DOCSLIB.ORG

ADAM and ADAMTS) Enzymes in Human Non-Small-Cell Lung Carcinomas (NSCLC)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
ADAM and ADAMTS) Enzymes in Human Non-Small-Cell Lung Carcinomas (NSCLC) British Journal of Cancer (2006) 94, 724 – 730 & 2006 Cancer Research UK All rights reserved 0007 – 0920/06 $30.00 www.bjcancer.com Expression of a disintegrin and metalloprotease (ADAM and ADAMTS) enzymes in human non-small-cell lung carcinomas (NSCLC) 1 1 1 2 1 1 1 1 N Rocks , G Paulissen , F Quesada Calvo , M Polette , M Gueders , C Munaut , J-M Foidart , A Noel , 2 *,1 P Birembaut and D Cataldo 1 Laboratory of Pneumology and Laboratory of Tumor and Development Biology, Center for Biomedical Integrative Genoproteomics (CBIG), University of 2 Lie`ge and Centre Hospitalier Universitaire de Lie`ge (CHU-Lie`ge), Avenue de l’Hoˆpital, CHU, Sart-Tilman, Lie`ge 4000, Belgium; INSERM U514, Laboratory Pol Bouin, Hoˆpital Maison Blanche CHU, Reims, France A Disintegrin and Metalloprotease (ADAM) are transmembrane proteases displaying multiple functions. ADAM with ThromboSpondin-like motifs (ADAMTS) are secreted proteases characterised by thrombospondin (TS) motifs in their C-terminal domain. The aim of this work was to evaluate the expression pattern of ADAMs and ADAMTS in non small cell lung carcinomas (NSCLC) and to investigate the possible correlation between their expression and cancer progression. Reverse transcriptase– polymerase chain reaction (RT–PCR), Western blot and immunohistochemical analyses were performed on NSCLC samples and corresponding nondiseased tissue fragments. Among the ADAMs evaluated (ADAM-8, -9, -10, -12, -15, -17, ADAMTS-1, TS-2 and TS-12), a modulation of ADAM-12 and ADAMTS-1 mRNA expression was observed. Amounts of ADAM-12 mRNA transcripts were increased in tumour tissues as compared to the corresponding controls. In sharp contrast, ADAMTS-1 mRNA levels were significantly lower in tumour tissues when compared to corresponding nondiseased lung. These results were corroborated at the protein level by Western blot and immunohistochemistry. A positive correlation was observed between the mRNA levels of ADAM- Molecular Diagnostics 12 and those of two vascular endothelial growth factor (VEGF)-A isoforms (VEGF-A and VEGF-A ). Taken together, these 165 121 results providing evidence for an overexpression of ADAM-12 and a lower expression of ADAMTS-1 in non-small-cell lung cancer suggest that these proteases play different functions in cancer progression. British Journal of Cancer (2006) 94, 724–730. doi:10.1038/sj.bjc.6602990 www.bjcancer.com Published online 21 February 2006 & 2006 Cancer Research UK Keywords: ADAM; ADAMTS; lung; proteinases; VEGF Lung cancer is one of the most common causes of cancer death in Although their functions are not yet fully elucidated, an Europe and in the United States and disease frequency rapidly upregulation of ADAMs and ADAMTS has been observed in some increased over the last decades. Accumulating evidence demon- pathological conditions. A recent report suggests that ADAM-8 is strated the important role of proteolytic enzymes such as matrix overexpressed by lung cancer cells and is detectable in patient’s metalloproteinases (MMPs) in cancer progression (Egeblad and serum (Ishikawa et al, 2004). A disintegrin and metalloprotease-10 Werb, 2002; Overall and Lopez-Otin, 2002; Handsley and Edwards, is upregulated in some tumour cells (Wu et al, 1997) and in 2005). In contrast, to date, no information is available on the arthritic chondrocytes (McKie et al, 1997). A disintegrin and putative relationship existing between lung cancers and MMP- metalloprotease-12 and 15 are also abundantly expressed in cells related enzymes such as A Disintegrin and Metalloprotease derived from haematological malignancies (Wu et al, 1997). (ADAM) and ADAM with ThromboSpondin-like motifs Monocytes from lung cancer patients produce elevated levels of (ADAMTS) proteases. mature TNF-a (Trejo et al, 2001) which could result from the A disintegrin and metalloprotease is a family of transmembrane shedding of pro-TNF-a by ADAM-17 (TACE) (Black et al, 1997). proteases displaying multiple functions among which 21 human ADAM with TS-like motifs-1 (ADAMTS-1) is expressed in colon ADAM genes likely encode active proteases (Puente et al, 2003). A cancer cells (Kuno et al, 1997). disintegrin and metalloprotease with thrombospondin (TS)-like Even if the implication of ADAMs and ADAMTS during lung motifs are secreted molecules bearing TS motifs in their C-terminal cancer progression remains unclear, it is conceivable that, as domain (Killar et al, 1999; Kaushal and Shah, 2000; Tang, 2001; Cal shown for MMPs, these related proteases contribute to extra- et al, 2002). On the basis of their structure, ADAMs and ADAMTS cellular matrix degradation, cell–cell adhesion, cell proliferation, are thought to mediate a wide variety of activities including cell migration as well as to the processing of cytokines or growth proteolysis, adhesion, cell fusion and signalling (Porter et al, 2005). factors (Egeblad and Werb, 2002; Overall and Lopez-Otin, 2002; Handsley and Edwards, 2005). The putative interest of studying ADAMs and ADAMTS in lung carcinomas is reinforced by a recent *Correspondence: Dr D Cataldo; E-mail: [email protected] report of Lemjabbar et al (2003), demonstrating that tobacco Received 19 September 2005; revised 21 December 2005; accepted 17 smoke-induced bronchial epithelial cell proliferation is mediated January 2006; published online 21 February 2006 by the cleavage of amphiregulin, a ligand of EGF receptor, by ADAM proteases in NSCLC N Rocks et al 725 ADAM-17. A disintegrin and metalloprotease-15 (ADAM-15) cultured in collagen-coated Petri dishes in Airway Epithelial Cell deficiency in mice is associated with impaired pathological Basal Medium (Promocell, Heidelberg, Germany). angiogenesis and reduced tumour growth (Horiuchi et al, 2003). Total RNAs were extracted from normal and tumoral lung In addition, recently, an interplay between vascular endothelial tissues as well as from 16-HBE, BZR, BZR-T33 and BEAS-2B cells growth factor (VEGF) and metalloproteases has been reported. by the use of the RNA Easy Qiagen Kit (Qiagen, MD, USA). Total This new concept is supported by (1) the ability of ADAMTS-1 to RNA concentrations were measured using the RiboGreen RNA bind VEGF and functionally inactivate VEGFR2 (Iruela-Arispe quantification Kit (Molecular Probes, OR, USA). Samples were et al, 2003), (2) the existence of a correlation between VEGF and stored at À801C. some MMP expression in tumours, (3) the upregulation of VEGF- A expression by the active form of membrane type-1 MMP (MT1- Design of oligonucleotide primers MMP, MMP14) (Munaut et al, 2003), (4) the reduction of VEGF expression in tumour cells by physiological inhibitor (TIMP-2) The design of oligonucleotide primers specific for the different (Hajitou et al, 2001) or synthetic inhibitor (Sounni et al, 2004) of targets was based on sequences available in the Genbank. Primers, MMPs. These observations suggest the involvement of ADAM, obtained from Eurogentec (Seraing, Belgium), were designed to ADAMTS and MMP members in the control of angiogenesis, a key anneal to distinct exons and the specificity of the selected step of metastatic dissemination. sequences was verified with the NCBI BLASTN program (Table 2). The aim of the present work was to determine the expression Polymerase chain reaction products obtained with each pair of profile of selected ADAMs and ADAMTS in NSCLC as well as to primers were digested with appropriate restriction enzymes to study the putative correlation existing between these proteases and verify the specificity of amplification. VEGF isoform expression levels and the disease stage. Semiquantitative RT–PCR MATERIALS AND METHODS The mRNA expression levels of ADAMs, ADAMTS and VEGF-A were determined by semiquantitative RT–PCR. Reverse Tumour tissue samples Surgical samples from non-small-cell lung tumours and corre- Table 1 Characteristics of tumours and patients sponding lung control tissues were obtained from 39 patients with squamous cell lung cancers or adenocarcinomas. Characteristics of Adenocarcinoma Squamous cell patients and histological subtypes are described in Table 1. The protocol of the study was approved by the Ethical Committee of Number of samples 26 13 ˆ Mean age 60 67 the Hopital Maison Blanche, Reims and informed consent was Sex ratio (M/F) 22/4 12/1 obtained from all patients before surgery. TT1:2 T1:2 T2:20 T2:9 Cell culture and RNA isolation T3:4 T3:2 Lung cancer cell lines: BEAS-2B were purchased from ATCC, while NN0:15 N0:6 BZR, BZR-T33, and 16-HBE were kindly provided by Dr CC Harris N1:5 N1:7 (National Institute of Health, Bethesda, MD, USA). All cell lines N2:5 N :1 were cultured in Dulbecco’s modified Eagle’s medium (DMEM, 3 Invitrogen, Merelbeke, Belgium) supplemented with 10% foetal MM0:26 M0:13 bovine serum, 5% penicillin–streptomycin (Invitrogen, Merelbeke, Belgium) and 5% glutamine in 5% CO2 at 371C. BEAS-2B cells were The staging reported here is the histological staging obtained after surgical resection Table 2 Primer sequences designed for RT–PCR studies ADAM (accession number) Tm Cycles Primer Sequence Molecular Diagnostics ADAM-8 (NM_001109) 56 38 Antisens 50TTCTTGCTGTGGTCCTGGTTCA30 Sens 50GTGAATCACGTGGACAAGCTAT30 ADAM-9 (U41766) 60 28 Antisens 50TTTTCCCGCCACTGCACGAAGT30 Sens 50AGAAGAGCTGTCTTGCCACAGA30 ADAM-10 (AF009615) 60 28 Antisens 50GGTTGGCCAGATTCAACAAAAC30 Sens 50TTTGGATCCCCACATGATTCTG 30 ADAM-12 (AF023476) 56 35 Antisens 50TTCCTGCTGCAACTGCTGAACA30 Sens 50GGAATTGTCATGGACCATTCAG30 12 spliced long (NM_003474) 58 36 Antisens 50TTGAGGGGTCTGCTGATGTCAA30 Sens 50TTGGCTTTGGAGGAAGCACAGA30
Load more

Recommended publications
  • Effect of Thrombin Treatment of Tumor Cells on Adhesion of Tumor Cells to Platelets in Vitro and Tumor Metastasis in Vivo1
    [CANCER RESEARCH 52. 3267-3272, June 15. 1992] Effect of Thrombin Treatment of Tumor Cells on Adhesion of Tumor Cells to Platelets in Vitro and Tumor Metastasis in Vivo1 Mary Lynn R. Nierodzik, Francis Kajumo, and Simon Karpatkin2 New York University Medical School, New York, New York 10016 [M. L. R. N., F. K., S. K.J, and Department of Veterans Affairs Medical Center, New York, New York 10010 ¡M.L. R. N.¡ ABSTRACT liunit concentrations of thrombin results in a 2- to 5-fold enhancement of adhesion to 6 different tumor cell lines from 3 Seven different tumor cell lines (human melanoma SK MEL 28; different species in vitro; infusion of thrombin in vivo results in hamster melanoma HM29; murine melanomas B16F10 and amelanotic melanoma B16a; human colon carcinoma 11("IX:murine colon carcinoma a 4- to 413-fold enhancement in pulmonary metastasis with CT26; and murine Lewis lung carcinoma) were treated with thrombin at two different tumor cell lines (5). 0.5-1 unit/ml and examined for their ability to bind to adherent platelets; Because of the marked effect of thrombin on platelet adhe HM29 was studied for its ability to bind to fibronectin and von Willebrand siveness to tumor cells in vitro and tumor metastasis in vivo, as factor; <T2<>.»1611.B16F10, and B16a were studied for their ability to well as the requirement of active thrombin on the platelet form pulmonary metastasis after i.v. injection of thrombin-treated tumor surface, we elected to determine whether tumor cells could be cells; CT26 was studied for its ability to grow s.c.
    [Show full text]
  • What Are the Roles of Metalloproteinases in Cartilage and Bone Damage? G Murphy, M H Lee
    iv44 Ann Rheum Dis: first published as 10.1136/ard.2005.042465 on 20 October 2005. Downloaded from REPORT What are the roles of metalloproteinases in cartilage and bone damage? G Murphy, M H Lee ............................................................................................................................... Ann Rheum Dis 2005;64:iv44–iv47. doi: 10.1136/ard.2005.042465 enzyme moiety into an upper and a lower subdomain. A A role for metalloproteinases in the pathological destruction common five stranded beta-sheet and two alpha-helices are in diseases such as rheumatoid arthritis and osteoarthritis, always found in the upper subdomain with a further C- and the irreversible nature of the ensuing cartilage and bone terminal helix in the lower subdomain. The catalytic sites of damage, have been the focus of much investigation for the metalloproteinases, especially the MMPs, have been several decades. This has led to the development of broad targeted for the development of low molecular weight spectrum metalloproteinase inhibitors as potential therapeu- synthetic inhibitors with a zinc chelating moiety. Inhibitors tics. More recently it has been appreciated that several able to fully differentiate between individual enzymes have families of zinc dependent proteinases play significant and not been identified thus far, although a reasonable level of varied roles in the biology of the resident cells in these tissues, discrimination is now being achieved in some cases.7 Each orchestrating development, remodelling, and subsequent family does, however, have other unique domains with pathological processes. They also play key roles in the numerous roles, including the determination of physiological activity of inflammatory cells. The task of elucidating the substrate specificity, ECM, or cell surface localisation (fig 1).
    [Show full text]
  • Human ADAM12 Quantikine ELISA
    Quantikine® ELISA Human ADAM12 Immunoassay Catalog Number DAD120 For the quantitative determination of A Disintegrin And Metalloproteinase domain- containing protein 12 (ADAM12) concentrations in cell culture supernates, serum, plasma, and urine. This package insert must be read in its entirety before using this product. For research use only. Not for use in diagnostic procedures. TABLE OF CONTENTS SECTION PAGE INTRODUCTION .....................................................................................................................................................................1 PRINCIPLE OF THE ASSAY ...................................................................................................................................................2 LIMITATIONS OF THE PROCEDURE .................................................................................................................................2 TECHNICAL HINTS .................................................................................................................................................................2 MATERIALS PROVIDED & STORAGE CONDITIONS ...................................................................................................3 OTHER SUPPLIES REQUIRED .............................................................................................................................................3 PRECAUTIONS .........................................................................................................................................................................4
    [Show full text]
  • Negatively Regulated by ADAM15 TRIF-Mediated TLR3 and TLR4
    TRIF-Mediated TLR3 and TLR4 Signaling Is Negatively Regulated by ADAM15 Suaad Ahmed, Ashwini Maratha, Aisha Qasim Butt, Enda Shevlin and Sinead M. Miggin This information is current as of September 27, 2021. J Immunol 2013; 190:2217-2228; Prepublished online 30 January 2013; doi: 10.4049/jimmunol.1201630 http://www.jimmunol.org/content/190/5/2217 Downloaded from Supplementary http://www.jimmunol.org/content/suppl/2013/01/30/jimmunol.120163 Material 0.DC1 References This article cites 57 articles, 20 of which you can access for free at: http://www.jimmunol.org/ http://www.jimmunol.org/content/190/5/2217.full#ref-list-1 Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists by guest on September 27, 2021 • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2013 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology TRIF-Mediated TLR3 and TLR4 Signaling Is Negatively Regulated by ADAM15 Suaad Ahmed, Ashwini Maratha, Aisha Qasim Butt, Enda Shevlin, and Sinead M.
    [Show full text]
  • ADAM10 Site-Dependent Biology: Keeping Control of a Pervasive Protease
    International Journal of Molecular Sciences Review ADAM10 Site-Dependent Biology: Keeping Control of a Pervasive Protease Francesca Tosetti 1,* , Massimo Alessio 2, Alessandro Poggi 1,† and Maria Raffaella Zocchi 3,† 1 Molecular Oncology and Angiogenesis Unit, IRCCS Ospedale Policlinico S. Martino Largo R. Benzi 10, 16132 Genoa, Italy; [email protected] 2 Proteome Biochemistry, IRCCS San Raffaele Scientific Institute, 20132 Milan, Italy; [email protected] 3 Division of Immunology, Transplants and Infectious Diseases, IRCCS San Raffaele Scientific Institute, 20132 Milan, Italy; [email protected] * Correspondence: [email protected] † These authors contributed equally to this work as last author. Abstract: Enzymes, once considered static molecular machines acting in defined spatial patterns and sites of action, move to different intra- and extracellular locations, changing their function. This topological regulation revealed a close cross-talk between proteases and signaling events involving post-translational modifications, membrane tyrosine kinase receptors and G-protein coupled recep- tors, motor proteins shuttling cargos in intracellular vesicles, and small-molecule messengers. Here, we highlight recent advances in our knowledge of regulation and function of A Disintegrin And Metalloproteinase (ADAM) endopeptidases at specific subcellular sites, or in multimolecular com- plexes, with a special focus on ADAM10, and tumor necrosis factor-α convertase (TACE/ADAM17), since these two enzymes belong to the same family, share selected substrates and bioactivity. We will discuss some examples of ADAM10 activity modulated by changing partners and subcellular compartmentalization, with the underlying hypothesis that restraining protease activity by spatial Citation: Tosetti, F.; Alessio, M.; segregation is a complex and powerful regulatory tool.
    [Show full text]
  • ADAMTS13 and 15 Are Not Regulated by the Full Length and N‑Terminal Domain Forms of TIMP‑1, ‑2, ‑3 and ‑4
    BIOMEDICAL REPORTS 4: 73-78, 2016 ADAMTS13 and 15 are not regulated by the full length and N‑terminal domain forms of TIMP‑1, ‑2, ‑3 and ‑4 CENQI GUO, ANASTASIA TSIGKOU and MENG HUEE LEE Department of Biological Sciences, Xian Jiaotong-Liverpool University, Suzhou, Jiangsu 215123, P.R. China Received June 29, 2015; Accepted July 15, 2015 DOI: 10.3892/br.2015.535 Abstract. A disintegrin and metalloproteinase with thom- proteolysis activities associated with arthritis, morphogenesis, bospondin motifs (ADAMTS) 13 and 15 are secreted zinc angiogenesis and even ovulation [as reviewed previously (1,2)]. proteinases involved in the turnover of von Willebrand factor Also known as the VWF-cleaving protease, ADAMTS13 and cancer suppression. In the present study, ADAMTS13 is noted for its ability in cleaving and reducing the size of the and 15 were subjected to inhibition studies with the full-length ultra-large (UL) form of the VWF. Reduction in ADAMTS13 and N-terminal domain forms of tissue inhibitor of metallo- activity from either hereditary or acquired deficiency causes proteinases (TIMPs)-1 to -4. TIMPs have no ability to inhibit accumulation of UL-VWF multimers, platelet aggregation and the ADAMTS proteinases in the full-length or N-terminal arterial thrombosis that leads to fatal thrombotic thrombocy- domain form. While ADAMTS13 is also not sensitive to the topenic purpura [as reviewed previously (1,3)]. By contrast, hydroxamate inhibitors, batimastat and ilomastat, ADAMTS15 ADAMTS15 is a potential tumor suppressor. Only a limited app can be effectively inhibited by batimastat (Ki 299 nM). In number of in-depth investigations have been carried out on the conclusion, the present results indicate that TIMPs are not the enzyme; however, expression and profiling studies have shown regulators of these two ADAMTS proteinases.
    [Show full text]
  • ADAMTS Proteases in Vascular Biology
    Review MATBIO-1141; No. of pages: 8; 4C: 3, 6 ADAMTS proteases in vascular biology Juan Carlos Rodríguez-Manzaneque 1, Rubén Fernández-Rodríguez 1, Francisco Javier Rodríguez-Baena 1 and M. Luisa Iruela-Arispe 2 1 - GENYO, Centre for Genomics and Oncological Research, Pfizer, Universidad de Granada, Junta de Andalucía, 18016 Granada, Spain 2 - Department of Molecular, Cell, and Developmental Biology, Molecular Biology Institute, University of California, Los Angeles, Los Angeles, CA 90095, USA Correspondence to Juan Carlos Rodríguez-Manzaneque and M. Luisa Iruela-Arispe: J.C Rodríguez-Manzaneque is to be contacted at: GENYO, 15 PTS Granada - Avda. de la Ilustración 114, Granada 18016, Spain; M.L. Iruela-Arispe, Department of Molecular, Cell and Developmental Biology, UCLA, 615 Charles Young Drive East, Los Angeles, CA 90095, USA. [email protected]; [email protected] http://dx.doi.org/10.1016/j.matbio.2015.02.004 Edited by W.C. Parks and S. Apte Abstract ADAMTS (a disintegrin and metalloprotease with thrombospondin motifs) proteases comprise the most recently discovered branch of the extracellular metalloenzymes. Research during the last 15 years, uncovered their association with a variety of physiological and pathological processes including blood coagulation, tissue repair, fertility, arthritis and cancer. Importantly, a frequent feature of ADAMTS enzymes relates to their effects on vascular-related phenomena, including angiogenesis. Their specific roles in vascular biology have been clarified by information on their expression profiles and substrate specificity. Through their catalytic activity, ADAMTS proteases modify rather than degrade extracellular proteins. They predominantly target proteoglycans and glycoproteins abundant in the basement membrane, therefore their broad contributions to the vasculature should not come as a surprise.
    [Show full text]
  • Expression of the Disintegrin Metalloprotease, ADAM-10, In
    314 Vol. 10, 314–323, January 1, 2004 Clinical Cancer Research Expression of the Disintegrin Metalloprotease, ADAM-10, in Prostate Cancer and Its Regulation by Dihydrotestosterone, Insulin-Like Growth Factor I, and Epidermal Growth Factor in the Prostate Cancer Cell Model LNCaP Daniel R. McCulloch,1 Pascal Akl,1 Conclusions: This study describes for the first time Hemamali Samaratunga,2 Adrian C. Herington,1 the expression, regulation, and cellular localization of and Dimitri M. Odorico1 ADAM-10 protein in PCa. The regulation and membrane 1 localization of ADAM-10 support our hypothesis that Hormone-Dependent Cancer Program, School of Life Sciences, ADAM-10 has a role in extracellular matrix maintenance Queensland University of Technology, Brisbane, Queensland, Australia, and 2Sullivan Nicolaides Pathology, Brisbane, Queensland, and cell invasion, although the potential role of nuclear Australia ADAM-10 is not yet known. INTRODUCTION ABSTRACT The disintegrin metalloproteases ADAMs, like the matrix Purpose: The disintegrin metalloprotease ADAM-10 is metalloproteinases (MMPs), are members of the metzincin a multidomain metalloprotease that is potentially significant (zinc-dependent metalloprotease) superfamily. To date, more in tumor progression due to its extracellular matrix-degrad- than 30 ADAMs have been characterized (1), some of which are ing properties. Previously, ADAM-10 mRNA was detected involved in diverse biological functions such as fertilization, in prostate cancer (PCa) cell lines; however, the presence of neurogenesis (2, 3), and the ectodomain shedding of growth ADAM-10 protein and its cellular localization, regulation, factors such as amyloid precursor protein and tumor necrosis and role have yet to be described. We hypothesized that factor ␣ (4, 5).
    [Show full text]
  • Conservation and Divergence of ADAM Family Proteins in the Xenopus Genome
    Wei et al. BMC Evolutionary Biology 2010, 10:211 http://www.biomedcentral.com/1471-2148/10/211 RESEARCH ARTICLE Open Access ConservationResearch article and divergence of ADAM family proteins in the Xenopus genome Shuo Wei*1, Charles A Whittaker2, Guofeng Xu1, Lance C Bridges1,3, Anoop Shah1, Judith M White1 and Douglas W DeSimone1 Abstract Background: Members of the disintegrin metalloproteinase (ADAM) family play important roles in cellular and developmental processes through their functions as proteases and/or binding partners for other proteins. The amphibian Xenopus has long been used as a model for early vertebrate development, but genome-wide analyses for large gene families were not possible until the recent completion of the X. tropicalis genome sequence and the availability of large scale expression sequence tag (EST) databases. In this study we carried out a systematic analysis of the X. tropicalis genome and uncovered several interesting features of ADAM genes in this species. Results: Based on the X. tropicalis genome sequence and EST databases, we identified Xenopus orthologues of mammalian ADAMs and obtained full-length cDNA clones for these genes. The deduced protein sequences, synteny and exon-intron boundaries are conserved between most human and X. tropicalis orthologues. The alternative splicing patterns of certain Xenopus ADAM genes, such as adams 22 and 28, are similar to those of their mammalian orthologues. However, we were unable to identify an orthologue for ADAM7 or 8. The Xenopus orthologue of ADAM15, an active metalloproteinase in mammals, does not contain the conserved zinc-binding motif and is hence considered proteolytically inactive. We also found evidence for gain of ADAM genes in Xenopus as compared to other species.
    [Show full text]
  • Selective Inhibition of ADAM12 Catalytic Activity Through
    Selective inhibition of ADAM12 catalytic activity through engineering of tissue inhibitor of metalloproteinases (TIMP)-2 Marie Kveiborg, Jonas Jacobsen, Meng-Huee Lee, Hideaki Nagase, Ulla M Wewer, Gillian Murphy To cite this version: Marie Kveiborg, Jonas Jacobsen, Meng-Huee Lee, Hideaki Nagase, Ulla M Wewer, et al.. Selective inhibition of ADAM12 catalytic activity through engineering of tissue inhibitor of metalloproteinases (TIMP)-2. Biochemical Journal, Portland Press, 2010, 430 (1), pp.79-86. 10.1042/BJ20100649. hal-00506526 HAL Id: hal-00506526 https://hal.archives-ouvertes.fr/hal-00506526 Submitted on 28 Jul 2010 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Biochemical Journal Immediate Publication. Published on 10 Jun 2010 as manuscript BJ20100649 Selective inhibition of ADAM12 catalytic activity through engineering of tissue inhibitor of metalloproteinases (TIMP)-2 Marie Kveiborg*,§, Jonas Jacobsen*,§, Meng-Huee Lee†, Hideaki Nagase‡, Ulla M. Wewer*,¶, and Gillian Murphy†,¶ *Department of Biomedical Sciences and Biotech Research and Innovation Centre (BRIC), University of Copenhagen, Ole Maaløes Vej 5, 2200 Copenhagen, Denmark †Department of Oncology, Cambridge University, Cancer Research Institute, Li Ka Shing Centre, Cambridge CB2 ORE, UK ‡Kennedy Institute of Rheumatology Division, Faculty of Medicine, Imperial College London, 65 Aspenlea Road, London W6 8LH, UK §,¶These authors contributed equally to the study.
    [Show full text]
  • Antibody Target for Therapeutic Inhibition Of
    CRT OPPORTUNITY Biological Therapeutics - Target Validation ANTIBODY TARGET FOR THERAPEUTIC INHIBITION OF ADAM8 • ADAM8 is a tractable target with broad utility in oncology and inflammatory indications • Recent study validates ADAM8 as an antibody target in cancer COMMERCIAL OPPORTUNITY A CRT is seeking a collaborative or licensing partner to develop an antibody against the validated target ADAM8 to inhibit activity for cancer therapy. We identified an epitope on ADAM8 (MS2, CD156), where three amino acids are exposed on the outside of the disintegrin domain (Fig 1A). This sequence forms a potential contact surface with several proteins, influencing ADAM8 activity. This epitope was then mimicked by a cyclic peptide and use of this peptide resulted in decreased ADAM8 activity. We now seek collaboration with a partner wanting to develop an inhibitory antibody against the epitope for use in cancer therapy and other ADAM8-related diseases. ADAM8 has been validated as a target by peptide inhibition, several knock-out and knock-down model systems and also by inhibition with commercial tool antibodies binding to the indicated epitope. Inhibition of ADAM8 by our peptide inhibitor BK-1361 comes with data that validates ADAM8 as a cancer target, plus identified targets potentially useful as PD markers. Additionally, there is the opportunity to develop a companion diagnostic. Figure 1: In vivo efficacy of inhibition of breast tumour formation with a commercial tool antibody against ADAM8 (MAb 1031). A) We demonstrated ADAM8 activity as being instrumental The epitope needed for activation of ADAM8. B) and C) show the inhibition of tumour formation and growth in a breast tumour model for tumour development in several indications including using MDA-MB-231 cells injected in the mammary fat pad of female pancreatic cancer [2] and glioma [3].
    [Show full text]
  • ADAM15 Targets MMP9 Activity to Promote Lung Cancer Cell Invasion
    ONCOLOGY REPORTS 34: 2451-2460, 2015 ADAM15 targets MMP9 activity to promote lung cancer cell invasion DAN-DAN DONG1, HUI ZHOU2 and GAO LI3 1Department of Pathology, Sichuan Academy of Medical Sciences, Sichuan Provincial People's Hospital, Chengdu, Sichuan 610072; 2Department of Thoracic Medicine, The Affiliated Cancer Hospital of Xiangya School of Medicine, Central South University, Changsha, Hunan 410013; 3Department of Thoracic Surgery, Hainan General Hospital, Haikou, Hainan 570311, P.R. China Received June 17, 2015; Accepted July 20, 2015 DOI: 10.3892/or.2015.4203 Abstract. ADAM15 is a membrane-associated proteinase bound cell surface glycoproteins (1). These zinc-dependent belonging to a disintegrin and metalloproteinase (ADAM) proteases contain an amino terminal metalloproteinase and a family. Recent studies suggested that ADAM15 is overex- disintegrin domain, a cysteine-rich and an EGF-like sequence, pressed in several types of cancer and is involved in metastatic a transmembrane and a cytoplasmic domain (2). It has been tumor progression. However, the function of ADAM15 in proven that 13 members of ADAM family are catalytically non-small cell lung cancer (NSCLC) is currently unknown. In active through their metalloproteinase domain. These catalytic the present study, we found that high expression of ADAM15 members play an important role in mediating extracellular was associated with decreased overall survival (OS) and matrix protein degradation and shedding of growth factors, disease-free survival (DFS) in NSCLC patients. Furthermore, cytokines and adhesion molecules. Besides, the disintegrin shRNA-mediated knockdown of ADAM15 attenuated cell domain of ADAMs is also involved in binding to integrins migration and invasion. Mechanistic study demonstrated that to mediate cell-cell and cell-matrix interactions (3).
    [Show full text]