–2138, 2018 www.jasn.org BASIC RESEARCH

independent RNAis directed against Gapvd1 in nephrocytes. Using the established read- out of FITC-albumin endocytosis,55 we observed significantly reduced nephrocyte function for both Gapvd1-RNAi lines (Fig- ure 6, B and C). Knockdown efficiency was confirmed by quantitative PCR (Supple- mental Figure 9D). Staining the slit diaphragm proteins Sns (ortholog of nephrin) and Kirre (ortholog of NEPH1), we found both slit diaphragm proteins to adhere to the nephrocyte surface in a fine, well defined line under control conditions (Figure 6, D–D’’). Silencing of Gapvd1 resulted in the appearance of subcortical vesicles/puncta and the line of slit diaphragm proteins appeared distorted, including protrusions from the surface toward the interior of the cell (Figure 6, E–E’’). To visualize the slit diaphragms directly, we performed TEM. In control nephrocytes, slit diaphragms were formed at regular intervals along the surface but never ectopically. Labyrinthine channels were narrow and limited to the cortical area of the cell (Figure 6F). Upon knockdown of Gapvd1, the slit diaphragms on the surface were formed properly but ectopic slit diaphragms appeared in addition (Figure 6, G and H). On average, about one Figure 5. GAPVD1 and ANKFY1 regulate podocyte migration rate. (A–E) Podocyte ectopic slit diaphragm per micrometer migration rate is analyzed by IncuCyte videomicroscopy. Representative images surface area was formed upon Gapvd1- show human podocytes after induction of scratch wound (light blue) and 22 hours silencing, whereas ectopic slit diaphragms thereafter. Scratch wound area (light blue) and podocytes that have migrated (dark were absent in control nephrocytes (Figure blue) are shown at 22 hours. Serum addition strongly increases podocyte migration 6I). The mislocalized slit diaphragms cor- rate. Podocytes stably expressing scrambled shRNA (negative control) show (A) respond to the protrusions of slit dia- complete wound closure, whereas (B–F) silencing GAPVD1 results in reduced mi- phragm proteins that were observed by gration. The decrease in podocyte migration was (C) strongly reversed by transfection fl of mouse Gapvd1 but (D and E) only partially rescued by murine Gapvd1 constructs immuno uorescence. We did not detect a reflecting mutations R937Q and L414V detected in patients with nephrotic syn- transcriptional upregulation of the ortho- drome. (F) Graph shows wound confluence versus time for conditions described in log of nephrin upon Gapvd1 silencing (A–E). Error bars indicate SD of 12 wells with identical conditions (n=3). (G–J) (Supplemental Figure 9D), suggesting Podocyte migration is observed, indicating (G) complete wound closure upon stable that the excess of nephrin reflects reduced expression of scrambled shRNA (negative control), whereas (H) silencing ANKFY1 in protein degradation. the presence of a mock-rescue results in reduced migration. The decrease in TEM further revealed that the labyrin- podocyte migration was (I) strongly reversed by transfection of shRNA-resistant thinechannelsbecamestronglydilated ANKFY1, whereas (J) introduction of the mutation from family B1027 (R95L) into the and protruded deeper into the cell (Fig- rescue construct abrogates this ability. (K) Graph shows wound confluence versus ure 6, G and H). These enlarged channels time for the conditions described in (G–J). Error bars indicate SD of 12 wells with identical conditions (n=3). impressed as cortical areas of reduced electro-density in lower magnifications that were absent from control cells (Figure 6, J and K). Because the channel formation that contains both a RasGAP and a VPS9 functional domain. is dependent on the slit diaphragm proteins, the enlarged We introduce the term Gapvd1 for the Drosophila ortholog channels are potentially caused by the ectopic formation of CG1657. slit diaphragms. To analyze conservation of a functional role of the ortholog We performed immunostaining of Sns/Kirre and TEM of GAPVD1 in this Drosophila model, we expressed two upon expression of a second, independent RNAi line and

J Am Soc Nephrol 29: 2123–2138, 2018 GAPVD1 Is a Nephrotic Syndrome Gene 2133 BASIC RESEARCH www.jasn.org

Figure 6. Silencing the Drosophila ortholog of GAPVD1 in nephrocytes affects slit diaphragm restriction and nephrocyte function. (A) Amino acid sequence of human GAPVD1 is 29% identical to the Drosophila ortholog CG1657 (Gapvd1), which shares the RasGAP and VPS9 domain as functional domains. (B) Silencing the GAPVD1 ortholog by two independent RNAi lines in nephrocytes using prospero-GAL4 signiﬁcantly reduces uptake of FITC-albumin as an established assay of nephrocyte function.

2134 Journal of the American Society of Nephrology J Am Soc Nephrol 29: 2123–2138, 2018 www.jasn.org BASIC RESEARCH observed a similar phenotype to the first Gapvd1-RNAi (Sup- function further downstream.79 From these findings we plemental Figure 9, A–C). Taken together, these findings imply derived a hypothetic working model (shown in Supplemental that loss of Gapvd1 impairs the function of the podocyte-like Figure 10). In line with previous reports,43–48,51,80,81 our data nephrocytes and results in altered trafficking of the ortholog of thus underscore the importance of the endocytic pathway for nephrin. nephrin trafficking. This pathway may further be involved in the delivery of nephrin to the slit diaphragm and/or slit diaphragm maintenance by endocytic turnover. Similar to dy- DISCUSSION namin, endophilin, and synaptojanin,52 GAPVD1 has been implicated in clathrin uncoating71 but a connection with these Here, we describe the discovery of recessive mutations in proteins currently remains unclear. Actin regulation and endo- GAPVD1 and likely also ANKFY1 as novel monogenic cytosis are intertwined, and RAB5 also promotes activation of causes of hereditary nephrotic syndrome in humans. Inter- RAC1.82 As suggested by the effect on podocyte migration rate, estingly, we found that both proteins are interaction part- actin dysregulation thus may contribute to the roles of GAPVD1 ners that are expressed in podocytes. We demonstrate that and ANKFY1 in nephrotic syndrome. GAPVD1 interacts with nephrin and both proteins partially Endocytosis is a fundamental cellular process. Although colocalize in rat glomeruli. Overexpressing GAPVD1 that it may seem surprising that recessive mutations in a RAB5 reflects mutations from patients with nephrotic syndrome regulator such as GAPVD1 manifest exclusively as ne- resulted in reduced ANKFY1 and nephrin affinity, whereas phrotic syndrome, the functional redundancy with RAB5- the mutations conversely increased binding to GTP-bound GEFs like RIN1, ALS2,andRABGEF1 may compensate for RAB5. GAPVD1 and ANKFY1 were required for podocyte most cellular functions. Similarly, a complete GAPVD1 migration and this assay indicated functional signifi- knock out was found to be viable in Caenorhabditis cance for the mutations of both genes. Finally, silencing elegans.70 the ortholog of GAPVD1 in Drosophila nephrocytes im- GAPVD1 and ANKFY1 appear to be rare causes of ne- paired tracer uptake in these podocyte-like cells and phrotic syndrome. This is consistent with a number of recently resulted in mislocalization of flynephrin. discovered novel monogenic causes1,19,22,24,32 that are simi- Our findings implicate RAB5 regulation in human hered- larly uncommon. Nevertheless, the identification of mono- itary nephrotic syndrome. The interaction of GAPVD1 and genic causes, including the less frequent ones, has shaped nephrin suggests that endocytic trafficking of nephrin may our understanding of podocyte biology.3 In conclusion, our play a role in an RAB5-mediated pathogenesis. Consistent findings implicate two RAB5-interacting proteins in heredi- with such a role, the mutations that we discovered in tary nephrotic syndrome and suggest RAB5 regulation as a our patients affected RAB5 binding and the interaction with novel pathogenetic mechanism. nephrin. This is supported by our findings in Drosophila nephrocytes, where slit diaphragms are mislocalized. This Accession Numbers may be caused by a lack of endocytic removal of ectopic fly Human GAPVD1 full-length protein is GenBank accession nephrin and/or impaired degradation. Ectopic slit dia- number NM_015635.3. phragms have been reported in pericardial nephrocytes Human ANKFY1 full-length is GenBank accession number upon silencing of RAB7, which blocks endo-lysosomal NM_001257999.2.

(C) Quantitation of data in (B) (n=3 per genotype, P,0.001). (D–D’’) Equatorial cross-section of a negative control garland cell nephrocyte costained for the nephrin ortholog Sns (green) and the KIRREL/NEPH1 ortholog Kirre (red). Slit diaphragm proteins localize at the cell periphery in a ﬁne line. Inset shows a subcortical section; Sns and Kirre are restricted to the plasma membrane. Nuclei are marked by Hoechst 33342 in blue. Scale bar represents 5 mm. (E–E’’) Equatorial cross-section of garland cell nephrocytes expressing Gapvd1-RNAi shows appearance of vesicles (arrow heads) and broadening of the line of slit diaphragm proteins. Inset shows a subcortical section; Sns and Kirre are observed in puncta and are not restricted to the membrane. Nuclei are marked by Hoechst 33342 in blue. Scale bar represents 5 mm. (F) Nephrocyte expressing control-RNAi shows regular formation of slit diaphragms (black arrow heads). Labyrinthine channels are slender and restricted to the cortical area (white asterisks). (G and H) EM image from a section through the surface of a nephrocyte expressing Gapvd1-RNAi shows cross-section of slit diaphragms (black arrow heads) on the surface but also in an ectopic localization deeper in the labyrinthine channels (red arrow heads, see also inset). Labyrinthine channels are dilated, fused, and protrude deeply into the cell (white asterisks). (I) Quantitation of the number of ectopic intracellular slit diaphragms underneath the cell surface formed per micrometer of the cell surface length. Note that ectopic slit diaphragms are absent under negative control conditions, whereas more than one ectopic slit diaphragm per micrometer is formed upon expression of Gapvd1-RNAi 1 (quantitation of six cells from three different animals per genotype, P,0.001). (J and K) Compared with (J) control nephrocytes, (K) cells expressing Gapvd1-RNAi show cortical areas of lower electro-density (black asterisks). These areas correspond to the enlarged labyrinthine channels (see [G and H]). Pros, prospero-GAL4.

J Am Soc Nephrol 29: 2123–2138, 2018 GAPVD1 Is a Nephrotic Syndrome Gene 2135 BASIC RESEARCH www.jasn.org

ACKNOWLEDGMENTS 6. Ebarasi L, Ashraf S, Bierzynska A, Gee HY, McCarthy HJ, Lovric S, et al.: Defects of CRB2 cause steroid-resistant nephrotic syndrome. Am – We are grateful to the families and study individuals for their con- J Hum Genet 96: 153 161, 2015 7. Gee HY, Sadowski CE, Aggarwal PK, Porath JD, Yakulov TA, Schueler tribution. We thank the Yale Center for Mendelian Genomics and the M, et al.: FAT1 mutations cause a glomerulotubular nephropathy. Nat Broad Center for Mendelian Genomics for whole-exome sequencing Commun 7: 10822, 2016 analysis. F.H. is the William E. Harmon Professor. We thank R. 8. Boute N, Gribouval O, Roselli S, Benessy F, Lee H, Fuchshuber A, et al.: Nitschke, Life Imaging Centre, University of Freiburg, for help with NPHS2, encoding the glomerular protein podocin, is mutated in autosomal confocal microscopy. recessive steroid-resistant nephrotic syndrome. Nat Genet 24: 349–354, 2000 This research was supported by grants from the National In- 9. Ozaltin F, Li B, Rauhauser A, An SW, Soylemezoglu O, Gonul II, et al.: DGKE variants cause a glomerular microangiopathy that mimics stitutes of Health to F.H. (DK076683), H.L.R., and D.M. (UM1 membranoproliferative GN. JAmSocNephrol24: 377–384, 2013 HG008900), and to the Yale Center for Mendelian Genomics 10. Ozaltin F, Ibsirlioglu T, Taskiran EZ, Baydar DE, Kaymaz F, Buyukcelik M, (U54HG006504); by the Deutsche Forschungsgemeinschaft et al.; PodoNet Consortium: Disruption of PTPRO causes childhood-onset (DFG) to T.H. (HE 7456/1-1), A.T.v.d.V. (VE916/1-1), and T.J.-S. nephrotic syndrome. Am J Hum Genet 89: 139–147, 2011 (Jo 1324/1-1); by the Iinuma-Tsuchiya Foundation for Overseas 11. Has C, Spartà G, Kiritsi D, Weibel L, Moeller A, Vega-Warner V, et al.: Integrin a3 – Research to M.N.; and by the German National Academy of Sci- mutations with kidney, lung, and skin disease. NEnglJMed366: 1508 1514, 2012 ences Leopoldina to E.W. (LPDS-2015-07). The Broad Center for 12. Kambham N, Tanji N, Seigle RL, Markowitz GS, Pulkkinen L, Uitto J, Mendelian Genomics was funded by the National Human Ge- et al.: Congenital focal segmental glomerulosclerosis associated with nome Research Institute, the National Eye Institute, and the Na- beta4 integrin mutation and epidermolysis bullosa. Am J Kidney Dis 36: tional Heart, Lung, and Blood Institute. 190–196, 2000 T.H., R.S., S.S., D.S., D.A.B., J.K.W., A.D., A.T.v.d.V., E.W., M.N., T.J.-S., 13. Zenker M, Aigner T, Wendler O, Tralau T, Müntefering H, Fenski R, fi A.J.M., J.R., S.A., R.P.L., S.M., K.L., M.L., D.M., and H.L.R. generated total et al.: Human laminin beta2 de ciency causes congenital nephrosis with mesangial sclerosis and distinct eye abnormalities. Hum Mol genome linkage analysis, performed exome capture and massively parallel Genet 13: 2625–2632, 2004 sequencing, and performed whole-exome evaluation and mutation anal- 14. Ashraf S, Gee HY, Woerner S, Xie LX, Vega-Warner V, Lovric S, et al.: ysis. R.S. and T.H. performed cDNA cloning, protein purification, tracer ADCK4 mutations promote steroid-resistant nephrotic syndrome through endocytosis and immunofluorescence, and subcellular localization studies CoQ10 biosynthesis disruption. J Clin Invest 123: 5179–5189, 2013 in cell lines by confocal microscopy. R.S., E.W., and A.T.v.d.V. performed 15. Diomedi-Camassei F, Di Giandomenico S, Santorelli FM, Caridi G, migration assays in immortalized human podocytes. T.H. and R.S. Piemonte F, Montini G, et al.: COQ2 nephropathy: A newly described inherited mitochondriopathy with primary renal involvement. JAmSoc performed coimmunoprecipitation and the experiments in Drosophila. Nephrol 18: 2773–2780, 2007 V.T., J.D.H., A.B., S.E.D., J.A.K., V.T., and F.H. recruited patients and 16. Heeringa SF, Chernin G, Chaki M, Zhou W, Sloan AJ, Ji Z, et al.: COQ6 gathered detailed clinical information for the study. L.S.F. and S.M.J. an- mutations in human patients produce nephrotic syndrome with sen- alyzed renal histology and electron microscopy and provided images. F.H. sorineural deafness. J Clin Invest 121: 2013–2024, 2011 conceived of and directed the study. T.H. wrote the manuscript with help 17. López LC, Schuelke M, Quinzii CM, Kanki T, Rodenburg RJ, Naini A, et al.: Leigh syndrome with nephropathy and CoQ10 deficiency due to from F.H. The manuscript was critically reviewed by all of the authors. decaprenyl diphosphate synthase subunit 2 (PDSS2) mutations. Am J Hum Genet 79: 1125–1129, 2006 18. Kaplan JM, Kim SH, North KN, Rennke H, Correia LA, Tong HQ, et al.: Mutations in ACTN4, encoding alpha-actinin-4, cause familial focal DISCLOSURES segmental glomerulosclerosis. Nat Genet 24: 251–256, 2000 F.H. is a cofounder of Goldfinch-Bio and receives royalties from Claritas. The 19. Gbadegesin RA, Hall G, Adeyemo A, Hanke N, Tossidou I, Burchette remaining authors declare that they have no competing financial interests. J, et al.: Mutations in the gene that encodes the F-actin binding protein anillin cause FSGS. J Am Soc Nephrol 25: 1991–2002, 2014 20. Akilesh S, Suleiman H, Yu H, Stander MC, Lavin P, Gbadegesin R, et al.: REFERENCES Arhgap24 inactivates Rac1 in mouse podocytes, and a mutant form is associated with familial focal segmental glomerulosclerosis. JClinIn- vest 121: 4127–4137, 2011 1. Bierzynska A, Soderquest K, Dean P, Colby E, Rollason R, Jones C, et al.; 21. Gupta IR, Baldwin C, Auguste D, Ha KC, El Andalousi J, Fahiminiya S, NephroS; UK study of Nephrotic Syndrome: MAGI2 mutations cause con- et al.: ARHGDIA: A novel gene implicated in nephrotic syndrome. J genital nephrotic syndrome. J Am Soc Nephrol 28: 1614–1621, 2017 Med Genet 50: 330–338, 2013 2. Lovric S, Goncalves S, Gee HY, Oskouian B, Srinivas H, Choi WI, et al.: Mu- 22. Gee HY, Saisawat P, Ashraf S, Hurd TW, Vega-Warner V, Fang H, et al.: tations in sphingosine-1-phosphate lyase cause nephrosis with ichthyosis ARHGDIA mutations cause nephrotic syndrome via defective RHO and adrenal insufficiency. J Clin Invest 127: 912–928, 2017 GTPase signaling. JClinInvest123: 3243–3253, 2013 3. Lovric S, Ashraf S, Tan W, Hildebrandt F: Genetic testing in steroid- 23. Brown EJ, Schlöndorff JS, Becker DJ, Tsukaguchi H, Tonna SJ, Uscinski resistant nephrotic syndrome: When and how? Nephrol Dial Transplant AL, et al.: Mutations in the formin gene INF2 cause focal segmental 31: 1802–1813, 2016 glomerulosclerosis. Nat Genet 42: 72–76, 2010 4. Kestilä M, Lenkkeri U, Männikkö M, Lamerdin J, McCready P, Putaala H, 24. Gee HY, Zhang F, Ashraf S, Kohl S, Sadowski CE, Vega-Warner V, et al.: et al.: Positionally cloned gene for a novel glomerular protein–nephrin–is KANK deficiency leads to podocyte dysfunction and nephrotic syn- mutated in congenital nephrotic syndrome. Mol Cell 1: 575–582, 1998 drome. J Clin Invest 125: 2375–2384, 2015 5. Löwik MM, Groenen PJ, Pronk I, Lilien MR, Goldschmeding R, Dijkman 25. Mele C, Iatropoulos P, Donadelli R, Calabria A, Maranta R, Cassis P, HB, et al.: Focal segmental glomerulosclerosis in a patient homozygous et al.; PodoNet Consortium: MYO1E mutations and childhood familial for a CD2AP mutation. Kidney Int 72: 1198–1203, 2007 focal segmental glomerulosclerosis. NEnglJMed365: 295–306, 2011

2136 Journal of the American Society of Nephrology J Am Soc Nephrol 29: 2123–2138, 2018 www.jasn.org BASIC RESEARCH

26. Heath KE, Campos-Barros A, Toren A, Rozenfeld-Granot G, Carlsson 44. Teng B, Schroder P, Müller-Deile J, Schenk H, Staggs L, Tossidou I, LE, Savige J, et al.: Nonmuscle myosin heavy chain IIA mutations et al.: CIN85 deficiency prevents nephrin endocytosis and proteinuria define a spectrum of autosomal dominant macrothrombocytopenias: in diabetes. Diabetes 65: 3667–3679, 2016 May-Hegglin anomaly and Fechtner, Sebastian, Epstein, and Alport- 45. Qin XS, Tsukaguchi H, Shono A, Yamamoto A, Kurihara H, Doi T: like syndromes. Am J Hum Genet 69: 1033–1045, 2001 Phosphorylation of nephrin triggers its internalization by raft-mediated 27. Ovunc B, Otto EA, Vega-Warner V, Saisawat P, Ashraf S, Ramaswami G, endocytosis. J Am Soc Nephrol 20: 2534–2545, 2009 et al.: Exome sequencing reveals cubilin mutation as a single-gene 46. Babayeva S, Rocque B, Aoudjit L, Zilber Y, Li J, Baldwin C, et al.: Planar cause of proteinuria. J Am Soc Nephrol 22: 1815–1820, 2011 cell polarity pathway regulates nephrin endocytosis in developing 28. Berkovic SF, Dibbens LM, Oshlack A, Silver JD, Katerelos M, Vears DF, podocytes. J Biol Chem 288: 24035–24048, 2013 et al.: Array-based gene discovery with three unrelated subjects shows 47. Königshausen E, Zierhut UM, Ruetze M, Potthoff SA, Stegbauer J, SCARB2/LIMP-2 deficiency causes myoclonus epilepsy and glomer- Woznowski M, et al.: Angiotensin II increases glomerular permeability ulosclerosis. Am J Hum Genet 82: 673–684, 2008 by b-arrestin mediated nephrin endocytosis. Sci Rep 6: 39513, 29. Boerkoel CF, Takashima H, John J, Yan J, Stankiewicz P, Rosenbarker L, 2016 et al.: Mutant chromatin remodeling protein SMARCAL1 causes 48. Quack I, Woznowski M, Potthoff SA, Palmer R, Königshausen E, Sivritas Schimke immuno-osseous dysplasia. Nat Genet 30: 215–220, 2002 S, et al.: PKC alpha mediates beta-arrestin2-dependent nephrin en- 30. Vollrath D, Jaramillo-Babb VL, Clough MV, McIntosh I, Scott KM, docytosis in hyperglycemia. J Biol Chem 286: 12959–12970, 2011 Lichter PR, et al.: Loss-of-function mutations in the LIM-homeodomain 49. Harris DP, Vogel P, Wims M, Moberg K, Humphries J, Jhaver KG, et al.: gene, LMX1B, in nail-patella syndrome. Hum Mol Genet 7: 1091–1098, Requirement for class II phosphoinositide 3-kinase C2alpha in maintenance 1998 of glomerular structure and function. Mol Cell Biol 31: 63–80, 2011 31. Hinkes B, Wiggins RC, Gbadegesin R, Vlangos CN, Seelow D, 50. Bechtel W, Helmstädter M, Balica J, Hartleben B, Kiefer B, Hrnjic F, Nürnberg G, et al.: Positional cloning uncovers mutations in PLCE1 et al.: Vps34 deficiency reveals the importance of endocytosis for po- responsible for a nephrotic syndrome variant that may be reversible. docyte homeostasis. J Am Soc Nephrol 24: 727–743, 2013 Nat Genet 38: 1397–1405, 2006 51. Inoue K, Ishibe S: Podocyte endocytosis in the regulation of the glomerular 32. Gee HY, Ashraf S, Wan X, Vega-Warner V, Esteve-Rudd J, Lovric S, filtration barrier. Am J Physiol Renal Physiol 309: F398–F405, 2015 et al.: Mutations in EMP2 cause childhood-onset nephrotic syndrome. 52. Soda K, Balkin DM, Ferguson SM, Paradise S, Milosevic I, Giovedi S, Am J Hum Genet 94: 884–890, 2014 et al.: Role of dynamin, synaptojanin, and endophilin in podocyte foot 33. Colin E, Huynh Cong E, Mollet G, Guichet A, Gribouval O, Arrondel C, et al.: processes. JClinInvest122: 4401 –4411, 2012 Loss-of-function mutations in WDR73 are responsible for microcephaly and 53. Lodhi IJ, Chiang SH, Chang L, Vollenweider D, Watson RT, Inoue M, steroid-resistant nephrotic syndrome: Galloway–Mowat syndrome. Am J et al.: Gapex-5, a Rab31 guanine nucleotide exchange factor that Hum Genet 95: 637–648, 2014 regulates Glut4 trafficking in adipocytes. Cell Metab 5: 59–72, 2007 34. Sethi S, Fervenza FC, Zhang Y, Smith RJ: Secondary focal and seg- 54. Weavers H, Prieto-Sánchez S, Grawe F, Garcia-López A, Artero R, mental glomerulosclerosis associated with single-nucleotide poly- Wilsch-Bräuninger M, et al.: The insect nephrocyte is a podocyte-like morphisms in the genes encoding complement factor H and C3. Am J cell with a filtration slit diaphragm. Nature 457: 322–326, 2009 Kidney Dis 60: 316–321, 2012 55. Hermle T, Braun DA, Helmstädter M, Huber TB, Hildebrandt F: Mod- 35. Jeanpierre C, Denamur E, Henry I, Cabanis MO, Luce S, Cécille A, et al.: eling monogenic human nephrotic syndrome in the Drosophila garland Identification of constitutional WT1 mutations, in patients with isolated cell nephrocyte. JAmSocNephrol28: 1521–1533, 2017 diffuse mesangial sclerosis, and analysis of genotype/phenotype cor- 56. Bour BA, Chakravarti M, West JM, Abmayr SM: Drosophila SNS, a relations by use of a computerized mutation database. Am J Hum member of the immunoglobulin superfamily that is essential for myo- Genet 62: 824–833, 1998 blast fusion. Genes Dev 14: 1498–1511, 2000 36. Yasukawa T, Suzuki T, Ueda T, Ohta S, Watanabe K: Modification defect 57. Galletta BJ, Chakravarti M, Banerjee R, Abmayr SM: SNS: Adhesive atanticodonwobblenucleotideofmitochondrialtRNAs(Leu)(UUR)with properties, localization requirements and ectodomain dependence in pathogenic mutations of mitochondrial myopathy, encephalopathy, lactic S2 cells and embryonic myoblasts. Mech Dev 121: 1455–1468, 2004 acidosis, and stroke-like episodes. JBiolChem275: 4251–4257, 2000 58. Koziell A, Grech V, Hussain S, Lee G, Lenkkeri U, Tryggvason K, et al.: 37. Winn MP, Conlon PJ, Lynn KL, Farrington MK, Creazzo T, Hawkins AF, Genotype/phenotype correlations of NPHS1 and NPHS2 mutations in et al.: A mutation in the TRPC6 cation channel causes familial focal nephrotic syndrome advocate a functional inter-relationship in glo- segmental glomerulosclerosis. Science 308: 1801–1804, 2005 merular filtration. Hum Mol Genet 11: 379–388, 2002 38. Rao J, Ashraf S, Tan W, van der Ven AT, Gee HY, Braun DA, et al.: 59. Machuca E, Benoit G, Nevo F, Tête MJ, Gribouval O, Pawtowski A, Advillin acts upstream of phospholipase C «1 in steroid-resistant ne- et al.: Genotype-phenotype correlations in non-Finnish congenital phrotic syndrome. J Clin Invest 127: 4257 –4269, 2017 nephrotic syndrome. JAmSocNephrol21: 1209–1217, 2010 39. Braun DA, Sadowski CE, Kohl S, Lovric S, Astrinidis SA, Pabst WL, et al.: 60. Abid A, Khaliq S, Shahid S, Lanewala A, Mubarak M, Hashmi S, et al.: A Mutations in nuclear pore genes NUP93, NUP205 and XPO5 cause spectrum of novel NPHS1 and NPHS2 gene mutations in pediatric steroid-resistant nephrotic syndrome. Nat Genet 48: 457–465, 2016 nephrotic syndrome patients from Pakistan. Gene 502: 133–137, 2012 40. Miyake N, Tsukaguchi H, Koshimizu E, Shono A, Matsunaga S, Shiina M, 61. Santín S, García-Maset R, Ruíz P, Giménez I, Zamora I, Peña A, et al.; et al.: Biallelic mutations in nuclear pore complex subunit NUP107 cause FSGS Spanish Study Group: Nephrin mutations cause childhood- and early-childhood-onset steroid-resistant nephrotic syndrome. Am J Hum adult-onset focal segmental glomerulosclerosis. Kidney Int 76: 1268– Genet 97: 555–566, 2015 1276, 2009 41. Park E, Ahn YH, Kang HG, Miyake N, Tsukaguchi H, Cheong HI: NUP107 62. Philippe A, Nevo F, Esquivel EL, Reklaityte D, Gribouval O, Tête MJ, mutations in children with steroid-resistant nephrotic syndrome. Nephrol Dial et al.: Nephrin mutations can cause childhood-onset steroid-resistant Transplant 32: 1013–1017, 2017 nephrotic syndrome. JAmSocNephrol19: 1871–1878, 2008 42. Braun DA, Rao J, Mollet G, Schapiro D, Daugeron MC, Tan W, et al.: 63. Godefroid N, Dahan K: Expanding the clinical spectrum of congenital ne- Mutations in KEOPS-complex genes cause nephrotic syndrome with phrotic syndrome caused by NPHS1 mutations. Nephrol Dial Transplant 25: primary microcephaly. Nat Genet 49: 1529–1538, 2017 2837–2839, 2010 43. Quack I, Rump LC, Gerke P, Walther I, Vinke T, Vonend O, et al.: beta- 64. Kaukinen A, Kuusniemi AM, Helin H, Jalanko H: Changes in glomerular Arrestin2 mediates nephrin endocytosis and impairs slit diaphragm mesangium in kidneys with congenital nephrotic syndrome of the integrity. Proc Natl Acad Sci U S A 103: 14110–14115, 2006 Finnish type. Pediatr Nephrol 25: 867–875, 2010

J Am Soc Nephrol 29: 2123–2138, 2018 GAPVD1 Is a Nephrotic Syndrome Gene 2137 BASIC RESEARCH www.jasn.org

65. Patrakka J, Kestilä M, Wartiovaara J, Ruotsalainen V, Tissari P, 75. Ito K, Ishii N, Miyashita A, Tominaga K, Kuriyama H, Maruyama H, et al.: Lenkkeri U, et al.: Congenital nephrotic syndrome (NPHS1): Features Molecular cloning of a novel 130-kDa cytoplasmic protein, Ankhzn, resulting from different mutations in Finnish patients. Kidney Int 58: containing Ankyrin repeats hooked to a zinc finger motif. Biochem Bi- 972–980, 2000 ophys Res Commun 257: 206–213, 1999 66. Hunker CM, Galvis A, Kruk I, Giambini H, Veisaga ML, Barbieri MA: 76. Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA, Zhang F: Genome en- Rab5-activating protein 6, a novel endosomal protein with a role in gineering using the CRISPR-Cas9 system. Nat Protoc 8: 2281–2308, 2013 endocytosis. Biochem Biophys Res Commun 340: 967–975, 2006 77. Liu Y, Liang W, Yang Y, Pan Y, Yang Q, Chen X, et al.: IQGAP1 regulates 67. Su X, Kong C, Stahl PD: GAPex-5 mediates ubiquitination, trafficking, actin cytoskeleton organization in podocytes through interaction with and degradation of epidermal growth factor receptor. J Biol Chem 282: nephrin. Cell Signal 27: 867–877, 2015 21278–21284, 2007 78. Zhuang S, Shao H, Guo F, Trimble R, Pearce E, Abmayr SM: Sns and 68. Lodhi IJ, Bridges D, Chiang SH, Zhang Y, Cheng A, Geletka LM, et al.: Kirre, the Drosophila orthologs of Nephrin and Neph1, direct adhesion, Insulin stimulates phosphatidylinositol 3-phosphate production via the fusion and formation of a slit diaphragm-like structure in insect neph- activation of Rab5. Mol Biol Cell 19: 2718–2728, 2008 rocytes. Development 136: 2335–2344, 2009 69. Kitano M, Nakaya M, Nakamura T, Nagata S, Matsuda M: Imaging of 79. Fu Y, Zhu JY, Zhang F, Richman A, Zhao Z, Han Z: Comprehensive Rab5 activity identifies essential regulators for phagosome maturation. functional analysis of Rab GTPases in Drosophila nephrocytes. Cell Nature 453: 241–245, 2008 Tissue Res 368: 615–627, 2017 70. Sato M, Sato K, Fonarev P, Huang CJ, Liou W, Grant BD: Caeno- 80. Jeon J, Leibiger I, Moede T, Walter B, Faul C, Maiguel D, et al.: rhabditis elegans RME-6 is a novel regulator of RAB-5 at the clathrin- Dynamin-mediated Nephrin phosphorylation regulates glucose- coated pit. Nat Cell Biol 7: 559–569, 2005 stimulated insulin release in pancreatic beta cells. JBiolChem287: 71. Semerdjieva S, Shortt B, Maxwell E, Singh S, Fonarev P, Hansen J, et al.: 28932–28942, 2012 Coordinated regulation of AP2 uncoating from clathrin-coated vesicles 81. Tossidou I, Teng B, Menne J, Shushakova N, Park JK, Becker JU, et al.: by rab5 and hRME-6. JCellBiol183: 499–511, 2008 Podocytic PKC-alpha is regulated in murine and human diabetes and 72. Schnatwinkel C, Christoforidis S, Lindsay MR, Uttenweiler-Joseph S, Wilm M, mediates nephrin endocytosis. PLoS One 5: e10185, 2010 Parton RG, et al.: The Rab5 effector Rabankyrin-5 regulates and coordinates 82. Diaz J, Mendoza P, Ortiz R, Diaz N, Leyton L, Stupack D, et al: Rab5 is different endocytic mechanisms. PLoS Biol 2: E261, 2004 required in metastatic cancer cells for Caveolin-1-enhanced Rac1 ac- 73. Zhang J, Reiling C, Reinecke JB, Prislan I, Marky LA, Sorgen PL, et al.: tivation, migration and invasion. JCellSci127: 2401–2406, 2014 Rabankyrin-5 interacts with EHD1 and Vps26 to regulate endocytic trafficking and retromer function. Traffic 13: 745–757, 2012 74. Nehru V, Voytyuk O, Lennartsson J, Aspenström P: RhoD binds the Rab5 effector Rabankyrin-5 and has a role in trafficking of the platelet- This article contains supplemental material online at http://jasn.asnjournals. derived growth factor receptor. Traffic 14: 1242–1254, 2013 org/lookup/suppl/doi:10.1681/ASN.2017121312/-/DCSupplemental.

AFFILIATIONS

1Department of Medicine, Boston Children’s Hospital, Harvard Medical School, Boston, Massachusetts; 2Renal Division, University Medical Center Freiburg, Faculty of Medicine, University of Freiburg, Freiburg, Germany; 3Department of Pathology, Seattle Children’s Hospital, University of Washington, Seattle, Washington; 4Department of Pediatric Nephrology, Medical Faculty Skopje, University Children’s Hospital, Skopje, Macedonia; 5Department of Pediatric Nephrology, Providence Sacred Heart Medical Center and Children’s Hospital, Spokane, Washington; 6Division of Nephrology, All India Institute of Medical Sciences, New Delhi, India; 7Department of Pathology, College of Medicine, and 8Pediatric Nephrology Center of Excellence and Pediatric Department, Faculty of Medicine, King Abdulaziz University, Jeddah, Kingdom of Saudi Arabia; 9Broad Center for Mendelian Genetics, Broad Institute of Massachusetts Institute of Technology and Harvard, Cambridge, Massachusetts; 10Department of Genetics, Yale University School of Medicine, New Haven, Connecticut; and 11Laboratory of Human Genetics and Genomics, The Rockefeller University, New York, New York

2138 Journal of the American Society of Nephrology J Am Soc Nephrol 29: 2123–2138, 2018 SIGNIFICANCE STATEMENT

A number of single gene mutations have been identified as causes of nephrotic syndrome (NS). This paper describes the discovery of two new monogenic genes with mutations associated with NS, GAPVD1,withdefinite evidence for causality, and ANKFY1, as probably causal. The genes are the first endosomal regulators and known RAB5 interactors implicated in NS. Both proteins interact and affect podocyte migration rate. GAPVD1 also interacts with the slit diaphragm protein nephrin. The mutations of GAPVD1 observed in patients affect binding to nephrin and RAB5. Silencing the ortholog of GAPVD1 in the podocyte-like Dro- sophila nephrocytes results in mistrafficking of fly nephrin. These findings implicate RAB5 regulation as a novel pathogenetic pathway of NS, potentially critical for nephrin trafficking. GAPVD1 and ANKFY1 mutations implicate RAB5 regulation in nephrotic syndrome Hermle et al.

Supplementary Information

• Supplementary Fig. 1. Proteins and pathogenetic pathways for SRNS genes and data on pedigree structure, Sanger sequencing, renal ultrasound and histology in patients with GAPVD1 and ANKFY1 mutations. • Supplementary Fig. 2. Homozygosity Mapping. • Supplementary Fig. 3. Subcellular localization of GFP-tagged GAPVD1 cDNA overexpression constructs in a human podocyte cell line. • Supplementary Fig. 4. Subcellular localization of ANKFY1 constructs in endosomes, and co-localization with GAPVD1. • Supplementary Fig. 5. GAPVD1 interacts with ANKFY1 and nephrin. • Supplementary Fig. 6. RAB5 activity assay and lack of an effect of GAPVD1 overexpression on tracer endocytosis in human podocyte cell line. • Supplementary Fig. 7. Characterization of stable shRNA lines used to measure podocyte migration rate for GAPVD1 (see Fig. 5A). • Supplementary Fig. 8. Characterization of stable shRNA lines used to measure podocyte migration rate for ANKFY1 (see Fig. 5B). • Supplementary Fig. 9. Phenotype of a second Gapvd1-RNAi, and qPCR analysis. • Supplementary Fig. 10. Hypothetical working model for GAPVD1 and ANKFY1 loss-of-function in podocytes. • Supplementary Table 1: Primer sequences

A B dominant CoQ10 biosynthesis Nucleus Nucleoporins Family B1391 recessive Mitochondrium WT1 ADCK4 COQ6 COQ2 LMX1B PDSS2 MTTL1 SMARCAL1

KEOPS complex S1P metabolism Actin regulation tRNA modi- Lysosome by Rho/ Rac/ fication SCARB2 Cdc42 OSGEP TPRKB TP53RK LAGE3 Actin binding proteins ARHGAP24 Slit MAGI2 MYO1E CRB2 ARHGDIA membrane KANK1,2,4 WDR73 MYH9 ANLN CD2AP V Rho/Rac/CDC42 EMP2 P T INF2 AVIL NPHS2 NPHS1 FAT1 PLCE1 Nephrotic Syndrome PTPRO TRPC6 NPHS1 Foot process CUBN DGKE died age 4

LAMB2 Glomerular basement membrane SSNS as a child Integrin/ Laminin Endothelial Cell

B1027 B1027 C B1391 D E A4619 I-1 F I-2

II-1

II-2 G H I J * * * *

Masson’s trichrome Jones’ silver PAS HE

Supplementary Fig. 1. Proteins and pathogenetic pathways for SRNS genes and data on pedigree structure, Sanger sequencing, renal ultrasound and histology in patients with GAPVD1 and ANKFY1 mutations.

(A) The schematic depicts a simplified podocyte with the proteins involved in single-gene causes of SRNS. Proteins are shown in red when causative mutations have been described as recessive and blue for dominant mutations. These SRNS-related proteins are part of protein–protein interaction complexes that participate in defined structural components or signaling pathways of podocyte function (black frames). These genes thus delineate pathogenetic pathways of SRNS. (B) Pedigree of family B1391 with multiple individuals affected with nephrotic syndrome (arrow indicates proband). Further family members were unavailable for genetic analysis. Consanguinity loops are indicated by double horizontal lines. Squares denote males, circles females, filled symbols denote affected individuals.

(C-E) Sanger sequencing traces confirming the mutations and segregations for B1391 (C), A4619 (D), and B1027 (E). DNA from the parents of A4619 were unavailable for sequencing.

(F) Renal ultrasound of B1027 reveals no significant anomalies.

(G-J) Additional images (see Fig. 1F-H) from renal nephrectomy of A4619 confirm mesangial hypercellularity and expansion of the extracellular matrix (asterisks).

B1391 GAPVD1 21 A 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 1920 22 1.0

0.8

0.6

A4619 GAPVD1 21 B 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 1920 22 1.0

0.8

0.6

B1027 ANKFY1 C 21 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 1920 22 1.0

0.8

0.6

B1027 ANKFY1 22 D 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 X

Supplementary Fig. 2. Homozygosity Mapping. (A) Nonparametric LOD (log of the odds ratio) (NPL) score profile across the human genome in one individual with SRNS of consanguineous family B1391. Ten maximum NPL peaks (red circles) indicate candidate regions of homozygosity by descent. GAPVD1 is positioned (arrowhead) within a peak on chromosome 9. (B) NPL score profile for individual A4619. Six maximum NPL peaks (red circles) indicate candidate regions of homozygosity. ANKFY1 is positioned (arrowhead) within a peak on chromosome 17. (C) NPL score profile across the human genome of linked analysis of two siblings of distantly consanguineous family B1027. Six maximum NPL peaks (red circles) indicate candidate regions of homozygosity by descent. ANKFY1 is positioned (arrowhead) within a peak on chromosome 17 that is shared between both siblings. (D) Linkage analysis indicates a shared region for both siblings around the ANKFY1 locus (arrow head). A B C

GFP-GAPVD1 GFP-GAPVD1L414V GFP-GAPVD1R937Q D D’ D’’

GFP-GAPVD1DRasGAP RAB5 merge E F G

RasGAP, VPS9 GFP-GAPVD1D D GFP-VPS9 domain HA-GAPVD1DVPS9

RasGAP VPS9

Supplementary Fig. 3. Subcellular localization of GFP-tagged GAPVD1 cDNA overexpression constructs in a human podocyte cell line.

(A-C) Overexpressed GFP-GAPVD1 localizes to the cytosol in podocytes (A). Overexpression of constructs reflecting the mutations L414V (B) or R937Q (C) does not alter subcellular localization. Weak GFP signal that may appear intranuclear most likely derives from perinuclear cytoplasm above or below.

(D-D’’) A GFP-GAPVD1-construct that lacks the inhibitory RasGAP domain localizes to vesicles that co-stain with an anti-RAB5 antibody.

(E) Deletion of both functional domains of GAPVD1 (DRasGAP, DVPS9, see Fig. 3D) results in a vesicular localization.

(F) A GAPVD1 construct that is restricted to the VPS9 domain (GFP-VPS9) localizes to vesicles.

(G) Deletion of the VPS9 domain from GAPVD1 does not alter the subcellular localization compared to wild type GFP-GAPVD1 overexpression.

A A’ A’’

anti-ANKFY1 GFP-ANKFY1 merge B B’ B’’

GFP-ANKFY1 mCherry-RAB5 merge C C’ C’’

anti-ANKFY1 anti-RAB5 merge D E F

GFP-ANKFY1 GFP-ANKFY1DFYVE GFP-ANKFY1R95L G G’ G’’

GFP-GAPVD1 Myc-ANKFY1 merge

PC:0.29 PC:0.91

Supplementary Fig. 4. Subcellular localization of ANKFY1 constructs in endosomes, and co- localizationB’’ with GAPVD1.

(A-A’’) A monoclonal mouse anti-ANKFY1 antibody detects GFP-tagged ANKFY1 overexpressed in podocytes.

(B-B’’) Overexpressed GFP-tagged ANKFY1 and overexpressed mCherry-RAB5 co-localize to vesicles in podocytes.

(C-C’’) Endogenous ANKFY1 partially co-localizes to vesicles with endogenous RAB5.

(D) Overexpressed GFP-tagged ANKFY1 localizes to vesicles in podocytes (inset shows detail from the same).

(E) Deletion of the FYVE domain of GFP-ANKFY1 abrogates the vesicular localization of the overexpressed protein.

(F) Overexpression of GFP-ANKFY1 reflecting the mutation Arg95Leu of an SRNS patient shows no obvious alteration of the subcellular localization.

(G-G’’) GFP-GAPVD1 and Myc-ANKFY1 show partial co-localization in cultured human podocytes.

of interaction premature (C) precipitate (B) not (A) Supplementary nephrin

mock Upon Upon A

construct -

GFP,

overexpression

(see overexpression GFP with stop

precipitates Fig -

GAPVD

tagged and Fig representing A B C .

3 .

IP: aGFP

D) IP: aMyc 5 160 loss 250 kDa IP: aMyc 160 30 250 160 160 160 kDa . 200 20

kDa

GAPVD

GAPVD is

and This not of

and Myc

the critical

a suggests - 1 Lysates (10 %) Lysates (10 %)

1 Lysates (5%) co

tagged 160 250 kDa 160 250 160 160

. 200 -

160 mutation kDa 30

20 interacts IP last -

with for

Myc 82

GAPVD

interaction

GFP

a that

Blot:

Blot: Myc a

a GFP a Myc a Myc a

anti GFP

amino Blot: - Myc in tagged

Myc GFP Mock Myc with GFP

wt Myc

RAC1 GFP -

the - - GAPVD1 /R1160* nephrin) patients GFP - - GAPVD1 - ANKFY1 - NPHS1

- GFP 1 GAPVD1

ANKFY

c acids in

terminal NPHS with

antibody HEK

with

(R GAPVD 1 293 1

1160 and

half but

SRNS, T GFP

cells

nephrin

1 not of

. - see

tagged

the .

which Myc

Fig cytosolic .

tagged . ANKFY

results 1 D ),

domain

shows RAC 1

, in

but

a 1

A B

kDa kDa Blot a

a ns RAB5

50 Actin 30 * 4

40 *

200 3

† 200

160 a GTP

GGFP 160 2

GFP

RAB5

Relative density Relative density [RAB5/actin]

a 1

IP: Lysates Lysates (2.5%) 0

30 30

C C’ E ns

Mock-GFP Texas-Red-dextran Texas-Red-dextran

D D’ Fluorescence intensity [ratio] Fluorescence intensity

GFP-GAPVD1 Texas-Red- Texas-Red- dextran dextran

Supplementary Fig. 6. RAB5 activity assay and lack of an effect of GAPVD1 overexpression on tracer endocytosis in human podocyte cell line.

(A) RAB5 activity assay in HEK293T cells. Cells express Mock-GFP, wild type GAPVD1 or GAPVD1 constructs that reflect the mutations that cause nephrotic syndrome. Compared to Mock-GFP, overexpressing wild type GAPVD1 does not result in a significant effect on RAB5 activity while the mutation from family B1381 (R937Q) increases active RAB5 (asterisk, see quantification in (B)). GFP staining reveals that compared to wild type GFP-GAPVD1 more GFP-GAPVD1-R937Q is precipitated along with the active RAB5 († sign). This suggests an increased affinity to active RAB5 compared to wild type.

(B) Quantitation of RAB5 activity shown as ratio of densities from RAB5 and actin normalized to Mock-GFP in experiments analogous to (A). The mutation R937Q significantly increases RAB5 activity while there is no significant effect of L414V. Each dot represents the result from one RAB5 assay normalized to an actin loading control (N=4).

(C-D’) Human podocytes transfected with Mock-GFP (C-C’) or GFP-GAPVD1 (D-D’) were exposed to Texas-Red-dextran (10 kDa) for 30 min. Transfected cells do not differ from neighboring cells in the extent of Texas-Red-dextran-positive vesicles. For quantification see (E).

(E) Quantitation of fluorescence intensity of experiments from (A-B’). Values are expressed as a ratio to fluorescence intensity of neighboring untransfected cells. N=26 (GFP-GAPVD1) and N=28 (Mock) respectively.

A B

250 160 aGAPVD1 250 aGAPVD1 160 50 aActin 50 40 40 aActin F Scrambled no serum 0 h 22 h C Scrambled qith serum Scrambled GAPVD1-shRNA1 D GAPVD1-shRNA2 GAPVD1-shRNA1

E Wound confluency [%] GAPVD1-shRNA2

0 h 22 h G K Supplementary Fig. 7. Characterization of stable shRNA lines used to measure Scrambled 100 Scrambled - serum Scrambled + serum podocyte migration rate for GAPVD1 (see Fig. 5A). ANKFY1-shRNA1 ANKFY1-shRNA2 80 ANKFY1-shRNA3 H ANFKY1- (A) Western blot from lysates of stable GAPVD1-shRNA or scrambled shRNA shRNA1 expressing human immortalized podocytes shows reduction of GAPVD1 by shRNA1 60 (weak knockdown) and GAPVD1-shRNA2 (strong knockdown). I ANFKY1- (B) Western blot from lysates of stable GAPVD1-shRNA and scrambled shRNA shRNA2 40

expressing human immortalized podocytes co-transfected for rescue constructs. [%] confluency Wound

Scrambled shRNA and mock-rescue (GFP) confirm the strong reduction of shRNA2 J ANFKY1- 20 (compare first to second lane). The wild type and mutant murine Gapvd1 rescue shRNA3 constructs escape knockdown because shRNA is directed against human GAPVD1 0 0 2 4 6 8 10 12 14 16 18 20 (lane three to five). The same is true for the murine Gapvd1 cDNA harboring the Time [h] respective loci of the mutations causing nephrotic syndrome(R937Q and L414, lanes four and five).

(C-E) Podocyte migration rate is analyzed by the IncuCyte videomicroscopy. Representative images show human podocytes directly after the scratch wound induction and 22 h thereafter. Scratch wound area (light blue) and podocytes that have migrated (dark blue) are shown. Representative images reveal wound confluency for podocytes expressing scrambled shRNA (D), while expression of two independent shRNA directed against ANKFY1 gives rise to a strongly reduced podocyte migration and partial wound closure (D and E).

(F) Graph shows wound confluence vs. time for the indicated genotypes. Error bars indicate SEM of 12 wells with identical conditions (18 wells per condition).

A B

a ANKFY1 160 160 aANKFY1

110 110

50 Actin 50 40 40 aActin 0 h 22 h C G Scrambled 100 Scrambled - serum Scrambled + serum ANKFY1-shRNA1 ANKFY1-shRNA2 80 ANKFY1-shRNA3 D ANFKY1- shRNA1

E ANFKY1-

shRNA2 40 Wound confluency [%] confluency Wound

F ANFKY1- 20 shRNA3

0 0 2 4 6 8 10 12 14 16 18 20 Time [h] Supplementary Fig. 8. Characterization of stable shRNA lines used to measure podocyte migration rate for ANKFY1 (see Fig. 5B).

(A) Western blot from lysates of stable ANKFY1-shRNA and scrambled shRNA expressing human immortalized podocytes. All three shRNAs tested resulted in knockdown of ANKFY1.

(B) Western blot from lysates of stable ANKFY1-shRNA and scrambled shRNA expressing human immortalized podocytes co-transfected for rescue constructs. Scrambled shRNA and mock-rescue (GFP) confirm the strong reduction of shRNA2 (compare first to second lane). The wild type and mutant ANKFY1 rescue constructs escape knockdown because of synonymous mutations within the shRNA target sequence.

(C-F) Podocyte migration rate is analyzed by the IncuCyte videomicroscopy. Representative images show human podocytes directly after the scratch wound induction and 22 h thereafter. Scratch wound area (light blue) and podocytes that have migrated (dark blue) are shown. Representative images reveal wound confluency for podocytes expressing scrambled shRNA (D), while expression of two independent shRNA directed against ANKFY1 gives rise to a strongly reduced podocyte migration and partial wound closure (D-F).

(G) Graph shows wound confluence vs. time for the indicated genotypes. Error bars indicate SEM of 12 wells with identical conditions (18 wells per condition).

A A’ A’’

RNAi 2 RNAi

Gapvd1 >

pros Sns Kirre merge control-RNAi

B C D Gapvd1-RNAi 1.8 ns * * * 1.6 * * 1.4 * 1.2

RQ RQ 1.0 * 0.8 * * 0.6 0.4 0.2 0 Gapvd1 Sns pros>Gapvd1-RNAi 2 pros>Gapvd1-RNAi 2

Supplementary Fig. 9. Phenotype of a second Gapvd1-RNAi, and qPCR analysis.

(A-A’) Immunostaining of Sns and Kirre in Drosophila nephrocytes expressing Gapvd1- RNAi2 reveals a thickening of the line of slit diaphragm proteins with protrusions towards the intracellular space and subcortical vesicular structures (inset shows subcortical section). (For comparison see control-RNAi Fig. 6D-D’’, and Gapvd1- RNAi1 Fig. 6E-E’’).

(B-C) Electron microscopy images of a nephrocyte expressing Gapvd1-RNAi2. The surface contains regular slit diaphragms but ectopic slit diaphragms are observed (red arrow head). Scale bar respresents 500 nm. (Control see Fig. 6F, Gapvd1-RNAi1 see Fig. 6G-H).

(D) qPCR from larvae expressing Gapvd1-RNAi1 ubiquitously with actin-GAL4 using primers for Gapvd1 and sns. The effect resulting from RPL39 primers were used to normalize the results. The Gapvd1 signal is reduced by Gapvd1 knockdown while expression of sns appears unaffected. Lysosomal degradation? Podocyte foot processes

Early endosome Nephrin recycling?

Slit diaphragm + nephrin nephrin Endocytosis of nephrin

Supplementary Fig. 10. Hypothetical working model for GAPVD1 and ANKFY1 loss-of-function in podocytes.

Nephrin that is ectopically localized and not in a homodimer is subject to endocytosis upon binding to GAPVD1. Consecutive activation of RAB5 and ANKFY1 occurs, propagating removal of nephrin from the cell surface and further endosomal processing. This may either result in degradation or recycling of nephrin. In that way, endocytosis may serve to restrict nephrin to the slit diaphragm. Supplementary Table 1: Primer sequences Construct Direction Primer sequence GAPVD1 full length human forward 5'-ATGGTGAAACTAGATATTCATACTCTG GAPVD1 full length human reverse 5'-TCACTTTCGGTCATCGATGGTTTTA GAPVD1- VPS9 domain human forward 5'-ATACCAGAGGTTTATCTTCGAGAAG GAPVD1- RasGAP domain reverse 5'-CTATCAGGGAGTCATTTCTAAACTGCTACT GAPVD1 VPS9 domain human forward 5'-ATACCAGAGGTTTATCTTCGAGAAG GAPVD1 full length mouse forward 5'-ATGGTGAAGCTAGATATTCACACATTG GAPVD1 full length mouse reverse 5'-TCACTTTCTGTCATCGATGGTTTTAAT GAPVD1 mutation R937Q forward 5'-AGTGTCTTCTGTGCAGCGGCCCATGAGTG mouse reverse 5'-CACTCATGGGCCGCTGCACAGAAGACACT GAPVD1 mutation L414V 5'-GTGGTGTATATAAGTTACAGTCAGGTTATTA mouse forward CTCTGGTAAATTTTATGA GAPVD1 mutation L414V 5'-TCATAAAATTTACCAGAGTAATAACC mouse reverse TGACTGTAACTTATATACACCAC GAPVD1 mutation R937Q 5'-TATAGTATCTTCTGTCCAG human forward AGACCCATGAGTGACC GAPVD1 mutation R937Q 5'-GGTCACTCATGGGTCTCTGGACAGAAGATA human reverse CTATA 5'-CATAAAATTCACCAGAGTAATAACCTGACTGT GAPVD1 mutation L414 human forward AGGTTATATAAACCA 5'-TGGTTTATATAACCTACAGTCAGGTTATTAC GAPVD1 mutation L414 human reverse TCTGGTGAATTTTATG GAPVD1 gRNA 1 forward 5'-CACCGTTGCTAACTGCTGCAAAAGG GAPVD1 gRNA 1 reverse 5'-AAACCCTTTTGCAGCAGTTAGCAAC GAPVD1 gRNA 2 forward 5'-CACCGGCGATCTGAAGATAAAGGTT GAPVD1 gRNA 2 reverse 5'-AAACTCAGGTTTTGCGATACTTGAC 5'-gatccGCCACTTTACATGAGCCAATTCGAAAA GAPVD1 shRNA 1 forward TTGGCTCATGTAAAGTGGCTTTTTTACGCGTg 5'-gatccGCACCTCATTCATCATCTTCACGAATGA GAPVD1 shRNA 2 reverse AGATGATGAATGAGGTGCTTTTTTACGCGTg ANKFY1 -DFYVE reverse 5'-CTACTAGTTATTCACCCCGAGGCGAG ANKFY1 mutation R95L human forward 5'-GTCCTTCATCAGCCTTCTGCTGGCCATCG ANKFY1 mutation R95L human reverse 5'-CGATGGCCAGCAGAAGGCTGATGAAGGAC 5'-gatccGCTGCCACTTTCCTCATTAAGCGAAC ANKFY1 shRNA 1 forward TTAATGAGGAAAGTGGCAGCTTTTTTACGCGTg 5'-aattcACGCGTAAAAAAGCTGCCACTTTCCTC ANKFY1 shRNA 1 reverse ATTAAGTTCGCTTAATGAGGAAAGTGGCAGCg 5'-gatccGCAGAAAGCCAATGCTCTTCACGAATG ANKFY1 shRNA 2 forward AAGAGCATTGGCTTTCTGCTTTTTTACGCGTg 5'-aattcACGCGTAAAAAAGCAGAAAGCCAATGCT ANKFY1 shRNA 2 reverse CTTCATTCGTGAAGAGCATTGGCTTTCTGCg 5'-gatccGCTCCTGGCATACATGAAAGGCGAAC ANKFY1 shRNA 3 forward CTTTCATGTATGCCAGGAGCTTTTTTACGCGTg 5'-aattcACGCGTAAAAAAGCTCCTGGCATACA ANKFY1 shRNA 3 reverse TGAAAGGTTCGCCTTTCATGTATGCCAGGAGCg ANKFY1 gRNA 1 forward 5'-CACCGTGGCAGCCCGCAGTGACAGC ANKFY1 gRNA 1 reverse 5'-AAACGCTGTCACTGCGGGCTGCCAC ANKFY1 gRNA 2 forward 5'-CACCGGCGATCTGAAGATAAAGGTT ANKFY1 gRNA 2 reverse 5'-AAACAACCTTTATCTTCAGATCGCC ANKFY1 shRNA resistant 5'-CCATTCTTAATGAGGAAGGTGGCGGCAAAG forward mutation AGATCTCCTCT ANKFY1 shRNA resistant 5'-AGAGGAGATCTCTTTGCCGCCACCTTC reverse mutation CTCATTAAGAATGG NPHS1 full length human forward 5'-ATGGCCCTGGGGACGACG NPHS1 full length human reverse 5'-CTACACCAGATGTCCCCTCAGCT NPHS1- R1160* reverse 5'-CTAGGAATAAGACACCTCCTCCTG NPHS1- aa1160-1241 forward 5'-CGAGGTTTCACAGGTGAAGATG NPHS1 -aa1084-1160 forward 5'-CTCTGGCAGCGGAGACTCA