Diss. ETH No. 15015

Interactions among sulfate-reducing and purple sulfur bacteria in the chemocline of meromictic Lake Cadagno, Switzerland

A dissertation submitted to the SWISS FEDERAL INSTITUTE OF TECHNOLOGY ZURICH for the degree of DOCTOR OF NATURAL SCIENCES

presented by SANDRO PEDUZZI Ing. dipl. EPFL born on October 15, 1973 from Airolo (Ticino)

accepted on the recommendation of

Prof. Dr. Alexander J.B. Zehnder, examiner Prof. Dr. Dittmar Hahn, co-examiner Dr. Mauro Tonolla, co-examiner

2003

Contents

Summary...... 7 Résumé...... 9

Chapter 1 13

Introduction 13

1.1 Stratified lakes...... 14 1.2 Lake Cadagno...... 17 1.3 The sulfur cycle...... 20 1.3.1 Sulfate-reduction...... 24 1.3.2 Sulfur disproportionation ...... 25 1.3.3 Anoxygenic photosynthesis ...... 26 1.3.4 Sulfate-reducing and phototropic sulfur bacteria in Lake Cadagno...... 29 1.3 Aim of the thesis ...... 32 1.4 References...... 34

Chapter 2 45

In situ analysis of sulfate-reducing bacteria related to Desulfocapsa thiozymogenes in the chemocline of meromictic Lake Cadagno (Switzerland) 45

Abstract ...... 46 References...... 53

Chapter 3 57

Spatio-temporal distribution of phototrophic sulfur bacteria in the chemocline of meromictic Lake Cadagno (Switzerland) 57

3.1 Abstract ...... 58 3.2 Introduction...... 58 3.3. Material and Methods...... 59 3.3.1. Site description, physical analyses and sampling...... 59 3.3.2. Chemical analysis ...... 60 3.3.3. Microbial analysis...... 60 3.4 Results...... 62 3.4.1. Analysis of physico-chemical conditions...... 62 3.4.2. Microbial analysis...... 64 3.5 Discussion ...... 68 3.6 References...... 71 Chapter 4 77

Vertical distribution of sulfate-reducing bacteria in the chemocline of Lake Cadagno, Switzerland, over an annual cycle 77

Abstract ...... 78 References...... 89

Chapter 5 93

Isolation and characterization of aggregate-forming sulfate-reducing and purple sulfur bacteria from the chemocline of meromictic Lake Cadagno, Switzerland 93

5.1 Abstract ...... 94 5.2 Introduction...... 94 5.3 Material and methods...... 96 5.3.1 Enrichment and isolation ...... 96 5.3.2 Identification and characterization...... 97 5.3.3 Mixed culture study ...... 98 5.4 Results...... 100 5.4.1 Isolation and characterization of the sulfate-reducing bacterium, isolate Cad626...... 100 5.4.2 Isolation and characterization of the phototrophic sulfur bacterium, isolate Cad16...... 101 5.4.3 Mixed culture study ...... 105 5.5 Discussion ...... 106 5.6 References...... 109

Chapter 6 115

Discussion 115

6.1 Aggregate formation ...... 116 6.2 Interactions among organisms involved in the sulfur cycle ...... 120 6.3 Interactions between sulfate-reducing and small-celled purple sulfur bacteria ...... 124 6.4 Future perspectives...... 131 6.5 References...... 133

Curriculum vitae...... 141 Aknowledgements...... 143

Summary 7

Summary

Permanently stratified lakes represent optimal model systems for the study of aquatic microorganisms since defined and stable vertical gradients of environmental conditions such as light intensity and quality, oxygen availability, or the presence of sulfide support the development of diverse populations of microorganisms adapted to defined ecological niches. Lake Cadagno is a meromictic lake located 1923 m above sea level in the Southern Alps of Switzerland (46°33'N, 8°43'E), in the catchment area of a dolomite vein rich in gypsum (Piora-Mulde). A permanent chemocline at a depth between 9 and 14 meters is stabilized by density differences of salt-rich water constantly supplied by subaquatic springs to the monimolimnion and of electrolyte-poor surface water feeding the mixolimnion. High concentrations of sulfate and steep sulfide gradients in the chemocline support the growth of large numbers of bacteria (up to 107 cells ml-1) indicating that a bacterial community making use of these gradients is present.

Molecular techniques that were used to analyze microbial community structure unaffected by the limitations of culturability showed that almost all bacteria in the chemocline of Lake Cadagno belonged to the Proteobacteria with numbers for the
-, -, - and -subdivision of Proteobacteria accounting for 23, 17, 45 and 15% of the total number of bacteria, respectively. Most prominent numerically (ca. 35% of all bacteria) were large- and small-celled phototrophic purple sulfur bacteria. The large-celled phototrophic sulfur bacteria were identified as Chromatium okenii, while small- celled phototrophic sulfur bacteria consisted of four major populations forming a tight cluster with Lamprocystis purpurea (former Amoebobacter purpureus and Pfennigia purpurea) and L. roseopersicina. The numerically most important phototrophic sulfur bacteria in the chemocline were small-celled purple sulfur bacteria of two yet uncultured populations designated D and F. Other small-celled purple sulfur bacteria (L. purpurea and L. roseopersicina) were found in numbers about one order of magnitude lower. These numbers were similar to those of the large-celled purple sulfur bacteria (C. okenii) and green sulfur bacteria that almost entirely consisted of Chlorobium phaeobacteroides. Under limited light conditions during winter and spring, most populations were evenly distributed throughout the whole chemocline. Under more favorable light conditions during summer and fall, however, a micro-stratification of populations was detected suggesting specific eco- physiological adaptations of different populations of phototrophic sulfur bacteria to the steep physico- chemical gradients in the chemocline of Lake Cadagno.

Depending on the season as much as 35 to 45% of the total microbial community were associated in aggregates consisting of small-celled purple sulfur bacteria (15 to 35% of the total microbial community) and sulfate-reducing bacteria of the family Desulfovibrionaceae (3 to 13% of the total microbial community). Based on comparative sequence analysis of a 16S rRNA gene clone library, these cells of the Desulfovibrionaceae that accounted for up to 72% of all sulfate-reducing bacteria were almost completely represented by a cluster of sequences closely related to Desulfocapsa 8 Summary thiozymogenes DSM7269. Another group of the Desulfovibrionaceae that was not very prominent numerically, was represented by a second cluster of sequences that resembled free-living cells or cells loosely attached to other cells or debris, similar to sulfate-reducing bacteria of the family Desulfobacteriaceae. The association between small-celled purple sulfur bacteria and these sulfate- reducing bacteria related to D. thiozymogenes was not specific for one of the four populations and also not obligate since non-associated cells of bacteria related to D. thiozymogenes were frequently found in winter and early summer when limited light conditions caused by snow and ice cover had reduced the abundance of small-celled phototrophic sulfur bacteria to below 25% of the values found in late summer. Nonetheless, the association suggested an ecological advantage to both groups of organisms under appropriate environmental conditions.

Both partners of this association were finally isolated using enrichment and isolation conditions that resembled those of their nearest cultured relatives, the sulfate-reducing bacterium D. thiozymogenes and small-celled purple sulfur bacteria belonging to the genus Lamprocystis, respectively. Molecular techniques were used to monitor the enrichments and to select potential isolates, i.e. in situ hybridization with specific oligonucleotide probes allowed targeted enrichments and isolations. Based on comparative 16S rRNA analysis and physiological characterization, isolate Cad626 was found to resemble D. thiozymogenes although it differed from the type strain by its ability to grow on lactate and pyruvate. Like D. thiozymogenes, isolate Cad626 was able to disproportionate inorganic sulfur compounds (sulfur, thiosulfate, sulfite) and to grow, although growth on sulfur required a sulfide scavenger (FeOOH). Isolate Cad16 represented small celled purple sulfur bacteria belonging to population F related to L. purpurea as evidenced by comparative 16S rRNA analysis and the presence of bacteriochlorophyll a and the carotenoid okenone. Mixed cultures of isolates Cad626 and Cad16 resulted in their association in aggregates similar to those observed in the chemocline of Lake Cadagno. Concomitant growth enhancement of both isolates in mixed culture suggested synergistic interactions that presumably resemble a source-sink relationship for sulfide between the sulfate- reducing bacterium growing by sulfur disproportionation and the purple sulfur bacteria acting as biotic scavenger.

The availability of these pure cultures opens up the door for future studies considering other facets of potential interactions in aggregates since both types of organisms are metabolically highly versatile and interactions may not be limited to sulfur compounds only. Future studies also need to address the effects of varying environmental conditions on growth and aggregate formation of both organisms and should incorporate the remaining three populations of uncultured small-celled purple sulfur bacteria in addition to attempts to imitate and maintain the environmental conditions found in the upper part of the chemocline of Lake Cadagno. Résumé 9

Résumé

Les lacs avec une stratification permanente représentent des modèles idéaux pour l'étude des micro- organismes aquatiques puisque différents groupes de bactéries adaptés à des niches écologiques particulières se succèdent le long de gradients stables de lumière, d'oxygène, de salinité et d'hydrogène sulfuré. Le lac de Cadagno est un lac méromictique crénogénique situé à une altitude de 1923 m.s.m au sud des Alpes dans le Massif du St. Gothard (46°33'N, 8°43'E), sur une lentille de dolomie riche en gypse (connue comme Piora-Mulde). La présence d'une zone de transition permanente entre 9 et 14 m de profondeur (la chémocline) est principalement due aux différences de densité entre les eaux du mixolimnion, pauvres en sels minéraux, et celles qui alimentent le monimolimnion par des sources sous-lacustres, riches en soufre, calcium et magnésium. Des teneurs en sulfates très élevés ainsi que des gradients très prononcés d'hydrogène sulfuré et d’autres substances trophogènes, permettent le développement et la prolifération massive de bactéries (jusqu'à 107 cellules ml-1), ce qui indique l'existence d'une communauté bactérienne capable d'exploiter d'une manière active les gradients présents.

L'utilisation de techniques moléculaires a permis d'analyser la structure de la communauté bactérienne sans les limitations dues aux problèmes de cultivabilité. Par hybridation in situ il a été démontré que la grande majorité des bactéries de la chémocline appartient au phylum des protéobactéries; les groupes majeurs
-, -, - et - ont montré des pourcentages de 23, 17, 45 et 15% respectivement par rapport au nombre total de bactéries. Le groupe des sulfobactéries pourpres (bactéries photosynthétiques anaérobies) appartenant au -protéobactéries est le plus nombreux et constitue environ 35% de la totalité des bactéries. De ce groupe font partie les sulfobactéries pourpres de grandes dimensions appartenant à l'espèce Chromatium okenii et quatre différentes populations de bactéries de petites dimensions, à l'apparence morphologique uniforme, phylogénetiquement très proches de Lamprocystis purpurea (anciennement Amoebobacter purpureus et Pfennigia purpurea) et L. roseopersicina. Deux des quatre populations de petite dimension, désignées par la suite D et F et auparavant pas cultivées in vitro, constituent la majorité des sulfobactéries pourpres de la chémocline. Les abondances des deux autres populations de sulfobactéries de petites dimensions (L. purpurea et L. roseopersicina) ainsi que de C. okenii et des sulfobactéries vertes, représentées presque entièrement par Chlorobium phaeobacteroides, étaient d'un ordre de grandeur inférieur. Dans des conditions de faible pénétration de lumière, en hiver et au printemps, la majorité de ces différentes populations liées au cycle du soufre étaient distribuée de manière uniforme dans la colonne de la chémocline. Par contre, en été et en automne avec des intensités lumineuses plus élevées, nous avons pu mettre en évidence des micro-stratifications marquées et distinctes des différentes populations, ce qui suggère des adaptations éco-physiologiques spécifiques aux gradients physico-chimiques très prononcés dans la chémocline. 10 Résumé

Selon la saison jusqu'à 35-45% des bactéries totales de la chémocline était associé en agrégats constitués de sulfobactéries pourpres de petites dimensions et de bactéries sulfato-réductrices de la famille des Desulfovibrionaceae qui représentent respectivement de 15 jusqu'à 35% et de 3 à 13% de la totalité de la communauté bactérienne. Sur la base de l'analyse comparative des séquences obtenues après clonation des gènes codant pour la sous-unité 16S du RNA ribosomique, les séquences des Desulfovibrionaceae, qui représentent jusqu'à 72% des bactéries sulfato-réductrices, étaient regroupées en un branche (cluster) phylogénétique proche de Desulfocapsa thiozymogenes DSM 7269. Un deuxième groupe appartenant aux Desulfovibrionaceae n'était pas très abondant et était représenté par des bactéries libres ou faiblement attachées à d'autres cellules ou à des débris de matière organique. L'association entre les bactéries sulfato-réductrices proches de D. thiozymogenes et les sulfobactéries pourpres à petites cellules ne semble pas être spécifique pour une des quatre populations décrites, ni strictement obligatoire. En effet, l’application de l’hybridation in situ a permis de mettre en évidence des bactéries proches de D. thiozymogenes non associés aux sulfobactéries pourpres en hiver et au printemps, lorsque l'abondance de ces dernières était réduite à moins de 25% par rapport à l'automne à cause des conditions de lumière limitées. Néanmoins, l'association observée suggère l'existence d'un avantage écologique pour les deux groupes d'organismes, au moins sous certaines conditions environnementales.

Les deux partenaires de cette association ont pu être mis en culture in vitro, en utilisant des conditions semblables à celles utilisées pour les bactéries les plus proches phylogénétiquement et déjà isolées, respectivement D. thiozymogenes et Lamprocystis spp.. Des techniques moléculaires ont permis de suivre les enrichissements et sélectionner les isolats potentiels. Selon l'analyse comparative des 16S rRNA, la souche Cad626 était phylogénétiquement très semblable mais non identique à D. thiozymogenes; en outre elle en différait par sa capacité de pousser avec du lactate et du pyruvate. Comme D. thiozymogenes, Cad626 est capable de croître par "disproportionation" de composés soufrés inorganiques (soufre élémentaire, thiosulfate, sulfite); la croissance sur le soufre nécessite néanmoins d'un utilisateur de sulfures (sulfide scavenger), par exemple de FeOOH. La deuxième souche isolée (Cad16) appartient à la population F des sulfobactéries pourpres proche de L. purpurea, comme l'indiquent l'analyse comparative des séquences du 16S de ARN ribosomique, la présence de bactériochlorophylle a et du caroténoïde okénone. Par des cultures mixtes des souches Cad626 et Cad16, nous avons obtenu des associations en agrégats semblables à ceux observés dans la chémocline du lac de Cadagno. Une meilleure croissance des deux isolats en culture mixte par rapport aux cultures pures, suggère l'existence d'interactions synergiques entre les deux souches. L'interaction mutuelle, avancée comme hypothèse, est probablement basée sur des échanges du type source- extinction (ou production-utilisation) d'hydrogène sulfuré: la bactérie sulfato-réductrice poussant par "disproportionation" du soufre élémentaire et les sulfobactéries pourpres ayant la fonction d’utilisateurs (scavengers) biologiques. Résumé 11

La disponibilité de deux organismes, avec un métabolisme très "versatiles", en culture pure offre la possibilité d'étudier les interactions potentielles sous diverses perspectives parce que les échanges métaboliques pourraient ne pas être limités qu'au seuls composés soufrés. Les résultats obtenus ouvrent ainsi la perspective pour des essais futurs dans lesquels il faudrait étudier les effets des variations des conditions environnementales sur la croissance et la formation d'agrégats entre les deux organismes. En outre, il serait fort utile d'intégrer dans ces expériences les trois populations de sulfobactéries pourpres restantes, qui ne sont pas encore en culture pure, dans le but de simuler les conditions environnementales de la chémocline du lac de Cadagno.

Chapter 1

Introduction 14 Chapter 1

1.1 Stratified lakes

During the year lakes usually establish layers with different physico-chemical characteristics. This stratification can be temporal or permanent (Figure 1.1). Temporal stratification regimen include holomictic, oligomictic and polymictic systems, separated from each other by differences in the annual mixing procedure and intensity (Figure 1.1). Temporal water stratification is usually thermally induced. In holomictic lakes, for example, that are characterized by a complete vertical mixing at least once a year, temperature increment of the surface water during summer results in a less dense upper layer, the aerated and circulating epilimnion, and concomitantly in a bottom layer of colder and much denser, stagnant water, the hypolimnion (Figure 1.1). Permanently stratified lakes are meromictic, and thus characterized by incomplete circulation.

Figure 1.1 Different lakes regimen and stratification of lakes (adapted from Wetzel, 1983 and Schwoerbel, 1999).

Meromictic lakes comprise therefore basins in which a portion of the water mass never mixes with the rest of the water body (Wetzel, 1983). The word “meromixis” is derived from the Greek words “meros” meaning “partly” or “partial” and “mixis” meaning “mixed”. Introduction 15

Figure 1.2 Production, consumption and decomposition processes associated to stratified lakes with a chemocline. These processes occur in permanently stratified lakes, such as meromictic lakes, but also in temporarily stratified aquatic ecosystems, most frequently in nutrient rich small lakes about 5 to 20 m depth, where oxygen depletion due to degradation can result in anoxic conditions in the sediments and hypolimnion (adapted from Pfennig, 1979; Schlegel and Jannasch, 1992).

A permanent stratification of the water can be caused or be accentuated by the morphometry of lake basin and its topographic position. An example is Lake Kauhakō (Hawaii, USA) in which the particular shape of this very deep lake with a small surface area reduces the effect of strong winds that are generally the major cause of water movement and thus circulation and mixing (Donachie et al., 1999). Meromixis can also be due to water characteristics such as electrolyte-poor water overlaying a dense saline water layer (Schwoerbel, 1999). An example for such a lake is Lake Cadagno, located in the southern Swiss Alps (Del Don et al., 2001).

The water column of meromictic lakes is generally characterized by three distinct layers: the mixolimnion, the upper layer that is usually oxic and characterized by complete circulation of the water body during the year, the monimolimnion, the lower layer that is usually anoxic and characterized by a stagnant water body, and the chémocline, a boundary layer between mixo- and monimolimnion characterized by steep physico-chemical gradients (Figure. 1.2). Two types of meromixis are generally distinguished: crenogenic meromixis, in which the stratification is caused by saline springs or dense saline water in the monimolimnion, and biogenic meromixis, in which the establishment of a stratification regime is due to an intense biological activity that results in an accumulation of dissolved salts and organic material in the monimolimnion. In both cases, the morphometry of lake basin and its topographic position can enhance the stability of the stratification. 16 Chapter 1

Due to their permanent stratification, meromictic lakes are interesting objects for general environmental research in aquatic ecosystems. The stagnant water of the monimolimnion with stable deposition dynamics and the lack of sediment bioturbation provide an environment that represents a stable history archive (Schink, 1999) and thus makes them ideal systems for paleo-limnological studies (Birch et al., 1996; Brown and McIntosh, 1987; Coolen and Overmann, 1998). In addition, meromictic lakes can be used as model environments for the study of biogeochemical processes mediated by microorganisms and characteristic of basins with permanently anoxic water columns, as previously reported for Lake Cadagno (Hanselmann and Hutter, 1998; Putschew et al., 1995).

The transition zone, the chemocline, is a second environment that offers many advantages for studies on microorganisms. The physico-chemical gradients across the chemocline support the development of very intense bacterial blooms (Lindholm, 1987; Overmann, 1997; Overmann et al., 1996; Parkin and Brock, 1981; Pedrós-Alió and Guerrero, 1993; Sorokin, 1970; van Gemerden and Mas, 1995). Along gradients of light as well as of different electron donors and acceptors, different physiological groups of organisms substitute each other (Guerrero et al., 1985; Jørgensen et al., 1979; Overmann et al., 1991) in distinct layers at depth intervals ranging from cm to m. These distinct layers facilitate accurate sampling and measurement of environmental characteristics (Tonolla et al., 1999). This is different in other stratified environments such as in microbial mats, biofilms or sediments in which very steep gradients mediated by microorganisms are encountered on a microscale, or in deep stratified oceans or basins, such as the Black sea (Luther et al., 1991), with gradients mostly controlled by water chemistry on the macroscale (Jørgensen, 1982a; Jørgensen et al., 1991). In microbial mats, biofilms and sediments, gradients can also be multidirectional and thus zones of discontinuity are frequently encountered, which adds complexity to the system and consequently complicates sampling and interpretation of data (Jørgensen, 1977; Lehmann and Bachofen, 1999). In meromictic lakes, the stability of the physico-chemical conditions in the water body and the clearly separated mixo- and monimolimnion reduce fluctuations and allow a more stable and permanent microbial community to inhabit the compact transition zone between the oxic and anoxic layer during the entire year (Del Don et al., 2001; Gorlenko et al., 1983; Overmann, 1997; van Gemerden and Mas, 1995). In that way large seasonal changes in physico-chemical conditions encountered in the water body of temporarily stratified lakes are avoided. The study of microbial community responses to environmental factors, such as light intensity and quality, redox conditions and nutrient availability, is therefore well facilitated in the water body of meromictic lakes. Introduction 17

1.2 Lake Cadagno

Lake Cadagno is a crenogenic meromictic lake located 1923 m above sea level in the Piora valley in the southern Alps of Switzerland (46°33' N, 8°43'E) (Del Don et al., 2001; Tonolla et al., 1998a) which is characterized by its richness in lakes and other water bodies (Garwood, 1906) and by a vein of dolomite rock rich in gypsum, traversing the entire valley. The lake has an average surface area of 24 ha (about 800 x 400 m) and a maximum depth of 21 m. Lake Cadagno as well as other lakes of the same region have been used to study and document phenomena like water stratification, sulfidogenic bottom waters and blooms of purple sulfur bacteria already since the beginning of the last century (Bourcart, 1906; Burckhardt, 1910; Garwood, 1906).

Fig. 1.3 The Piora region and its lakes (from Garwood, 1906)

In these lakes, the importance of bacteria involved in the sulfur-cycle has already been pointed out at that time (Düggeli, 1924). A monography on Lake Ritom, adjacent to Lake Cadagno, was published after the studies that were conducted for the construction of the Ritom hydroelectric dam (Collet et al., 1918, 1919). Specific studies on fish (Surbeck, 1917) and early studies on phytoplankton and bacterial communities participating in the sulfur cycle initially focused on Lake Ritom, but were finally expanded to Lake Cadagno (Bachmann, 1924; 1928; Borner, 1928a, b; Burckhardt, 1910; Düggeli, 1919, 1924; Eder-Schweizer, 1924). 18 Chapter 1

During the last 20 years, Lake Cadagno was object of intensive studies that lead to a consistent production of scientific data on lake chemistry and biology. A review of these data was published recently in a special volume of the journal “Documenta dell’Istituto Italiano di Idrobiologia” (Peduzzi et al., 1998). The availability of scientific records on the lake over such a long time frame is a great resource for present researchers, because it furnishes a precious, long-term perspective and provides valuable baseline data for future investigations. Since meromictic lakes are relatively rare worldwide (Pfennig and Trüper, 1992), the value of these records on one specific lake is even more pronounced. Other meromictic lakes that received and/or still receive some attention are Lake Mahoney in the USA with large blooms of phototrophic sulfur bacteria (Overmann et al., 1991, 1992, 1994, 1996, 1997) and Lake Belovod (Gorlenko et al., 1983; Sorokin, 1970). Blooms of phototrophic sulfur bacteria were also observed and studied in stratified lakes Cisó and Vilar and others karstic lakes of the Spanish Mediterranean region (Lakes Banyoles-basin III, Nou, Coromines, Negre 1, Moncortès and Estanya) (Guerrero et al., 1987). Specific studies on bacterial communities of these lakes can be found in the literature (Camacho and Vicente, 1998; Casamayor et al., 1998; 2000; 2002; Guerrero et al., 1978; 1985; Pedrós-Alió et al., 1993; van Gemerden et al., 1985). Meromixis can also be encountered as a final stage of eutrophication processes as reported for several lakes such as Lago di Lugano (Barbieri and Polli, 1992). In such nutrient-rich lakes, anaerobic and sulfidogenic hypolimnia can remain temporal or become permanent (biogenic meromixis) (Widdel, 1988). Fjords or other deeper basins are examples for other environments in which conditions or some of the microbiological processes encountered in Lake Cadagno can be found (Øvreas et al., 1997; Ramsing et al, 1996). Thus, Lake Cadagno with its well-documented records of physico-chemical conditions and microbial analyses over time comprises an excellent reference and potential model-system for other stratified aquatic ecosystems.

The importance of Lake Cadagno as reference lake for studies on other meromictic systems might probably even increase in the future since studies on the ecology of Lake Cadagno significantly increased in recent years supported by two major developments. The first is the establishment of new research facilities at the shore of the lake, the Centro di Biologia Alpina (CBA), in the early 1990s (Peduzzi, 1990; Peduzzi, 1993), and the second, the development of novel molecular techniques (Amann et al., 1995; Head et al., 1998) that avoided a cultivation of the target organisms and thus permitted the analysis of microbial populations in Lake Cadagno unaffected by the limitations of culturability (Demarta et al., 1998; Gattuso et al., 2002; Tonolla et al., 1998b). Introduction 19

+ 156500 697000

0.2 Km

192

Lake Cadagno

Fig. 1.4 Bathymetric map of Lake Cadagno with contour lines (altitude in m above sea) eveiy 2m (1 , 2, 3 and 4 tributaires; 5 effluent) (from Del Don et al., 2001; Lehmannn and Bachofen, 1999; Tonolla et al., 1998a)

Lake Cadagno is permanently stratified in three distinct layers, the oxic mixolimnion, the anoxic monimolimnion and a nanow stable chemocline generally found at a depth between 11 and 14 m (Del Don et al., 2001; Hanselmann et al., 1998; Peduzzi et al., 1993). The chemocline is stabilized by density differences of salt-rich water constantly supplied by subaquatic springs to the monimolimnion and of electrolyte-poor smface water feeding the mixolimnion (Del Don et al., 2001; Lehmann and Bachofen, 1999; Tonolla et al., 1998a). The anaerobic monimolimnion is rich in reduced sulfur compounds such as sulfide resulting from sulfate reduction. Sulfide concentrations can reach 1 mM in the monimolimnion (Tonolla et al., 1998a). High concentrations of sulfate, steep gradients of sulfide and availability of light in the chemocline (Bosshardt et al. , 2000b; Egli et al., 1998; Lehmann et al., 7 1 1998) support the growth of elevated numbers of bacteria (up to 10 cells ml- ) indicating that a bacterial community making use of these gradients is present (Camacho et al. , 2001; Luthy et al. , 2000; Tonolla et al., 1999).

Lake Cadagno contains approximately 10 to 20 times more sulfate than most freshwater lakes (Hanselmann and Hutter, 1998), with concentrations in the chemodine and monimolimnion ranging from 120 to 160 mg r 1 (1.3 to 1.7 mM, while concentrations of 0.01 to 0.2 mM are usually reported for freshwater habitats, and up to 32 mM for seawater). Beside sulfate, hydrogen carbonate, calcium and manganese are the dominant ions or elements in the water body of Lake Cadagno (Tonolla et al., 1998a). However, the high concentration of sulfate leads to a dominance of sulfur compounds in the chemistry of the lake (Tonolla et al., 1998a; Wagener et al. 1990) and thus favors the development of microbial populations directly involved in the sulfur cycle. The development of microbial populations is especially pronounced in the chemodine, the boundary layer between the oxic and anoxic layers 20 Chapter 1 where light reaches sulfide-containing, anoxic water and thus conditions for an abundant development of sulfate-reducing bacteria and phototrophic sulfur bacteria are created (Lindholm, 1987; van Gemerden and Mas, 1995).

Figure 1.5 Comparison of physico-chemical vertical profiles from different lakes. (A) Idealized vertical profile of a stratified freshwater lake with a chemocline in the temperate climate zone during summer season (adapted from Schlegel and Jannasch, 1992); (B) vertical profiles from Lake Belovod (adapted from Gorlenko et al. 1983); (C) vertical profiles from Lake Cadagno (adapted from Tonolla et al., 1998a)

1.3 The sulfur cycle

Although transformations in the sulfur cycle can occur biologically as well as chemically, microbial activity has a prominent impact on these transformations. Except for assimilative sulfate-reduction, prokaryotes are essentially responsible for all biologic transformations of the sulfur cycle (Schink, 1999). Sulfide oxidation and sulfate reduction are the most prominent key reactions in the biogeochemistry of sulfur compounds. Sulfate-reduction, for example, plays a large role in anaerobic organic matter mineralization in both terrestrial and aquatic subsurface environments (Grossmann and Desrocher, 2001; Jørgensen, 1982b; Smith, 1996), whenever sulfates but no other preferable external electron acceptors are available (Ehrlich, 1996). Two other processes, sulfur reduction and sulfur disproportionation, are now considered key pathways as well (Grossmann and Desrocher, 2001; Madigan et al., 2000) even though the relative importance of disproportionation is still a matter of discussion (Cypionka, 1999). Disproportionation (or dismutation) is a general term in chemistry and Introduction 21 biology indicating a reaction or process in which a substance is simultaneously oxidized and reduced, resulting in two different products. Sulfur disproportionation and sulfur reduction, which were first described by Bak and Pfennig (1987), Biebl and Pfennig (1977) and Pfennig and Biebl (1976), respectively, are relatively recent findings compared to the other general transformations of sulfur compounds mediated by microorganisms (e.g. sulfate-reduction and sulfide oxidation) which are based on the discoveries of Beijerinck and Winogradsky more than a century ago.

Two lines of evidence seem to indicate that the disproportionation pathway can be relevant in sulfur transformations in aquatic environments. In studies on the sulfur cycle of sediments from Braband Lake (Denmark) and other anoxic environments, an important thiosulfate shunt due to its disproportionation was observed (Jørgensen et al., 1990a, b, 1991). Based on isotope sulfur fractionation observed during elemental sulfur disproportionation, the 34S sulfide depletion commonly reported in sediments was explained (Canfield and Thamdrup, 1994). Bacteria disproportionating elemental sulfur were recently reported in high numbers in marine sediments over a wide range of environmental conditions (Canfield et al., 1998) indicating a potential function of these organisms in these environments. Disproportionation of elemental sulfur to sulfate and sulfide was thus included into the major transformations of the sulfur cycle as a novel form of anaerobic respiration with environmental relevance (Lovely and Coates, 2000).

Today, most textbooks covering the transformations within the sulfur cycle include sulfur disproportionation, and also sulfur reduction as general processes of the sulfur cycle (Fig. 1.6). Due to the discovery of novel sulfur transformations in sulfate-reducing bacteria such as the disproportionation of thiosulfate or sulfite to sulfate and sulfide (Bak and Cypionka, 1987), the sulfur cycle and its transformations are object of a renewed interest. Disproportionation was immediately considered of great interest (Kelly, 1987) and seen either as a novel energy yielding process or even as a possible new pathway in sulfur cycle alternative to the classic oxidative and reductive pathways of 0 2- the sulfur cycle (Figure 1.6). In addition to sulfur/thiosulfate disproportionation (4S → SO4 + 3H2S; 2- 2- S2O3 → SO4 + H2S) carried out by bacteria belonging to the genera Desulofobulbus and Desulfocapsa, and some others, the most important biologically catalyzed processes in the sulfur cycle 0 2- are 1) sulfide or sulfur oxidation (H2S → S → SO4 ) carried out by a variety of aerobic chemolithotrophic bacteria (Thiobacillus sp., Beggiatoa, Thiothrix sp., or Sulfolobus sp.), or by anaerobic bacteria such as phototrophic purple (Chromatium, Thiopedia) or green (Chlorobium) sulfur 2- bacteria, and some chemolithotrophic bacteria, 2) sulfate reduction (SO4 → H2S) mediated by bacteria of the genera Desulfovibrio, Desulfobacter, Desulfomonas and some others, and 3) sulfur 0 reduction (S → H2S) by bacteria of the genus Desulfuromonas and many hyperthermophilic Archaea (Madigan et al., 1999; Gorlenko et al., 1983). 22 Chapter 1

Fig. 1.6 Redox cycle for sulfur (from Madigan et al. 1999)

These transformations generally resemble those found in meromicitic lakes in which the water chemistry is dominated by sulfur compounds. Sulfur oxidation is the major process in the oxic mixolimnion, while sulfate reduction is a prominent process in the anoxic monimolimnion. The production of sulfide helps to maintain anoxic conditions in the monimolimnion. Under anaerobic conditions and in the presence of hydrogen sulfide in the euphotic zone, anoxygenic photosynthesis using light as energy source and sulfide as electron donor can oxidize sulfide back to sulfate which can then be used again as electron acceptor by sulfate-reducing bacteria. In the chemocline between oxic and anoxic layer all three transformations, i.e. sulfur oxidation, sulfate reduction and anoxygenic photosynthesis, might be carried in close proximity since steep gradients in physico-chemical conditions are found in a short distance in depth (see Fig. 1.7). Additional transformations at the interface between oxic and anoxic layer where both oxygen and sulfide are present in very low concentrations include autotrophic sulfide oxidation (Sorokin, 1970), or chemical oxidation if oxygen is present in high concentrations, leading to intermediate forms such as elemental sulfur, thiosulfate and sulfate (Lüthy et al., 2000).

It is assumed that anoxygenic photosynthesis, that can usually be found at the boundary layer between the oxic and anoxic zones, is supported by the diffusion of hydrogen sulfide originating from sulfate reduction in the hypolimnion of stratified lakes (Pfennig, 1979; Schlegel and Jannasch, 1992). This assumption is supported by observations in meromictic Lake Belovod where two layers with peaks in sulfate reduction activity were observed in the water column: one just below the maximum peak of high photosynthesis and chemosynthesis and the other near the bottom sediments (Fig. 1.7) (Gorlenko et al., 1983; Sorokin, 1970). Introduction 23

Figure 1.7 Most important sulfur transformations in a stratified lake, with a redox discontinuity layer, with emphasis on the microbiological processes (chemical oxidation is also shown). Although sulfur disproportionation can occur in the sediments and in water column of stratified lakes, relative importance of disproportionation and its spatial distribution is still a matter of discussion. More evidence on this novel energy yielding process in fresh-water habitats is needed to draw general conclusions (adapted from Wetzel, 1983; Schwoerbel, 1999).

Observations of two distinct layers consisting of sulfate-reducing bacteria, one positioned at the redox transition zone and the other deep below in the anoxic compartment, respectively, were also reported for other types of stratified environments such as microbial mats, fjord water columns and freshwater sediments (Ramsing et al., 1996; Risatti et al., 1993; Teske et al., 1996; 1998). Significant sulfate reduction activity was also observed in the water column of Lake Knaak (Parkin and Brock, 1981). In meromictic Lake Mahoney more than 63% of the photo-oxidized sulfide in the bacterial layer was produced within the same layer (Overmann et al., 1991). Thus, zones of photosynthesis, chemosynthesis and sulfate reduction are not always clearly separated but can overlap indicating a close proximity between potentially complementary functional groups in stratified lakes as well as in cyanobacterial mats and sediments. Conditions for an abundant development of sulfate-reducing bacteria and phototrophic sulfur bacteria are provided in the chemocline of Lake Cadagno, the boundary layer between the oxic and anoxic layers where light reaches sulfide-containing, anoxic water. Sulfate-reducing bacteria are probably present and active where phototrophic sulfur bacteria thrive, a situation more widely perceived than thought until now. However, studies on interactions between sulfate-reducing bacteria and phototrophic sulfur bacteria are relatively scarce (Overmann, 1997; Overmann et al., 1996; Teske et al., 1998). 24 Chapter 1

1.3.1 Sulfate reduction

Sulfate-reducing bacteria comprise a large group of functionally similar, but phylogentically diverse 2- bacteria that are widely distributed in nature. Sulfate-reducing bacteria are able to use sulfate (SO4 ) as terminal electron acceptor in anaerobic respiration. Sulfate reduction is carried out with a variety of electron donors and results in the production of H2S. Inorganic sulfur compounds other than sulfate can be used as electron acceptors as well. During the last 20 years, sulfate-reducing bacteria have been object of a considerable number of publications, reviews and books. Comprehensive reviews and monographies on sulfate-reducing bacteria can be found in Postgate (1984), Widdel (1988), Odom and Singleton (1993), and Barton (1995). These references also retrace the chronological evolution of knowledge on sulfate-reducing bacteria: from Postgate’s initial methodological work as foundation to the “explosion of new and diverse sulfate- and sulfur-reducers discovered by Widdel, Pfennig and others” (Odom and Singleton, 1993). The latter topic is probably best represented by studies on Desulforomonas acetoxidans that is able to grow by elemental sulfur reduction (Pfennig and Biebl, 1976; Biebl and Pfennig, 1977). This organism was cultured in syntrophic co-culture with green sulfur bacteria (Biebl and Pfennig, 1978), introducing the idea of sulfate-reducing bacteria able to use sulfur compounds other than sulfate as terminal electron acceptors (Schauder and Kröger, 1993) and the idea of a sulfur-based syntrophy (Pfennig, 1980). Another organism of interest was Desulfotomaculum acetoxidans which was able to grow by oxidation of acetate under sulfate reducing conditions (Widdel and Pfennig, 1977). D. acetoxidans is the first of many different sulfate reducers isolated and capable of using a wide range of diverse organic substrates previously though to be limited for sulfate-reducing bacteria (Widdel and Pfennig, 1981, 1982, 1992; Widdel and Bak, 1992; Widdel and Hansen, 1992).

Recent data indicate that sulfate reduction is present in four different taxonomic groups comprising mesophilic gram-negative bacteria, gram-positive spore-forming bacteria, thermophilic Bacteria and thermophilic Archaea (Castro et al., 2000). They are found in different environments such as in freshwater sediments (Bak and Pfennig, 1991), marine sediments (Knoblauch et al., 1999; Ravenschlag et al., 2000), salt marshes (Rooney-Varga et al., 1997; 1998), biofilms (Santegoeds et al., 1998), stratified fjords (Ramsing et al., 1996; Teske et al., 1996), activated sludge (Manz et al., 1998), and in rivers and streams (Manz et al., 1999). A wide range of metabolically diverse sulfate-reducing bacteria can persist in these environments, especially at the intersection between oxic and anoxic conditions (Cypionka, 2000; Fukui and Takii, 1990; Risatti et al., 1993; Wieringa et al., 2000). More and more often sulfate-reducing bacteria are detected in oxic environments (Minz et al., 1999a; b; Sass et al., 1996; 1997; Teske et al., 1998) and isolated from oxic layers of microbial mats and marine sediments (Finster et al., 1997; Krekeler et al., 1997; Sass et al., 1998). Microbial sulfate reduction is of primary importance for mineralization processes (Jørgensen, 1982b) and can be a dominant terminal process even in freshwater environments, as it was observed in littoral sediment of lake Constance Introduction 25

(Bak and Pfennig, 1991). Sulfate-reducing bacteria were also reported to out-compete methanogens at freshwater sulfate concentrations (Lovely and Klug, 1983).

1.3.2 Sulfur disproportionation

Sulfur disproportionation is an energy yielding process in the metabolism of some sulfate-reducing bacteria, that use inorganic sulfur compounds of intermediary oxidation state (thiosulfate, sulfite and elemental sulfur) both as electron donor and acceptor. The habitat of bacteria disproportionating sulfur seems to be located in boundary environments between oxic and anoxic conditions (Finster et al., 1998; Janssen et al., 1996). Disproportionation in which the same inorganic compound functions both as an electron donor and electron acceptor was initially referred to as “inorganic fermentation”, in reference to “fermentation” of organic compounds in the absence of external electron acceptors. Sulfur disproportionation was observed for the first time in Desulfovibrio sulfodismutans (Bak and Cypionka, 2- 2- 1987; Bak and Pfennig, 1987; Bak, 1993) where thiosulfate (S2O3 ) or sulfite (SO3 ) were 2- - disproportionated into sulfate (SO4 ) and sulfide (HS ):

2- 2- - + S2O3 + H2O J SO4 + HS + H o 2- G ’= -21.9 kJ/mol S2O3

2- + 2- - 4SO3 + H J 3SO4 + HS o 2- G ’= -58.9 kJ/mol SO3

Other sulfate-reducing bacteria were later found to be able to disproportionate thiosulfate as well, and today as many as 8 sulfate-reducing bacterial species are known to be able to grow by this means (Krämer and Cypionka, 1989). Based on these findings, the potential environmental significance of sulfur disproportionation was investigated by Jørgensen and co-workers, who determined that 40% of the thiosulfate in sediments was disproportionated (Jørgensen and Bak, 1991). Experiments on marine sediments showed that some enrichment cultures were able to grow by disproportionation of elemental sulfur in the presence of sulfide scavengers only (Thamdrup et al., 1993). Desulfocapsa thiozymogenes (Janssen et al., 1996) and Desulfocapsa sulfoexigens (Finster et al., 1998) were finally isolated from freshwater lake sediments (Lake Braband, Denmark) and marine intertidal sediments (Arcachon Bay, France), respectively. Another organism able to disproportionate elemental sulfur was Desulfobulbus propionicus (Lovely and Phillips, 1994). 26 Chapter 1

o 2- According to Janssen (1996) elemental sulfur (S ) can be disproportionated to H2S and SO4 :

0 2- - + 4 S + 4 H2O J SO4 + 3 HS + 5 H Go’= +10.2 kJ/mol So

However, disproportionation of elemental sulfur is a thermodynamically unfavorable process, since the reaction is endergonic under standard conditions. Unless H2S is continuously removed, bacteria disproportionating elemental sulfur cannot grow (Finster et al., 1998; Janssen et al., 1996). Thus, a

H2S scavenger is required to drive the energetically unfavorable reaction. Growth of both D. thiozymogenes and D. sulfoexigens was coupled to the presence of amorphous FeOOH reacting with sulfide and precipitating FeS (Janssen et al., 1996):

- + 0 3 HS + 2 FeOOH +3 H J S + 2 FeS + 4 H2O Go’= -143.9 kJ/mol S0

The sum of the two reactions results in:

0 2- + 3 S + 2 FeOOH J SO4 + 2 FeS + 2 H Go’= -34.4 kJ/mol S0

The coupling of these two reactions resulted in more favorable thermodynamic conditions by removing HS-, because growth was observed. Indeed, the free energy of sulfur disproportionation is strongly influenced by the concentrations of the products (Widdel and Hansen, 1992). Krämer and Cypionka (1989) proposed that the reversal of sulfate reduction serves as the energy-generating pathway in sulfate-reducing bacteria growing by disproportionation of thiosulfate. However, intimate metabolic mechanisms of elemental sulfur disproportionation and how energy is conserved have not been elucidated yet and remain to be investigated. It is important to retain the fundamental role played by sulfide scavengers, since it seems that disproportionation of elemental sulfur has to be coupled with the removal of sulfide from the solution. Recent findings on the ability of the gram-positive thermophilic sulfate-reducing bacterium Desulfotomaculum thermobenzoicum that was growing by disproportionation of thiosulfate (Jackson and McInerey, 2000) show that disproportionation abilities are not restricted to gram-negative sulfate-reducing bacteria and thus that disproportionation might be more widespread than previously thought.

1.3.3 Anoxygenic photosynthesis

Anoxygenic photosynthesis is carried out by a large group of metabolically diverse bacteria widely distributed in anoxic environments where light is available (Madigan, 1988; Pfennig, 1979; 1989). Phototrophic purple and green sulfur bacteria are known since the early work of Winogradsky (1888), Introduction 27

Lauterborn (1906) and others more than a century ago (Overmann, 2001; Pfennig, 1989). They have been object of detailed investigations on their physiology, taxonomy, ecology and distribution in natural habitats and several comprehensive reviews have been published on these issues (Blankenship et al., 1995; Garrity and Holt, 2002; Gorlenko et al., 1983; Imhoff, 2002; Imhoff et al., 1998; Lindholm, 1987; Madigan, 1988; Overmann and van Gemerden, 2000; Pedrós-Alió and Guerrero, 1993; Pfennig, 1979, 1989; Pfennig and Trüper, 1989, 1992; van Gemerden and Beeftink, 1983).

Sulfide is used by purple and green sulfur bacteria as the most common electron donor during anoxygenic photosynthesis (Pfennig, 1979; 1989). To a certain extent, elemental sulfur and thiosulfate can be used as alternative electron donors to sulfide. Thus, exogenous substrates provide the reducing equivalents for CO2 assimilation. During photosynthesis under anaerobic conditions, these reduced sulfur compounds are oxidized to sulfur or sulfate (Pfennig and Trüper, 1992). The main factors affecting growth and survival of phototrophic sulfur bacteria are reviewed in van Gemerden and Mas (1995). Light, electron donors for photosynthesis, oxygen concentrations and carbon resources are the most important factors influencing the development of phototrophic sulfur bacteria (Guerrero et al., 1987; Madigan 1988; Pedrós-Alió et al., 1993; Pfennig, 1989; Pfennig and Trüper, 1992; van Gemerden and Beeftink, 1983; Vila et al., 1998). During photooxidation, purple sulfur bacteria store globules of elemental sulfur intracellularly as intermediary oxidation products that can be further photo-oxidized or be reduced in the dark by oxidation of internal storage products like glycogen (Mas and van Gemerden, 1995). Purple sulfur bacteria such as Amoebobacter purpureus (now Lamprocystis purpurea) are physiologically very versatile. In the dark, for example, L. purpurea can grow chemolithotrophically under microoxic conditions with thiosulfate and sulfide as electron donors (Eichler and Pfennig, 1988; Kämpf and Pfennig, 1980). Even anaerobic oxidation of ferrous iron was observed in some purple sulfur bacteria (Ehrenreich and Widdel, 1994). In addition, members of the genus Lamprocystis can potentially photooxidize, in addition to sulfide, elemental sulfur and thiosulfate (Imhoff, 2001).

During stratification different groups of phototrophic sulfur bacteria find suitable conditions for growth along the complex gradients of light and sulfide. As a general rule, the upper part of the plume mainly consists of purple sulfur bacteria (e.g. Chromatiaceae) while the lower part is often colonized by green sulfur bacteria (e.g. Chlorobiaceae). Chlorobiaceae are generally adapted to lower light intensities and higher sulfide concentrations than Chromatiaceae. These general distribution patterns have been observed in many field studies on interactions between phototrophic sulfur bacteria and environmental conditions (Caldwell and Tiedje, 1975; Guerrero et al., 1978, 1985, 1987; Pedròs–Aliò et al., 1983; Pedròs–Aliò and Guerrero, 1993; Parkin and Brock, 1981; van Gemerden et al., 1985; Vila et al., 1994, 1996, 1998), which consequently helped to unravel microorganism-environment interactions (Pfennig and Trüper, 1992; van Gemerden and Mas, 1995). 28 Chapter 1

However, even though the growth requirements for phototrophic sulfur bacteria are quite well understood under defined laboratory conditions (van Gemerden, 1987; van Gemerden and Beeftink, 1981), phototrophic sulfur bacteria are abundant under certain environmental conditions in nature that sometimes are in contrast with knowledge based on results from the laboratory or previous field studies. Thus, the complex interactions between the bacteria and biotic and abiotic environmental determinants in natural habitats, which affect abundance, distribution and finally ecological success, are not yet completely understood and thus require intensive further investigations (van Gemerden and Mas, 1995).

The major ecological features of both purple and green sulfur bacteria are their capacity to carry out anaerobic CO2 assimilation at low light intensities and to anaerobically oxidize sulfur compounds (Madigan, 1988; Pfennig 1989). In anaerobic habitats where the chemistry is dominated by sulfur species (usually referred to as sulfureta) (van Gemerden and Beeftink, 1983), these compounds are used as major electron carriers between different types of bacteria such as phototrophic sulfur and sulfate-reducing bacteria. Therefore, these bacteria play significant roles in the interconnection of two major biogeochemical cycles, the carbon and sulfur cycle, respectively (Figure 1.8) (Sorokin, 1970; van Gemerden and Beeftink, 1983).

Figure 1.8 Simplified scheme of the interactions between the cycles of carbon and sulfur in anaerobic habitats (from van Gemerden and Beeftink, 1983). Introduction 29

1.3.4 Sulfate-reducing and phototropic sulfur bacteria in Lake Cadagno

Since the water chemistry of Lake Cadagno is dominated by components of the sulfur cycle with steep gradients in the chemocline, it is not surprising that organisms like sulfate-reducing bacteria and phototrophic sulfur bacteria are very abundant. Abundance is especially pronounced in the upper part of the chemocline, at the boundary layer between the oxic and anoxic layers where a dense bacterial plume of phototrophic bacteria can generally be detected in spring and summer. Previous studies on the organisms in this plume mainly focused on the metabolic responses of the phototrophic bacteria to light and other environmental growth determinants (Del Don et al., 1994; Fischer et al., 1996; Joss et al., 1994; Schanz et al., 1998). Other studies dealt with the characterization of environmental conditions (Del Don et al., 2001), or the biogeochemical cycles in the lake (Birch et al., 1996; Camacho et al., 2001; Fritz et al., 2000; Lehmann and Bachofen, 1999; Lüthy et al., 2000; Putchew et al., 1995). Rapid physiological responses of phototrophic sulfur bacteria at different depths in the bacterial layer indicated possible adaptation mechanisms along the gradient of light with respect to intensity and quality (Fischer et al., 1996; Joss et al., 1994; Schanz et al., 1998). However, variations over the summer season in the photosynthetic properties of the bacterial population were random and no photoadaptation effect was found (Schanz et al., 1998). From microscopic observations it was concluded that the major bacteria in the plume were purple sulfur bacteria, mainly the large-celled Chromatium okenii and the small-celled Amoebobacter purpureus.

Studies including measurements of oxygenic photosynthesis and chemolithoautotrophy were carried out at the redox transition zone of Lake Cadagno (Camacho et al., 2001). Beside high rates of photoassimilation in the chemocline, high rates of dark carbon assimilation were also reported, especially in the zone where oxygen and sulfide co-existed. It was concluded that the contribution of autotrophic chemolithotrophs to total productivity of the lake might be important. However, a mass development of such bacteria (e.g. Thiobacillus) was never observed. A strong link between production in the chemocline and the trophogenic zone in the mixolimnion was pointed out because of grazing, and it was concluded that zooplankton may obtain as much as half of its carbon from the chemocline (Camacho et al., 2001).

Although Lake Cadagno has been intensively studied in the past, only recently molecular studies allowed to retrieve information on population dynamics of the dominant members of the bacterial community inhabiting the redox transition zone (Bosshard et al., 2000a; Demarta et al., 1998; Tonolla et al., 1998b; 1999). These techniques showed that almost all bacteria in the chemocline belonged to the Proteobacteria with the
-, -, - and -subdivision of Proteobacteria, respectively, accounting for 23, 17, 45 and 15% of the total number of bacteria (Tonolla et al., 1998b; 1999). Depending on the season as much as 35 to 45% of the total microbial community was associated in aggregates consisting of small-celled purple sulfur bacteria (15 to 35% of the total microbial community) (Tonolla et al., 30 Chapter 1

1999) and others organisms belonging to the -subdivision of Proteobacteria (Tonolla et al., 1998b). Molecular methods identified four major populations of purple sulfur bacteria in these aggregates forming a tight cluster with the genus Lampocystis, i.e. L. purpurea, L. roseopersicina, and two yet uncultured populations D and F (Tonolla et al., 1999). In the redox transition zone a micro- stratification of this four populations was observed, apparently showing different and specific eco- physiological adaptations (Tonolla et al., 1999). Green sulfur bacteria were present at all times but did not contribute significantly to the biomass (Tonolla et al., 2002). This was different for C. okenii that was abundant at certain depths late in the year. However, a clear correlation between environmental conditions and factors favoring population shifts could not be detected (Bosshardt et al., 2000b).

Figure 1.9 Comparison of microbiological characteristics from different lakes. 1. oxygenic photosynthesis, 2. anoxygenic photosynthesis, 3. chemosynthesis (dark carbon fixation), 4. 5. rate of H2S formation. (A) Idealized vertical profile of a stratified freshwater lake with a chemocline in the temperate climate zone during summer season (adapted from Schlegel and Jannasch, 1992); (B) vertical profiles from Lake Belovod (adapted from Gorlenko et al., 1983; Sorokin, 1970); (C) vertical profiles from lake Cadagno, late summer (adapted from Camacho et al., 2001). The absence of a peak of oxygenic photosynthesis in Lake Cadagno might simply be explained by the periodicity of primary productivity of phytoplankton. Positive sulfide turnover rates were measured within the photrophic bacterial plume of Lake Cadagno indicating production of sulfide in the redox transition layer (Lüthy, 2000) as reported in A and B. However turnover rates were given as relative rates and data reported did not allow to calculate specific oxidation or reduction rates. Introduction 31

Various non-phototrophic bacteria developed within the chemocline including members of the - subdivision of Proteobacteria, most probably sulfate-reducing bacteria that accounted for up to 15% of the total population (Tonolla et al., 1998b). These populations seemed to be diverse but stable (Bosshardt et al., 2000a; Demarta et al., 1998; Tonolla et al., 1998b). The presence of sulfate-reducing bacteria in the bacterial layer was further supported by in situ determination of sulfide turnover rates (Lüthy et al., 2000) and high-resolution images of sulfide concentrations in the water column (Lehmann and Bachofen, 1999). Evidence was given for sulfate reduction in the layer dominated by the purple sulfur bacteria (Lüthy et al., 2000), introducing the possibility of a significant sulfur cycling within the chemocline coupled to a rapid turnover of sulfide (Fritz and Bachofen, 2000). Interestingly, during daytime at maximum of bacterial density often no detection of sulfide was reported (see Fig. 1.5), indicating a possible lack of sulfide for anoxygenic photosynthesis similar to the one reported for Lakes Mahoney and Ciso.

Comparative 16S rRNA sequence analysis of clone libraries from the chemocline of Lake Cadagno (Bosshardt et al., 2000a; Tonolla et al., 1998b) retrieved sequences closely related to bacteria of the genus Desulfocapsa, that comprise sulfate-reducing bacteria capable of performing sulfur disproportionation as energy yielding process. The presence of these organisms in the chemocline of Lake Cadagno together with purple sulfur bacteria (Tonolla et al., 1998b) was used to speculate about a potential interaction between them in a cycling of sulfur and possibly carbon compounds within the bacterial plume. However, since phylogenetic relationships do not necessarily reflect physiological relationships (Achenbach and Coates, 2000; Pace, 1999; Zinder and Salyers, 2001), the potential interactions between the sulfate-reducing and anoxygenic phototrophic bacteria in the chemocline of Lake Cadagno based on sequence information have to be elucidated in much more detail which was the aim of this thesis. 32 Chapter 1

1.3 Aim of the thesis

Since both sulfate-reducing and anoxygenic phototrophic bacteria are difficult to obtain in pure culture, the initial proposal was to take advantage of the availability of sequence information and address questions on the effects of varying environmental conditions on growth of both groups of organisms in the chemocline. The availability of sequence information would also be used in a concomitant attempt to isolate both sulfate-reducing and phototrophic bacteria following the strategy of others to monitor enrichment cultures (Kane et al., 1993; Purdy et al., 1997; Rabus et al., 1996) with the aim to isolate bacteria with a high ecological significance, i.e. with a high numerical abundance in the microbial community. Detailed pure culture studies with isolates of both types of organisms would then be used to evaluate and confirm the speculations on their potential interactions. This aim would include a confirmation of metabolic similarity with their closest cultured relatives, a demonstration of aggregate formation and association of both organisms in vitro and the demonstration of beneficial effects of mixed cultures on growth performance of both organisms.

Based on these aims, the work presented in this thesis is dealing with three major parts:

1) a detailed molecular and in situ analysis of the organisms potentially participating in the sulfur cycle in the chemocline and in aggregate formation or associations (Chapters 2 and 3),

2) a detailed analysis of the spatial and temporal shifts of associated or aggregate-forming organisms together and a correlation of microbial data with physico-chemical data (Chapters 3 and 4), and

3) an attempt to enrich and isolate the partners of associations or aggregates to evaluate and confirm the speculations on their potential interactions (Chapter 5).

These objectives were addressed in order to gather and improve knowledge on the specific organisms developing in the chemocline and potentially involved in the biogeochemical sulfur cycle, particularly sulfate-reducing and phototrophic sulfur bacteria. For this purpose, group-specific probes were developed targeting rRNA sequences of major populations of sulfate-reducing bacteria and phototropic sulfur bacteria in the chemocline of Lake Cadagno. The probes were evaluated and used to quantify different populations of these bacteria by in situ hybridization. Subsequently, shifts in community structure of the dominant populations were analyzed in space and time and related to changes in physico-chemical conditions. Observations on associations and aggregate formation between sulfate-reducing and phototrophic sulfur bacteria in the chemocline were finally evaluated in pure and mixed culture studies when isolates became available. Introduction 33

Figure 1.10 Overview on the topics investigated in this thesis 34 Chapter 1

1.4 References

Achenbach L. A. and Coates J. D. (2000) Disparity between bacterial phylogeny and physiology. ASM News. 66: 714-715. Amann R., Ludwig W. and Schleifer K.-H. (1995) Phylogenetic identification and in situ detection of individual microbial cells without cultivation. Microbiol. Rev. 59: 143-169. Bachmann H. (1928) Das Phytoplankton der Pioraseen nebst einigen Beiträgen zur Kenntniss des Phytoplanktons Schweizerischer Alpenseen. Schweiz. Zeitschr. Hydrol. V, Heft 1/2: 50-103. Bachmann H. (1924) Der Ritomsee. Schweiz. Zeitschr. Hydrol. II, Heft 1/2: 7-28. Bak F. and Cypionka A. (1987) A novel type of energy metabolism involving fermentation of inorganic sulphur compounds. Nature 326: 891-892. Bak F. and Pfennig N. (1991) Microbial sulfate reduction in littoral sediment of lake Constance. FEMS Microbiol. Ecol. 85: 31-42. Bak F. and Pfennig N. (1987) Cheomolithotrophic growth of Desulfovibro sulfodismutans sp. nov. by disproportionation of inorganic sulfur compounds. Arch. Microbiol. 147: 184-189. Bak F. (1993) Fermentation of inorganic sulfur compounds by sulfate-reducing bacteria. p. 75-78. In: R. Guerrero and C. Pedrós-Alió (eds.), Trends in Microbial Ecology, Spanish Society for Microbiology. Barbieri A. and Polli B. (1992) Limnological aspects and management of Lago di Lugano. Aquat. Sci., special issue 54 (3/4): 390 pp. Barton L. L. (1995) Sulfate-reducing bacteria. Plenum Press, New York. p. 333. Biebl H. and Pfennig N. (1978) Growth yields of green sulfur bacteria in mixed cultures with sulfur and sulfate reducing bacteria. Arch. Microbiol. 117: 9-16. Biebl H. and Pfennig N. (1977) Growth of sulfate-reducing bacteria with sulfur as electron acceptor. Arch. Microbiol. 112: 115-117. Birch L., Hanselmann K. W. and Bachofen R. (1996) Heavy metal conservation in Lake Cadagno sediments: historical record of anthropogenic emissions in a meromictic alpine lake. Water Res. 30: 679-687. Blankenship R. E., Madigan M. T. and Bauer C. E. (eds) (1995) Anoxygenic photosynthetic bacteria, Kluwer Academic Publishers, The Netherlands. p. 1331. Borner L. (1928a) Die Bodenfauna des Lago Ritom und seines Deltagebiets vor der Absenkung (1916) I. Schweiz. Zeitschr. Hydrol. IV, Heft 1/2: 121-162. Borner L. (1928b). Die Bodenfauna des Lago Ritom und seines Deltagebiets vor der Absenkung (1916) II. Schweiz. Zeitschr. Hydrol. IV, Heft 3/4: 1-30. Bosshard P. P., Santini Y., Gruter D., Stettler R. and Bachofen R. (2000a) Bacterial diversity and community composition in the chemocline of the meromictic alpine Lake Cadagno as revealed by 16S rDNA analysis. FEMS Microbiol Ecol. 31: 173-182. Bosshard P. P., Stettler R. and Bachofen R. (2000b) Seasonal and spatial community dynamics in the meromictic Lake Cadagno. Arch. Microbiol. 174: 168-74. Bourcart F. (1906) Les lacs alpins suisses, étude chimique et physique. Thèse université de Genève. Georg & Co. Eds. Genève. Brown S. R. and McIntosh H. J. (1987) The fossil history of sulfur phototrophs in a meromictic lake ecosystem. p. 83-96. In: T. Lindholm (eds), Ecology of photosynthetic prokaryotes, with special reference to meromictic lakes and coastal lagoons. Åbo Academy Press, Åbo Finland. Introduction 35

Burckhardt G. (1910). Das Plankton des Lago Ritom unter dem Einfluss der Schwefelquellen. Verhandl. Schweiz. Naturforsch. Ges. 93: 302-303. Caldwell D.E. and Tiedje J. M. (1975) The structure of anaerobic bacterial communities in the hypolimnia of several Michigan lakes. Can. J. Microbiol. 21: 377-385. Camacho A., Erez J., Chicote A., Florin M., Squires M. M., Lehmann C. and Bachofen R. (2001) Microbial microstratification, inorganic carbon photoassimilation and dark carbon fixation at the chemocline of the meromictic Lake Cadagno (Switzerland) and its relevance to the food web. Aquat. Sci. 63: 91-106. Camacho A. and Vicente E. (1998) Carbon photoassimilation by sharply stratified phototrophic communities at the chemocline of Lake Arcas (Spain). FEMS Microbiol. Ecol. 25: 11-22. Canfield D. E. and Thamdrup B. (1994) The production of 34S-depleted sulfide during bacterial disproportionation of elemental sulfur. Science 266: 1973-1975. Canfield D. E., Thamdrup B. and Fleischer S. (1998) Isotope fractionation and sulfur metabolism by pure and enrichment cultures of elemental sulfur-disproportionating bacteria. Limnol. Oceanog. 43: 253-264. Casamayor E. O., Calderon-Paz J. I., Mas J. and Pedrós-Alió C. (1998) Identification of phototrophic sulfur bacteria through the analysis of lmwRNA band patterns. Arch. Microbiol. 170: 269-278. Casamayor E. O., Pedrós-Alió C., Muyzer G. and Amann R. (2002) Microheterogeneity in 16S ribosomal DNA-defined bacterial populations from a stratified planktonic environment is related to temporal changes and to ecological adaptations. Appl. Environ. Microbiol. 68: 1706-1714. Casamayor E. O., Schafer H., Baneras L., Pedrós-Alió C. and Muyzer G. (2000) Nucleotide Identification of and spatio-temporal differences between microbial assemblages from two neighboring sulfurous lakes: comparison by microscopy and denaturing gradient gel electrophoresis. Appl. Environ. Microbiol. 66:499-508. Castro H. F., Williams N. H. and Ogram A. (2000) Phylogeny of sulfate-reducing bacteria (MiniReview). FEMS Microbiol. Ecol. 31: 1-9. Collet L. W. and Mellet R. (1919) Le lac Ritom (haute Léventine, Tessin)-Provenance de l’hydrogène sulfuré, abaissement du niveau du lac de 30 m. Arch. Sci. Phys. Nat., 5ème période, Vol. 1 année CXXIV Supp.1. Soc. Phys. et Hist. Nat. Genève, compte rendu des séances. Collet L. W., Mellet R. and C. Ghezzi (1918) Le lac Ritom. Département suisse de l'intérieur, Communication du Service des eaux No. 13 (Dr. C. Mutzner), Bern. Coolen M. J. L. and Overmann J. (1998) Analysis of subfossil molecular remains of purple sulfur bacteria in lake sediment. Appl. Environ. Microbiol. 64:4513-4521. Cypionka H. (1999) Grundlagen der Mikrobilogie. Springer Verlag, Berlin. p. 277. Cypionka H. (2000) Oxygen respiration by Desulfovibrio species. Annu. Rev. Microbiol. 54: 827- 848. Del Don C., Hanselmann K. W., Peduzzi R. and Bachofen R. (2001) The meromictic alpine Lake Cadagno: orographical and biogechemical description. Aquat. Sci. 63: 70-90. Del Don C., Hanselmann K. W., Peduzzi R. and Bachofen R. (1994) Biomass composition and methods for the determination of metabolic reserve polymers in phototrophic sulfur bacteria. Aquat. Sci. 56:1-15. Demarta A., Tonolla M., Caminada A.-P., Ruggeri N. and Peduzzi R., (1998) Phylogenetic diversity of the bacterial community from the anoxic layer of the meromictic Lake Cadagno. Doc. Ist. Ital. Idrobiol. 63: 19-30. 36 Chapter 1

Donachie S. P, Kinzie III R. A., Bidigare R. R., Sadler D. W. and Karl D. M. (1999) Lake Kauhakō, Moloka'i, Hawai'i: Biological and chemical aspects of a morpho-ectogenic meromictic lake. Aquat. Microb. Ecol. 19: 93-103. Düggeli M. (1924). Hydrobiologische Untersuchungen im Pioragebiet. Bakteriologische Untersuchungen am Ritomsee. Schweiz. Zeitschr. Hydrol. II, Heft 1/2: 62-205. Düggeli M. (1919) Die Schwefelbakterien. Neujahrsblatt 121 der Naturforschenden Gesellschaft Zürich. Eder-Schweizer J. (1924) Chemische Untersuchungen am Lago Ritom vor und nach der Absenkung. Schweiz. Zeitschr. Hydrol. II, Heft 1/2: 28-64. Egli K., Wiggli M., Klug J. and Bachofen R. (1998) Spatial and temporal dynamics of the cell density in a plume of phototrophic microorganisms in their natural environment. Doc. Ist. Ital. Idrobiol. 63: 121-126. Eichler B. and Pfennig N. (1988) A new purple sulfur bacterium from stratified freshwater lakes, Amoebobacter purpureus sp. nov. Arch. Microbiol. 149: 395-400. Ehrenreich A. and Widdel F. (1994) Anaerobic oxidation of ferrous iron by purple bacteria, a new type of phototrophic metabolism. Appl. Envir. Microbiol. 60: 4517-4526. Ehrlich H. L. (1996) Geomicrobiology, Third edition, Marcel Dekker Inc. New York. p. 697. Finster K., Liesack W. and Thamdrup B. (1998) Elemental sulfur and thiosulfate disproportionation by Desulfocapsa sulfoexigens sp. nov., a new anaerobic bacterium isolated from marine surface sediment. Appl. Envir. Microbiol. 64: 119-125. Finster K., Liesack W., and Tindall B. J. (1997) Desulfospira joergensenii, gen. nov., sp. nov., a new sulfate–reducing bacterium isolated from marine surface sediment. System. Appl. Microbiol. 20: 201-208. Fischer C., Wiggli M., Schanz F., Hanselmann K. W. and Bachofen R. (1996) Light environment and synthesis of bacterioclorophyll by populations of Chromatium okenii under natural environmental conditions. FEMS Microbiol. Ecol. 21: 1-9. Fritz M. and Bachofen R. (2000) Volatile organic sulfur compounds in a meromictic alpine lake. Acta hydrochim. Hydrobiol. 28: 185-192. Fukui M. and Takii S. (1990) Survival of sulfate-reducing bacteria in oxic surface sediment of a seawater lake. FEMS Microbiol. Ecol. 73: 317-322. Garrity G. M. and Holt J. G. (2002) Phylum BXI. Chlorobi phy. nov.. p. 601-623. In: D. R. Boone and R. W. Castenholz (eds), Bergey's Manual of Systematic Bacteriology, Vol.1.Williams and Wilkins, Baltimore. Garwood E. J. (1906) The tarns of the Canton Ticino. Quart. Journ. Geol. Soc. Vol. LXII: 165-193. Gattuso J. P., Peduzzi S., M. D. Pizay and Tonolla M. (2002) Changes of bacterial community composition during measurements of community and microbial respiration. J. Plankton Res. 24: 1197- 1206. Gorlenko V. M., Dubinina G. A. and Kusnetsov S. I. (1983) The ecology of aquatic micro- organisms. Vol. XXVIII. E. Schweizerbart’sche Verlagsbuchhandlung, Stuggart. p. 252. Grossmann E. L. and Desrocher S. (2001) Microbial sulfur cycling in terrestrial subsurface environments. p. 219-247. In: J. K. Fredrickson and M. Fletcher (eds.), Subsurface microbiology and biogeochemistry, Wiley series in ecological and applied microbiology, Wiley, New York. Guerrero R., Abella C. and Miracle M. R. (1978) Spatial and temporal distribution of bacteria in a meromictic karsic lake basin relationships with physicochemical parameters and zooplankton. Verh. Internat. Verein. Limnol. 29: 2264-2271. Introduction 37

Guerrero R., Montesinos E., Pedrós-Alió C., Esteve I., Mas J. and van Gemerden, H. (1985) Phototrophic sulfur bacteria in two Spanish Lakes: vertical distribution and limiting factors. Limnol. Oceanogr. 30: 919-931. Guerrero R., Pedrós-Alió C., Esteve I. and Mas J. (1987) Communities of phototrophic sulfur bacteria in lakes of the Spanish mediterranean region. p. 125-151. In: T. Lindholm (eds), Ecology of photosynthetic prokaryotes, with special reference to meromictic lakes and coastal lagoons, Åbo Academy Press, Åbo Finland. Hanselmann K. and Hutter R. (1998) Geomicrobiological coupling of sulfur and iron cycling in anoxic sediments of a meromictic lake: sulfate reduction and sulfide sources and sinks in Lake Cadagno. Doc. Ist. Ital. Idrobiol. 63: 85-98. Head I. M., Saunders J. R. and Pickup R.W. (1998) Microbial evolution, diversity, and ecology: a decade of ribosomal RNA analysis of uncultivated microorganisms. Microb. Ecol. 35: 1-21. Imhoff J. F. (2002) The anoxigenic phototrophic purple bacteria. p. 631-637. In: D. R. Boone and R. W. Castenholz (eds) Bergey's Manual of Systematic Bacteriology, Vol. 1.Williams and Wilkins, Baltimore. Imhoff J. F. (2001) Transfer of Pfennigia purpurea Tindall 1999 (Amoebobacter purpureus Eichler and Pfennig 1988) to the genus Lamprocystis as Lamprocystis purpurea comb. nov. Int. J. Syst. Evol. Microbiol. 51:1699-701. Imhoff J. F., Süling J. and Petri R. (1998) Phylogenetic relationships among the Chromatiaceae, their taxonomic reclassification and description of the new genera Allochromatium, Halochromatium, Isochromatium, Marichromatium, Thiococcus, Thiohalocapsa and Thermochromatium. Int. J. Syst. Bacteriol. 48:1129-1143. Jackson B. E. and McInerey M. J. (2000) Thiosulfate disproportionation by Desulfotomaculum thermobenzoicum. Appl. Environ. Microbiol. 66: 3650-3653. Janssen P. H., Schuhmann A., Bak F. and Liesack W. (1996) Disproportionation of inorganic sulfur compounds by the sulfate-reducing bacteium Desulfocapsa thiozymogenes gen. nov., sp. nov. Arch. Microbiol. 166: 184-192. Jørgensen B. B. (1990a) The sulfur cycle of freshwater sediments: role of thiosulfate. Limnol. Oceanogr. 35: 1329-1342. Jørgensen B. B. (1990b) A thiosulfate shunt in the sulfur cycle of marine sediments. Science 249: 152-154. Jørgensen B. B. (1982a) Ecology of the bacteria of the sulphur cycle with special reference to anoxic- oxic interface environnements. Phil. Trans. R. Soc. Lond. B 298: 543-561. Jørgensen B. B. (1982b) Mineralization of organic matter in the sea bed-the role of sulfate reduction. Nature 296: 643-645. Jørgensen B. B. (1977) Bacterial sulfate reduction within reduced microniches of oxidized marine sediments. Mar. Biol. 41:7-17. Jørgensen B. B. and Bak F. (1991) Pathways and Microbiology of thiosulfate transformations and sulfate reduction in a marine sediment (Kattegat, Denmark). Appl. Environ. Microbiol. 57: 847-856. Jørgensen B. B., Fossing H., Wirsen C. O. and Jannasch H. (1991) Sulfide oxidation in the Black Sea chemocline. Deep-sea Res. 38: 1083-1103. Jørgensen B. B., Kuenen J. G. and Cohen Y. (1979) Microbial transformations of sulfur compounds in a stratified lake (Solar Lake, Sinai). Limnol. Oceanogr. 24: 799-822. Joss A., Mez K., Känel B., Hanselmann K. W. and Bachofen R. (1994) Measurement of fluorescence kinetics of phototrophic bacteria in the natural environment. J. Plant. Physiol. 144: 333- 338. 38 Chapter 1

Kämpf C. and Pfennig N. (1980) Capacity of Chromatiaceae for chemotrophic growth. Specific respiration rates of Thiocystis violacea and Chromatium vinosum. Arch. Microbiol. 127: 125-135. Kane M. D., Poulsen L. K. and Stahl D. A. (1993) Monitoring the enrichment and isolation of sulfate-reducing bacteria by using oligonucleotide hybridization probes designed from environmentally derived 16S rRNA sequences. Appl. Environ. Microbiol. 59: 682-686. Kelly D. P. (1987) Sulphur bacteria first again. Nature 326: 830. Knobluch C., Sahm K. and Jørgensen B. B. (1999) Psychrophilic sulfate-reducing bacteria isolated from permanently cold Artic marine sediments: description of Desulfofrigus oceanense gen. nov., sp. nov., Desulfofrigus fragile sp. nov., Desulfofaba gelida gen. nov., sp. nov., Desulfotalea psychrofila gen. nov., sp. nov. and Desulfotalea artica, sp. nov. Int. J. Syst. Bacteriol. 49: 1631-1643. Krämer M. and Cypionka H. (1989) Sulfate formation via ATP sulfurylase in thiosulfate- and sulfite-disproportionating bacteria. Arch. Microbiol. 151:232-237. Krekeler D., Sigalevich P., Teske A., Cypionka H. and Cohen Y. (1997) A sulfate-reducing bacterium from the oxic layer of a microbial mat from Solar lake (Sinai), Desulfovibrio oxyclinae sp. nov. Arch. Microbiol. 167: 369-365. Lehmann C. and Bachofen R. (1999) Images of concentrations of dissolved sulphide in the sediment of a lake and implications for internal sulphur cycling. Sedimentol. 46: 537-545. Lehmann C., Luehty L. and Bachofen R. (1998) Tools for the evaluation of sources and sinks of sulfide in Lake Cadagno. Doc. Ist. Ital. Idrobiol. 63: 99-104. Lindholm T. (eds) (1987) Ecology of photosynthetic prokaryotes, with special reference to meromictic lakes and coastal lagoons. Åbo Academy Press, Åbo Finland. p. 151. Lovely D. R. and Coates J. D. (2000) Novel forms of anaerobic respiration of environmental relevance. Current Opinion in Microbiology 3: 252-256. Lovely D. R. and Klug M. J. (1983) Sulfate reducers can outcompete methanogens at freshwater sulfate concentrations. Appl. Environ. Microbiol. 45: 187-192. Lovely D. R. and Phillips E. J. P. (1994) Novel processes for anaerobic sulfate reduction from elemental sulfur by sulfate-reducing bacteria. Appl. Environ. Microbiol. 60: 2394-2399. Luther G. W., Church M. and Powell D. (1991) Sulfur speciation and sulfide oxidation in the water column of the Black Sea. Deep-sea Res. 38: 1121-1137. Lüthy L., Fritz M. and Bachofen R. (2000) In situ determination of sulfide turnover rates in a meromictic alpine lake. Appl. Environ. Microbiol. 66:712-717. Madigan M. T. (1988) Microbiology, physiology, and ecology of phototrophic bacteria, p. 39-111. In: A. J. B. Zehnder (editor) Biology of Anaerobic Organisms. John Wiley, New York. Madigan M. T., Martinko J. M. and Parker J. (2000) Brock, Biology of Microorganisms, Prentice Hall Inc., Upper Saddle River, NJ. p. 991 Manz W., Eisenbrecher M., Neu T. R. and Szewzyk U. (1998) Abundance and spatial organization of Gram-negative sulfate-reducing bacteria in activated sludge investigated by in situ probing with specific 16S rRNA targeted oligonucleotides. FEMS Microbiol. Ecol. 25:43-61. Manz W., Wendt-Potthoff K., Neu T. R., Szewzyk U. and Lawrence J. R. (1999) Phylogenetic composition, spatial structure, and dynamics of lotic bacterial biofilms investigated by fluorescent in situ hybridization and confocal laser scanning microscopy. Microl. Ecol. 37: 225-237. Minz D., Fishbain S., Green S. J., Muyzer G., Cohen Y., Rittmann B. E. and Stahl D. A. (1999a) Unexpected population distribution in a microbial mat community: sulfate-reducing bacteria localized to the highly oxic chemocline in contrast to a eukaryotic preference for anoxia. Appl. Environ. Microbiol. 65: 4659-4665. Introduction 39

Minz D., Flax J. L., Green S. J., Muyzer G., Cohen M., Wagner M., Rittmann B. E. and Stahl D. A. (1999b) Diversity of sulfate-reducing bacteriain oxic and anoxic regions of a microbial mat characterized by comparative analysis of dissimilatory sulfite reductase genes. Appl. Environ. Microbiol. 65: 4666-4671. Odom J. M. and Singleton R. Jr. (1993) The sulfate-reducing bacteria: contemporary perspectives. Brock/Springer series in contemporary bioscience, Springer-Verlag, New York. p. 290. Overmann J. (1997) Mahoney lake: a case study of the ecological significance of phototrophic sulfur bacteria. Adv. Microb. Ecol. 15: 251-288. Overmann J., Beatty T., Krouse H. R. and Hall K. J. (1996) The sulfur cycle in the chemocline of a meromictic salt lake. Limnol. Oceanogr. 41: 147-156. Overmann J., Beatty T. and Hall K. J. (1994) Photosynthetic activity and population dynamics of Amoebobacter purpureus in a meromictic saline lake. FEMS Microbiol. Ecol. 15: 309-320. Overmann J., Beatty T., Hall K. J., Pfennig N. and Northcote T. G. (1991) Characterization of a dense, purple sulfur bacterial layer in a meromictic lake. Limnol. Oceanogr. 36: 846-859. Overmann J. and Pfennig N. (1992) Buoyancy regulation and aggregate formation in Amoemobacter purpureus from Mahoney Lake. FEMS Microbiol. Ecol. 101: 67-79. Overmann J. and van Gemerden H. (2000). Microbial interactions involving sulfur bacteria: implications for the ecology and evolution of bacterial communities. FEMS Microbiol Rev. 24: 591- 599. Øvreas L., Forney L., Daae F. L. and Torsvik V. (1997) Distribution of bacterioplankton in meromictic lake Saelvannet, as determined by denaturing gradient gel electrophoresis of PCR- amplified gene fragments coding for 16S rRNA. Appl. Environ. Microbiol. 63: 3367-3373. Pace N. R. (1999) Microbial Ecology & Diversity. ASM News. 65: 328-333. Parkin T. B. and Brock T. D. (1981) The role of phototrophic bacteria in the sulfur cycle of a meromictic lake. Limnol. Oceanogr. 26: 880-890. Pedrós-Alió C. and Guerrero R. (1993) Microbial ecology in Lake Cisó. Adv. Microb. Ecol. 13: 155-209. Pedrós-Alió C., Montesinos E. and Guerrero R. (1983) Factors determining annual changes in bacterial photosynthetic pigments in holomictic Lake Cisó, Spain. Appl. Environ. Microbiol. 46: 999- 1006. Peduzzi R. (1990) Etude d'un filtre bactérien retenant les composés toxiques et trophogènes dans un lac alpin (Lac de Cadagno, Massif du St. Gothard). Cahier de la Faculté des Sciences, Univ. Genève, 20: 121-133. Peduzzi R. (1993) Il nuovo Centro di biologia alpina di Piora. Memorie Soc. Tic. Sc. Nat. 4: 25-31. Peduzzi, R., Bachofen R., and Tonolla, M. (eds.) (1998). Lake of Cadagno: a meromictic alpine lake. Documenta dell’ Istituto Italiano di Idrobiologia. 63. p. 152. Peduzzi R., Demarta A. and Tonolla M. (1993) Dynamics of the autochtonous and contaminant bacterial colonization of lakes (Lake Cadagno and Lake of Lugano as model systems), p. 323-335. In: J.-P. Vernet (eds), Studies in Environmental Science 55: Environmental Contamination, Elsevier Publ., Amsterdam, The Netherlands. Pfennig N. (1989) Ecology of phototrophic purple and green sulfur bacteria. p. 97-176. In: H. G. Schlegel and B. Bowien (eds), Autotrophic bacteria, Science Tech Publishers and Springer-Verlag, Madison and New York. Pfennig N. (1980) Syntrophic mixed cultures and symbiotic consortia with phototrophic bacteria: a review. p. 127-131. In G. Gottschalk, N. Plenning and H. Werner (eds), Anaerobes and anaerobic infections, Fischer, Stuttgart. 40 Chapter 1

Pfennig N. (1979) General physiology and ecology of photosynthetic bacteria. p. 3-17. In: R. K. Clayton and W. R. Sistrom (eds), The photosynthetic bacteria, Plenum Press, New York and London. Pfennig N. and Biebl H. (1976) Desulfuromonas acetooxidans gen. nov. and sp. nov., a new anaerobic, sulfur reducing, acetate oxidizing bacterium. Arch. Microbiol. 110: 3-12. Pfennig N. and Trüper H.G. (1992) The family Chromatiaceae. p. 3199-3221. In: A. Balows, H. G. Trueper, M. Dworkin, W. Harder and K. H. Schleifer (eds), The Prokaryotes, Springer, New York. Pfennig N. and Trüper H. G. (1989) Anoxygenic phototrophic bacteria. p. 1635-1709. In: J. T. Staley, M. P. Bryant, N. Pfennig and J. C. Holt (eds), Bergey’s Manual of Systematic Bacteriology, Williams and Wilkins, Baltimore. Postgate J. R. (1984) The Sulphate-Reducing bacteria, 2nd edition, Cambridge University Press, Cambridge. UK. p. 208. Purdy K. J., Nedwell D. B., Embley T. M. and Takii S. (1997) Use of 16S rRNA-targeted oligonucleotide probes to investigate the occurrence and selection of sulfate-reducing bacteria in response to nutrient addition to sediment slurry microcosms from a Japanese estuary. FEMS Microbiol. Ecol. 24: 221-234. Putschew A., Scholz-Böttcher B. M. and Rullkötter J. (1995) Organic geochemistry of sulfur-rich surface sediments of meromictic lake Cadagno, swiss Alps. p. 59-79. In: M. A. Vairavamurthy and M. A. A. Schoonen (eds), Geochemical transformations of sedimentary sulfur, ACS Symposium series 612, Washington DC. Rabus R., Fukui M., Wilkes H. and Widdel, F. (1996) Degradative capacities and 16S rRNA- targeted whole-cell hybridization of sulfate-reducing bacteria in an anaerobic enrichment culture utilizing alkylbenzenes from crude oil. Appl. Environ. Microbiol. 62: 3605-3616. Ramsing N. B., Fossing H., Ferdelman T. G., Andersen F. and Thamdrup B. (1996). Distribution of bacterial populations in a stratified fjord (Mariager Fjord, Denmark) quantified by in situ hybridization and related to chemical gradients in the water column. Appl. Environ. Microbiol. 62: 1391-1404. Ravenschlag K., Sahm K., Knoblauch C., Jørgensen B. B. and Amann R. (2000) Community structure, cellular rRNA content, and activity of sulfate-reducing bacteria in marine artic sediments. Appl. Environ. Microbiol. 66: 3592-3602. Risatti J. B., Capman W. C. and Sthal D. A. (1994) Community structure of microbial mat: the phylogenetic dimension. Proc. Natl. Acad. Sci. USA 91: 10173-10177. Rooney-Varga J. N., Devereux R., Evans R. S. and Hines M. E. (1997) Seasonal changes in the relative abundance of uncultivated sulfate-reducing bacteria in a salt marsh sediment and in the rhizosphere of Spartina alterniflora. Appl. Environ. Microbiol. 63: 3895-3901. Rooney-Varga J. N., Sharak Genthner B. R., Devereux R., Willis S. G. Friedmann S. D. and Hines M. E. (1998) Phylogenetic and physiological diversity of sulfate-reducing bacteria isolated from a salt marsh sediment. System. Appl. Microbiol. 21: 557-568. Santegoeds C. M., Ferdelmann T. G., Muyzer G. and de Beer D. (1998) Structural and functional dynamics of sulfate-reducing populations in bacterial biofilms. Appl. Environ. Microbiol. 64: 3731- 3739. Sass H., Berchtold M., Branke J., König H., Cypionka H. and Babenzien H-D. (1998) Psychrotolerant sulfate-reducing bacteria from an oxic freshwater sediment, description of Desulfovibrio cuneatus sp. nov. and Desolfovibrio litoralis sp. nov. System. Appl. Microbiol. 21: 212- 219. Sass H., Cypionka H. and Babenzien H-D. (1997) Vertical distribution of sulfate-reducing bacteria at the oxic-anoxic interface in sediments of the oligotrophic Lake Stechlin. FEMS Microbiol. Ecol. 22: 245-255. Introduction 41

Sass H., Cypionka H. and Babenzien H-D. (1996) Sulfate-reducing bacteria from the oxic sediment layers of the oligotrophic Lake Stechlin. Arch. Hydrobiol. Spec. Issues Adv. Limnol. 48: 241-246. Schanz F., Fischer-Romero C. and Bachofen R. (1998) Photosynthetic production and photoadaptatin of phototrophic sulfur bacteria in Lake Cadagno (Switzerland). Limnol. Oceanogr. 43:1262-1269. Schauder R. and Kröger A. (1993) Bacterial sulphur respiration (Minireview). Arch. Microbiol. 159: 491-497. Schink B. (1992) Syntropism among prokaryotes. p. 276-299. In: A. Balows, H. G. Trueper, M. Dworkin, W. Harder and K. H. Schleifer (eds), The Prokaryotes, Springer, New York. Schink B. (1999) Habitats of prokaryotes. p. 763-811. In: J. W. Schlegel, G. Drews, H.G. Schlegel (eds), Biology of the prokaryotes, Thieme Verlag, Stuttgart, Germany. Schlegel H. G. and Jannasch H. W. (1992) Prokaryotes and their habitat. p. 75-124. In: A. Balows, H. G. Trueper, M. Dworkin, W. Harder and K. H. Schleifer (eds), The Prokaryotes, Springer, New York. Schwoerbel J. (1999) Einführung in die Limnologie, 8. Auflage, Gustav Fischer Verlag, Stuttgart. p. 465. Smith D. W. (1993) Ecological actions of sulfate-reducing bacteria. p.161-188. In: J. M. Odom and R. Singleton Jr. (eds), The sulfate-reducing bacteria: contemporary perspectives. Brock/Springer Series in Contemporary Bioscience, Springer-Verlag, New York. Sorokin Y. I. (1970) Interrelations between sulphur and carbon turnover in meromictic lakes. Arch. Hydrobiol. 66: 391-446. Surbeck G. (1917) Über die Fische des Ritom-, Cadagno- und Tomsees in Val Piora. Verh. Schweiz. Natur. Ges. 99: 264-265. Thamdrup B., Finster K., Hansen J. W. and Bak F. (1993) Bacterial disproportionation of elemental sulfur coupled to chemical reduction of iron or manganese. Appl. Environ. Microbiol. 59: 101-108. Teske A., Ramsing N. B., Habicht K., Fukui M., Küver J., Jørgensen B. B. and Cohen Y. (1998) Sulfate-reducing bacteria and their activities in cyanobacterial mats of Solar Lake (Sinai, Egypt). Appl. Environ. Microbiol. 64: 2943-2951. Teske A., Wawer C., Muyzer G. and N. B. Ramsing (1996) Distribution of sulfate-reducing bacteria in a stratified fjord (Mariager Fjord, Denmark) as evaluated by most-probable–number counts and denaturing gradient gel electrophoresis of PCR-amplified ribosomal DNA fragments. Appl. Environ. Microbiol. 62: 1405-1415. Tonolla M., Demarta A. and Peduzzi R. (1998a) The chemistry of Lake Cadagno. Doc. Ist. Ital. Idrobiol. 63: 11-17. Tonolla M., Demarta A., Hahn D. and Peduzzi R. (1998b) Microscopic and molecular in situ characterization of bacterial populations in the meromictic lake Cadagno. Doc. Ist. Ital. Idrobiol. 63: 31-44. Tonolla M., Demarta A., Peduzzi R. and Hahn D. (1999) In situ analysis of phototrophic sulfur bacteria in the chemocline of meromictic Lake Cadagno (Switzerland). Appl. Environ. Microbiol. 65: 1325-1330. Tonolla M., Peduzzi S., Hahn D. and Peduzzi R. (2002) Seasonal distribution patterns of purple sulfur bacteria in the chemocline of meromictic Lake Cadagno, Switzerland. FEMS Microbiol. Ecol. 43: 89-98. van Gemerden (1987) Competition between purple sulfur bacteria and green sulfur bacteria: role of sulfide, sulfur and polysulfides. p. 13-27. In: T. Lindholm (eds), Ecology of photosynthetic 42 Chapter 1 prokaryotes, with special reference to meromictic lakes and coastal lagoons. Åbo Academy Press, Åbo Finland. van Gemerden H. and Beeftink H. H. (1983) Ecology of phototrophic bacteria. p. 146-185. In: J. G. Ormerod (eds), The phototrophic bacteria: anaerobic life in the light, Studies in Microbiology Vol. 4, University of California Press, Berkeley and Los Angeles. van Gemerden H. and Beeftink H. H. (1981) Coexistence of Chlorobium and Chromatium in a sulfide-limited continuous culture. Arch. Microbiol. 129: 32-34. van Gemerden H. and Mas J. (1995) Ecology of Phototrophic Sulfur Bacteria. p. 49-85. In: R. E. Blankenship, M. T. Madigan and C. E. Bauer (eds), Anoxygenic Photosynthetic Bacteria, Kluwer Academic Publishers, The Netherlands. van Gemerden H., Montesinos E., Mas J. and Guerrero R. (1985) Diel cycle of metabolism of phototrophic purple sulfur bacteria in Lake Cisó (Spain). Limnol. Oceanogr. 30: 932-943. Vila X. and Abella C. A. (1994) Effects of light quality on the physiology and the ecology of planktonic green sulfur bacteria in lakes. Photosynthesis Res. 41: 53-65. Vila X., Abella C. A., Figueras J. B. and Hurley J. P. (1998) Vertical models of phototrophic bacterial distribution in the metalimnetic microbial communities of several freshwater north-american kettle lakes. FEMS Microbiol. Ecol. 25: 287-299. Vila X., Dukulil M., Garcia-Gil L. J., Abella C. A., Borrego C. M. and Bañeras L. (1996) Composition and distribution of phototrophic bacterioplancton in the deep communities of several Central European lakes: the role of light quality. Arch. Hydrobiol. 48: 183-196. Wagener S., Schulz S. and Hanselmann K. (1990) Abundance and distribution of anaerobic protozoa and their contribution to methane production in Lake Cadagno (Switzerland). FEMS Microbiol. Ecol. 74: 39-48. Wetzel R. G. (1983) Limnology, Sanunders College Publishing, Philadelphia. p. 767. Widdel F. (1988) Microbiology and ecology of sulfate- and sulfur-reducing bacteria, p. 469-585. In: A. J. B. Zehnder (eds), Biology of Anaerobic Organisms, John Wiley, New York. Widdel F. and Bak F. (1992) Gram-negative mesophilic sulfate-reducing bacteria. p. 3352-3378. In: A. Balows, H. G. Trueper, M. Dworkin, W. Harder and K. H. Schleifer (eds), The Prokaryotes, Springer, New York. Widdel F. and Pfennig N. (1977) A new anaerobic, sporing, acetate-oxidizing, sulfate-reducing bacterium, Desulfotomaculum (emend.) acetoxidans. Arch. Microbiol. 112: 119-122. Widdel F. and Hansen T. A. (1992) The dissimilatory sulfate- and sulfur-reducing bacteria. p. 584- 624. In: A. Balows, H. G. Trueper, M. Dworkin, W. Harder and K. H. Schleifer (eds), The Prokaryotes, Springer, New York. Widdel F. and Pfennig N. (1992) The genus Desulforomonas and other Gram-negative sulfur- reducing eubacteria. p. 3379-33. In: A. Balows, H. G. Trueper, M. Dworkin, W. Harder and K. H. Schleifer (eds), The Prokaryotes, Springer, New York. Widdel F. and Pfennig N. (1982) Studies on dissimilatory sulfate-reducing bacteria that decompose fatty acids. II. Incomplete oxidation of propionate by Desulfobulbus propionicus gen. nov., sp. nov. Arch. Microbiol. 131: 360-365. Widdel F. and Pfennig N. (1981) Studies on dissimilatory sulfate-reducing bacteria that decompose fatty acids. I. Isolation of new sulfate-reducing bacteria enriched with acetate from saline environments. Description of Desulfobacter postgatei gen. nov., sp. nov. Arch. Microbiol. 129: 395- 400. Wieringa E. B. A., Overmann J. and Cypionka H. (2000) Detection of abundant sulphate-reducing bacteria in marine oxic sediment layers by a combined cultivation and molecular approach. Environmental Microbiology 2: 417-427. Introduction 43

Zinder S. H. and Salyers A. A. (2002) Microbial ecology-new directions, new importance, p. 101- 109. In: D. R. Boone and R. W. Castenholz (eds) Bergey's Manual of Systematic Bacteriology, Vol. 1. Williams and Wilkins, Baltimore.

Chapter 2

In situ analysis of sulfate-reducing bacteria related to Desulfocapsa thiozymogenes in the chemocline of meromictic Lake Cadagno (Switzerland)

Mauro Tonolla, Antonella Demarta, Sandro Peduzzi, Dittmar Hahn1), Raffaele Peduzzi

Cantonal Institute of Bacteriology, Microbial Ecology (University of Geneva), Via Ospedale 6, CH- 6904 Lugano, Switzerland

1)Department of Chemical Engineering, Chemistry and Environmental Science, New Jersey Institute of Technology (NJIT), and Department of Biological Sciences, Rutgers University, 101 Warren Street, Smith Hall 135, Newark, NJ 07102-1811, U.S.A.

Applied and Environmental Microbiology, 66: 820-824 (2000) 46 Chapter 2

Abstract

Comparative sequence analysis of a 16S rRNA gene clone library from the chemocline of the meromictic Lake Cadagno (Switzerland) retrieved two clusters of sequences resembling sulfate- reducing bacteria within the family Desulfovibrionaceae. In situ hybridization showed that, similar to sulfate-reducing bacteria of the family Desulfobacteriaceae, bacteria of one cluster with similarity values between 92.6 and 93.1% to the closest cultured relatives resembled cells being free or loosely attached to other cells or debris. Bacteria of the second cluster closely related to Desulfocapsa thiozymogenes DSM7269 with similarity values between 97.9 and 98.4% were generally associated with aggregates of different small-celled phototrophic sulfur bacteria suggesting a potential interaction between both groups of bacteria.

In situ analysis of sulfate-reducing bacteria related to Desulfocapsa thiozymogenes in the chemocline of meromictic Lake Cadagno (Switzerland)

Lake Cadagno is a meromictic lake in the Piora valley in the south of Switzerland characterized by a high salinity of the monimolimnion and a permanent chemocline at a depth between 9 and 14 m separating the aerobic epilimnion from the anaerobic, sulfidogenic hypolimnion (Peduzzi et al., 1993; Wagener et al. 1990). Due to the infiltration of water through dolomite rich in gypsum, the water chemistry of Lake Cadagno is dominated by inorganic sulfur compounds with high concentrations of sulfate and steep gradients of sulfide in the chemocline (Hanselmann and Hutter, 1998; Lehmann et al., 1998). A turbidity maximum in the chemocline is correlated with elevated numbers of bacteria (up to 107 cells ml-1) indicating that a bacterial community making use of these gradients is present (Tonolla et al., 1998, 1999).

In a previous study using in situ hybridization with 16S and 23S rRNA targeted oligonucleotide probes we demonstrated that the bacterial community in the chemocline of Lake Cadagno mainly consisted of Proteobacteria (Tonolla et al., 1998, 1999). Averaged over the whole chemocline, cells hybridizing with probes ALF1b, BET42a, GAM42a and SRB385 targeting members of the
-, -, - and - subdivision of Proteobacteria, respectively, accounted for 23, 17, 45 and 15% of the DAPI-stained bacteria (Tonolla et al., 1998, 1999). Phototrophic sulfur bacteria that belong to the -subdivision of Proteobacteria were most prominent with on average 33% of the bacteria (Fischer et al., 1996, Peduzzi et al., 1993). In situ hybridization identified all large-celled phototrophic sulfur bacteria as Chromatium okenii, while small-celled phototrophic sulfur bacteria consisted of four major populations forming a tight cluster with Amoebobacter purpureus and Lamprocystis roseopersicina (Tonolla et al., 1999). Small-celled phototrophic sulfur bacteria were usually found in aggregates, together with cells that hybridized with probe SRB385 targeting sulfate-reducing bacteria of the family In situ analysis of sulfate-reducing bacteria related to Desulfocapsa thiozymogenes 47

Desulfovibrionaceae (Tonolla et al., 1998, 1999). Since the populations of small-celled phototrophic sulfur bacteria displayed different distribution profiles in the chemocline indicating different ecophysiological adaptations (Tonolla et al., 1999), we were interested to see whether the associated sulfate-reducing bacteria also resembled different populations and whether these were associated with specific populations of phototrophic sulfur bacteria.

For this purpose, representative clones of 82 phylotypes of a 16S rRNA gene clone library from the chemocline of Lake Cadagno that was generated in E. coli and screened for phylotype distribution by restriction analysis in a previous study (Demarta et al., 1998), were analyzed by whole cell hybridization with Cy3-labeled probes SRB385 or SRB385Db (Rabus et al., 1996) to retrieve clones representing sulfate-reducing bacteria of the families Desulfovibrionaceae and Desulfobacteriaceae, respectively. Five-µl-samples of paraformaldehyde-fixed E. coli cultures spotted onto gelatin-coated slides were hybridized in the presence of non-labeled competitor probe with 20% formamide in hybridization buffer at 53°C for 2 h as described by Zarda et al. (1997). Following hybridization, the slides were washed in buffer without formamide (5 mM EDTA, 20 mM Tris (pH 7.0), 215 mM NaCl and 0.001% SDS) at 55°C for 20 min. and examined by epifluorescence microscopy (Tonolla et al., 1999). Thirteen clones hybridized to probe SRB385 and ten to SRB385Db. Since we were interested in sulfate-reducing bacteria associated with phototrophic sulfur bacteria, further analyses focused on clones hybridizing to probe SRB385. Eight clones with rDNA fragments showing distinct restriction patterns were selected, the fragments re-amplified and sequenced as described elsewhere (Tonolla et al., 1999). Sequence data were deposited in the EMBL/GenBank databases with accession numbers AJ389622 to AJ389629, respectively. The sequences were aligned initially with a subset of bacterial 16S rDNA sequences obtained from the Ribosomal Database Project (Maidak et al., 1997) using the CLUSTALW service at EBI (Higgins et al., 1994). Phylogenetic relationships were estimated using the Phylogeny Inference Package (PHYLIP version 3.573c). Kimura-2-Parameters evolutionary distances were calculated using the DNADIST program and phylogenetic tree was derived using the FITCH program with random order input of sequences and the global rearrangement option (Felsenstein, 1990). The absence of chimeras was verified submitting our sequences to the RDP program CHECK_CHIMERA (Maidak et al., 1997).

Comparative sequence analysis revealed the presence of two distinct clusters within the -subdivision of Proteobacteria (Fig. 2.1). Sequences of one cluster consisting of six clones were closely related to that of Desulfocapsa thiozymogenes DSM7269 with similarity values between 97.9 and 98.4%. The closest cultured relatives to the second cluster of two clones were Desulfofustis glycolicus DSM9705, Desulfocapsa thiozymogenes DSM7269, Desulfocapsa sulfoexigens DSM10523, and Desulforhopalus vacuolatus DSM9700 with similarity values between 92.6 and 93.1%. Similarity values of all clones to other sulfate-reducing bacteria that should be detectable by hybridization with probe SRB385 such as 48 Chapter 2 e.g. Desulfobulbus elongatus, Desulfobacter curvatus, Desulfuromonas pigra and Desulfovibrio sp. as well as to other phylogenetic groups were generally below 90%.

These results indicate a limited complexity of populations of sulfate-reducing bacteria detectable with probe SRB385. However, since PCR-based approaches for the analysis of microbial diversity in heterogeneous environments might be influenced by several constraints (see von Wintzingerode et al., 1997 for review), our results do not necessarily reflect the abundance of the target sequences in the original sample (Suzuki and Giovannoni, 1996). We therefore tried to confirm the relevance of the sequence data in the original sample by in situ hybridization. Based on comparative analysis of sequences retrieved and those of reference organisms, two oligonucleotide probes DSC213 (5’CCT CCC TGT ACG ATA GCT, pos. 213-230 according to the E. coli numbering (Brosius et al., 1980)) and DSC441 (5’ATT ACA CTT CTT CCC ATC C, pos. 441-459) were designed targeting the cluster of six clones. Probe DSC213 also targeted the closely related Desulfocapsa thiozymogenes DSM7269 (Fig. 2.1). A third probe SRB441 (5’CAT GCA CTT CTT TCC ACT T, pos. 441-459) was designed to specifically bind to sequences of the two other clones.

Sphingomonas sp. (AB021492) Thiomicrospira sp. (AF013972) Arcobacter sp. (L42994) Desulfovibrio profundus (U90726) Unidentified delta proteobacterium, strain BD1-2 (AB015515) Uniden ified epsilon proteobacterium, strain NKB13 (AB013265) Desulfobulbus elongatus (X95180) Sulfate-reducing bacterium R-PropA1 (AJ012591) Desulfobulbus elongatus (M34410) Desulforhopalus vacuolatus (L42613) Unidentified eubacterium, clone WH26 Uniden ified delta proteobacterium, strain JTB20 (AB015241) Desulfofustis glycolicus (X99707) Bacterium Adria icR16 associated with marine snow (F030774) Probe SRB385 Unidentified delta proteobacterium, strain BD7-15 (AB015588) Clone 141 (AJ389624) Probe SRB441 Clone 22 (AJ389622) Desulfocapsa sulfoexigens (Y13672) Bacterium WCHB1-67 from aquifer (AF050536) Clone 330 (AJ389627) Clone 282 Probes DSC213 (AJ389626) and DSC441 Clone 368 (AJ389629) Desulfocapsa thiozymogenes (X95181) Probe DSC213 Clone 348 (AJ389628) Probes DSC213 Clone 167 (AJ389625) and DSC441 Clone 113 (AJ389623) Desulforhabdus amnigenus (X83274) Synthrophus buswellii (X85131) Synthrophus gentianae (X85132) Desulfomonile tiedjei (M26635) Geobacter “chapelleii” (U41561) Pelobacter propionicus (X70954) Probe SRB385Db Pelobacter acetylenicus (X70955) Pelobacter carbinolicus (U23141) Desulfosarcina variabilis (M34407) Desulfosarcina variabilis (M26632) Desulfobacterium niacini (U51845) 0.01 Desulfobacterium vacuolatum (M34408) Desulfobacter curvatus (M34413) Probe SRB385

Figure 2.1 Neighbor-Joining tree based on the aligned sequences of selected clones from the 16S rRNA gene library of the chemocline of Lake Cadagno and of selected bacteria searched from the EMBL/GenBank databases. The distance scale indicates the expected number of changes per sequence position. Bars and probe designations indicate target groups of sulfate-reducing bacteria for specific oligonucleotide probes. In situ analysis of sulfate-reducing bacteria related to Desulfocapsa thiozymogenes 49

Probe specificity with reference to available 16S rRNA sequences was checked with the ARB program (Strunk and Ludwig, 1996) and in the EMBL/GenBank databases using FASTA (Pearson and Lipmann, 1988). Pure cultures of sulfate reducing bacteria such as Desulfotomaculum orientis DSM765, and Desulfovibrio desulfuricans DSM642, of bacteria from other phyla like C. okenii DSM169, C. vinosum DSM180, L. roseopersicina DSM229, A. purpureus DSM4197, A. roseus DSM235, Burkholderia cepacia DSM50181, Brevundimonas diminuta DSM1635, and Campylobacter jejuni DSM4688, and of water samples from Lake Cadagno were used to test probe specificity and to establish appropriate in situ hybridization conditions for the specific detection. The specificity of the hybridization was then adjusted by the addition of 30% (probes DSC213 and DSC441) and 5% (probe SRB441) formamide to the hybridization buffer and by a reduction of NaCl in the washing buffer to 124 and 762 mM, respectively (Zarda et al., 1997).

Aliquots (3 µl) of paraformaldehyde-fixed water samples (n=3) spotted onto gelatin-coated slides (Glöckner et al., 1996) were hybridized and concomitantly stained with DAPI according to Zarda et al. (1997). The analysis was performed in a top-to-bottom approach detecting initially members of the domain Bacteria (probe EUB338) (Amann et al., 1990), sulfate-reducing bacteria of the families Desulfovibrionaceae (probe SRB385) and Desulfobacteriaceae (probe SRB385Db) (Rabus et al., 1996), followed by different populations of sulfate-reducing bacteria within these families (Devereux et al., 1992; Manz et al., 1998) and finally our clusters with probes DSC213 and DSC441 as well as probe SRB441.

For the in situ analysis, water samples were obtained from the chemocline with a thin-layer pneumatic multi-syringe sampler on October 3, 1997 (Tonolla et al., 1998). The physicochemical parameters (temperature, conductivity, pH, dissolved oxygen and turbidity) measured during sampling with a Hydropolytester HPT-C profiler displayed the characteristic stratification profile of Lake Cadagno (Peduzzi et al. 1993; Tonolla et al., 1999). Although oxygen was depleted already at a depth of 9 m, the rapid increase in sulfide concentrations (Fig. 2.2a) determined photometrically (Tonolla et al., 1998) and the turbidity profile (data not shown) indicated the formation of a condensed chemocline at a depth between 11.5 and 14 m. The turbidity profile correlated well with the number of organisms detected by DAPI-staining which ranged between 17 ± 5 and 70 ± 15 x 105 cells ml-1 showing a maximum around a depth of 12.5 m (Fig. 2.2b). Averaged over the whole chemocline, approx. 47% of the DAPI-stained cells were detectable by in situ hybridization with probe EUB338, again showing a maximum of cells at a depth of 12.5 m (37 ± 8 x 105 cells ml-1) (Fig. 2.2b).

The vertical distribution profile of cells detected with probe SRB385 corresponded roughly to that of cells detected with probe SRB385Db, though at higher numbers. With 9 ± 4 and 5 ± 1 x 105 cells ml-1, respectively, numbers of cells detected with probe SRB385 and SRB385Db displayed a maximum again at a depth of 12.5 m (Fig. 2.2c). Averaged over the whole chemocline, approx. 75% of the cells detected with probe SRB385 represented only one morphotype and were obviously associated with 50 Chapter 2

agglomerates of small-celled phototrophic sulfur bacteria (Fig. 2.2d). Small-celled phototrophic sulfur bacteria could nicely be detected due to their comparatively large cell size and their pronounced autofluorescence (Fig. 2.3a). The remaining 25% of the cells detected with probe SRB385 were free or loosely attached to other cells and cell deb1is, which was similar to all cells detected with probe SRB385Db. In contrast to cells detected with probe SRB385, cells detected with probe SRB385Db represented many different morphotypes (Fig. 2.3b).

(mg 1-1) Number of cells (x 105 ml-1)

0 40 80 40 80 2 4 6 8 2 4 6 8 0.4 11.5

12.0

12.5 E'~ .:: Q. c-Cl) 13.0

13.5

14.0

Figure 2.2 Vertical distribution of chemical parameters and bacteria in the chemocline of Lake Cadagno at a depth between 11.5 m and 14 m; a, sulfide ( o ), and sulfate ( • ); b, total bacterial cells after DAPI staining (+ ) and cells detectable after in situ hybridization with probe EUB338 (~ ); c, cells detectable after in situ hybridization with probes SRB385Db (• ) and SRB385 (o); d, cells attached to aggregates of small-celled phototrophic bacteria and detectable after in situ hybridization with probe SRB38 ( ... ), and cells attached to aggregates of small-celled phototrophic bacteria and detectable after in situ hybridization with probes DSC213 and DSC441 ( ). Numbers detemiined in forty microscopic fields of tluee samples are expressed as mean± standard eiwr.

Averaged over the whole chemocline, probes SRB385 and SRB385Db allowed us to detect 24% (15 and 9%, respectively) of the DAPI-stained cells which shows that sulfate-reducing bacteda make up a significant pait of the bactedal population in the chemocline of Lake Cadagno. About absolute numbers, however, one can only speculate since the probes used might also detect non-sulfate-

reducing members of the o-subdivision of Proteobacteria as well as several members of the a- subdivision of the Proteobacteria (Zai·da et al., 1997). The ve1tical distiibution profiles of sulfate- reducing bacte1ia detected with probes SRB385 and SRB385Db are similai· to those of phototi·ophic sulfur bacte1ia that make up on average 33% of the DAPI-stained bacte1ia in the chemocline (Tonolla et al. , 1998, 1999). The high abundance of both sulfate-reducing bacteria and phototrophic sulfur bacteria suppo1ts assumptions on the dominance of these groups ofbacteda in the chemocline of lakes such as Lake Cadagno (Guenero et al., 1978, 1985; Ove1mann et al., 1991; Pedr6s-Ali6 et al., 1983). In situ analysis of sulfate-reducing bacteria related to Desulfocapsa thiozymogenes 51

Figure 2.3 In situ detection of sulfate-reducing bacteria with Cy3-labeled probes SRB385 targeting members of the family Desulfovibrionaceae (a), SRB385Db targeting members of the family Desulfobacteriaceae (b), a combination of probes DSC213 and DSC441 targeting a cluster of six clones of a 16S rRNA gene clone library from the chemocline of Lake Cadagno and D. thiozymogenes (c), and SRB441 targeting a second cluster with two clones of the same 16S rRNA gene clone library (d). Cells in the background represent mainly small-celled phototrophic sulfur bacteria exhibiting strong autofluorescent signals. Arrows show hybridizing cells. Bar represents 10 µm. 52 Chapter 2

Only very few of the free or loosely attached cells did hybridize to probes commonly used to analyze populations of sulfate-reducing bacteria (Devereux et al., 1992; Manz et al., 1998). None of the associated cells hybridized to these probes (results not shown). A combination of our probes DSC213 and DSC441 targeting a cluster of six clones and the closely related Desulfocapsa thiozymogenes DSM7269, however, only detected cells associated to small-celled phototrophic sulfur bacteria (Fig. 2.3c). A vertical distribution profile of numbers of associated cells was obtained with statistically not significantly different values from 1 ± 1 to 8 ± 2 x 105 cells ml-1 compared to those obtained with probe SRB385 (Fig. 2.2d). Probe SRB441 designed to specifically bind to sequences of two other clones only hybridized to loosely attached or free cells (2 ± 2 to 25 ± 11 x 104 cells ml-1) (Fig. 2.2e, 2.3d). Averaged over the whole chemocline, numbers of cells detected with probes DSC213, DSC441 and SRB441 comprise about 64% of those obtained by hybridization with probe SRB385. This percentage indicates that numbers of cells detected with probe SRB385 might be too high due to the detection of non-sulfate-reducing members of the -subdivision of Proteobacteria and members of the
-subdivision of the Proteobacteria. Another reason might be that the number of clones analyzed in our library was not sufficient to obtain of all bacteria detectable with probe SRB385. Nevertheless, our results demonstrate that a numerically prominent population of bacteria closely related to D. thiozymogenes and therefore most likely sulfate-reducing bacteria is associated with agglomerates of small-celled phototrophic sulfur bacteria.

Although the phylogenetic relationship of our clones to the closest cultured relative, D. thiozymogenes DSM7269, does not necessarily reflect physiological relationships, physiological traits of D. thiozymogenes might be used to speculate about the nature of the association. D. thiozymogenes was described as sulfate-reducing bacterium growing under strictly anaerobic conditions by disproportionation of thiosulfate, sulfite or elemental sulfur to sulfate and sulfide. It was also able to grow by the oxidation of a limited range of organic compounds coupled to sulfate reduction (Janssen et al., 1996). Similar to observations with Desulfocapsa sulfoexigens DSM10523 (Finster et al., 1998) and Desulfobulbus propionicus DSM2032 (Lovely and Phillips, 1994), disproportionation of sulfur to sulfate and sulfide was enhanced in the presence of sulfide scavengers such as amorphous ferric hydroxide (Janssen et al., 1996), FeCO3 or MnO2 generally resulting in the formation of sulfate along with iron and manganese sulfides (Lovely and Phillips, 1993; Thamdrup et al., 1993). In the chemocline of Lake Cadagno, small-celled phototrophic sulfur bacteria that oxidize sulfide to sulfur and further to sulfate, might act as alternative sulfide scavengers to ferric and manganic oxides creating a sink for sulfide produced by sulfur disproportionation of the sulfate-reducing bacteria represented by our clones. Such speculations, however, need further investigations and can probably be supported if bacteria represented by our clones can be obtained in pure culture using the conditions for the isolation of D. thiozymogenes (Janssen et al., 1996) or D. sulfoexigens (Finster et al., 1998). In situ analysis of sulfate-reducing bacteria related to Desulfocapsa thiozymogenes 53

Acknowledgements This work was supported by grants from the Swiss National Science Foundation (NF31-46855.96), and the canton of Ticino (Switzerland). The authors are indebted to N. Ruggeri and A. Caminada for technical support. References

Amann R. I., Binder B. J., Olsen R. J., Chisholm S. W., Devereux R. and Stahl D. A. (1990) Combination of 16S rRNA-targeted oligonucleotide probes with flow cytometry for analyzing mixed microbial populations. Appl. Environ. Microbiol. 56: 1919-1925. Brosius J., Dull T. J., Sleeter D. and Noller H. F. (1981). Gene organization and primary structure of a ribosomal RNA operon from Escherichia coli. J. Mol. Biol. 148: 107-127. Demarta A., Tonolla M., Caminda A.-P., Ruggeri N. and Peduzzi R. (1998) Phylogenetic diversity of the bacterial community from the anoxic layer of the meromictic Lake Cadagno. Doc. Ist. Ital. Idrobiol. 63: 19-30.

Devereux R., Kane M. D., Winfrey J. and Stahl D. A. (1992) Genus- and group-specific hybridization probes for determinative and environmental studies of sulfate-reducing bacteria. System. Appl. Microbiol. 15: 601-609. Felsenstein J. (1990). PHILIP manual version 3.3. University of California, Berkeley. Finster K., Liesack W. and Thamdrup B. (1998) Elemental sulfur and thiosulfate disproportionation by Desulfocapsa sulfoexigens sp. nov., a new anaerobic bacterium isolated from marine surface sediment. Appl. Environ. Microbiol. 64: 119-125. Fischer C., Wiggli M., Schanz F., Hanselmann K. W. and Bachofen R. (1996) Light environment and synthesis of bacteriochlorophyll by populations of Chromatium okenii under natural environmental conditions. FEMS Microbiol. Ecol. 21: 1-9.

Glöckner F. O., Amann R. I., Alfreider A., Pernthaler J., Psenner R., Trebesius K. and Schleifer K.-H. (1996) An optimized in situ hybridization protocol for planktonic bacteria. System. Appl. Microbiol. 19: 403-406.

Guerrero R., Abella C. and Miracle M. R. (1978) Spatial and temporal distribution of bacteria in a meromictic karsic lake basin; relationships with physicochemical parameters and zooplankton. Verh. Internat. Verein. Limnol. 29: 2264-2271.

Guerrero R., Montesinos E., Pedrós-Alió C., Esteve I., Mas J., van Gemerden H., Hofman P. A. G. and Bakker J. F. (1985) Phototrophic sulfur bacteria in two Spanish Lakes: vertical distribution and limiting factors. Limnol. Oceanogr. 30: 919-931.

Hanselmann K. and Hutter R. (1998) Geomicrobiological coupling of sulfur and iron cycling in anoxic sediments of a meromictic lake: sulfate reduction and sulfide sources and sinks in Lake Cadagno. Doc. Ist. Ital. Idrobiol. 63: 85-98.

Higgins D., Thompson J., Gibson T., Thompson J. D., Higgins D. G. and Gibson T. J. (1994) CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22: 4673-4680. Janssen P. H., Schuhmann A., Bak F. and Liesack W. (1996) Disproportionation of inorganic sulfur compounds by the sulfate-reducing bacterium Desulfocapsa thiozymogenes gen. nov., sp. nov. Arch. Microbiol. 166: 184-192. 54 Chapter 2

Lehmann C., Luehty L. and Bachofen R. (1998) Tools for the evaluation of sources and sinks of sulfide in Lake Cadagno. Doc. Ist. Ital. Idrobiol. 63: 99-104.

Lovely D. R. and Phillips E. J. P. (1994) Novel processes for anaerobic sulfate reduction from elemental sulfur by sulfate-reducing bacteria. Appl. Environ. Microbiol. 60: 2394-2399. Maidak B. L., Olsen G. J., Larsen N., Overbeek R., McCaughey M. J. and Woese C. R. (1997) The RDP (Ribosomal Database Project). Nucleic Acids Res. 25: 109-111. Manz W., Eisenbrecher M., Neu T. R. and Szewzyk U. (1998) Abundance and spatial organization of Gram-negative sulfate-reducing bacteria in activated sludge investigated by in situ probing with specific 16S rRNA targeted oligonucleotides. FEMS Microbiol. Ecol. 25: 43-61. Overmann J., Beatty T., Hall K. J., Pfennig N. and Northcote T. G. (1991) Characterization of a dense, purple sulfur bacterial layer in a meromictic lake. Limnol. Oceanogr. 36: 846-859.

Pearson W. R. and Lipman D. J. (1988) Improved tools for biological sequence comparison. Proc. Natl. Acad. Sci. USA 85: 2444-2448.

Pedrós-Alió C., Montesinos E. and Guerrero R. (1983) Factors determining annual changes in bacterial photosynthetic pigments in holomictic Lake Cisó, Spain. Appl. Environ. Microbiol. 46: 999- 1006.

Peduzzi R., Demarta A. and Tonolla M. (1993) Dynamics of the autochthonous and contaminant bacterial colonization of lakes (Lake of Cadagno and Lake of Lugano as model systems). Stud. Environ. Sci. 55: 323-335.

Rabus R., Fukui M., Wilkes H. and Widdel F. (1996) Degradative capacities and 16S rRNA- targeted whole-cell hybridization of sulfate-reducing bacteria in an anaerobic enrichment culture utilizing alkylbenzenes from crude oil. Appl. Environ. Microbiol. 62: 3605-3613. Strunk O. and Ludwig W. (1996) ARB. Computer program distributed by the Technical University Munich, Munich, Germany.

Suzuki M. T. and Giovannoni S. J. (1996) Bias caused by template annealing in the amplification of mixtures of 16S rRNA genes by PCR. Appl. Environ. Microbiol. 62: 625-630. Thamdrup B., Finster K., Hansen J.W. and Bak F. (1993) Bacterial disproportionation of elemental sulfur coupled to chemical reduction of iron or manganese. Appl. Environ. Microbiol. 59: 101-108. Tonolla M., Demarta A., Hahn D. and Peduzzi R. (1998) Microscopic and molecular in situ characterization of bacterial populations in the meromictic Lake Cadagno. Doc. Ist. Ital. Idrobiol. 63: 31-44.

Tonolla M., Demarta A., Peduzzi R. and Hahn D. (1999) In situ analysis of phototrophic sulfur bacteria in the chemocline of meromictic Lake Cadagno (Switzerland). Appl. Environ. Microbiol. 65: 1325-1330. von Wintzingerode F., Göbel U. B. and Stackebrandt E. (1997) Determination of microbial diversity in environmental samples: pitfalls of PCR-based rRNA analysis. FEMS Microbiol. Rev. 21: 213-229. Wagener S., Schulz S. and Hanselmann K. (1990) Abundance and distribution of anaerobic protozoa and their contribution to methane production in Lake Cadagno (Switzerland). FEMS Microbiol. Ecol. 74: 39-48.

Zarda B., Hahn D., Chatzinotas A., Schönhuber W., Neef A., Amann R. I. and Zeyer J. (1997) Analysis of bacterial community structure in bulk soil by in situ hybridization. Arch. Microbiol. 168: 185-192.

Chapter 3

Spatio-temporal distribution of phototrophic sulfur bacteria in the chemocline of meromictic Lake Cadagno (Switzerland)

Mauro Tonolla1, Sandro Peduzzi1,2, Dittmar Hahn2*, Raffaele Peduzzi1

1Cantonal Institute of Microbiology, Microbial Ecology (University of Geneva), Via Giuseppe Buffi 6, CH-6904 Lugano, Switzerland

2Dept. of Chemical Engineering, New Jersey Institute of Technology (NJIT), and Dept. of Biological Sciences, Rutgers University, 101 Warren Street, Smith Hall 135, Newark, NJ, USA

FEMS Microbiology Ecology, 43: 89-98 (2002) 58 Chapter 3

3.1 Abstract

In situ hybridization was used to study the spatio-temporal distribution of phototrophic sulfur bacteria in the permanent chemocline of meromictic Lake Cadagno, Switzerland. At all four sampling times during the year the numerically most important phototrophic sulfur bacteria in the chemocline were small-celled purple sulfur bacteria of two yet uncultured populations designated D and F. Other small- celled purple sulfur bacteria (Amoebobacter purpureus and Lamprocystis roseopersicina) were found in numbers about one order of magnitude lower. These numbers were similar to those of large-celled purple sulfur bacteria (Chromatium okenii) and green sulfur bacteria that almost entirely consisted of Chlorobium phaeobacteroides. In March and June when low light intensities reached the chemocline, cell densities of all populations, with the exception of L. roseopersicina, were about one order of magnitude lower than in August and October when light intensities were much higher. Most populations were evenly distributed throughout the whole chemocline during March and June, while in August and October a microstratification of populations was detected suggesting specific eco- physiological adaptations of different populations of phototrophic sulfur bacteria to the steep physico- chemical gradients in the chemocline of Lake Cadagno.

3.2 Introduction

Studies on the ecology of microorganisms are often complicated by the heterogeneous and dynamic nature of their habitat together with the small and discontinuous size distribution of microhabitats. In this regard, water columns of stratified lakes offer defined physicochemical conditions or unidirectional gradients in depth intervals ranging from cm to m (Sorokin, 1970). As such, meromictic lakes are interesting model systems for research on bacterioplankton because a number of different physiological groups of bacteria substitute each other along the vertical gradient of light, oxygen and sulfide (Guerrero et al., 1985; Jørgensen et al., 1979; Overmann et al. 1991). Lake Cadagno in Switzerland represents such a model system. The water body of this lake is structured in three distinct layers, the oxic mixolimnion, a narrow chemocline and the anoxic monimolimnion. The chemocline is permanent and stabilized by density differences of salt-rich water constantly supplied by subaquatic springs to the monimolimnion and of electrolyte-poor surface water feeding the mixolimnion (Del Don et al., 1991). High concentrations of sulfate and steep gradients of sulfide in the chemocline (Hanselmann et al., 1998; Lehmann et al., 1998) support the growth of elevated numbers of bacteria (up to 107 cells ml-1) indicating that a bacterial community making use of these gradients is present (Tonolla et al., 1998, 1999). Molecular techniques that permit analysis of microbial community structure unaffected by the limitations of culturability showed that almost all bacteria belonged to the Proteobacteria (Tonolla et al., 1998, 1999) with numbers for the
-, -, - and -subdivision of Proteobacteria, respectively, accounting for 23, 17, 45 and 15% of the total number of bacteria Spatio-temporal distribution of phototrophic sulfur bacteria 59

(Tonolla et al., 1998, 1999). Purple sulfur bacteria were most prominent numerically with on average 33% of all bacteria (Fischer et al., 1996; Peduzzi et al., 1993). All large-celled purple sulfur bacteria were identified as Chromatium okenii, while small-celled purple sulfur bacteria consisted of four major populations forming a tight cluster with Amoebobacter purpureus (recently reclassified as Lamprocystis purpurea Imhoff, 2001) and Lamprocystis roseopersicina (Tonolla et al., 1999). These small-celled purple sulfur bacteria were usually found in aggregates, together with sulfate-reducing bacteria of the family Desulfovibrionaceae (Tonolla et al., 1998, 1999). The populations of small-celled purple sulfur bacteria displayed different distribution profiles in the chemocline of Lake Cadagno indicating different eco-physiological adaptations (Pedrós-Alió et al., 1983; Tonolla et al., 1999; van Gemerden and Mas, 1995). Since most of these bacteria have not been obtained in pure culture yet, the aim of this study was to gather information on their spatial and temporal distributions in the chemocline of Lake Cadagno and to analyze their interrelationships with environmental factors (Pedrós-Alió et al., 1983; van Gemerden and Mas, 1995). The analysis was based on in situ hybridization using rRNA targeted, Cy3 labeled oligonucleotide probes. In addition to specific populations of purple sulfur bacteria (C. okenii, A. purpureus, L. roseopersicina, and two yet uncultured and uncharacterized populations D and F) (Tonolla et al., 1999), green sulfur bacteria were analyzed using a published (Tuschak et al., 1999) and a newly designed probe specifically targeting a sequence retrieved from a 16S rRNA gene clone library from the chemocline of Lake Cadagno (Demarta et al., 1998).

3.3. Material and Methods

3.3.1. Site description, physical analyses and sampling

Lake Cadagno is an alpine lake located 1923 m above sea level in the south of Switzerland (46°33' N, 8°43'E) in the catchment area of a dolomite vein rich in gypsum (Piora-Mulde). The lake has a surface area of 26 x 105 m2 and a maximum depth of 21 m. Due to the infiltration of water through the dolomite vein, Lake Cadagno is a meromictic lake characterized by a high salinity of the monimolimnion and a permanent chemocline in a depth between 9 and 14 m (Del Don et al., 2001; Wagener et al., 1990). Samples were taken from the chemocline over the deepest site in the center of the lake (21 m) in October 1998, and in March, June and August 1999. The chemocline and the bacterial plume in Lake Cadagno were located at each sampling date using temperature, conductivity, pH, dissolved oxygen, turbidity and redox potential measurements with a YSI 6000 profiler (Yellow Springs Inc., Yellow Springs, OH, USA) (Tonolla et al., 1999, 2000). In addition, PAR-light transmission conditions were determined down to the chemocline in steps of 0.1 m using 2 LI-193SA spherical quantum sensors and a LI-COR 1000 datalogger (LI-COR Ltd., Lincoln, NE, USA). The latter measurements were used to calculate vertical attenuation coefficients (Kd) of photosynthetically available radiation (Dubinsky, 1980) for the mixolimnion and the bacterial layer. The YSI 6000 60 Chapter 3 profiler and LI-COR sensors were fixed at the lowest part of a thin-layer pneumatic multi-syringe sampler (University of Zurich, Institute of Microbiology, Switzerland) that was used after detection of the chemocline to take 20 samples of 100 ml simultaneously each over a total depth of 2 m, yielding in a depth resolution of 10 cm between each sample (Bosshard, 2000a, b; Tonolla et al., 1999, 2000).

3.3.2. Chemical analysis

From these samples, 11-ml-subsamples were immediately transferred to screw capped tubes containing 0.8 ml of a 4 % zinc acetate solution. These were stored on ice and used to determine sulfide concentrations by colorimetric analysis (Gilboa-Garber, 1971) using the Spectroquant® kit of Merck (Switzerland) (Tonolla et al., 1999, 2000). Additional 10 ml were immediately filtered through 0.22 µm polyethersulfone membrane filters (GyroDisc-PES25, Orange Scientific, Waterloo, Belgium) into plastic tubes containing 100 µl of 65% nitric acid solution (Fluka, Buchs, Switzerland). These samples were further analyzed for dissolved iron by graphite furnace and air acetylene flame atomic absorption with a SpectrAA-800 instrument (Varian, Melbourne, Australia). Ammonium and sulfate concentrations were measured by isocratic ion chromatography with suppressed conductivity detection with a Dionex DX-500 ion chromatograph (Dionex, Olten, Switzerland). For the determination of ammonium, a CG-12 pre-column, a CS-12 column, a CSRS-1 suppressor, 20 mM methanesulfonic acid as an eluent at a flow of 1.0 ml min-1 was used, for that of sulfate a AG-14 pre-column, a AS-14 column, a ASRS Ultra suppressor, and a mixture of 3.5 mM Na-carbonate and 1.0 mM Na-bicarbonate as eluent were used at a flow of 0.6 ml min-1 (DEV, 2000).

3.3.3. Microbial analysis

For the microbial analysis of the chemocline, 15-ml-subsamples of water obtained with the multi-syringe sampler were filtered immediately after sampling through 0.22 µm polycarbonate membrane filters (25 mm diameter; Millipore, Volketswil, Switzerland) (Glöckner et al., 1996). Bacteria were fixed by overlaying the filters with 4% paraformaldehyde in phosphate buffered saline (PBS; 0.13 M NaCl, 7 mM

Na2HPO4, 3 mM NaH2PO4, pH 7.2) for 30 min. at room temperature (Amann et al., 1990). The filters were subsequently rinsed twice with PBS by vacuum filtration and transferred into plastic bags with 1 ml of 50% ethanol in PBS. In sealed bags, the bacterioplankton was released from filters and resuspended by slightly massing the filter with thumb and forefinger (ISO, 26). The complete release of the bacteria from filters was checked microscopically after DAPI staining. Resuspended bacterial cells were than transferred into Eppendorf tubes and stored at -20°C until further use (Amann et al., 1990; Tonolla et al., 1999). Aliquots (1 µl) of the samples were spotted onto gelatin-coated slides (0.1% gelatin, 0.01%

KCr(SO4)2). The preparations were allowed to air-dry and subsequently dehydrated in 50, 80 and 96% Spatio-temporal distribution of phototrophic sulfur bacteria 61 of ethanol for 3 min each (Amann et al., 1990). The analysis of purple and green sulfur bacteria in the chemocline samples from Lake Cadagno was based on in situ hybridization using rRNA targeted, Cy3 labeled oligonucleotide probes (Table 3.1). In addition to previously published probes GAM42a (Manz et al., 1992), Cmok453, Apur453, Laro453, S453D, S453F (Tonolla et al., 1999) and GSB532 (Tischak et al., 1999), an additional probe (CHLP441) was designed using the ARB program (Strunk and Ludwig, 1996). Probe CHLP441 specifically detected clone 366 of a 16S rRNA gene clone library from the chemocline of Lake Cadagno (Demarta et al., 1998) that had a sequence identical to that of Chlorobium phaeobacteroides (Accession Number Y08104). Probe specificity was checked with reference to available 16S rRNA sequences with the ARB program and in the EMBL/GenBank databases using FASTA (Pearson and Lipmann, 1988).

Table 3.1 Oligonucleotide probes Probe Target Sequence (5’ =>3’) Reference (% formamide in hybridization buffer) GAM42a γ-subdivision of Proteobacteria GCCTTCCCACATCGTTT (10%) [27] 23S rRNA, pos. 1027-1043 Cmok453 Chromatium okenii (DSM169) AGCCGATGGGTATTAACCACGAGGTT (20%) [9] 16S rRNA, pos. 453-479 Apur453 Amoebobacter purpureus (DSM4197) TCGCCCAGGGTATTATCCCAAACGAC (40%) [9] 16S rRNA, pos. 453-479 Laro453 Lamprocystis roseopersicina (DSM229) CATTCCAGGGTATTAACCCAAAATGC (40%) [9] 16S rRNA, pos. 453-479 S453D Clone 261 from Lago Cadagno CAGCCCAGGGTATTAACCCAAGCCGC (30%) [9] 16S rRNA, pos. 453-479 S453F Clone 371 from Lago Cadagno CCCTCATGGGTATTARCCACAAGGCG (35%) [9] 16S rRNA, pos. 453-479 GSB532 Green sulfur bacteria TGCCACCCCTGTATC (10%) [15] 16S rRNA, pos. 532-547 Chlp441 Chlorobium phaeobacteroides AAATCGGGATATTCTTCCTCCAC (40%) This study 16S rRNA, pos. 441-464

Hybridizations were performed in 9 µl of hybridization buffer (0.9 M NaCl, 20 mM Tris/HCl, 5 mM EDTA, 0.01% SDS; pH 7.2) in the presence of 10 to 40% formamide depending on the probe (Table 1), 1 µl of the probe (25 ng µl-1), and 1 µl of a solution of DAPI (200 ng µl-1) at 46°C for 2 h (Zarda et al., 1997). After hybridization, the slides were washed in buffer containing 20 mM Tris/HCl, pH 7.2, 10 mM EDTA, 0.01% SDS and either 440, 308, 102, 80 or 56 mM NaCl depending on the formamide concentration during hybridization (10, 20, 30, 35, and 40%, respectively) for 15 min at 48°C, subsequently rinsed with distilled water, and air-dried. The slides were mounted with Citifluor AF1 immersion oil solution (Citifluor Ltd., London, UK) and examined with a Zeiss Axiolab microscope (Zeiss, Oberkochen, Germany) fitted for epifluorescence microscopy with a high-pressure mercury bulb and filter sets F31 (AHF Analysentechnik, Tübingen, Germany; D360/40, 400DCLP, D460/50, for DAPI detection) and F41 (AHF Analysentechnik; HQ535/50, Q565LP, HQ610/75, for Cy3 detection), respectively. Microorganisms were counted at 1000 x magnification in 40 fields covering an area of 0.01 mm2 each (Fischer et al., 1995). Numbers were expressed as mean ± standard error. 62 Chapter 3

Biovolumes of hybridized bacterial cells were analyzed on images captured with a charge-coupled device camera (CF 8/1 FMC, Kappa, Gleichen, Germany) connected to a Zeiss Axiolab epifluorescence microscope (Zeiss, Oberkochen, Germany) using the Q500MC Image Processing and Analysis System (Leica Cambridge Ltd., Cambridge, UK). For each value, between 30 and 300 cells were analyzed. Their volume was calculated according to: 4 Vab
2 3 where V is the cell volume and a and b are the major and the minor axes, respectively, of the best fitting ellipsoid (Ramsing et al., 1996). After determination of a mean cell biovolume, the total biovolume for microbial populations was determined using cell numbers obtained through visual counting. This was converted into biomass using the calibration factor of 310 fg C µm-3 (Fry, 1990).

3.4 Results

3.4.1. Analysis of physico-chemical conditions

The chemocline of Lake Cadagno was located at a depth between 11 and 13 m at all sampling times, except for March when it was found at a depth between 12 and 14 m. Basic physico-chemical conditions were similar at all sampling times with high conductivity and sulfate values throughout the whole chemocline, low and rapidly declining oxygen concentrations and subsequently steeply increasing ammonium and sulfide concentrations (Fig. 3.1). Turbidity and light intensity profiles, however, differed between sampling times. Turbidity was high in October (approx. 57 FTU) indicating the presence of a well-developed plume of microorganisms. In March, a very low turbidity (<8 FTU) was measured, that slowly increased from June to August to values similar to that found in October (Fig. 3.1). Since the lake was covered by ice and snow (2 m) at the sampling in March, light reaching the chemocline was of much lower intensity than at the other sampling times (Fig. 3.1). After melting of the ice cover in June, about 10-fold higher light intensities reached the chemocline. Light intensity values, however, generally decreased steeply with depth (Fig. 3.1, Table 3.2). In contrast to March and June, the vertical attenuation coefficient (Kd) of photosynthetically available radiation was high in August and October indicating large absorption in the bacterial plume (Table 3.2). Kd values in the mixolimnion were low for both August and October samplings indicating good light transmission (Table 3.2). Light transmission through the mixolimnion was much lower in March as indicated by a higher Kd value. At this sampling time a Kd value of 2.46 m-1 in the bacterial layer suggested smaller microbial densities than in October or August (Table 3.2). Spatio-temporal distribution ofphototroph ic sulfur bacteria 63

0 Conductivity (p.S cm-1) O Oxygen (mg 1-1) O Sulfate (mg i-1) 0 100 200 300 0.01 0.1 10 0 0.2 0.4 0.6 0.8 0 50 100 150 11

12

13 12

13

~ .c 14 11 a<> 0

12

13 11

12

13 0 20 40 60 0 0.4 0.8 0 0 1 0.2 0 4 8 • Turbidity (FTU) •Ammonium (mg 1-1) • Diss. iron (mg 1-1) • Sulfide (mg i-1)

Figure 3.1 Physico-chemical characteristics of the chemocline of Lake Cadagno at the samplings in October 1998, March 1999, June 1999, and August 1999.

Table 3.2 Vertical attenuation coefficient of photosynthetically available radiation Kd (PAR), calculated for the mixolimnion Kd (PAR, a) and the bacterial layer Kd (PAR, b) and scalar iffadiance at the upper border of the bacterial layer (z1) Eo (PAR, 2 1 z1) calculated for a normalized sUlface radiation of 1500 ~tE m- s- .

Sampling Kd(PAR,a) Kd(PAR, b) Sampling depth z1 Eo(PAR, z1) [m-11 [m-11 [ml (µE m-2s-11 Octobe1· 1998 0.38 311 11.4 42

March 1999 0.61 2.46 13.1 03

June 1999 0.57 2.14 11.4 22

August 1999 0.38 6.66 11.6 5.8 64 Chapter3

3.4.2. Microbial analysis

Enumeration of bacte1ia after DAPI-staining or in situ hybridization with specific probes revealed large shifts in their spatio-temporal distiibution. Numbers of DAPI-stained bacteria generally followed the turbidity profiles with maximum numbers obtained in October and August at a depth around 12 m (Fig. 3.2). In March and June, values were about one order of magnitude lower. Cells detected with probe GAM42a targeting members of the y-subdivision of Proteobacteria and thus also detecting pmple sulfur bacte1ia accounted generally for about 34% of the DAPI-stained bacteria. Their distribution profile was similar to that of the DAPI-stained cells (Fig. 3 .2). The majority of these cells were detected with probes S453D and S453F targeting yet uncultmed small-celled pmple sulfur bacteria (Fig. 3.2). Probes targeting C. okenii (Cmok453), A. p u.rpureus (Apm453), L. roseopersicina (Laro453), or green sulfur bacte1ia (GSB532, CHU41) generally detected numbers that were about one order of magnitude lower (Fig. 3.3). Populations comprising A. p u.rpureus exhibited similar distiibution profiles as population F with high number in October and August, but much lower numbers in March and June (Fig. 3.3).

ADAPI B. GAM42a C. S453D D.S453F

October 1998 October· 1998

12

March l999 March l999

13

,,.... 8 '-' 14 .= 11 Q. June 1999 June 1999 Q"' 12

13 11 Augustl999 August l999 1r---t..._-. 12

13 2 6 10 2 3 0.5 1.5 25 0.2 0.6 1.4

Number of cells (x 1Q6 m1-1)

Figure 3.2 Number of cells stained with DAPI (cohunn A) or hybridizing to probes GAM42a (cohunn B), S453D (column C) or S453F (cohunn D), respectively, in chemocline samples from Lake Cadagno from October 1998, March 1999, June 1999, and August 1999. Spatio-temporal distribution ofphototrophic sulfur bacteria 65

The other populations, however, displayed different seasonal distributions. Significant populations of C. okenii were only detected in October 1998, but not the following year. Populations of green sulfur bacteria that were only slightly higher than those for Ch. phaeobacteroides at all sampling times were detected in high numbers in August 1999 only (Fig. 3.3). In March, green sulfur bacteria were not detected, but they were present in June and October though in relatively small numbers (Fig. 3.3). In contrast to all other populations, populations comp1ising L. roseopersicina were found at all samplings in the same order of magnitude, even though numbers were smaller in March and June than in October and August (Fig. 3.3).

AApur453 B. Laro453 C. Cmok453 D. CIH.A41 or GSB532 11 October· 1998 October· 1998 October· 1998

12

13 12 l\'Jru:ch 1999 Marchl999

13

,-.. !. 14 .= 11 Q. June 1999 June 1999 June 1999 Q"'

12

13 11 August 1999 August 1999 August 1999

12

13 0.5 15 25 0.1 0.3 0.5 0.2 0.6 1.0 L4 2 4 6 8 Nwnber of cells (x HP m1-1)

Figure 3.3 Number of cells hybridizing to probes Apur453 (cohunn A), Laro453 (cohunn B), Cmok453 (column C) or CHIA41 and GSB532 (cohunn D), respectively, in chemocline samples from Lake Cadagno from October 1998, March 1999, June 1999, and August 1999.

Determination of biovolumes within the phototrophic sulfur bacteria confnmed the differentiation

3 1 3 between large-celled (55.8 ± 3.6 gm cell- ) and small-celled (between 4.7 ± 0.3 and 7.6 ± 0.5 ~tm cell-

1 in October) purple sulfin· bacte1ia, and the comparably much smaller volume of the green sulfin· 3 1 bacteria (0.8 ± 0.1 gm cell- ). Within the small-celled pmple sulfur bacte1ia, populations detected with 66 Chapter 3 probes Apur453 and Laro453 were slightly larger with biovolumes (average of all samplings) of 8.65 ± 0.55 and 8.45 ± 0.65 µm3 cell-1, respectively, than cells detected with S453D and S453F (7.82 ± 0.37 and 6.77 ± 0.35 µm3 cell-1, respectively). Most of these populations showed only small seasonal changes in biovolumes. Cells detected with probe Laro453, however, almost doubled in volume in March and June compared to October samples.

Total biomass of phototrophic sulfur bacteria averaged over the whole chemocline increased between March and August by one order of magnitude from 6.33 to 61.37 mg C ml-1. In March, June and August, cells detected with probe S453D (population D) contributed most to the biomass accounting for 67, 58 and 62% of the biomass, respectively. At these times, population F contributed between 18 and 30% of the biomass, while the remaining populations accounted for about 10% (A. purpureus) or less (Ch. phaeobacteroides 0-1%, L. roseopersicina 1-6%, C. okenii 0%). In October, population F was most prominent with 41% of the biomass, followed by population D with 28%, C. okenii with 16% and A. purpureus with 13%. Due to their small number and size, cells detected with probe CHLP441 never constituted an important part of the bacterial biomass, always accounting for less than 1 % of the total biomass averaged over the whole chemocline. Fine scale analysis in 10-cm-steps through the chemocline displayed differences in spatial and seasonal distribution of phototrophic sulfur bacteria in the chemocline (Table 3.3). In March and June when cell densities were low, most populations were relatively evenly distributed throughout the whole chemocline. At these times, biomass of phototrophic sulfur bacteria was mainly represented by that of population D (40-80%). Population F and A. purpureus generally accounted for the remaining biomass though biomass of L. roseopersicina was detectable at lower depths (Table 3.3). C. okenii and green sulfur bacteria were not present in significant amounts. Green sulfur bacteria were detectable troughout the chemocline in June, August and October generally in small percentages (usually 1-2%, occasionally up to 7% of the biomass of phototrophic sulfur bacteria) (Table 3.3). In August a clear microstratification of phototrophic sulfur bacteria was detected with A. purpureus making up 100% of the phototrophic sulfur bacteria at the upper border of the chemocline at a depth of 11 m, followed by 100% of L. roseopersicina at a depth of 11.1 m, and 93% of population F at a depth of 11.4 m. The remaining portion of the chemocline down to a depth of 13 m was then dominated by population D. In August, biomass of C. okenii was not present in significant amounts. In October, however, biomass of C. okenii made up a large portion of the biomass in the upper part of the chemocline (36% at 11.5 m), together with populations D and F, and to a lesser part A. purpureus (Table 3.3). Spatio-temporal distribution of phototrophic sulfur bacteria 67

Table 3 Percentage of biomass of phototrophic sulfur bacteria in the chemocline of Lake Cadagno

October 1998

Depth [m] Biomass [mg C l-1 ]* Percentage of biomass [% ] detected with probes Apur453 Cmok453 S453D Laro453 S453F CHLP441 11.0 0 33 22 21 0 0 57 0 11 1 0 56 22 6 3 0 68 1 11.3 0 97 7 6 12 1 73 2 11.4 1 30 20 15 17 0 48 0 11.5 1 70 24 36 10 1 28 1 11.6 2 40 14 14 43 127 1 11.7 6 80 4 28 53 014 0 11.8 2 50 13 25 41 0 20 1 11.9 2 70 10 13 26 2 49 0 12.0 1 10 23 10 20 4 42 1 12.1 1 50 9 2 18 3 67 1 12.2 1 30 13 0 7 2 77 1 12.3 0 78 26 0 12 2 55 5 12.4 1 20 23 8 1 2 64 1 12.5 0 63 39 7 9 9 35 1 12.6 0 93 12 0 6 0 81 0 13.0 0 94 9 0 3 1 87 0

March 1999 12.0 0 23 25 0 57 117 0 12.1 0 13 15 0 62 024 0 12.3 0 22 15 0 72 112 0 12.4 0 15 14 0 71 015 0 12 5 0 13 11 0 63 027 0 12.6 0 35 7 0 79 112 0 12.7 0 25 12 0 73 212 0 12 8 0 17 2 0 78 019 0 12 9 0 20 2 0 77 219 0 13.0 0 39 16 0 40 27 18 0 13 1 0 30 8 0 58 24 10 0 13.2 0 55 9 0 68 12 11 0 13 3 0 76 11 0 69 516 0 13.4 0 56 7 0 59 628 0 13 5 0 87 9 0 75 214 0 13.6 0 51 2 0 73 124 0 14.0 0 56 4 0 66 129 0

June 1999 11.0 0 55 7 034 0 59 0 11 1 0 37 15 038 4 43 0 11 3 0 35 13 0 66 021 0 11.4 1 00 5 0 50 0 45 0 11 5 0 41 18 0 50 032 0 11.6 0 88 9 0 55 036 0 11.7 0 57 16 0 75 090 11 8 0 83 13 0060 270 11 9 0 79 12 0 72 016 0 12.0 0 75 7 0 71 022 0 12 1 0 94 6 0 71 022 0 12.2 0 80 10 0 61 029 0 12 3 0 77 5 0 59 035 0 12.4 0 70 17 0 29 4 50 0 12 5 0 82 8 0 70 122 0 12.6 1 20 13 0 61 521 0 13.0 0 85 6 0 54 436 0

August 1999 11.0 0 08 100 0 00 0 0 11.1 0 03 0 0 0 100 0 0 11.3 0 29 34 0 0 48 18 0 11.4 0 06 0 0 0 0 93 7 11.5 1 20 4 0 81 212 0 11.6 6 80 4 0 71 0 24 1 11.7 10 00 6 0 71 122 1 11.8 7 90 7 0 71 1 20 1 11.9 12 00 6 0 66 027 1 12.0 7 80 7 0 58 2 32 1 12.1 4 20 10 0 49 139 1 12.2 2 10 4 0 58 3 33 2 12.3 2 00 8 0 29 4 58 1 12.4 2 90 8 0 62 2 27 2 12.5 1 90 7 0 33 1 59 0 12.6 1 90 8 0 43 0 47 1 13.0 1 70 12 0 35 2 50 2

* sum of specific biomasses determined after in situ hybridization with the respective probes Apur453, Cmok453, S453D, Laro453, S453F, and CHLP441, ** boxes indicate specific biomass values making up more than 40% of the total biomass of all phototrophic sulfur bacteria in the chemocline of Lake Cadagno 68 Chapter 3

3.5 Discussion

In contrast to previous reports in which C. okenii and A. purpureus were described as key organisms of Lake Cadagno (Bosshard, 2000a, b; Schanz et al., 1998), our study demonstrated that, although both C. okenii and A. purpureus can make up significant portions of the phototrophic sulfur bacteria in the chemocline, these were dominated by yet uncultured populations designated D and F throughout the whole chemocline. Major factors supposed to determine both composition and distribution of phototrophic sulfur bacteria in bacterial layers as encountered in the chemocline of Lake Cadagno are intensity and quality of light, in addition to oxygen and sulfide concentrations (Montesinos et al., 1983; Vila et al., 1994, 1996, 1998). The light quality in the water column of Lake Cadagno has been extensively studied (Del Don et al., 2001; Fischer et al., 1996; Vila et al., 1996). At the bacterial plume wavelengths ranging from 450 to 650 nm with a maximum at 570 nm are present in summer as well as in winter (Del Don et al., 2001). Light intensity, however, varied significantly during the year with lower intensities related to smaller populations of phototrophic sulfur bacteria as shown in our study. Light intensities also generally decreased within the chemocline by two orders of magnitude confirming results of previous studies (Fischer et al., 1996). Since green sulfur bacteria such as Ch. phaeobacteroides require strictly anoxic conditions (Pfennig, 1989), need only about one quarter of the light intensity of the purple sulfur bacteria in order to grow at comparable growth rates (Biebl and Pfennig, 1978) and show different light absorption optima than purple sulfur bacteria (Del Don et al., 2001), a microstratification of phototrophic sulfur bacteria with purple sulfur bacteria growing above green sulfur bacteria could be expected (Biebl and Pfennig, 1978; Caldwell and Tiedje, 1975; Lindholm et al., 1985). Green sulfur bacteria, however, were only detected when light intensities reaching the chemocline were relatively high (i.e. in June, August and October). At these times, they were distributed over the whole chemocline and thus encountered in a light intensity range from high to low and, similar to reports for other meromictic lakes (Vila et al., 1998), were they were present at the same depths as purple sulfur bacteria. Populations of purple sulfur bacteria, however, were microstratified under these conditions. The different distribution profiles might be due to the fact that purple sulfur bacteria such as A. purpureus, L. roseopersicina or C. okenii are motile and thus have the potential to reposition themselves when environmental conditions change while non-motile green sulfur bacteria such as Ch. phaeobacteroides cannot. Although purple sulfur bacteria are the dominant group of phototrophic sulfur bacteria in the chemocline of Lake Cadagno, populations of green and purple sulfur bacteria co-exist in the same environment most obviously due to eco-physiological differences such as e.g. differences in light absorption spectra. In addition to other physico-chemical conditions such as higher redox potential, higher oxygen or sulfide concentrations reported to favor growth of purple sulfur bacteria over that of certain green Spatio-temporal distribution of phototrophic sulfur bacteria 69 sulfur bacteria (Guerrero et al., 1987; Vila et al., 1998), metabolic properties might give purple sulfur bacteria growth advantages over green sulfur bacteria. Small-celled purple sulfur bacteria in the chemocline of Lake Cadagno form large cell aggregates with up to 900 cells and are associated with sulfate-reducing bacteria related to the genus Desulfocapsa (Tonolla et al., 2000). D. thiozymogenes is able to grow by the oxidation of a limited range of organic compounds and by disproportionation of inorganic sulfur compounds (Janssen et al., 1996). Either sulfate-reduction or disproportionation in association with aggregates of small-celled phototrophic sulfur bacteria might therefore overcome sulfide limitations of small-celled phototrophic sulfur bacteria during periods of intensive photo- oxidation.

The metabolic versatility of purple sulfur bacteria might also add to their superior competitiveness with green sulfur bacteria. Purple sulfur bacteria might be able to simultaneously oxidize sulfide and polysulfide (van Gemerden, 1987) and have the capacity to grow chemolithotrophically (Eichler and Pfennig, 1988; Schaub and van Gemerden, 1994). Compared to green sulfur bacteria which are strictly anaerobic, obligate phototrophs, they are better adapted to the presence of oxygen and also much more versatile with respect to carbon resources (Trüper, 1981; van Gemerden and Mas, 1995). A. purpureus, for example, also grows under mixotrophic conditions with several organic compounds (Eichler and Pfennig, 1988). High concentrations of dissolved organic compounds (DOC; 1-4 mg l-1) have been reported at the upper border of the chemocline of Lake Cadagno with steep decreases with depth suggesting large production and consumption activity of DOC (Bertoni et al., 1998). Different spatio-temporal distribution profiles were obtained for specific populations of purple sulfur bacteria. These were most pronounced for C. okenii and L. roseopersicina. C. okenii was only detected in significant numbers in October which is in agreement with previous observations on larger populations in late-summer and fall (Camacho et al., 2001; Tonolla et al., 1999). Their development might be impacted by day length since long dark periods were found to favor growth of large-celled purple sulfur bacteria in competition with small-celled purple sulfur bacteria (van Gemerden et al., 1974). In contrast to populations of other purple sulfur bacteria, cell densities of L. roseopersicina were in the same order of magnitude at all sampling times. The maximum abundance in October (3.7 x 104 cells ml-1), for example, was not significantly different from that in March (3.2 x 104 cells ml-1). Maximum abundance of L. roseopersicina was always detected below the other populations of purple phototrophic sulfur bacteria similar to that of green sulfur bacteria suggesting an adaptation of L. roseopersicina to low light conditions and relatively high sulfide concentration (ranging from 1.2 mg l-1 in October to 6-7 mg l-1 in March). Similar to green sulfur bacteria, however, the failure to become dominant under these conditions indicates an impact of other environmental conditions on populations of L. roseopersicina that essentially allows them to persist and increase biomass by increasing cell size but not to proliferate in the environment. 70 Chapter 3

The most pronounced microstratification of populations of purple sulfur bacteria along environmental gradients of light, oxygen and sulfide was obtained in August when defined layers consisting entirely or almost entirely of one population of small-celled purple sulfur bacteria developed. A. purpureus at the upper border of the chemocline inhabits an environment characterized by high light intensities, the presence of oxygen although at low concentration, no sulfide and no ammonium. Just below the layer of A. purpureus, similar conditions, however with even less oxygen present, support the establishment of L. roseopersicina. Decreasing light intensity and oxygen concentrations as well as increasing sulfide concentrations characterize the environment almost entirely inhabited by population F at a slightly lower depth. Together with population D, population F makes up for most of the remaining purple sulfur bacteria within the chemocline, supposedly tolerating a large range of environmental conditions with steep gradients in light intensity from high to low, and increasing sulfide concentrations. Populations F seems to tolerate low concentrations of oxygen as indicated in October, while population D does not. The differences obtained in the distribution profiles of specific populations of purple sulfur bacteria suggest eco-physiological adaptations to the steep physico-chemical gradients in the chemocline of Lake Cadagno. However, although different environmental characteristics such as light intensity (and supposedly quality), sulfide and oxygen concentrations were related to specific populations, these relationships only represent indications and have to be confirmed by defined pure culture studies. Such studies should also include biotic interrelationships and address questions on competition between different populations of phototrophic sulfur bacteria or synergism between small-celled purple sulfur bacteria and associated sulfate-reducing bacteria.

Acknowledgements Mauro Tonolla and Sandro Peduzzi contributed equally to the study. This work was supported by grants from the Swiss National Science Foundation (SNSF) (NF31-46855.96), and the canton of Ticino (Switzerland). S. Peduzzi’s work at Rutgers University was supported by a fellowship from the SNSF Commission of the University of Lugano (81IT-59640). The authors are indebted to N. Ruggeri and A. Caminada for technical support. Spatio-temporal distribution of phototrophic sulfur bacteria 71

3.6 References

Amann R. I., Krumholz L. and Stahl D. A. (1990) Fluorescent-oligonucleotide probing of whole cells for determinative, phylogenetic, and environmental studies in microbiology. J. Bacteriol. 172: 762-770.

Bertoni R., Callieri C. and Pugnetti A. (1998) Organic carbon dynamics in Lake Cadagno and microbial activities in the mixolimnion. Doc. Ist. Ital. Idrobiol. 63: 105-120.

Biebl H. and Pfennig N. (1978) Growth yields of green sulfur bacteria in mixed cultures with sulfur and sulfate reducing bacteria. Arch. Microbiol. 117: 9-16.

Bosshard P. P., Santini Y., Grüter D., Stettler R. and Bachofen R. (2000a) Bacterial diversity and community composition in the chemocline of in the meromictic Lake Cadagno as revealed by 16S rDNA analysis. FEMS Microbiol. Ecol. 31: 173-182.

Bosshard P. P., Stettler R. and Bachofen R. (2000b) Seasonal and spatial community dynamics in the meromictic Lake Cadagno. Arch. Microbiol. 174: 168-174.

Caldwell D. E. and Tiedje J. M. (1975) The structure of anaerobic bacterial communities in the hypolimnia of several Michigan lakes. Can. J. Microbiol. 21: 377-385.

Camacho A., Erez J., Chicote A., Florin M., Squires M. M., Lehmann C. and Bachofen R. (2001) Microbial microstratification, inorganic carbon photoassimilation and dark carbon fixation at the chemocline of the meromictic Lake Cadagno (Switzerland) and its relevance to the food web. Aquat. Sci. 63: 91-106.

Del Don C., Hanselmann K. W., Peduzzi R. and Bachofen R. (2001) The meromictic alpine Lake Cadagno: orographical and biogechemical description. Aquat. Sci. 63: 70-90.

Demarta A., Tonolla M., Caminda A.-P., Ruggeri N. and Peduzzi R. (1998) Phylogenetic diversity of the bacterial community from the anoxic layer of the meromictic Lake Cadagno. Doc. Ist. Ital. Idrobiol. 63: 19-30.

DEV (2000) Deutsche Einheitsverfahren zur Wasser-, Abwasser- und Schlamm-Untersuchung. Physikalische, chemische, biologische und bakteriologische Verfahren. Fachgruppe in der GDCh Wasserchemische Gesellschaft und Deutsches Institut für Normung (DIN). Wiley-VCH, Weinheim, Germany.

Dubinsky Z. (1980) Light utilization efficiency in natural phytoplankton communities. p. 83-97. In: P. G. Falkowski (eds), Primary productivity in sea, Plenum Press, New York.

Eichler B. and Pfennig N. (1988) A new purple sulfur bacterium from stratified freshwater lakes, Amoebobacter purpureus sp. nov. Arch. Microbiol. 149: 395-400.

Fischer C., Wiggli M., Schanz F., Hanselmann K. W. and Bachofen R. (1996) Light environment and synthesis of bacteriochlorophyll by populations of Chromatium okenii under natural environmental conditions. FEMS Microbiol. Ecol. 21: 1-9.

Fischer K., Hahn D., Amann R. I., Daniel O. and Zeyer J. (1995) In situ analysis of the bacterial community in the gut of the earthworm Lumbricus terrestris L. by whole-cell hybridization. Can. J. Microbiol. 41: 666-673.

Fry J. C. (1990) Direct methods and biomass estimation. Meth. Microbiol. 22: 41-86. 72 Chapter 3

Gilboa-Garber N. (1971) Direct spectrophotometric determination of inorganic sulfide in biological materials and in other complex mixtures. Anal. Biochem. 43: 129-133.

Glöckner F. O., Amann R. I., Alfreider A., Pernthaler J., Psenner R., Trebesius K. and Schleifer K.-H. (1996) An optimized in situ hybridization protocol for planktonic bacteria. System. Appl. Microbiol. 19: 403-406.

Guerrero R., Montesinos E., Pedrós-Alió C., Esteve I., Mas J., van Gemerden H., Hofman P. A. G. and Bakker J. F. (1985) Phototrophic sulfur bacteria in two Spanish Lakes: vertical distribution and limiting factors. Limnol. Oceanogr. 30: 919-931.

Guerrero R., Pedrós-Alió C., Esteve I. and Mas J. (1987) Communities of phototrophic sulfur bacteria in lakes of the Spanish Mediterranean region. p. 125-151. In: T. Lindholm (eds), Ecology of photosynthetic prokaryotes, Åbo Academy Press, Helsinki, Finland.

Hanselmann K. and Hutter R. (1998) Geomicrobiological coupling of sulfur and iron cycling in anoxic sediments of a meromictic lake: Sulfate reduction and sulfide sources and sinks in Lake Cadagno. Doc. Ist. Ital. Idrobiol. 63: 85-98.

Imhoff J. F. (2001) Transfer of Pfennigia purpurea Tindall 1999 (Amoebobacter purpureus Eichler and Pfennig 1988) to the genus Lamprocystis as Lamprocystis purpurea comb. nov. Int. J. System. Evol. Microbiol. 51: 1699-1701.

ISO (International Standard Organization) (1998) Water quality - Detection and enumeration of Legionella. Intern. Standard 11731: 1-16.

Janssen P. H., Schuhmann A., Bak F. and Liesack W. (1996) Disproportionation of inorganic sulfur compounds by the sulfate-reducing bacterium Desulfocapsa thiozymogenes gen. nov., sp. nov. Arch. Microbiol. 166: 184-192.

Jørgensen B. B., Kuenen J. G. and Cohen Y. (1979) Microbial transformations of sulfur compounds in a stratified lake (Solar Lake, Sinai). Limnol. Oceanogr. 24: 799-822.

Lehmann C., Luehty L. and Bachofen R. (1998) Tools for the evaluation of sources and sinks of sulfide in Lake Cadagno. Doc. Ist. Ital. Idrobiol. 63: 99-104.

Lindholm T., Weppling K. and Jensen H. A. (1985) Stratification and primary production in a small brackish lake studied by close-interval siphon sampling. Verh. Internat. Verein. Limnol. 22: 2190-2194.

Manz W., Amann R., Ludwig W., Wagner M. and Schleifer K.-H. (1992) Phylogenetic oligodeoxynucleotide probes for the major subclasses of proteobacteria: problems and solutions. System. Appl. Microbiol. 15: 593-600.

Montesinos E., Abella C., Guerrero R. and Esteve I. (1983) Ecology and physiology of the competition for light between Chlorobium limicola and Chlorobium phaeobacteroides in natural habitats. Appl. Environ. Microbiol. 46: 1007-1016.

Overmann J., Beatty T., Hall K. J., Pfennig N. and Northcote T. G. (1991) Characterization of a dense, purple sulfur bacterial layer in a meromictic lake. Limnol. Oceanogr. 36: 846-859.

Pearson W. R. and Lipman D. J. (1988) Improved tools for biological sequence comparison. Proc. Natl. Acad. Sci. USA 85: 2444-2448.

Pedrós-Alió C., Montesinos E. and Guerrero R. (1983) Factors determining annual changes in bacterial photosynthetic pigments in holomictic Lake Cisó, Spain. Appl. Environ. Microbiol. 46: 999- 1006. Spatio-temporal distribution of phototrophic sulfur bacteria 73

Peduzzi R., Demarta A. and Tonolla M. (1993) Dynamics of the autochthonous and contaminant bacterial colonization of lakes (Lake of Cadagno and Lake of Lugano as model systems). Stud. Environ. Sci. 55: 323-335.

Pfennig N. (1989) Ecology of phototrophic purple and green sulfur bacteria. p. 97-116. In: H. G. Schlegel and B. Bowien (eds), Autotrophic bacteria, Springer Verl., New York.

Ramsing N. B., Fossing H., Ferdelman T. G., Andersen F. and Thamdrup B. (1996) Distribution of bacterial populations in a stratified fjord (Mariager Fjord, Denmark) quantified by in situ hybridization and related to chemical gradients in the water column. Appl. Environ. Microbiol. 62: 1391-1404.

Schanz F., Fischer-Romero C. and Bachofen R. (1998) Photosynthetic production and photoadaptation of phototrophic sulfur bacteria in Lake Cadagno (Switzerland). Limnol. Oceanogr. 43: 1262-1269.

Schaub B. E. M. and van Gemerden H. (1994) Simultaneous phototrophic and chemotrophic growth in the purple sulfur bacterium Thiocapsa roseopersicina M1. FEMS Microbiol. Ecol. 13: 185- 196.

Sorokin J. I. (1970) Interrelations between sulphur and carbon turnover in meromictic lakes. Arch. Hydrobiol. 66: 391-446.

Strunk O. and Ludwig W. (1996) ARB. Computer program distributed by the Technical University Munich, Munich, Germany.

Tonolla M., Demarta A., Hahn D. and Peduzzi R. (1998) Microscopic and molecular in situ characterization of bacterial populations in the meromictic Lake Cadagno. Doc. Ist. Ital. Idrobiol. 63: 31-44.

Tonolla M., Demarta A., Peduzzi R. and Hahn D. (1999) In situ analysis of phototrophic sulfur bacteria in the chemocline of meromictic Lake Cadagno (Switzerland). Appl. Environ. Microbiol. 65: 1325-1330.

Tonolla M., Demarta A., Peduzzi S., Hahn D. and Peduzzi R. (2000) In situ analysis of sulfate- reducing bacteria related to Desulfocapsa thiozymogenes in the chemocline of meromictic Lake Cadagno (Switzerland). Appl. Environ. Microbiol. 66: 820-824.

Trüper H. G. (1981) Versatility of carbon metabolism in the phototrophic bacteria. p. 116-121. In: H. Dalton (eds), Microbial growth on C1 compounds, Heyden and Son, London, UK.

Tuschak C., Glaeser J. and Overmann J. (1999) Specific detection of green sulfur bacteria by in situ hybridization with a fluorescently labeled oligonucleotide probe. Arch. Microbiol. 171: 265-272. van Gemerden H. (1974) Coexistence of organisms competing for the same substrate: an example among the purple sulfur bacteria. Microb. Ecol. 1: 104-119. van Gemerden H. (1987) Competition between purple sulfur bacteria and green sulfur bacteria: role of sulfide, sulfur and polysulfides. p. 13-27. In: T. Lindholm (eds), Ecology of photosynthetic prokaryotes, Åbo Academy Press, Helsinki, Finland. van Gemerden H. and Mas J. (1995) Ecology of phototrophic sulfur bacteria. p. 49-85. In: R. E. Blankenship, M. T. Madigan and C. E. Bauer (eds), Anoxygenic photosynthetic bacteria, Kluwer Academic Press, Dordrecht, The Netherlands.

Vila X. and Abella C. A. (1994) Effects of light quality on the physiology and the ecology of planktonic green sulfur bacteria in lakes. Photosynthesis Res. 41: 53-65. 74 Chapter 3

Vila X., Abella C. A., Figueras J. B. and Hurley J. P. (1998) Vertical models of phototrophic bacterial distribution in the metalimnetic microbial communities of several freshwater North- American kettle lakes. FEMS Microbiol. Ecol. 25: 287-299.

Vila X., Dukulil M., Garcia-Gil L. J., Abella C. A., Borrego C. M. and Bañeras L. (1996) Composition and distribution of phototrophic bacterioplancton in the deep communities of several Central European lakes: The role of light quality. Arch. Hydrobiol. 48: 183-196.

Wagener S., Schulz S. and Hanselmann K. (1990) Abundance and distribution of anaerobic protozoa and their contribution to methane production in Lake Cadagno (Switzerland). FEMS Microbiol. Ecol. 74: 39-48.

Zarda B., Hahn D., Chatzinotas A., Schönhuber W., Neef A., Amann R. I. and Zeyer J. (1997) Analysis of bacterial community structure in bulk soil by in situ hybridization. Arch. Microbiol. 168: 185-192.

Chapter 4

Vertical distribution of sulfate-reducing bacteria in the chemocline of Lake Cadagno, Switzerland, over an annual cycle

Sandro Peduzzi1,2, Mauro Tonolla1, Dittmar Hahn2

1Cantonal Institute of Microbiology, Microbial Ecology (University of Geneva), Via Giuseppe Buffi 6, CH-6904 Lugano, Switzerland

2Dept. of Chemical Engineering, New Jersey Institute of Technology (NJIT), and Dept. of Biological Sciences, Rutgers University, 101 Warren Street, Smith Hall 135, Newark, NJ, USA

Aquatic Microbial Ecology, 30: 295-302 (2003) 78 Chapter 4

Abstract

Sulfate-reducing bacteria were analyzed in the chemocline of meromictic Lake Cadagno, Switzerland, in March, June, August and October using in situ hybridization. Numbers of sulfate-reducing bacteria determined as sum of cells hybridizing to probes SRB385Db targeting Desulfobacteriaceae and SRB385 targeting Desulfovibrionaceae were similar at all samplings accounting for 13 to 18% of the total microbial community. Abundance of cells detected with either probe, however, changed during the year with cell numbers detected with probe SRB385Db being larger in early summer (June) and those detected with probe SRB385 being larger in late summer (October). Increasing cell numbers detected with probe SRB385Db were mainly caused by a yet uncultured and phylogenetically unidentified bacterium with a peculiar morphology (“morphotype R”) that followed the sulfide profile in June as well as in August with increasing numbers at increasing concentrations with depth. From the fraction of cells detected with probe SRB385, only a minor part was representing a yet uncultured population without close cultured relatives. At all samplings, the majority of cells detected with probe SRB385 (93 to 99%) represented populations phylogenetically related to Desulfocapsa thiozymogenes DSM7269. Their cells were generally found in association with aggregates of small-celled phototrophic sulfur bacteria. This association was not specific for one of the four populations representing all small-celled phototrophic sulfur bacteria in Lake Cadagno. The association was also not obligate since non-associated cells were frequently found, especially in winter and early summer when limited light conditions caused by snow and ice cover reduced the abundance of small-celled phototrophic sulfur bacteria to about 50% of the values found in late summer. Nonetheless, the association between populations related to D. thiozymogenes and small-celled phototrophic sulfur bacteria suggests an ecological advantage to both organisms under appropriate environmental conditions.

Key words aggregates, chemocline, in situ hybridization, meromictic lake, purple sulfur bacteria, sulfate-reducing bacteria

Vertical distribution of sulfate-reducing bacteria in the chemocline of Lake Cadagno, Switzerland, over an annual cycle

Lake Cadagno is a meromictic lake located 1923 m above sea level in the southern Alps of Switzerland (46°33'N, 8°43'E), in the catchment area of a dolomite vein rich in gypsum (Piora-Mulde). A permanent chemocline at a depth between 9 and 14 meters (Peduzzi et al. 1993, Wagener et al., 1990) is stabilized by density differences of salt-rich water constantly supplied by subaquatic springs to the monimolimnion and of electrolyte-poor surface water feeding the mixolimnion (Del Don et al., 2001). High concentrations of sulfate and steep sulfide gradients in the chemocline (Hanselmann and Vertical distribution of sulfate-reducing bacteria 79

Hutter, 1998; Lehmann et al., 1998) support the growth of large numbers of bacteria (up to 107 cells ml-1) indicating that a bacterial community making use of these gradients is present (Tonolla et al., 1998a, 1999). Molecular techniques that were used to analyze microbial community structure unaffected by the limitations of culturability showed that almost all bacteria in this chemocline belonged to the Proteobacteria (Tonolla et al., 1998a, 1999) with numbers for the
-, -, - and - subdivision of Proteobacteria accounting for 23, 17, 45 and 15% of the total number of bacteria, respectively (Tonolla et al., 1998a, 1999). Most prominent numerically (ca. 33% of all bacteria) were large- and small-celled phototrophic purple sulfur bacteria (Tonolla et al., 1998a, 1999; Fischer et al. 1996; Peduzzi et al., 1993). These large-celled phototrophic sulfur bacteria were identified as Chromatium okenii, while small-celled phototrophic sulfur bacteria consisted of four major populations forming a tight cluster with Lamprocystis purpurea (former Amoebobacter purpureus and Pfennigia purpurea) and L. roseopersicina (Tonolla et al., 1999). These small-celled phototrophic sulfur bacteria were usually found in aggregates, together with sulfate-reducing bacteria of the family Desulfovibrionaceae (Tonolla et al., 1998a, 1999). Based on comparative sequence analysis of a 16S rRNA gene clone library, the latter were separated into two groups. One group represented by a cluster of sequences closely related to Desulfocapsa thiozymogenes DSM7269, resembled cells that were generally associated with aggregates of small-celled phototrophic sulfur bacteria, while the other group consisted of cells represented by a second cluster that were free-living or loosely attached to other cells or debris, similar to sulfate-reducing bacteria of the family Desulfobacteriaceae (Tonolla et al., 2000). Since the populations of small-celled phototrophic sulfur bacteria differentially distributed along the chemocline indicating different ecophysiological adaptations (Tonolla et al., 1999), we were interested in further analyzing the vertical distribution of sulfate-reducing bacteria in the chemocline of Lake Cadagno over an annual cycle and to elucidate their interaction with the small-celled phototrophic sulfur bacteria.

For this purpose, water samples were collected from the chemocline over the center of the lake, at its deepest point (21 m), four times over a period of one year for chemical and bacterioplankton analysis. Four representative periods of the year were chosen as sampling dates: i) the end of the summer season (October 14, 1998) before partial water mixing (only oxic mixolimnion) and surface freezing, ii) the middle of the winter season (March 24, 1999) with the lake covered by a thick layer of ice and snow (about 2 meters), iii) the beginning of the summer season, (June 16, 1999) just after the ice melting, and iv) in the middle of the summer season, (August 23, 1999). A thin layer pneumatic multisyringe sampler was employed allowing the simultaneous collection of 100-ml-water samples in the chemocline with a resolution of 10 cm over a depth of 2 m (Tonolla et al., 1999). Basic physico- chemical parameters (temperature, conductivity, pH, dissolved oxygen, turbidity and redox potential) were simultaneously measured with a YSI 6000 profiler (Yellow Springs Inc., Yellow Springs, OH, USA) attached to the lowest part of the multisyringe sampler (Tonolla et al., 1999). In addition, PAR- 80 Chapter 4 light transmission conditions were determined in 10-cm-steps using 2 LI-193SA spherical quantum sensors and a LI-COR 1000 datalogger (LI-COR Ltd., Lincoln, NE, USA). From the water samples, 11-ml-subsamples were immediately transferred to screw capped tubes containing 0.8 ml of a 4 % zinc acetate solution that were stored on ice and used to determine sulfide concentrations colorimetrically (Gilboa-Garber 1971) using a Merck (Switzerland) Spectroquant® kit (Tonolla et al. 1999, 2000). Additional water samples were further analyzed for soluble iron, ammonia and sulfate using standard protocols (DEV, 2000).

Profiles generated generally agreed with those commonly obtained for chemocline samples of Lake Cadagno during the year (Tonolla et al., 1998b). The chemocline was located at a depth between 11 and 13 m, except for March where it was found at a slightly lower depth (12 to 14 m) (Fig. 1). Throughout the whole year, it was characterized by high conductivity (between 230 µS cm-1 and 270 µS cm-1) and sulfate (100 to 150 mg l-1) values. Low oxygen concentrations (below 1 mg l-1) were found in the upper part of the chemocline but concentrations rapidly decreased with depth to undetectable values when sulfide concentrations increased (up to 7 mg l-1; Fig. 4.1). Sulfide profiles showed the typical steep gradients in the chemocline (Lüthy et al., 2000; Tonolla et al., 1999) (Fig. 4.1). Ammonia and soluble iron concentrations increased with depth from 0 up to 0.6 mg l-1 and from 0.02 mg l-1 to 0.09 mg l-1, respectively (Tonolla et al., 1998b).

During the year, major differences in profiles were only displayed for light intensities and turbidities. In October, high light intensities (4.2 µE m-2 s-1) were detected in the upper part of the chemocline that significantly decreased with depth (Fig. 4.1). High turbidity values with up to 57 Formazine Turbidity Units (FTU) at this time indicated the presence of a well-developed plume of microorganisms. Since the lake was covered by ice and snow (2 m) at the sampling in March, the light intensity in the chemocline was much lower decreasing from 0.5 to 0.2 µE m-2 s-1 with an average of 0.3 µE m-2 s-1 at the upper border of the bacterial layer at a depth of 13.1 m (Fig. 4.1). The bacterial layer was less developed than in October as indicated by much lower values for turbidity (<8 FTU) (Fig. 4.1). After melting of the ice cover in June, about 10-fold higher light intensities reached the chemocline (2.2 µE m-2 s-1) that also showed increasing turbidity values to about 16 FTU at a depth of 11.6 m (Fig. 4.1). At the fourth sampling in August 1999, light intensity was similar to that in October (5.8 µE m-2 s-1) and turbidity values up to 45 FTU indicated the establishment of a dense microbial community around a depth of 11.8 m (Fig. 4.1).

High turbidity values were generally found in a depth range where sulfide concentrations were increasing with depth from undetectable to up to 7-8 mg l-1 of sulfide (Fig. 4.1) suggesting the presence of both sulfide producing as well as sulfide consuming microbial populations in these plumes. This suggestion is supported by previous in situ analyses of sulfide turnover rates in the chemocline of Lake Cadagno that showed net sulfide consumption during the day and net sulfide production during the night at the maximum of turbidity (Lehmann et al., 1998; Lüthy et al., 2000). Vertical distribution ofsulfate -reducing bacteria 81

Net sulfide consumption at high light intensities during the day could be attributed to the large activity of phototrophic sulfur bacte1ia, and net sulfide production during the night to the activity of sulfate- reducing bacte1ia and the anaerobic respiration of internal storage compounds (biopolymers) of the phototrophic bacteria (Del Don et al. , 1994; Mas and van Gemerden, 1995). The steep gradient of sulfide in the chemocline of Lake Cadagno during periods of intensive photo-oxidation suggests that sulfide might even become limiting for phototrophic sulfur bacte1ia in the upper pa1t of the bacte1ial plume (Luthy et al. , 2000) with different populations competing with each other. Interactions between these populations and sulfate-reducing bacte1ia might overcome sulfide limitations and suppo1t specific populations.

o Light (µE m-2s-l) O Oxygen (mg 1-1) 0 SRB385Db (x 10s m1-1) 0_01 0.1 1 10 0 0.2 0.4 0.6 0.8 0 4 8 12 A 11

s'-' ; 12 Q. ~ Q 13 B n s '-' ; 13 Q. ~ Q

14 c 11

s'-' ; 12 Q. ~ Q 13 D 11

s'-' ; 12 Q. ~ Q 13 0 20 40 60 0 4 8 0 4 8 12 • Turbidity (FTU) •Sulfide (mg 1-1) • SRB385 (x 10s m1-1)

Figure 4.1 Profiles of some physico-chemical characteristics (Light, Turbidity, Oxygen and Sulfide) and bacteria detected after in situ hybridization with probes SRB385 and SRB385Db in the chemocline of Lake Cadagno in October 1998 (A), March 1999 (B), June 1999 (C) and August 1999 (D). Data are presented as means± standard e!l'o1'S. 82 Chapter 4

Bacterial populations were analyzed by in situ hybridization in aliquots (3 µl) of paraformaldehyde- fixed water samples (n=3) spotted onto gelatin-coated slides (Glöckner et al., 1996). The analysis was performed with Cy3-labeled probes in a top-to-bottom approach initially focussing on sulfate-reducing bacteria of the families Desulfovibrionaceae (probe SRB385) (Amann et al., 1990) and Desulfobacteriaceae (probe SRB385Db) (Rabus et al., 1996; Table 4.1). Probes SRB385 and SRB385Db are generally used to analyze Gram-negative mesophilic sulfate-reducing bacteria (Manz et al., 1992, 1998; Tonolla et al., 2000) even though hybridization of both to other non-target organisms has been demonstrated. Within the Desulfovibrionaceae, two populations were subsequently analyzed: Desulfocapsa thiozymogenes and a cluster of 6 clones retrieved from the chemocline of Lake Cadagno were targeted by combined probes DSC213 and DSC441, and a second cluster with no identified cultured relative was targeted by probe SRB441 (Tonolla et al., 2000). The interaction of these populations with specific small-celled phototrophic sulfur bacteria was analyzed with Cy5-labeled probes Apur453 targeting Lamprocystis purpurea DSM4197, Laro453 targeting Lamprocystis roseopersicina DSM229, and S453D and S453F, both targeting yet uncultured populations of phototrophic sulfur bacteria (Tonolla et al., 1999) (Table 4.1).

Table 4.1 Oligonucleotide probes Probe Target Sequence (5’ =>3’) Reference (% formamide in hybridization buffer)

Sulfate-reducing bacteria

SRB385 Desulfovibrionaceae, and others CGGCGTCGCTGCGTCAGG (Amann et al. 1990) 16S rRNA, pos. 385-402 (20%) SRB385Db Desulfobacteriaceae, and others CGGCGTTGCTGCGTCAGG (Rabus et al. 1996) 16S rRNA, pos. 385-402 (30%) SRB441 Clones 141 and 22 from Lake Cadagno CATGCACTTCTTTCCACTT (Tonolla et al. 2000) 16S rRNA, pos. 441-459 (5%) DSC441 Clones 113 and 330 from Lake Cadagno ATTACACTTCTTCCCATCC (Tonolla et al. 2000) 16S rRNA, pos. 441-459 (30%) DSC213 Desulfocapsa thiozymogenes (DSM7269) CCTCCCTGTACGATAGCT (Tonolla et al. 2000) Clones 113 and 330 from Lake Cadagno (30%) 16S rRNA, pos. 213-230

Small-celled phototrophic sulfur bacteria

Apur453 Lamprocystis purpurea (DSM4197) TCGCCCAGGGTATTATCCCAAACGAC (Tonolla et al. 1999) 16S rRNA, pos. 453-479 (40%) Laro453 Lamprocystis roseopersicina (DSM229) CATTCCAGGGTATTAACCCAAAATGC (Tonolla et al. 1999) 16S rRNA, pos. 453-479 (40%) S453D Clone 261 from Lake Cadagno CAGCCCAGGGTATTAACCCAAGCCGC (Tonolla et al. 1999) 16S rRNA, pos. 453-479 (30%) S453F Clone 371 from Lake Cadagno CCCTCATGGGTATTARCCACAAGGCG (Tonolla et al. 1999) 16S rRNA, pos. 453-479 (35%) Vertical distribution of sulfate-reducing bacteria 83

Hybridizations were performed in 9 µl of hybridization buffer (0.9 M NaCl, 20 mM Tris/HCl, 5 mM EDTA, 0.01% SDS; pH 7.2) in the presence of 5 to 40% formamide depending on the probe (Table 1), 1 µl of the probe (25 ng µl-1), and 1 µl of a solution of DAPI (200 ng µl-1) at 46°C for 2 h (Zarda et al. 1997). After hybridization, the slides were washed in buffer containing 20 mM Tris/HCl, pH 7.2, 10 mM EDTA, 0.01% SDS and either 636, 318, 112, 80 or 56 mM NaCl depending on the formamide concentration during hybridization (5, 20, 30, 35, and 40%, respectively) for 15 min at 48°C, subsequently rinsed with distilled water, and air-dried (Zarda et al., 1997). The slides were mounted with Citifluor AF1 immersion oil solution (Citifluor Ltd., London, UK) and examined with a Zeiss Axiolab microscope (Zeiss, Oberkochen, Germany) fitted for epifluorescence microscopy with a high- pressure mercury bulb and filter sets F31-000 (AHF Analysentechnik, Tübingen, Germany; D360/50, 400DCLP, D460/50, for DAPI detection), F41-007 (AHF Analysentechnik; HQ545/30, Q565LP, HQ610/75, for Cy3 detection), and F41-008 (AHF Analysentechnik; HQ620/60, Q660LP, HQ700/75, for Cy5 detection), respectively. Microorganisms were counted at 1000 x magnification in 40 fields covering an area of 0.01 mm2 each (Tonolla et al., 2000). Numbers were expressed as mean ± standard error and compared using Student’s t-test with a significance level of 0.05.

Microbial population density, as indicated by the numbers of cells determined after DAPI staining averaged across the whole chemocline, largely correlated to turbidity profiles (Fig. 4.1). Numbers declined between October and March from 22 M 3 x 105 cells ml-1 to 8 M 1 x 105 cells ml-1, and then increased to 15 M 2 x 105 cells ml-1 in June and further to 50 M 4 x 105 cells ml-1 in August. Of the DAPI-stained cells, about 18%, 13%, 18% and 13% were detected with both probes SRB385 and SRB385Db in October, March, June and August, respectively (Table 4.2). These numbers are similar to those of other samplings (e.g. 23% in October 1997, Table 4.2) (Tonolla et al., 2000) and demonstrate the presence of a large and numerically relatively stable community of sulfate-reducing bacteria in the chemocline of Lake Cadagno as expected under the given environmental conditions (Fig. 4.1). Over the annual cycle, however, differences were obtained in abundance of bacteria detected with probes SRB385 and SRB385Db, respectively, although profiles of cell numbers detected with either probe corresponded roughly to each other and to the turbidity and DAPI profiles (Fig. 4.1). Cells detected with probe SRB385, however, were most prominent at the end of the summer with 12.9 M 1.7% of the DAPI-stained cells while numbers detected with probe SRB385Db were much lower (4.7 M 0.6% of the DAPI-stained cells) (Table 4.2). In contrast, numbers of cells detected with probe SRB385Db were much higher at the beginning of the summer. In June, for example, they accounted for 14.3 M 1.5% of the DAPI-stained cells, while probe SRB385 detected only 3.4 M 0.3% of the DAPI- stained cells (Table 4.2). These results suggest different ecophysiological adaptations to environmental characteristics of fractions of sulfate-reducing bacteria detected with probes SRB385 and SRB385Db. 84 Chapter 4

Table 4.2 Seasonal shifts in abundance of sulfate-reducing and phototrophic purple sulfur bacteria in the chemocline of Lake Cadagno (in % of DAPI-stained cells) (X M SE)

Probe October’97 October’98 March’99 June’99 August’99

DSC441+DSC213 (associated) 10.2 M 1.7 12.3 M 1.6 6.6 M 0.7 2.7 M 0.3 6.1 M 0.5 DSC441+DSC213 (non-associated) n.d.* 0.3 M 0.0 1.5 M 0.3 1.6 M 0.2 0.4 M 0.1 SRB441(non-associated) 0.4 M 0.1 1.2 M 0.2 0.2 M 0.0 0.2 M 0.0 0.1 M 0.0 SRB385 (all) 13.9 M 2.3 12.9 M 1.7 8.7 M 0.9 3.4 M 0.3 6.1 M 0.5 SRB385Db (all) 9.0 M 1.5 4.7 M 0.6 3.9 M 0.4 14.3 M 1.4 7.2 M 0.6 SRB385 + SRB385Db (all) 22.8 M 3.7 17.6 M 2 3 12.6 M 1.3 17.7 M 1.7 13.3 M 1.1 Autofluorescence/morphology 27.5 M 4.8 35.0 M 4 5 19.5 M 2.2 14.6 M 1.4 28.0 M 2.3 (all small-celled phototrophic sulfur bacteria) Sum of all small-celled sulfur and sulfate- 50.3 M 8.6 52.6 M 6.8 32.1 M 3.5 32.3 M 3.1 41.3 M 3.4 reducing bacteria (SRB385 and SRB385Db)

*n.d. not determined

One potential candidate for each of the fractions of sulfate-reducing bacteria detected with probes SRB385 and SRB385Db was identified. Within the fraction of sulfate-reducing bacteria detected with probe SRB385Db, the population of a bacterium with a peculiar morphology, previously described as “morphotype R” (Bensadoun et al., 1998) was shown to follow the sulfide profile in June as well as in August with increasing numbers at increasing concentrations with depth (data not shown). This morphotype hybridized with probe SRB385Db and was observed in the bacterial plume, particularly in its lowest part and in the sampling of June. In a previous study it was mainly detected in the monimolimnion of the lake and its presence was positively correlated with sulfide content and the redox potential (Bensadoun et al., 1998). Based on morphological features and habitat occurrence, a high similarity between the “morphotype R” and other yet uncultured bacteria (morphotype T5) of anoxic waters was observed (Bensadoun et al., 1998; Caldwell and Tiedje, 1975). Representatives of the morphotype T5, Desulfomonile tiedjei and D. liminaris, have been isolated and described (DeWeerd et al., 1990; Sun et al., 2001). The isolation techniques and media employed in those studies could eventually be used for isolation of “morphotype R” from Lake Cadagno which would allow pure culture studies on potential metabolic capacities. Such studies would support ongoing attempts to obtain 16S rRNA sequence information from this morphotype which could be basis for probe design and application to monitor population dynamics of “morphotype R” in the water column and in the anoxic sediment of Lake Cadagno in order to obtain a more detailed picture about its abundance and ecophysiological adaptations.

Within the fraction of sulfate-reducing bacteria detected with probe SRB385, two groups were analyzed, but only one was important numerically. Only a small percentage of the DAPI-stained bacteria hybridized with probe SRB441 representing yet uncultured free-living sulfate-reducing bacteria also hybridizing with probe SRB385 (Tonolla et al., 2000). Averaged over the whole chemocline, they accounted for 1.2 M 0.2%, 0.2 M 0.0%, 0.2 M 0.0%, and 0.1 M 0.0% of the DAPI- Vertical distribution ofsulfate -reducing bacteria 85

stained bacteria in October, March, June and August, respectively (Table 4.2). They also only represented a ve1y small fraction of the total sulfate-reducing populations (Desulfovibrionaceae and Desulfobacteriaceae) with percentages ranging between 1.1 ± 0.1 % and 6.8 ± 0.9%. The major fraction of cells hyb1idizing with probe SRB385 was detected with a combination of probes DSC2 l 3 and DSC44 l targeting sulfate-reducers closely related to Desu.lfocapsa thiozymogenes. Between 93 .1 ± 10.9% and 98.5 ± 12.7% of the total number of cells detected with probe SRB385 hybridized with these probes. Most of the cells detected were found to be associated with small-celled phototrophic sulfur bacte1ia, as rep01ted previously (Tonolla et al., 2000).

Number of cells (x 105 mI-1) 0 SRB385 (associated) 0 SRB441 4 8 12 0.2 0.4 0.6 0.8 11 A ,-..

'-'e ; 12 Q. ~ Q 13 12 B s '-' ; 13 Q. ~ Q

14 11 c ,-..

'-'e ; 12 Q. ~ Q

13 D 11 ,-..

'-'e ; 12 Q. ~ Q 13

0 4 8 12 0 0.2 0.4 0.6 0.8 • DSC213/441 (associated) • DSC213/441 (free) Number of cells (x 105 mI-1)

Figure 4.2 Vertical distribution profiles of bacteria detected after in situ hybridization w-ith probes SRB385 or a combination of probes DSC213 and DSC441 both representing cells associated to aggregates of phototrophic sulfur bacteria only, and with probe SRB441 or probes DSC213 and DSC441 both representing free cells (i.e. cells not associated to aggregates of phototrophic sulfiu· bacteria) in the chemocline of Lake Cadagno in October 1998 (A), March 1999 (B), Jm1e 1999 (C) and August 1999 (D). Data are presented as means± standard e!l'o1-s. 86 Chapter 4

The close association of these bacteria with aggregates of phototrophic sulfur bacteria, however, influenced the accurate determination of cell numbers. Since probe SRB385 alone exhibits lower signal intensities than probes DSC213 and DSC441 together, and the analysis is impacted by the three- dimensional structure of the aggregates, numbers of cells detected with probe SRB385 might be underestimated, and thus percentages described above be overestimated. An indication for this assumption were detection rates in June and August, where hybridization with the combination of DSC213 and DSC441 resulted in higher cell numbers, although statistically not different, than with SRB385 (Table 4.2).

In addition to associated cells, hybridization with the combination of probes DSC213 and DSC441 also detected cells that were not associated with aggregates of phototrophic sulfur bacteria. These accounted for 0.3 M 0.0%, 1.5 M 0.2%, 1.6 M 0.2%, and 0.4 M 0.0% of the DAPI-stained bacteria in October, March, June and August, respectively. In March and June they represent a large proportion of the cells hybridizing with probes DSC213 and DSC441 (18.5 M 2.0% and 38.3 M 3.8%, respectively). This was different in the October and August samples when only small percentages of 2.7 M 0.4% and 5.9 M 0.5%, respectively, of cells hybridizing with probes DSC213 and DSC441 were not found in aggregates with small-celled phototrophic sulfur bacteria (Table 4.2). These results suggested that the interaction between sulfate-reducers closely related to D. thiozymogenes and small-celled phototrophic sulfur bacteria was not obligate but promoted by environmental conditions.

The increase in non-associated cells and the concomitant decrease in associated cells was correlated to a decrease in abundance of small-celled phototrophic sulfur bacteria as experienced in March and June samples (Table 4.2). In these samples, small-celled phototrophic sulfur bacteria were present in small aggregates (approx. 5-40 cells) and accounted for about 20 and 15% of the DAPI-stained cells, respectively. These numbers were determined based on typical morphological characteristics (i.e. cell size) and the concomitant autofluorescence of the cells (Tonolla et al., 1998a, 1999). In August and October, much larger aggregates were encountered (approx. 200-900 cells) and numbers represented 28 and 35% of the DAPI-stained cells (Table 4.2). Linear regression analysis (JMP Statistical software, SAS Institute Inc., North Carolina, USA) in which small-celled phototrophic sulfur bacteria were taken as the independent variable, found a highly significant correlation between the total number of small-celled phototrophic sulfur bacteria and the associated cells related to D. thiozymogenes (October [R2=0.79, p<0.0001], March [R2=0.70, p=0.0007], June [R2=0.81, p=0.0001], August [R2=0.86, p<0.0001]). Cells related to D. thiozymogene, however, did not specifically associate with one of the four populations currently meant to represent all small-celled phototrophic sulfur bacteria although these displayed different distribution profiles in the chemocline suggesting different ecophysiological adaptations (Tonolla et al., 2000). Probes DSC213 and DSC441 detected cells in aggregates formed by all four populations as shown by in situ hybridization concomitantly using Cy3- labeled probes targeting bacteria related to D. thiozymogenes and Cy5-labeled probes targeting the Vertical distribution ofsulfat e-reducing bacteria 87 specific populations of small-celled phototrophic sulfur bacteria (Fig. 4.3). Although these results did not provide evidence for a specific inten elationship between a single population of small celled phototrophic sulfur bacteria and cells related to D. thiozymogenes, they provide strong evidence of a tight association between small-celled photot:rophic sulfur bacte1ia and bacteria related to D. thiozymogenes.

Figure 4.3 In situ detection of sulfate-reducing bacteria related to D. thiozymogenes with Cy3-labeled probes DSC213 and DSC441 (a). Concomitantly, yet tmcultured small-celled phototrophic sulftu· bacteria (population F) were detected w'itlt Cy5- labeled probe S453F (b) as shown in tlte upper right portion of the aggregate. TI1e remaining cells represent autofluorescent, non-target small-celled phototrophic sulfiu· bacteria. Aiwws indicate hybridizing cells. Bar represents 10 µm.

Since the interaction is specific for sulfate-reducing bacteria related to D. thiozymogenes, specific traits of this bacterium can be used as fuither indications on the potential interactions that may take place in the aggregate even though phylogenetic relationships do not necessruily reflect physiological relationships (Pace, 1999; Achenbach and Coates, 2000; Zinder and Salyers, 2001). In addition to sulfate reduction, D. thiozymogenes DSM7269 can grow by dispropo1tionation of thiosulfate and sulfite to sulfate and sulfide (Janssen et al. , 1996). Similar to D. sulfoexigens DSM10523 and Desulfobulbus propionicus DSM2032 (Finster et al., 1998; Lovely and Phillips, 1994), D. thiozymogenes can also grow by dispropo1tionation of elemental sulfur, though only in the presence of a sulfide scavenger such as amo1phous f en ic hydroxide, generally resulting in the fo1mation of sulfate along with iron sulfides (Lovely and Phillips, 1994; Thamdrnp et al., 1993) and thus removing free sulfide from the culture (Janssen et al., 1996). Since the small-celled phototrophic sulfui· bacte1ia Lamprocystis p urpurea and L. roseopersicina both photo-oxidize sulfide to sulfui· and fuither to sulfate (Eichler and Pfennig, 1988 ; Imhoff, 2001), small-celled phototrophic sulfui· bacte1ia in the 88 Chapter 4 chemocline of Lake Cadagno might act as sulfide scavengers creating a sink for sulfide produced by sulfur disproportionation of the sulfate-reducing bacteria in the association. The interaction might be mutualistic since either sulfate-reduction or disproportionation in association with aggregates of small- celled phototrophic sulfur bacteria might overcome sulfide limitations of small-celled phototrophic sulfur bacteria during periods of intensive photo-oxidation.

In addition to sulfide, members of the genus Lamprocystis can also photo-oxidize elemental sulfur and thiosulfate (Imhoff, 2001). During photo-oxidation globules of elemental sulfur are stored intracellularly as intermediary oxidation products which can be further oxidized or, in the dark, be reduced by oxidation of internal storage products like glycogen (Mas and Van Gemerden, 1995). Under such conditions an association with sulfate-reducing bacteria would be commensalistic since it would not provide an obvious advantage for the phototrophic sulfur bacteria. However, since both organisms are metabolically highly versatile, interactions may not be limited to sulfur compounds only. During sulfate reduction and concomitant oxidation of organic substrates small organic molecules such as acetate might be excreted by the sulfate-reducing bacteria which could further be used by small-celled phototrophic bacteria growing under mixotrophic conditions (Eichler and Pfennig, 1988). Also, an association creates relatively stable microenvironmental conditions in a habitat where bioturbation phenomena or continuous movement of the plume due to chemo- or phototaxis result in rapid changes of environmental conditions (e.g. intensity of light, sulfide concentrations) (Egli et al., 1998; Hanselmann and Hutter, 1998; Lüthy et al., 2000).

Thus, the association between small-celled phototrophic sulfur bacteria and bacteria related to D. thiozymogenes could be commensalistic or mutualistic. However, the fundamental interactions between both organisms can only be elucidated with detailed pure culture studies on both partners of the association. Future perspectives will therefore focus on the isolation of both small-celled phototrophic sulfur bacteria as well as the bacteria related to D. thiozymogenes from the chemocline of Lake Cadagno, on the evaluation of their metabolic capacity and similarity with their closest cultured relatives, on the demonstration of aggregate formation and association of both organisms in vitro and the demonstration of beneficial effects of mixed cultures on growth performance of both organisms.

Acknowledgements Sandro Peduzzi and Mauro Tonolla contributed equally to the study. This work was supported by grants from the Swiss National Science Foundation (SNSF) (NF31-46855.96) and the canton of Ticino (Switzerland). During the work in the U.S.A, S.P. was supported by a fellowship from the SNSF Commission of the University of the Italian-speaking Switzerland (81IT-59640). The authors are indebted to N. Ruggeri and A. Caminada for technical support. Vertical distribution of sulfate-reducing bacteria 89

References

Achenbach L. A. and Coates J. D. (2000) Disparity between bacterial phylogeny and physiology. ASM News 66: 714-715. Amann R. I., Binder B. J., Olsen R. J., Chisholm S. W., Devereux R. and Stahl D. A. (1990) Combination of 16S rRNA-targeted oligonucleotide probes with flow cytometry for analyzing mixed microbial populations. Appl. Environ. Microbiol. 56: 1919-1925. Bensadoun J.-C., Tonolla M., Demarta A., Barja F. and Peduzzi R. (1998) Vertical distribution and microscopic characterization of a non-cultivable micro-organism (morphotype R) of Lake Cadagno. Doc Ist. Ital. Idrobiol. 63: 45-51. Caldwell D. E. and Tiedje J. M. (1975) A morphological study of anaerobic bacteria from the hypolimnia of two Michigan lakes. Can. J. Microbiol. 21: 362-376. Del Don C., Hanselmann K. W., Peduzzi R. and Bachofen R. (1994) Biomass composition and methods for the determination of metabolic reserve polymers in phototrophic sulfur bacteria. Aquat. Sci. 56: 1-15. Del Don C., Hanselmann K. W., Peduzzi R. and Bachofen R. (2001) The meromictic alpine Lake Cadagno: orographical and biogeochemical description. Aquat. Sci. 63: 70-90. DEV (2000) Deutsche Einheitsverfahren zur Wasser-, Abwasser- und Schlamm-Untersuchung. Physikalische, chemische, biologische und bakteriologische Verfahren. Fachgruppe in der GDCh Wasserchemische Gesellschaft und Deutsches Institut für Normung (DIN). Wiley-VCH, Weinheim, Germany. DeWeerd K. A., Mandelco L., Tanner R. S., Woese C. R. and Suflita J. M. (1990) Desulfomonile tiedjei gen. nov. and sp. nov., a novel anaerobic, dehalogenating, sulfate-reducing bacterium. Arch. Microbiol. 154: 23-30. Egli K., Wiggli M., Klug J. and Bachofen R. (1998) Spatial and temporal dynamics of the cell density in a plume of phototrophic microorganisms in their natural environment. Doc. Ist. Ital. Idrobiol. 63: 121-126. Eichler B. and Pfennig N. (1988) A new purple sulfur bacterium from stratified freshwater lakes, Amoebobacter purpureus sp. nov. Arch. Microbiol. 149: 395-400. Finster K., Liesack W. and Thamdrup B. (1998) Elemental sulfur and thiosulfate disproportionation by Desulfocapsa sulfoexigens sp. nov., a new anaerobic bacterium isolated from marine surface sediment. Appl. Environ. Microbiol. 64: 119-125. Fischer C., Wiggli M., Schanz F., Hanselmann K. W. and Bachofen R. (1996) Light environment and synthesis of bacteriochlorophyll by populations of Chromatium okenii under natural environmental conditions. FEMS Microbiol. Ecol. 21: 1-9. Gilboa-Garber N. (1971) Direct spectrophotometric determination of inorganic sulfide in biological materials and in other complex mixtures. Anal. Biochem. 43: 129-133. Glöckner F. O., Amann R. I., Alfreider A., Pernthaler J., Psenner R., Trebesius K. and Schleifer K.-H. (1996) An optimized in situ hybridization protocol for planktonic bacteria. System. Appl. Microbiol. 19: 403-406. Hanselmann K. W. and Hutter R. (1998) Geomicrobiological coupling of sulfur and iron cycling in anoxic sediments of a meromictic lake: sulfate reduction and sulfide sources and sinks in Lake Cadagno. Doc. Ist. Ital. Idrobiol. 63: 85-98. Imhoff J. F. (2001) Transfer of Pfennigia purpurea Tindall 1999 (Amoebobacter purpureus Eichler and Pfennig 1988) to the genus Lamprocystis as Lamprocystis purpurea comb. nov. Int. J. Syst. Evol. Microbiol. 51: 1699-1701. 90 Chapter 4

Janssen P. H., Schuhmann A., Bak F. and Liesack W. (1996) Disproportionation of inorganic sulfur compounds by the sulfate-reducing bacterium Desulfocapsa thiozymogenes gen. nov., sp. nov. Arch. Microbiol.166: 184-192. Lehmann C., Lüthy L. and Bachofen R. (1998) Tools for the evaluation of sources and sinks of sulfide in Lake Cadagno. Doc. Ist. Ital. Idrobiol. 63: 99-104. Lovely D. R. and Phillips E. J. P. (1994) Novel processes for anaerobic sulfate reduction from elemental sulfur by sulfate-reducing bacteria. Appl. Environ. Microbiol. 60: 2394-2399. Lüthy L., Fritz M. and Bachofen R. (2000) In situ determination of sulfide turnover rates in a meromictic alpine lake. Appl. Environ. Microbiol. 66: 712-717. Manz W., Amann R., Ludwig W., Wagner M. and Schleifer K.-H. (1992) Phylogenetic oligodeoxynucleotide probes for the major subclasses of proteobacteria: problems and solutions. System. Appl. Microbiol. 15: 593-600. Manz W., Eisenbrecher M., Neu T. R. and Szewzyk U. (1998) Abundance and spatial organization of Gram-negative sulfate-reducing bacteria in activated sludge investigated by in situ probing with specific 16S rRNA targeted oligonucleotides. FEMS Microbiol. Ecol. 25: 43-61. Mas J. and van Gemerden H. (1995) Storage products in purple and green sulfur bacteria, p. 973- 990. In: R. E. Blankenship, M. T. Madigan, C. E. Bauer (eds), Anoxygenic photosynthetic bacteria, Kluwer Academic Publishers, The Netherlands. Pace N. R. (1999) Microbial Ecology & Diversity. ASM News 65: 328-333. Peduzzi R., Demarta A. and Tonolla M. (1993) Dynamics of the autochthonous and contaminant bacterial colonization of lakes (Lake Cadagno and Lake of Lugano as model systems), p. 323-335. In: J.-P. Vernet (eds), Studies in Environmental Science 55: Environmental Contamination, Elsevier Publ., Amsterdam, The Netherlands. Rabus R., Fukui M., Wilkes H. and Widdel F. (1996) Degradative capacities and 16S rRNA- targeted whole-cell hybridization of sulfate-reducing bacteria in an anaerobic enrichment culture utilizing alkylbenzenes from crude oil. Appl. Environ. Microbiol. 62: 3605-3613. Sun B., Cole J. R. and Tiedje J. M. (2001) Desulfomonile limimaris sp. nov., an anaerobic dehalogenating bacterium from marine sediments. Int. J. Syst. Evol. Microbiol. 51: 365-371. Thamdrup B., Finster K., Hansen J. W. and Bak F. (1993) Bacterial disproportionation of elemental sulfur coupled to chemical reduction of iron or manganese. Appl. Environ. Microbiol. 59: 101-108. Tonolla M., Demarta A., Hahn D. and Peduzzi R. (1998a) Microscopic and molecular in situ characterization of bacterial populations in the meromictic Lake Cadagno. Doc. Ist. Ital. Idrobiol. 63: 31-44 Tonolla M., Demarta A. and Peduzzi R. (1998b) The chemistry of Lake Cadagno. Doc. Ist. Ital. Idrobiol. 63: 11-17. Tonolla M., Demarta A., Peduzzi R. and Hahn D. (1999) In situ analysis of phototrophic sulfur bacteria in the chemocline of meromictic Lake Cadagno (Switzerland). Appl. Environ. Microbiol. 65: 1325-1330. Tonolla M., Demarta A., Peduzzi S., Hahn D. and Peduzzi R. (2000) In situ analysis of sulfate- reducing bacteria related to Desulfocapsa thiozymogenes in the chemocline of meromictic Lake Cadagno (Switzerland). Appl. Environ. Microbiol. 66: 820-824. Wagener S., Schulz S. and Hanselmann K. W. (1990) Abundance and distribution of anaerobic protozoa and their contribution to methane production in Lake Cadagno (Switzerland). FEMS Microbiol. Ecol. 74: 39-48. Vertical distribution of sulfate-reducing bacteria 91

Zarda B., Hahn D., Chatzinotas A., Schönhuber W., Neef A., Amann R. I. and Zeyer J. (1997) Analysis of bacterial community structure in bulk soil by in situ hybridization. Arch. Microbiol. 168: 185-192. Zinder S. H. and Salyers A. A. (2001) Microbial ecology-new directions, new importance. p. 101- 109. In: D. R. Boone, R. W. Castenholz (eds), Bergey's Manual of Systematic Bacteriology. Williams and Wilkins, Baltimore.

Chapter 5

Isolation and characterization of aggregate-forming sulfate-reducing and purple sulfur bacteria from the chemocline of meromictic Lake Cadagno, Switzerland

Sandro Peduzzi1,2, Mauro Tonolla2 and Dittmar Hahn1

1Dept. of Chemical Engineering, New Jersey Institute of Technology (NJIT), and Dept. of Biological Sciences, Rutgers University, 101 Warren Street, Smith Hall 135, Newark, NJ, USA

2Istituto Cantonale di Microbiologia, Via Mirasole 22, CH-6500 Bellinzona, Switzerland

FEMS Microbiology Ecology, 45: 29-37 (2003) 94 Chapter 5

5.1 Abstract

In situ hybridization with specific oligonucleotide probes was used to monitor enrichment cultures of yet uncultured populations of sulfate-reducing and small-celled purple sulfur bacteria found to associate to aggregates in the chemocline of meromictic Lake Cadagno, Switzerland, and to select potential isolates. Enrichment and isolation conditions resembled those of their nearest cultured relatives, the sulfate-reducing bacterium Desulfocapsa thiozymogenes and small-celled purple sulfur bacteria belonging to the genus Lamprocystis, respectively. Based on comparative 16S rRNA analysis and physiological characterization, isolate Cad626 was found to resemble D. thiozymogenes although it differed from the type strain by its ability to grow on lactate and pyruvate. Like D. thiozymogenes, isolate Cad626 was able to disproportionate inorganic sulfur compounds (sulfur, thiosulfate, sulfite) and to grow, although growth on sulfur required a sulfide scavenger (FeOOH). Isolate Cad16 represented small celled purple sulfur bacteria belonging to population F related to L. purpurea as evidenced by comparative 16S rRNA analysis and the presence of bacteriochlorophyll a and the carotenoid okenone. Mixed cultures of isolates Cad626 and Cad16 resulted in their association in aggregates similar to those observed in the chemocline of Lake Cadagno. Concomitant growth enhancement of both isolates in mixed culture suggested synergistic interactions that presumably resemble a source-sink relationship for sulfide between the sulfate-reducing bacterium growing by sulfur disproportionation and the purple sulfur bacteria acting as biotic scavenger.

Key words: Desulfocapsa thiozymogenes; Lamprocystis, okenone; sulfide scavenger; sulfur disproportionation

5.2 Introduction

Permanently stratified lakes such as the meromictic Lake Cadagno, Switzerland, represent optimal model systems for the study of aquatic microorganisms since defined and stable vertical gradients of environmental conditions such as light intensity and quality, oxygen availability, or the presence of sulfide support the development of diverse species of microorganisms adapted to defined ecological niches (Gorlenko et al., 1983). Lake Cadagno is characterized by a permanent stratification stabilized by density differences of salt rich water constantly supplied by subaquatic springs to the monimolimnion and of electrolyte-poor surface water feeding the mixolimnion (Del Don et al., 2001). A permanent chemocline generally found at a depth between 11 and 13 m and characterized by high concentrations of sulfate and steep gradients of sulfide (Hanselmann and Hutter, 1998; Lehmann et al., 1998) supports the growth of elevated numbers of bacteria (up to 107 cells ml-1) indicating that a bacterial community making use of these gradients is present (Tonolla et al., 1998, 1999). Depending Isolation and characterization of aggregate forming sulfate-reducing and purple sulfur bacteria 95 on the season as much as 35 to 45% of the total microbial community are associated in aggregates consisting of small-celled purple sulfur bacteria (15 to 35% of the total microbial community) (Tonolla et al., 2002; Peduzzi et al., 2003) and sulfate-reducing bacteria (13 to 18% of the total microbial community) (Peduzzi et al., 2003). Molecular methods identified four major populations of purple sulfur bacteria in these aggregates forming a tight cluster with the genus Lampocystis, i.e. L. purpurea, L. roseopersicina, and two yet uncultured populations D and F (Tonolla et al., 2002). All four populations form associations with sulfate-reducing bacteria related to Desulfocapsa thiozymogenes (Tonolla et al., 2002). The latter account for up to 72% of all sulfate-reducing bacteria and are almost completely representing those belonging to the family Desulfovibrionaceae (Peduzzi et al., 2003). The association between small-celled purple sulfur bacteria and these sulfate-reducing bacteria is not obligate since non-associated cells of bacteria related to D. thiozymogenes were frequently found in winter and early summer when limited light conditions caused by snow and ice cover had reduced the abundance of small-celled phototrophic sulfur bacteria to below 25% of the values found in late summer (Peduzzi et al., 2003). Nonetheless, the association suggests an ecological advantage to both groups of organisms under appropriate environmental conditions. Since the bacterial partners of the association in the chemocline of Lake Cadagno have not been obtained in pure culture yet, specific traits of their closest cultured relatives have been used previously to speculate about their potential interactions in the aggregate (Peduzzi et al., 2003; Tonolla et al. 2000, 2002) even though it was acknowledged that phylogenetic relationships not necessarily reflect metabolic similarities (Achenbach and Coates, 2000). D. thiozymogenes DSM7269, for example, can grow by disproportionation of thiosulfate and sulfite to sulfate and sulfide (Janssen et al., 1996). It also disproportionates elemental sulfur, though growth was only observed in the presence of a sulfide scavenger such as amorphous ferric hydroxide (Janssen et al., 1996), similar to conditions found for D. sulfoexigens DSM10523 and Desulfobulbus propionicus DSM2032 (Finster et al., 1998; Lovely and Phillips, 1994). This generally results in the formation of sulfate along with iron sulfides (Lovely and Phillips, 1994; Thamdrup et al., 1993) and thus removes free sulfide from the culture (Janssen et al., 1996). The small-celled phototrophic sulfur bacteria L. purpurea and L. roseopersicina both photo- oxidize sulfide to sulfur and further to sulfate (Eichler and Pfennig, 1988; Imhoff, 2001). Small-celled phototrophic sulfur bacteria in the chemocline of Lake Cadagno might therefore act as sulfide scavengers creating a sink for sulfide produced by sulfur disproportionation of the sulfate-reducing bacteria in the association. The consumption of sulfide by small-celled sulfur phototrophic bacteria might therefore enhance the activity of bacteria related to D. thiozymogenes while these would provide a continuous supply of electron donors for the small-celled phototrophic sulfur bacteria. Thus, principally the association would benefit both small-celled sulfur phototrophic bacteria as well as the bacteria related to D. thiozymogenes. 96 Chapter 5

Such speculations, however, can only be confirmed with detailed pure culture studies with both partners of this association. The aim of this study was therefore to isolate both small-celled sulfur phototrophic bacteria as well as the bacteria related to D. thiozymogenes found in the chemocline of Lake Cadagno, to confirm their metabolic similarity with their closest cultured relatives, to show aggregate formation and association of both organisms in vitro and to demonstrate beneficial effects of mixed culture on growth performance of both organisms.

5.3 Material and methods

5.3.1 Enrichment and isolation Samples from the chemocline of Lake Cadagno were taken with a “Friedinger” type bottle (Zuellig AG, Rheineck, Switzerland) at the maximum of turbidity corresponding to the highest bacterial density in October 1999. Samples were used to completely fill 0.5L screw-cap glass bottles that were subsequently stored in the dark at 4LC for a week. Aggregates of sulfate-reducing and small-celled phototrophic sulfur bacteria, macroscopically identified by the characteristic purple-red color of the phototrophic sulfur bacteria, that accumulated at the neck of the bottle and under the screw-cap were then collected with a previously gassed syringe (N2) and served as concentrated inoculum for liquid and deep agar dilutions (1% v/v) prepared by the Hungate technique (Pfennig, 1978; Widdel and Bak, 1992). Media for both sulfate-reducing as well as purple sulfur bacteria were prepared in a 2L-bottle with a N2/CO2 (80%/20%) gas phase according to Widdel and Bak (1992). Sulfate-reducing bacteria related to D. thiozymogenes were enriched and cultivated in a bicarbonate- -1 -1 buffered (30 ml L of 1M of NaHCO3 in water solution), sulfide-reduced (1 ml L of a 1M Na2S in -1 -1 water solution) and sulfate-free basal medium that also contained (L ) 0.5 g of KH2PO4 l , 0.3 g of

NH4Cl, 0.5 g of MgCl26H2O, 0.1 g of CaCl22H2O, 1 ml of non-chelated trace element mixture, 1 ml of selenite-tungstate solution, 1 ml of vitamin mixture, 1 ml of vitamin B12 solution, and 1 ml of thiamine solution (Widdel and Bak, 1992). Before inoculation, different combinations of electron donors and acceptors were aseptically added from sterile stock solutions (final conc.): ethanol (5 mM) and sulfate (20 mM); propanol (5 mM) and sulfate (20 mM); lactate (5 mM) and sulfate (20 mM); and thiosulfate (10 mM) and acetate (1 mM) as used for the isolation of D. thiozymogenes DSM7269

(Janssen et al., 1996). Headspace gas was 80% N2 and 20% CO2. Small-celled phototrophic sulfur bacteria were enriched and cultured in medium containing (L-1) 0.25 g KH2PO4, 0.34 g NH4Cl, 0.5 g MgSO4 x 7H2O, 0.25 g CaCl2 x 2H2O, 0.34 g KCl, 1.5 g NaHCO3, 0.5 ml trace element solution SL10, and 0.02 mg vitamin B12 (Eichler and Pfennig, 1988). The medium was -1 reduced with 0.3 g L Na2S x 9H2O (1.10 mM final conc.) and adjusted to a pH around 7.2. Acetate (2 mM) was added to pure cultures of phototrophic bacteria. All cultures were incubated at room temperature (20-23°C). Sulfate-reducing bacteria were incubated in the dark, while purple sulfur bacteria were subjected to a photoperiod (6h light/6h dark) with low Isolation and characterization of aggregate forming sulfate-reducing and purple sulfur bacteria 97 light intensities generated with an incandescent 40W bulb placed at a distance of 60 cm from the cultures (Eichler and Pfennig, 1988). Enrichments of sulfate-reducing bacteria in liquid culture were periodically checked for growth by microscopy and for sulfide formation or iron sulfide precipitation, when FeOOH was present. Small-celled phototrophic sulfur bacteria were initially enriched exploiting the tendency of gas-vacuolated species to accumulate in the upper part of the culture bottle (Eichler and Pfennig, 1988; Pfennig and Trüper, 1992). Several transfers with cells taken from the surface of the culture vessel (Pfennig and Trüper, 1989) thus preceded the purification steps in agar-shake dilutions series (Pfennig, 1978). Enrichments in liquid media as well as single colonies from deep agar dilutions were always re-suspended in 5 ml liquid medium before inoculation into a new agar-shake series.

5.3.2 Identification and characterization Enrichments and single colonies were analyzed for target organisms by in situ hybridization in a top- to-bottom approach. Sulfate-reducing bacteria were initially monitored using Cy3-labeled probes SRB385 (Amann et al., 1990) and SRB385Db (Rabus et al., 1996) targeting members of the families Desulfovibrionaceae and Desulfobacteriaceae, respectively. Cells hybridizing with probe SRB385 were further analyzed with probe SRB441 targeting yet uncultured free-living sulfate-reducing bacteria with no identified cultured relative and combined probes DSC213 and DSC441 targeting sulfate-reducing bacteria related to D. thiozymogenes (Tonolla et al., 2000). Small-celled phototrophic sulfur bacteria were analyzed with Cy3-labeled probes Apur453 targeting Lamprocystis purpurea DSM4197, Laro453 targeting L. roseopersicina DSM229, and S453D and S453F, both targeting yet uncultured populations of phototrophic sulfur bacteria (Tonolla et al., 1999). In situ hybridization was performed on aliquots (3 µl) of fresh cultures spotted onto gelatin-coated slides (Glöckner et al., 1996) as described previously (Tonolla et al., 1999, 2000). A strain was considered pure when all cells hybridized with one specific probe. Purity of sulfate-reducing strains was also tested using the medium described above supplemented with 0.25% (w/v) yeast extract, 5mM pyruvate, 5mM glucose and 5mM fumarate (Janssen et al., 1996). Pure cultures that hybridized to probes DSC213 and DSC441 (targeting sulfate-reducing bacteria related to D. thiozymogenes) or to probe S453F (targeting yet uncultured phototrophic sulfur bacteria) were initially identified by comparative 16S rRNA sequence analysis. Nucleic acids were extracted from pure cultures using the MagNA Pure LC automated extractor (Roche Molecular Biochemicals, Indianapolis, Ind.) and the DNA isolation extraction kit produced by the same manufacturer. 16S rDNA was amplified and purified as described previously (Tonolla et al., 1999) and sequenced with an ABI PRISM Ready Reaction dye deoxy terminator cycle sequencing kit and an ABI Prism 310 atomated sequencer (Perkin-Elmer). Sequences were aligned with a subset of bacterial 16S rDNA sequences obtained from the Ribosomal Database Project (RDP) (Maidak et al., 1997) by using the 98 Chapter 5

CLUSTAL W service at EBI (Higgins et al., 1994). Sequences from the 16S rRNA gene clone library of Lake Cadagno (Demarta, 1998; Tonolla et al., 1999, 2000) as well as sequences of other purple sulfur and sulfate-reducing bacteria were included in the phylogenetic analysis. Phylogenetic relationships were estimated using the Phylogeny Inference Package (PHYLIP version 3.573c). Kimura-2-Parameters evolutionary distances were calculated using the DNADIST program and phylogenetic trees were derived using the FITCH program with random order input of sequences and the global rearrangement option (Felstein, 1990). The sequences obtained were deposited in the EMBL/GenBank databases with accession numbers AJ511274 (Cad16) and AJ511275 (Cad626), respectively. The sulfate-reducing bacterium, isolate Cad626, was further characterized with respect to its ability to grow with different electron donors and acceptors (Janssen et al., 1996). Desulfocapsa thiozymogenes DSM7269 purchased from the Deutsche Sammlung von Mikroorganismen und Zellkulturen (Braunschweig, Germany) was analyzed concomitantly. Metabolic characteristics of both organisms were compared to published data from Janssen et al. (1996). Stock solutions (300 mM) of amorphous ferric hydroxide (FeOOH) solution were prepared as described by Lovely and Philips (1986) and diluted to a final concentration of 30 mM in cultures (Finster et al., 1998; Janssen et al., 1996).

Inorganic sulfur compounds stock solutions, i.e. Na2S2O3, Na2SO3 and flowers of sulfur, were prepared according to Janssen et al. (Janssen et al., 1996). Final concentrations in culture were 10 mM for both thiosulfate and sulfite, and 20-30 mg S ml-1 culture medium (Finster et al., 1998). The small-celled phototrophic sulfur bacterium, isolate Cad16, was further characterized based on morphological criteria and pigment analysis. The absorption spectra of living cells were measured with a UV/VIS Spectrometer Lambda 2S (Perkin-Elmer) in a 1-cm-cuvette following the procedure described by Pfennig (1974). Before measurements, cell suspensions were treated in an ultrasonic bath to reduce scattering (Eichler and Pfennig, 1988). Chemolithoautotrophic growth of strain Cad16 was tested as described by Kämpf and Pfennig (1980). Characteristics of isolate Cad16 were compared to those published for its closest cultured relatives L. purpurea DSM4197 (Eichler and Pfennig, 1988) and strain LcCad1 (Eichler and Pfennig, 1988), and L. roseopersicina DSM229 (Imhoff, 2001; Pfennig and Trüper, 1989).

5.3.3 Mixed culture study Studies on interactions between isolates Cad626 and Cad16 were performed in basal medium used for sulfate-reducing enrichments supplemented with 1 mM acetate and flowers of sulfur in excess (20-30 -1 mg ml ) as the sole energy source for isolate Cad626. Headspace gas was 80% N2 and 20% CO2, and the incubation temperature 20°C. Experiments were carried out in duplicate at low light intensities and a 6-h-light/dark photoperiod for 60 days. Growth of the sulfate-reducing bacterium, isolate Cad626, was analyzed in pure culture, with or without FeOOH as scavenger, and in mixed culture with the Isolation and characterization of aggregate forming sulfate-reducing and purple sulfur bacteria 99 purple sulfur bacterium, isolate Cad16. Growth of isolate Cad16 was monitored in pure culture and in mixed culture with isolate Cad626. Both isolates were inoculated at an initial density of approx. 5 x 105 cells ml-1. Rough estimates of the abundance of both organisms by OD measurements at 440 nm and 650 nm, respectively, were followed by microscopic enumeration after DAPI staining and in situ hybridization with oligonucleotide probes DSC 213 and DSC 441 or probe S453F.

Clone 282 (AJ389626) Clone 368 (AJ389629) 0.02 Isolate Cad626 Clone 330 (AJ389627) Clone 348 (AJ389628) Clone 113 (AJ389625) Clone 167 (AJ389623) Desulfocapsa thiozymogenes (X95181) Desulfocapsa sulfoexigens (Y13672) Desulfofustis glycolicus (X99707) Desulforhopalus vacuolatusus (L42613C) Clone 141 (AJ389624) Clone 22 (AJ389622) Desulfobulbus sp. BG25 (U85473C) Desulfobulbus marinus (M34411) Desulfobulbus elongatus (X95180C) Desulfobulbus propionicus (M34410) Desulforhabdus amnigenus (X83274C) Desulfomonile tiedjei (M26635) Pelobacter propionicus (X70954C) Synthropus busvellii (X85131C) Synthropus busvellii (X85132C) Desulfovibrio profundus (U90726)

Figure 5.1 Neighbor-joining tree showing the relationship of isolate Cad626 to clones from the 16S rRNA gene clone library of lake Cadagno, to Desulfocapsa species and other related sulfate-reducing bacteria. The distance scale indicates the expected number of changes per sequence position. 100 Chapter 5

5.4 Results

5.4.1 Isolation and characterization of the sulfate-reducing bacterium, isolate Cad626 After about 10-12 weeks of incubation, sulfide and iron sulfide formation was detected in enrichments with ethanol, propanol, lactate and thiosulfate as electron donors and acceptor, respectively. Cells hybridizing to probes DSC213 and DSC441, however, were only detected in enrichments with either 1 mM acetate and 10 mM thiosulfate or with 10 mM lactate and 20 mM sulfate. From these enrichments and several subsequent series of agar-shake dilutions with 10 mM lactate and 20 mM sulfate, isolate Cad626 was finally obtained in pure culture with all cells hybridizing to probes DSC213 and DSC441. Comparative sequence analysis of the 16S rRNA gene confirmed the hybridization data placing isolate Cad626 into the -subdivision of Proteobacteria with 99.9% and 99.7% similarity, respectively, to clones 282 (AJ389626) and 368 (AJ389629) previously retrieved from the chemocline of Lake Cadagno, and 97.8% similarity to Desulfocapsa thiozymogenes DSM7269, the closest cultured relative and the type strain of the genus (Fig. 5.1). Cells of isolate Cad626 were gram-negative, motile rods with a width of 0.4-0.5 µm and a length of 1.0-2.2 µm (Fig. 5.2). During exponential growth, single rods were evenly distributed in the culture medium, but developed into elongated cells that formed small aggregates during stationary phase. Growth was inhibited at temperatures higher than 25°C. Cells grew by sulfate reduction (20 mM) and oxidation of butanol, ethanol, lactate, propanol and pyruvate (each 10 mM), but not of acetate, glucose, propionate, and fumarate (each 10 mM) (Table 5.1). In the absence of sulfate, no fermentative growth was observed on butanol, ethanol, lactate, propanol, propionate or pyruvate. Cad626 could grow by thiosulfate and sulfite disproportionation. A scavenger for sulfide was not necessary, although its presence (i.e. amorphous FeOOH) reduced the lag phase and resulted in higher growth yields. Sulfur disproportionation was indicated in the absence of FeOOH through the production of sulfide and sulfate was not accompanied by an increase in cell number. In the presence of FeOOH, Cad626 grew by disproportionation of sulfur. The metabolic characteristics of isolate Cad626 generally resembled those of D. thiozymogenes DSM7269 although it differed from the type strain by its ability to grow on lactate and pyruvate (Table 5.1). Isolation and characterization ofaggregate forming sulfate-reducing and p urple sulfur bacteria 101

a 5µm b 5µm

Figure 5.2 Phase contrast micrographs of isolates Cad16 (a) and Cad626 (b), as well as epifluorescence micrographs of aggregates fonued in the chemocline of Lake Cadagno (c) or by mixed culnu·es of isolates Cad16 and Cad626 (d) after in situ hybridization with probes DSC213 and DSC441 .

5.4.2 Isolation and characterization of the phototrophic sulfur bacterium, isolate Cad16 After about 4-6 weeks of incubation at low light intensity, growth of photot:rophic sulfur bacte1ia was macroscopically detected in emichments. Strain Cadl 6 was isolated from emichments in liquid media with 0.83 mM sulfide as electron donor and 2 mM acetate as organic carbon source after several series of agar-shake dilutions. All cells were hyb1idizing to probe S453F.

Comparative sequence analysis of the 16S rRNA gene confirmed the hybddization data placing isolate Strain Cadl6 into they-subdivision of Proteobacteria with 100% sequence similarity to clone 371 (AJ006061) representing population F of small celled purple sulfur bacteria in the chemocline of Lake Cadagno (Fig. 3). The highest sequence similarities to cultured relatives were found for Lamprocystis p urpurea (95.3%) and L. roseopersicina (95.4%). Table 5.1 Comparison of selected metabolic characteristics of strain Cad626 and its closest cultured relatives

Isolate Cad626 Desulfocapsa Desulfocapsa Desulfocapsa Desulfobulbus Desulfobulbuselong Desulfobulbus Desulforhopalus thiozymogenes thiozymogenes sulfoexigens (DSM propionicus (DSM atus (DSM 2908)a marinus (DSM vacuolatus (DSM (DSM 7269) (Strain Bra2)a 10523)a 2032)a 2058)a 9700)a

Sulfate reduction with

Ethanol +++-++++ Propanol +++-++++ Butanol + + + - n.a n.a n.a - Lactate +- - -++++ Propionate - - - -++++ Pyruvate +---+++(+)3 Acetate ------

Disproportionation of

Sulfur + FeOOH +++++- - - - FeOOH (+)2 (+)2 (+)2 (+)2 n.a - - n.a Thiosulfate + FeOOH +++++n.an.a- - FeOOH + + + + + n.a n.a n.a Sulfite + FeOOH + + + + n.a n.a n.a n.a - FeOOH + + + + n.a n.a n.a n.a aData from Janssen et al., 1996 [11] n.a. not available (+)2 no increase in cells number but disproportionation (+)3 no sulfide detection Isolation and characterization of aggregate forming sulfate-reducing and purple sulfur bacteria 103

Thiocystis violascens (AJ224438) 0.02 Thiocystis gelatinosa (Y11317) Thiocystis violacea (Y11315) Clone 359 (AJ006221) Chromatium okenii (AJ223234) Allochromatium vinosum (M26629) Thiococcus pfennigii (Y12373) Thiolamprovum pedioforme (Y12297) Thiocapsa roseopersicina strain 5811 (AF112998) Thiocapsa rosea (AJ006062) Thiocapsa sp. (Y12298) Clone 371 (AJ006061) Isolate Cad16 Clone 335 (AJ006059) Unnamed purple bacterium strain Thd2 (X78718) Clone 136 (AJ006057) Lamprocystis roseopersicina (AJ006063) Clone 261 (AJ006058) Clone 345 (AJ006060) Lamprocystis purpurea (AJ223235) Achromatium sp. strain HK6 (AF129555) Isochromatium buderii (AJ224430) Halochromatium glycolicum (X93472) Marichromatium purpuratum (AJ224439) Thiorhodovibrio winogradskyi (Y12368)

Figure 5.3 Neighbor-joining tree showing the relationship of isolate Cad16 to clones from the 16S rRNA gene clone library of lake Cadagno, to Lamprocystis species and other related phototrophic sulfur bacteria. The distance scale indicates the expected number of changes per sequence position.

Cells of strain Cad16 were non-motile, spherical to oval cells of 1.4 µm to 2.4 µm wide (Fig. 5.2; Table 5.2). In liquid media strain Cad16 developed as single cells as well as in irregular aggregates of variable size with up to about 100 cells. Cells of strain Cad16 stained gram-negative, contained gas vacuoles and had a slime capsule. Bright field microscopy revealed the presence of sulfur globules in the cells. The color of cell suspensions was purple-red. In vivo absorption spectra of cell suspensions displayed absorption maxima at 833 nm, 582 nm and 374 nm indicating the presence of bacterioclorophyll a and one at 528 nm suggesting the presence of the carotenoid okenone (Fig. 5.4). Photolithoautotrophic growth of strain Cad16 under anaerobic conditions occurred with hydrogen sulfide, and elemental sulfur as electron donors. Globules of sulfur were stored inside the cells as intermediary oxidation products. In the presence of carbon dioxide and sulfide, photoassimilation of acetate was observed. Chemolithoautotrophic growth was observed with hydrogen sulfide or thiosulfate under micro-oxic conditions in the dark. These characteristics correspond to those published for L. purpurea DSM4197 and strain LcCad1 (Table 5.2). 104 Chapter 5

Table 5.2 Comparison of some characteristics of strain Cad16, isolated from chemocline samples of Lake Cadagno as a representative of purple sulfur bacteria belonging to population F, with those of its closest cultured relatives Population F Lamprocystis purpurea Lamprocystis purpurea Lamprocystis (Strain Cad16) (Strain LcCad1) (DSM4197T) roseopersicina (DSM229)

Shape Spherical to oval Spherical to oval Spherical to oval Spherical Size (µm) 1.4-2.4 3.3-3.8 x 3.5-4.5 1.9-2.3 x 2.0-3.2 3.0-3.5 Aggregate formation ++++ Gas vacuoles ++++ Sulfur storage +++n.d. Slime capsule +++ - Color of cell suspension purple-red purple-red purple-red purple Motility ---+ Carotenoid group okenone okenone okenone lycopenal, lycopenol Chemolithotrophic +++ _ growth n.d., not determined

374 528

582 833 Absorption (Relative O.D.) (Relative Absorption

300 400 500 600 700 800 900 1000 Wavelength (nm)

Figure 5.4 Absorption spectrum of living cells of isolate Cad16. The presence of bacteriochlorophyll a is indicated by absorption peaks at 833 nm, 582 nm and 374 nm, that of the carotenoid okenone by the absorption peak at 528 nm. Isolation and characterization ofaggregate forming sulfate-reducing and purple sulfur bacteria 10 5

5.4.3 Mixed culture study Mixed cultures of the sulfate-reducing bacterium, isolate Cad626, and the purple sulfur bacterium, isolate Cadl6, generally resulted in higher cell numbers for both organisms than obtained in pure culture under the same conditions. Highest numbers were obtained for isolate Cad626 in pure culture in the presence ofFeOOH as sulfide scavenger with cell numbers increasing about 155-fold during the incubation pe1iod of 60 days. No growth of isolate Cad626 was obse1ved in the absence of FeOOH (Fig. 5.5). Without FeOOH, but in the presence of isolate Cadl6, however, Cad626 grew significantly with number of cells increasing about 47-fold during the incubation pe1iod of 60 days. Cadl6 grew in pure culture though at lower cell density than in mixed culture with Cad626 (Fig. 5.6). During the incubation, sulfide was not detectable in mixed cultures and in pure cultures with FeOOH. In pure as well as in mixed cultures, cells of the small-celled purple sulfur bacterium Cadl 6 developed aggregates dming the incubation pe1iod (Fig. 5.2). In contrast to the appearance of these aggregates in the chemocline of Lake Cadagno, however, they seemed to be less dense (Fig. 5.2). In mixed cultures, the sulfate reducing bacte1ium Cad626 in pa1t associated with these aggregates but was also obse1ved with no direct contact to cells of Cadl 6. With about half of the cells of Cad626 being non-associated, their propo1tion was higher compared to obse1vations in the chemocline of Lake Cadagno. Isolate Cadl 6 grew faster than the sulfate reducing bacterium Cad626 which resulted in large propo1tional shifts from about 1 at the beginning of the incubation to 0.12 after 60 days. The latter propo1tion approximated the value generally found in the chemocline of Lake Cadagno in June (0.18).

10

'7 -8 r- 0 .._.,"""ii< C'll

~ -Cj ~ 4 0 '""~ .c 2 8 z=

0 20 40 60 days

Figure 5.5 Growth of the sulfate-reducing bacterium, isolate Cad626, in pure culhU'e, with ( o) or without ( • ) FeOOH as scavenger, or in mixed culhU'e with isolate Cadl6 (• ),a small-celled purple sulfiu· bacteriwu representing population F. 106 Chapter 5

5.5 Discussion

A variety of methods can be used for the isolation and cultivation of physiologically and genetically different bacteria from environmental samples. The reliance on culture techniques alone, however, bears the 1isk to retrieve the most easily culturable bacte1ia from the natural community only, and not the most frequently occuning ones (Devereux et al., 1992; Tuomi et al. , 1997). Our isolation attempt on yet uncultured populations of sulfate-reducing and small-celled purple sulfur bacteria from the chemocline of Lake Cadagno took advantage of results of previous studies that provided background data on the usefulness of molecular tools, i.e. specific probes detecting the dominant bacteiial populations in the chemocline (Peduzzi et al. , 2003; Tonolla et al., 1999, 2000, 2002). Using these tools, we were successfully following the strategy of others to monitor enrichment cultures (Ra.bus et al., 1996; Purdy et al., 1997; Kane et al. , 1993) with the aim to isolate bacte1ia with a high ecological significance, i.e. a numerical abundance with up to 50% of the total number of bacteria and a potential interaction since they were found to occur mainly associated in aggregates in the chemocline of Lake Cadagno (Peduzzi et al., 2003).

.... .:... -e 2

0 20 40 60 days

Figure 5.6 Growih of isolate Cadl 6, a small-celled purple sulfiu· bacteritun representing population F in pm·e culttu·e ( o) and in mixed culture with the sulfate-reducing isolate Cad626 ( • )

Although phylogenetic relationships do not necessarily reflect physiological relationships (Achenbach and Coates, 2000; Zinder and Saylers, 2001; Pace, 1999), eruichment and isolation conditions that resembled those for the nearest cultured relatives of our target organisms, the sulfate-reducing bacterium Desulfocapsa thiozymogenes DSM7269 and small-celled purple sulfur bacte1ia belonging to the genus Lamprocystis, respectively, were successfully used to retrieve isolate Cad626 resembling D. Isolation and characterization of aggregate forming sulfate-reducing and purple sulfur bacteria 107 thiozymogenes and isolate Cad16 representing population F related to L. purpurea. The limited number of physiological traits of the isolates analyzed in this study resembled those of D. thiozymogenes and L. purpurea, respectively, that had been used in previous studies to speculate about the potential nature of the association (Peduzzi et al., 2003; Tonolla et al., 2000, 2002). The availability of pure cultures of both organisms now opened up the opportunity to study potential interactions by comparing growth of a mixed culture with that of the respective pure cultures using the same experimental conditions and inoculation densities (Pringault et al., 1999; Biebl and Pfennig, 1978). In mixed culture, cells of both organisms were growing and assembling in aggregates similar to those observed in the chemocline of Lake Cadagno. The cells of Cad626, however, seemed to be more attached to the surface of aggregates of purple sulfur bacteria rather than deeply inserted into the aggregate as encountered in the chemocline (Tonolla et al., 2000, 2002). The association is not obligate since about half of the cells of the sulfate reducing bacterium remained non-associated, a situation similarly encountered in the chemocline of Lake Cadagno during winter and spring when purple sulfur bacteria were significantly reduced numerically due to limited light conditions (Peduzzi et al., 2003). In the presence of large numbers of purple sulfur bacteria in the chemocline during summer and fall, however, most of the Desulfocapsa-like sulfate reducing bacteria were associated (Peduzzi et al., 2003). Although the association is not highly structured as described for phototrophic consortia (Overmann and Schubert, 2002), it seems to be a highly specific synergistic relationship between sulfate reducing bacteria related to the genus Desulfocapsa and four distinct groups of purple sulfur bacteria of the genus Lamprocystis (Peduzzi et al., 2003; Tonolla et al., 2002). In addition to sulfate reduction, isolate Cad626 was able to grow by disproportionation of inorganic sulfur compounds similar to D. thiozymogenes DSM7269 (Janssen et al., 1996). Disproportionation of sulfur to sulfate and sulfide and growth required the presence of a sulfide scavenger (FeOOH) similar to observations with D. thiozymogenes DSM7269 (Janssen et al., 1996), Desulfocapsa sulfoexigens DSM10523 (Finster et al., 1998) and Desulfobulbus propionicus DSM2032 (Lovely and Phillips, 1994). Without sulfide scavenger, Cad626 could not grow. FeOOH, however, could be replaced by the purple sulfur bacterium, isolate Cad16. In mixed culture, isolates Cad626 and Cad16 displayed a synergistic relationship since both benefited from the presence of the other organism showing increased growth compared to pure cultures. These results and the close spatial proximity of both organisms in aggregates suggest a physiological interaction presumably resembling a source-sink relationship for sulfide between the sulfate-reducing bacterium growing by sulfur disproportionation and the purple sulfur bacteria acting as biotic scavenger.

Sulfate-reduction or disproportionation of Cad626 in association with aggregates of Cad16 might also overcome sulfide limitations of these small-celled phototrophic sulfur bacteria during periods of intensive photo-oxidation in the upper part of the layer where the highest light intensities are encountered (Egli et al., 1998; Lüthy et al., 2000; Tonolla et al., 2002). The latter assumption is 108 Chapter 5 probably more pronounced under high light intensity conditions and might explain the closer association between both partners during summer and fall than during winter and spring when low light conditions prevail (Peduzzi et al., 2003; Tonolla et al., 2002). Under artificial conditions in the laboratory with excess of sulfur, the additional sulfide source might only marginally increase its availability for the purple sulfur bacterium and thus explain the only small effect on growth of Cad16. The source-sink relationship for sulfide between both organisms might be a reasonable explanation for their association and the growth increase under laboratory conditions, however, it still remains speculative since no data on sulfur transformations are yet available. Under natural conditions in the chemocline, several additional facets of potential interactions in aggregates must be considered since both organisms are metabolically highly versatile and interactions may not be limited only to sulfur compounds. The metabolic properties of phototrophic sulfur bacteria, for example, are different in the presence or absence of light (Del Don et al., 1994; Camacho et al. 2001; van Gemerden and Mas, 1995) and depend on the position of the organisms in the bacterial plume (Joss et al., 1994; Guerrero et al., 1985). In the absence of light, interactions with sulfate- reducing bacteria might loose their synergistic character if storage polymers such as glycogen or polyhydroxyalkanoates are oxidized with the concomitant reduction of sulfur stored intracellularly (Del Don et al., 1994). Aggregation, however, could also confer better a resiliency of both associated organisms to environmental stresses such as the presence of oxygen (Cypionka, 2000; Krekeler et al., 1997; Teske et al., 1998; Wieringa et al., 2000) that could occur in zones with overlapping oxygenic and anoxygenic photosynthesis (Camacho et al., 2001) or reduced sulfide availability in the upper part of the bacterial layer (Overmann et al., 1991). Thus, further studies on the interaction between isolates Cad626 and Cad16 need to address the effects of varying environmental conditions on growth and aggregate formation of both organisms. In addition, the remaining three populations of uncultured small-celled purple sulfur bacteria must be incorporated into these studies that should also include an attempt to imitate and maintain the environmental conditions found in the upper part of the chemocline of Lake Cadagno.

Acknowledgements

The authors are indebted to Drs. Widdel, Zengler and Amann (Max-Planck Institute for Marine Microbiology, Bremen, Germany) for their generous support and advice during a visit of S.P. in Bremen that was basis for the successful isolation attempts. The authors also like to thank N. Ruggeri and A. Caminada for technical support. This work was supported by grants from the Swiss National Science Foundation (SNSF) (NF31-46855.96) and the canton of Ticino (Switzerland). During the work at Rutgers University, S.P. was supported by a fellowship from the SNSF Commission of the University of Lugano (81IT-59640). Isolation and characterization of aggregate forming sulfate-reducing and purple sulfur bacteria 109

5.6 References

Achenbach L. A. and Coates J. D. (2000) Disparity between bacterial phylogeny and physiology. ASM News 66: 714-715.

Amann R. I., Binder B. J., Olsen R. J., Chisholm S. W., Devereux R. and Stahl D.A. (1990) Combination of 16S rRNA-targeted oligonucleotide probes with flow cytometry for analyzing mixed microbial populations. Appl. Environ. Microbiol. 56: 1919-1925.

Biebl H. and Pfennig N. (1978) Growth yields of green sulfur bacteria in mixed cultures with sulfur and sulfate reducing bacteria. Arch. Microbiol. 117: 9-16.

Camacho A., Erez J., Chicote A., Florin M., Squires M. M., Lehmann C. and Bachofen R. (2001) Microbial microstratification, inorganic carbon photoassimilation and dark carbon fixation at the chemocline of the meromictic Lake Cadagno (Switzerland) and its relevance to the food web. Aquat. Sci. 63: 91-106.

Cypionka H. (2000) Oxygen respiration by Desulfovibrio species. Annu. Rev. Microbiol. 54: 827- 848.

Del Don C., Hanselmann K. W., Peduzzi R. and Bachofen R. (1994) Biomass composition and methods for the determination of metabolic reserve polymers in phototrophic sulfur bacteria. Aquat. Sci. 56: 1-15.

Del Don C., Hanselmann K. W., Peduzzi R. and Bachofen R. (2001) The meromictic alpine Lake Cadagno: orographical and biogechemical description. Aquat. Sci. 63: 70-90.

Demarta A., Tonolla M., Caminada A.-P., Ruggeri N. and Peduzzi R. (1998) Phylogenetic diversity of the bacterial community from the anoxic layer of the meromictic Lake Cadagno. Doc. Ist. Ital. Idrobiol. 63: 19-30.

Devereux R., Kane M. D., Winfrey J. and Stahl D. A. (1992) Genus- and group-specific hybridization probes for determinative and environmental studies of sulfate-reducing bacteria. System. Appl. Microbiol. 15: 601-609.

Egli K., Wiggli M., Klug J. and Bachofen R. (1998) Spatial and temporal dynamics of the cell density in a plume of phototrophic microorganisms in their natural environment. Doc. Ist. Ital. Idrobiol. 63: 121-126.

Eichler B. and Pfennig N. (1988) A new purple sulfur bacterium from stratified freshwater lakes, Amoebobacter purpureus sp. nov. Arch. Microbiol. 149: 395-400.

Felstein J. (1990) PHILIP manual version 3.3. University of California, Berkeley, CA, USA.

Finster K., Liesack W. and Thamdrup B. (1998) Elemental sulfur and thiosulfate disproportionation by Desulfocapsa sulfoexigens sp. nov., a new anaerobic bacterium isolated from marine surface sediment. Appl. Environ. Microbiol. 64: 119-125.

Glöckner F. O., Amann R. I., Alfreider A., Pernthaler J., Psenner R., Trebesius K. and Schleifer K.-H. (1996) An optimized in situ hybridization protocol for planktonic bacteria. System. Appl. Microbiol. 19: 403-406.

Gorlenko V. M., Dubinina G. A. and Kusnetszov S. I. (1983) The ecology of aquatic micro- organisms. Vol. XXVIII. E. Schweizerbart'sche Verlagsbuchandlung, Stuttgart, Germany. 110 Chapter 5

Guerrero R., Montesinos E., Pedrós-Alió C., Esteve I., Mas J., van Gemerden H., Hofman P. A. G. and Bakker J. F. (1985) Phototrophic sulfur bacteria in two Spanish Lakes: vertical distribution and limiting factors. Limnol. Oceanogr. 30: 919-931.

Hanselmann K. and Hutter R. (1998) Geomicrobiological coupling of sulfur and iron cycling in anoxic sediments of a meromictic lake: sulfate reduction and sulfide sources and sinks in Lake Cadagno. Doc. Ist. Ital. Idrobiol. 63: 85-98.

Higgins D., Thompson J., Gibson T., Thompson J. D., Higgins D. G. and Gibson T. J. (1994) CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22: 4673- 4680.

Imhoff J. F. (2001) Transfer of Pfennigia purpurea Tindall 1999 (Amoebobacter purpureus Eichler and Pfennig 1988) to the genus Lamprocystis as Lamprocystis purpurea comb. nov. Int. J. Syst. Evol. Microbiol. 51: 1699-1701.

Janssen P. H., Schuhmann A., Bak F. and Liesack W. (1996) Disproportionation of inorganic sulfur compounds by the sulfate-reducing bacterium Desulfocapsa thiozymogenes gen. nov., sp. nov. Arch. Microbiol. 166: 184-192.

Joss A., Mez K., Kanel B., Hanselmann K. W. and Bachofen R. (1994) Measurement of fluorescence kinetics of phototrophic bacteria in the natural environment. J. Plant Physiol. 144: 333- 338.

Kämpf C. and Pfennig N. (1980) Capacity of Chromatiaceae for chemotrophic growth: specific respiration rates of Thiocystis violacea and Chromatium vinosum. Arch. Microbiol. 127: 125-135.

Kane M. D., Poulsen L. K. and Stahl D. A. (1993) Monitoring the enrichment and isolation of sulfate-reducing bacteria by using oligonucleotide hybridization probes designed from environmentally derived 16S rRNA sequences. Appl. Environ. Microbiol. 59: 682-686.

Krekeler D., Sigalevich P., Teske A., Cypionka H. and Cohen Y. (1997) A sulfate-reducing bacterium from the oxic layer of a microbial mat from Solar Lake (Sinai), Desulfovibrio oxyclinae sp. nov. Arch. Microbiol. 167: 369-365.

Lehmann C., Luehty L. and Bachofen R. (1998) Tools for the evaluation of sources and sinks of sulfide in Lake Cadagno. Doc. Ist. Ital. Idrobiol. 63: 99-104.

Lovely D. R. and Phillips E. J. P. (1986) Organic matter mineralization with reduction of ferric iron in anaerobic sediments. Appl. Environ. Microbiol. 51: 683-689.

Lovely D. R. and Phillips E. J. P. (1994) Novel processes for anaerobic sulfate reduction from elemental sulfur by sulfate-reducing bacteria. Appl. Environ. Microbiol. 60: 2394-2399.

Luthy L., Fritz M. and Bachofen R. (2000) In situ determination of sulfide turnover rates in a meromictic alpine lake. Appl. Environ. Microbiol. 66: 712-717.

Maidak B. L., Olsen G. J., Larsen N., Overbeek R., McCaughey M. J. and Woese C. R. (1997) The RDP (Ribosomal Database Project). Nucleic Acids Res. 25: 109-111.

Overmann J. and Schubert K. (2002) Phototrophic consortia: model systems for symbiotic interrelations between prokaryotes. Arch. Microbiol. 177: 201-208.

Overmann J., Beatty T., Hall K. J., Pfennig N. and Northcote T. G. (1991) Characterization of a dense, purple sulfur bacterial layer in a meromictic lake. Limnol. Oceanogr. 36: 846-859. Isolation and characterization of aggregate forming sulfate-reducing and purple sulfur bacteria 111

Pace N. R. (1999) Microbial Ecology & Diversity. ASM News 65: 328-333.

Peduzzi S., Tonolla M. and Hahn D. (2003) Spatio-temporal distribution of sulfate-reducing bacteria in the chemocline of Lake Cadagno, Switzerland. Aquat. Microb. Ecol. 30: 295-302.

Pfennig N. (1974) Rhodopseudomonas globiformis, sp. nov., a new species of the Rhodospirillaceae. Arch. Microbiol. 100: 197-206.

Pfennig N. (1978) Rhodocyclus purpureus gen. nov. and sp. nov., a ring-shaped, vitamine B12- requiring member of the family Rhodospirillaceae. Int. J. Syst. Bacteriol. 28: 283-288.

Pfennig N. and Trüper H.G. (1989) Anoxygenic phototrophic bacteria, p. 1635-1679. In: J. T. Staley, M. P. Bryant, N. Pfennig and J.C. Holt (eds), Bergey's Manual of Systematic Bacteriology, Williams and Wilkins, Baltimore, USA.

Pfennig N. and Trüper H. G. (1992) The family Chromatiaceae, p. 3199-3221. In: A. Balows, H. G. Trüper, M. Dworkin, W. Harder and K.-H. Schleifer (eds) The prokaryotes, Springer Verlag, New York, USA.

Pringault O., de Wit R. and Kühl M. (1999) A microsensor study of the interactions between purple sulfur and green sulfur bacteria in experimental benthic gradients. Microb. Ecol. 37: 173-184.

Purdy K. J., Nedwell D. B., Embley T. M. and Takii S. (1997) Use of 16S rRNA-targeted oligonucleotide probes to investigate the occurrence and selection of sulfate-reducing bacteria in response to nutrient addition to sediment slurry microcosms from a Japanese estuary. FEMS Microbiol. Ecol. 24: 221-234.

Rabus R., Fukui M., Wilkes H. and Widdel F. (1996) Degradative capacities and 16S rRNA- targeted whole-cell hybridization of sulfate-reducing bacteria in an anaerobic enrichment culture utilizing alkylbenzenes from crude oil. Appl. Environ. Microbiol. 62: 3605-3613.

Teske A., Ramsing N. B., Habicht K., Fukui M., Küver J., Jørgensen B. B. and Cohen, Y. (1998) Sulfate-reducing bacteria and their activities in cyanobacterial mats of Solar Lake (Sinai, Egypt). Appl. Environ. Microbiol. 64: 2943-2951.

Thamdrup B., Finster K., Hansen J.W. and Bak F. (1993) Bacterial disproportionation of elemental sulfur coupled to chemical reduction of iron or manganese. Appl. Environ. Microbiol. 59: 101-108.

Tonolla M., Demarta A., Hahn D. and Peduzzi R. (1998) Microscopic and molecular in situ characterization of bacterial populations in the meromictic Lake Cadagno. Doc. Ist. Ital. Idrobiol. 63: 31-44.

Tonolla M., Demarta A., Peduzzi R. and Hahn D. (1999) In situ analysis of phototrophic sulfur bacteria in the chemocline of meromictic Lake Cadagno (Switzerland). Appl. Environ. Microbiol. 65: 1325-1330.

Tonolla M., Demarta A., Peduzzi S., Hahn D. and Peduzzi R. (2000) In situ analysis of sulfate- reducing bacteria related to Desulfocapsa thiozymogenes in the chemocline of meromictic Lake Cadagno (Switzerland). Appl. Environ. Microbiol. 66: 820-824.

Tonolla M., Peduzzi S., Hahn D. and Peduzzi R. (2002) Seasonal distribution patterns of purple sulfur bacteria in the chemocline of meromictic Lake Cadagno, Switzerland. FEMS Microbiol. Ecol. 43: 89-98.

Tuomi P., Torsvik T., Heldal M. and Bratbak G. (1997) Bacterial population dynamics in a meromictic lake. Appl. Environ. Microbiol. 63: 2181-2188. 112 Chapter 5 van Gemerden H. and Mas J. (1995) Ecology of phototrophic sulfur bacteria, p. 49-85. In: R. E Blankenship, M. T. Madigan, and C. E.Bauer (eds) Anoxygenic photosynthetic bacteria, Kluwer Acad. Publ., Dordrecht, The Netherlands.

Widdel F. and Bak F. (1992) Gram-negative mesophilic sulfate-reducing bacteria, p. 3352-3378. In: A. Balows, H. G. Trüper, M. Dworkin, W. Harder and K.-H. Schleifer (eds) The prokaryotes, Springer Verlag, New York, USA.

Wieringa E.B.A., Overmann J. and Cypionka, H. (2000) Detection of abundant sulphate-reducing bacteria in marine oxic sediment layers by a combined cultivation and molecular approach. Environ. Microbiol. 2: 417-427.

Zinder S. H. and Salyers A. A. (2001) Microbial ecology -new directions, new importance, p. 101- 109. In: D. R. Boone and R. W. Castenholz (eds), Bergey's Manual of Systematic Bacteriology, Williams and Wilkins, Baltimore, USA.

Chapter 6

Discussion 116 Chapter 6

6.1 Introduction

Depending on the season, as much as 35 to 45% of the total microbial community in the chemocline of Lake Cadagno were found to be associated in aggregates consisting of small-celled purple sulfur bacteria belonging to the genus Lamprocystis (15 to 35% of the total microbial community) and of sulfate-reducing bacteria related to Desulfocapsa thiozymogenes (3 to 13% of the total microbial community). Although the association was not obligate, the establishment of an assemblage of different physiological groups in close proximity under certain environmental conditions suggested a potential interaction between these organisms. This assumption is supported by the fact that at certain times up to 98% of the cells of the sulfate-reducing bacteria related to D. thiozymogenes present in the chemocline were found in the association.

Thus, the assumption is that the association provides a potential ecological advantage to one or both groups of the organisms involved. In order to elucidate the advantages of a potential interaction, several facets of this interaction need to be considered and discussed. These facets include the potential advantages of aggregate formation in general, and more specifically with respect to the results presented in this thesis, the potential interactions among organisms involved in the sulfur cycle in general, and specifically between sulfate-reducing and purple sulfur bacteria.

6.2 Aggregate formation

Formation of aggregates, microcolonies and biofilms around solid surfaces, and floc- or granule- formation by bacteria is commonly observed in many environments (Costerton et al., 1995; Hirsch, 1984; Overmann, 2001; Simon et al., 2002; Teske and Stahl, 2002; Tolker-Nielsen and Mølin, 2000). Bacteria in natural habitats are rarely uniformly distributed but have the tendency to accumulate around point sources of substrates (Fenchel, 2002; Krembs et al., 1998). In such accumulations represented by marine and lake snow, for example, bacterial densities are two to three orders of magnitude higher than in the surrounding water (Ploug et al., 1999; Simon et al., 2002). Thus, these accumulations or aggregates are places of concentrated bacterial activity in the water column. Large lake snow aggregates usually consist of a few dominating bacterial groups succeeding each other during degradation of organic matter, suggesting an adaptation of certain bacteria to the particular environmental conditions in aggregates (Simon et al., 2002; Weiss et al., 1996). Such adaptations might result in interactions between bacteria that provide growth advantages for one or more participants. For example, in situ hybridization experiments on activated sludge showing large nitrifying activity revealed that members of the nitrifying bacteria Nitrobacter and Nitrosomonas occurred frequently in clusters together with direct contact between their cells (Mobarry et al., 1996). The formation of aggregates between different types of bacteria suggests interactions that require a Discussion 117 close spatial vicinity and that are beneficial for the organisms involved probably confirming the statement by Pace (1999) that “syntrophy is probably a common theme in microbial ecosystems”. The close spatial association and the cell-to-cell contact of bacteria involved in subsequent steps of the nitrification process were therefore used to suggest a potential syntrophic interaction between Nitrobacter and Nitrosomonas. Based on this example, associations may thus potentially support synergistic: commensalistic, or even mutualistic interrelationships between different bacterial populations.

The importance of a metabolic pathway is likely influenced by the availability of a substrate on a microscale level and thus by the conditions at the aggregate level (Jørgensen, 2001). Potential interactions between organisms are affected by the distance between the organisms and thus in an aggregate are favored by the close proximity of the cells. Since the aggregate is the natural habitat of interacting bacteria and thus ultimately their “true” microbial habitat (Brock, 1993), these organisms live in a small-scale world dominated by viscous forces with diffusion of solutes dominating over advective transport (Fenchel, 2002). The diffusion flux (J), i.e. the amount of a certain compound moving across a distance in time, is described by Fick's first law: J = -D  dc/dx, where D is the diffusion coefficient which is specific for the respective compound and dc/dx is the concentration cheange over the distance x (Schink, 1999). Therefore, three-dimensional laws of diffusion determine mechanisms of availability and transport of nutrients released or taken up by associated microorganisms, and affect the quality of microenvironments that can be created in and around aggregates such as marine snow (Jørgensen, 2001; Schink, 1992).

The region around solid surfaces of aggregates or particles in water in which diffusion is faster than advection is defined as “diffusive boundary layer” (Jørgensen et al., 2001). For small particles with sizes similar to bacteria, the diffusion sphere is defined as the region where the substrate concentration can be depleted to below 90% of the ambient concentration. The diffusion sphere can be many times larger than the diameter of the cell (Jørgensen, 2001). Since the transfer of solutes occurs by molecular diffusion, spatial vicinity is a determining factor for an efficient exchange of metabolites (usually low molecular weight solutes) between two microorganisms (Fenchel, 2002; Searcy, 2001). Indeed, according to diffusion laws the diffusion time, i.e. the time needed for a molecule to be transported along one axis over a given distance, increases with the square of that distance (Schink, 1999), and thus the efficiency of metabolite transfers decreases significantly with increasing distance between the partners (Overmann and Schubert, 2002; Schink, 1992). In a three dimensional space, assuming a spherical diffusion model and an increase in distance from 1 to 2 or even to 10 µm between bacteria, the concentration of metabolites reaching the partner cell will be reduced to 25% or to 0.01%, respectively, of the original value at the distance of 1 µm (Boone et al., 1989; Overmann and Schubert, 2002). Thus, the transfer efficiency is inversely proportional to the 118 Chapter 6 diffusion distance, which means that the shorter the distance is between the organisms, the more efficient is the transfer of metabolites (Schink, 1992).

Many different prokaryotes live in close proximity to each other in the environment, and one could assume that only organisms with very dissimilar metabolic requirements do not interact. This assumption might particularly be expressed in anoxic environments where low energy yielding transformations are involved in the anaerobic degradation process and tight cooperation of several types of bacteria in food chains appears to be the rule (Schink, 1992). An example for metabolic interactions in associations under anaerobic conditions is the interspecies hydrogen transfer between secondary fermenting bacteria (the “obligate syntrophs”) and hydrogen-oxidizing methanogens

(Schink, 1992). The fermenting bacteria produce acetate, CO2 and H2 and cannot grow unless H2 is -3 kept at low partial pressures (≤ 10 bar) by the methanogens that use H2 as electron donor. It has been shown that in “methanogenic” flocs in which these fermenting bacteria and methanogens are closely associated, more than 90% of the H2 generated is consumed within the same floc (Conrad et al.,

1985). The consumption results in an inhomogeneous distribution of H2 in the sample, a situation that is also found in field samples (sediments and sludge), even tough H2-molecules are small and diffuse easily (Conrad et al., 1986).

As reported above, in addition to exchanges of metabolites between the organisms in an aggregate, association can also result in particular micro-environmental conditions. Basic growth conditions for aggregate-forming or associated bacteria might be totally different at the inside of an aggregate as compared to the outside or as experienced by a free-living organism (Schramm et al., 1999). Nutrients or electron acceptors, for example, might gradually be depleted along a transect from out- to inside. Examples for environments providing such growth conditions are marine or lake snow (Simon et al., 2002) or anaerobic aggregates (Santegoeds et al., 1999). Clump or aggregate formation among sulfate-reducing bacteria has been recently reported in various sulfidogenic, oxygen-exposed environments (Fukui and Takii, 1990; Krekeler et al., 1997; Manz et al., 1998; Minz et al., 1999; Teske et al., 1998; Wieringa et al., 2000;). Aggregate formation of sulfate-reducing bacteria can increase their tolerance to oxygen exposure (Brune et al., 2000; Cypionka, 2000) and to more positive redox potentials (Manz et al., 1998), and thus result generally in a higher resiliency to environmental changes. Aggregation was even considered as a defensive emergency reaction when these bacteria were exposed to oxygen (Cypionka, 2000). It is generally assumed that aggregates but also consortia can "offer their component members fairly stable conditions and protection against environmental stress" (Hirsch, 1984).

It was speculated that regulation of buoyant density and aggregate formation contributed substantially to the narrow stratification of Amoebobacter purpureus in Lake Mahoney (Overmann and Pfennig, 1992). Aggregate formation in pure culture of A. purpureus (strain ML1) was related to substrate concentrations, i.e. sulfide concentrations (Overmann and Pfennig, 1992). Aggregates were formed Discussion 119 after sulfide depletion and disintegrated in less than 1 second after the addition of sulfide. Aggregation, however, could not be related to changes in metabolism, but rather were a function of a reversible formation of disulfide bridges between hydrophobic cell surface proteins.

Thus, the development of aggregates is potentially dependent on environmental factors such as substrate concentration or chemical and physical diffusion gradients as indicated by pure culture studies on small-celled phototropic bacteria (Overmann and Pfennig, 1992) or observed in comparable systems producing associations such as during biofilm or aggregate formation (Christensen et al., 2002; Santegoeds et al., 1998, 1999). In biofilms, where different strains of microorganisms can be interdependent, structurally organized communities were reported (Costerton et al., 1995; Christensen et al., 2002, Santegoeds et al., 1998; Tolker-Nielsen and Mølin, 2000) suggesting that active structure- function relationships were established. Such interactions have led to significant speculations on cell- to-cell signaling and recognition, that might regulate and control the community structure (Davies et al., 1998; McClean et al., 1997). Thus, in addition to environmental impacts, aggregate formation and association between purple sulfur and sulfate-reducing bacteria related to D. thiozymogenes might be actively regulated by cell- or organism-specific factors as hypothesized for phototropic consortia (Overmann and Schubert, 2002).

Based on recent findings in quorum-sensing research (Whitehead et al., 2001; Fuqua et al., 1998), a self-induced control of the aggregation might be hypothesized. Aggregate formation might be influenced in a similar way, as the structure and composition of biofilms affected by cell-to-cell signaling (Davies et al., 1998; Wimpenny et al., 2000). Bachofen and Schenk (1998), for example, recently demonstrated that N-acyl homoserine lactones, identified as common signal transmitters in Gram-negative bacteria (Whitehead et al., 2001), were produced in dense cyanobacterial blooms and in microbial mats from wetland ponds near Lake Cadagno. The high specificity of the aggregation between small-celled purple sulfur bacteria and sulfate-reducing bacteria related to D. thiozymogenes in the bacterial plume of Lake Cadagno might suggest the presence of an interspecies communication system, as reported for microbial populations inhabiting rhizosphere environments (Cha et al. 1998; Pierson et al., 1998; Whitehead et al., 2001; Wood et al., 1997). 120 Chapter 6

6.3 Interactions among organisms involved in the sulfur cycle

Potential synergistic interactions between different bacteria in aggregates or other accumulations have been analyzed in several natural environments (Boetius et al., 2000; Dubilier et al., 2001; Overmann, 2001; Overmann and van Gemerden, 2000). An example is the association between a sulfate-reducing and a sulfide-oxidizing bacterium in a marine oligochaete worm (Dubilier et al., 2001). In addition to their symbiotic relationship with the worm, both endosymbionts might interact in a synergistic or mutualistic relationship presumably carrying out an endosymbiotic sulfur cycle. The sulfate-reducing bacteria produces sulfide that can serve as an energy source for the sulfide-oxidizing partner. Both bacteria were phylogenetically characterized and belonged to the δ- and γ-subclasses of the Proteobacteria, respectively (Dubilier et al., 2001).

Another example deals with a marine microbial consortium that apparently mediates the anaerobic oxidation of methane. Molecular methods were used to show that this consortium consists of a central part with up to 100 coccoid cells of Archaea surrounded by an outer shell of one to two layers of sulfate-reducing bacteria with about 200 cells (Boetius et al., 2000). The hypothesis on possible mechanisms of anaerobic methane oxidation involves the interspecies transfer of hydrogen and the formation of an organic intermediate (acetate) via “reversed methanogenesis” (Valentine, 2001). The

Archaea member of the association would oxidize methane to CO2 (or possibly acetate) and H2, while the sulfate-reducing member would oxidize molecular hydrogen and possibly acetate that serve as electron donors for sulfate-reduction (Valentine, 2001). Microorganisms mediating this reaction have not yet been isolated and the pathway of anaerobic methane oxidation is still not understood; however, a prerequisite for the anaerobic oxidation of methane through “reversed methanogenesis” in the consortia seems to be the maintenance of a micro-environment depleted in hydrogen, acetate (as low as 10-10 to 10-9 M for hydrogen and 3x10-12 to 3x10-8 M for acetate) and other possible intermediates (Boetius et al., 2000; Hansen et al., 1998; Hoehler et al., 1994).

Another example is the interaction between a marine sulfide-oxidizing Thioploca spp. that resembles filamentous, colorless sulfur bacteria with an appearance similar to Beggiatoa spp., and filamentous sulfate-reducing bacteria of the genus Desulfonema, that densely cover the sheaths of Thioploca (Jørgensen and Gallardo, 1999). Thioploca filaments seem to oxidize sulfide, taken up in the bottom layer of sediments, with nitrate as an electron acceptor in the surface layers of sediments. Since the concentration of sulfide can be low in the deeper layers of the sediments, the association with a sulfide-producing organism provides a potential advantage for Thioploca (Overmann and van Gemerden, 2000). The close proximity of these two bacteria to each other was used to speculate about a rapid recycling of sulfur compounds used as electron donors or acceptors by either organism, however, the organisms have not yet been isolated and the assumptions about metabolic interactions remain highly speculative (Jørgensen and Gallardo, 1999). Discussion 121

Phototrophic consortia represent another striking example of associations between different bacteria (Overmann, 2001). They are among the few examples of prokaryotic symbioses based on metabolic interactions with direct cell-to-cell contact that have been identified so far. These consortia were first reported by Lauterborn in 1906 (Hirsch, 1984; Overmann, 2001) and represent spatially structured associations between a colorless central bacterium and several green- or brown-colored epibionts generally consisting of green sulfur bacteria (Overmann and van Gemerden, 2000; Overmann and Schubert, 2002). Since the metabolism of the central bacterium has not yet been studied in pure culture, the metabolic function of this association is still uncertain, but it was speculated that it involves the mutual exchange of sulfur compounds (Pfennig, 1980) with the central bacterium consisting of a heterotrophic sulfate- or sulfur-reducing organism. However, recent findings (Fröstel and Overmann, 2000; Overmann and Schubert, 2002) indicate that physiological interactions in phototrophic consortia might not be based exclusively on an internal sulfur cycle. The phylogenetic affiliation of the central chemotrophic bacterium shows that it belongs to the β-subdivision of Proteobacteria. It may therefore not be a typical sulfate- or sulfur-reducing bacterium, which opens up the door for speculations on different metabolic interactions with green sulfur bacteria (Tsuchak et al. 1999, Fröstel and Overmann, 2000). Other interactions involving specific mechanisms of mutual recognition and signal exchange, must also occur since intact phototrophic consortia exhibited chemotaxis toward several organic carbon compounds and scotophobic response to low light intensities (Fröstel and Overmann, 1997; Overmann and Schubert, 2002).

Interactions between sulfur- or sulfate-reducing and phototropic bacteria were first discussed by Pfennig and Biebl (1976) who isolated a sulfur-reducing and a green sulfur bacterium from a supposedly “pure” culture of the ethanol-utilizing green phototrophic bacterium “Chloropseudomonas ethylica” (Schink, 1992; Schlegel and Jannasch, 1992). “C. ethylica” thus represents a syntrophic culture consisting of a sulfur-reducing bacterium, a Desulforomonas sp., and a green sulfur bacterium, a Chlorobium sp.. Both organisms used the sulfur compounds as electron carriers between them, which allowed them to grow at low concentrations of sulfur or sulfide (0.25 mM) (Widdel and Pfennig, 1992). The concentration of the electron carriers had little effect on growth yield and did not limit substrate conversion rates. Values of both growth yields were mainly determined by the amount of ethanol, the electron donor for Desulfuromonas, added to the culture. Growth yield of Chlorobium was therefore controlled by the capacity of the sulfide-producing organism to recycle sulfate back to sulfide (Biebl and Pfennig, 1978) (see Fig. 6.1a).

Mixed and co-culture studies were conducted in many laboratories with different groups of bacteria participating in the sulfur cycle (Biebl and Pfennig, 1978; Pringault et al., 1996, 1999 a, b; van den Ende 1996; 1997; van Gemerden and Beeftink, 1981; Wahrtmann et al., 1992). These studies were often based on observations on the co-occurrence of these bacteria in natural systems such as lakes, sediments or microbial mats and on contrasting and/or complementing nutritional requirements of pure 122 Chapter 6 cultures that suggested potential interactions between these groups (Overmann et al., 1996; Ramsing et al., 1993; Visscher, 1992 a, b). Co-cultures between a sulfate-reducing Desulfovibrio sp. and purple sulfur bacteria belonging to the Chromatiaceae, for example, were established already in 1967 by van Gemerden (Pfennig, 1980; van Gemerden and Beeftink, 1983). The potential interaction between both bacteria were assuming the recycling of the sulfur compounds used as electron carriers (Fig. 6.1b).

Figure 6.1a The sulfide/sulfur cycle in a syntrophic co- Figure 6.1b The sulfide/sulfate cycle in a syntrophic co- culture of ethanol-oxidizing Desulforomonas and a green culture of ethanol-oxidizing Desulfovibrio and a purple sulfur bacterium (from Schlegel and Jannasch, 1992; sulfur bacterium Chromatium (from Schlegel and Biebl and Pfennig, 1978). Jannasch, 1992).

Interactions between bacteria involved in the sulfur cycle have not only been investigated between sulfate-reducing and phototropic sulfur bacteria, but have also dealt with interactions among different sulfur bacteria (Overmann and van Gemerden, 2000; van Gemerden, 1987; van Gemerden and Beeftink, 1983). Interactions between colorless sulfide-oxidizing and sulfate-reducing bacteria were investigated in chemostat co-culture studies with Thiobacillus thioparus and Desulfovibrio desulfuricans, with lactate as energy and carbon source and sulfate as electron acceptor under oxygen limitation (van den Ende et al., 1997). D. desulfuricans increased its biomass significantly in co- culture compared to pure culture suggesting a synergistic relationship between both organisms in co- culture. Under these conditions, due to oxygen limitation, T. thioparus incompletely oxidized sulfide to polysulfides and thiosulfate that were then used as terminal electron acceptors by the sulfate- reducing bacteria instead of sulfate. The use of these intermediate electron acceptors was energetically more favorable than the use of sulfate for D. desulfuricans, which could double its biomass with respect to pure cultures (van den Ende et al., 1997). Since both bacteria are present in the same depth layers of microbial mats, it was suggested that this synergistic relationship might potentially be established in their natural environment as well (Overmann and van Gemerden, 2000).

Another association between colorless sulfide-oxidizing and sulfate-reducing bacteria was found between the marine Thioploca filaments covered with sulfate-reducing bacteria of the genus Desulfonema, as mentioned above. Even though the main energy metabolism of both organisms remains uncertain since no pure culture has been obtained yet, the close proximity may explain the Discussion 123 rapid cycling of sulfur compounds observed in the Chilean shelf sediments (Jørgensen and Gallardo, 1999).

Anaerobic purple sulfur bacteria of the genera Thiocapsa and aerobic sulfide oxidizing bacteria of the genera Thiobacillus, that would in principle be competitors for sulfide if present in the same environment, were successfully co-cultured under oxygen limited conditions. Thiocapsa was able to grow on the partially oxidized sulfur components excreted by Thiobacillus and thus avoided to be out competed (van den Ende et al., 1996). In contrast to mixed cultures, pure cultures of Thiobacillus accumulated extra-cellular sulfur indicating a less efficient utilization of the electron donating substrate. Therefore, in environments such as dense microbial mats where sulfide and oxygen might be present at low concentrations simultaneously, growth of both organisms could essentially be based on the same sulfide resource. This assumption would also help to explain blooms of Thiocapsa in microbial mats. However, a structured consortium between purple sulfur bacteria of the genera Thiocapsa and Thiobacillus has not been observed in nature yet (Overmann and van Gemerden, 2000).

Many studies have been conducted describing the temporal and spatial distribution of green and purple sulfur bacteria in natural environments [for reviews see Madigan (1988), Pedrós-Alió and Guerrero (1993) and van Gemerden and Mas (1995)]. Green and purple sulfur bacteria share very similar but also different nutritional requirements. They frequently bloom in fresh water lakes in which each group develops under slightly different environmental conditions with the general rule that green sulfur bacteria are generally adapted to lower light intensities, higher sulfide concentrations and are more sensible to oxygen than purple sulfur bacteria since they are obligate anaerobes. This leads to a vertical stratification along environmental gradients and results in a multi-layered microbial community. However, depending on the environmental conditions they can also be found in mixed populations (Caldwell and Tiedje, 1975; van Gemerden and Mas, 1995; Vila et al., 1998). Competition or interactions among green and purple sulfur bacteria were investigated in mixed cultures with Chlorobium sp. and Chromatium sp. under sulfide-limited conditions (van Gemerden and Beeftink, 1981). Despite a potentially higher affinity of Chlorobium sp. for sulfide, which should result in the competitive exclusion of Chromatium sp., stable co-cultures were established. This was attributed to intracellular storage of sulfur by Chromatium sp., that allowed them to compete successfully with Chlorobium sp. (van Gemerden and Beeftink, 1981). A more complex interaction was proposed after it was determined that Chromatium prefers the oxidation of polysulfides to that of sulfides (van Gemerden, 1987). Successful competition of Chromatium sp with Chlorobium sp. was therefore supposed to be a function of polysulfide formation in an abiotic reaction between sulfide present in solution and extracellular sulfur produced by Chlorobium sp. and its use as electron donor by Chromatium sp. 124 Chapter 6

More recently, in an experimental benthic gradient chamber (Pringault et al., 1996; 1999a) interactions between green and purple sulfur bacteria were investigated as well, with mixed populations of Prosthecochloris aestuarii and Thiocapsa roseopersicina (Pringault et al., 1999b). Surprisingly, growth yields of T. roseopersicina were higher in mixed than in pure culture. Speculations explaining the increase of T. roseopersicina in mixed culture included the complete consumption of sulfide by both organisms under these conditions, in contrast to pure cultures where sulfide was still present. The complete consumption of sulfide in mixed culture forced T. roseopersicina to completely oxidize elemental sulfur stored intracellularly, which resulted in the production of more reducing equivalents per mole of oxidized sulfide than in pure culture. Another hypothesis focused on polysulfides formed in an abiotic reaction between sulfide present in solution and extracellular sulfur produced by the green sulfur bacterium, and oxidized by T. roseopersicina. Pringault (1999b) concluded that resource utilization in mixed culture was more efficient than in pure culture, so that the presence of P. aestuarii unexpectedly exerted a positive effect on T. roseopersicina.

These results illustrate that the potential interactions between organisms have to be analyzed under ecologically relevant conditions and cannot be inferred from the metabolic characteristics of the organisms alone. Therefore, detailed analyses of bacterial populations and their environment are needed, together with adequate pure culture studies in order to properly understand their ecology.

6.4 Interactions between sulfate-reducing and small-celled purple sulfur bacteria

A discussion of the potential interactions between small-celled purple sulfur bacteria (Lamprocystis sp., strain Cad16) and sulfate-reducing bacteria (Desulfocapsa sp., strain Cad626) is essentially based on observations on these populations in the chemocline of Lake Cadagno and on isolates, and takes into consideration previous knowledge on the ecophysiology of bacteria belonging to the genera Lamprocystis and Desulfocapsa (Eichler and Pfennig, 1988; Finster et al., 1998; Imhoff, 2001, 2002; Janssen et al., 1996). Similar to the interaction between green or purple sulfur and sulfate-reducing bacteria described above (Biebl and Pfennig, 1978; Pfennig, 1980; Fig. 6.1), the interaction between isolates Cad16 and Cad626 could be based on a rapid internal cycling of the electron-transferring sulfur compound, which is in agreement with textbook predictions and previous knowledge (Fig. 6.2) (Pfennig, 1980; van Gemerden and Beeftink, 1983). Discussion 125

Figure 6.2 Metabolic interactions between a sulfate-reducing (Desulfocapsa sp.) and a purple sulfur bacterium (Lamprocystis sp.) in a potentially syntrophic co-culture. A small pool size of the respective electron transferring sulfur compound does not constitute a growth-limiting factor because sulfur carriers can be rapidly recycled between the two partners (adapted from Schlegel and Jannasch, 1992; Pfennig, 1980; van Gemerden and Beeftink, 1983).

The degree of interaction between both organisms depends on environmental conditions, i.e. on the availability of sulfate and sulfide. The relationship can become obligatory (i.e. synthropic or symbiotic) when the concentration of sulfur compounds is low (Pfennig, 1980; Schink, 1992). In this case “a close sulfur cycle can be established through which each sulfur atom cycles many times” (Overmann and van Gemerden, 2000). In contrast, high concentrations of sulfate and sulfide reduce the metabolic dependence of both organisms from each other and the relationship, though still positive for both, is not obligatory (i.e. protocooperative).

These first hypotheses suggested that syntrophic interactions occur within the aggregates and that these are based on an internal sulfur cycle (Pfennig, 1980; van Gemerden and Beeftink, 1983). However, as reported for the genus Desulfocapsa (Janssen et al., 1996), isolate Cad626 is able to grow by disproportionation of reduced intermediates of sulfur, such as thiosulfate, sulfite and elemental sulfur, to sulfate and sulfide under thermodynamically favorable conditions (Peduzzi et al., 2003). Thus, the interaction could still be based on the exchange of sulfur compounds but with a different metabolic pathway adopted by the sulfate-reducing bacteria related to D. thiozymogenes. Indeed, isolate Cad626 was able to grow on elemental sulfur only in the presence of a sulfide scavenger, i.e. when sulfide was chemically removed from the culture solution. Under standard conditions the disproportionation of elemental sulfur is thermodynamically unfavorable (∆Go’>0), it becomes energetically feasible only if free sulfide is kept at low levels (Bak, 1993; Widdel and 2- -7 -2 Hansen, 1992). For example with concentrations of H2S and SO4 of 10 and 10 M, respectively, ∆G’= -92 kJ mol-1, which is sufficient for ATP synthesis (Thamdrup et al., 1993). 126 Chapter 6

In the presence of isolate Cad16, but without abiotic sulfide scavenger, isolate Cad626 grew as well, most probably because of the removal of sulfide by isolate Cad16 that served as a biotic scavenger. The reported results can tentatively be interpreted as described in Fig.6.3.

Figure 6.3 Schematic representation of the metabolic interactions between a small-celled phototrophic sulfur bacterium (Lamprocystis sp., isolate Cad16) and a facultative S0-disproportionating bacterium (Desulfocapsa sp., isolate Cad626) when co-cultured with elemental sulfur as the sole source sulfur atoms. Thick arrows indicate the path of sulfur oxydation, from elemental sulfur to sulfate, through isolate Cad626 and isolate Cad16.

Elemental sulfur can also be photo-oxidized by strain Cad16. Therefore, it is unknown to what extent elemental sulfur was utilized by either organism. However, isolate Cad16 was certainly using sulfide excreted by isolate Cad626 as electron donor, keeping its concentrations at very low levels and thus promoting growth of isolate Cad626. Provided that sulfide is present acetate can also be assimilated, simultaneously with carbon dioxide, by Lamprocystis sp. (Eichler and Pfennig, 1988; Imhoff, 1998).

Based on the assumption of a potential source-sink relationship for sulfide between the sulfate- reducing bacterium growing by sulfur disproportionation and the small-celled purple sulfur bacteria acting as biotic scavenger, the mechanism for a biologically- and ultimately light-driven elemental sulfur disproportionation can be postulated (Fig. 6.3). The coupling of two complementary metabolic pathways results in favorable thermodynamics through the removal of sulfide (source-sink). Similar to other syntrophic relationships that are better understood (Schink, 1992), the proposed mechanism can Discussion 127 be seen as a kind of “interspecies sulfide transfer”. However, since both isolates show a high degree of metabolic diversity and both strains used intermediate reduced sulfur compounds other than elemental sulfur such as thiosulfate, the potential metabolic interactions that might take place in the natural environment might be more complex than depicted in Fig. 6.2 and Fig. 6.3. Sulfate-reducing bacteria related to D. thiozymogenes can disproportionate thiosulfate and sulfite as well and similar to elemental sulfur the presence of a sulfide scavenger, although not mandatory, favors growth. In addition to sulfide, purple sulfur bacteria of the genus Lamprocystis can oxidize thiosulfate and elemental sulfur as well (Eichler and Pfennig, 1988; Peduzzi et al., 2003) suggesting that the associated organisms can potentially consume the same substrate and thus compete under certain conditions (Fig. 6.4).

Figure 6. 4 Potential transformations of sulfate, thiosulfate, and sulfide carried out by bacteria related to D. thiozymogenes or belonging to the genus Lamprocystis. The potential chemical oxidation of sulfide is also shown.

The isolation in pure culture of the organisms found to be associated in the natural environments and data on free-living cells from winter and spring sampling demonstrated that the bacterial partners considered in this study can live independently and thus cannot be considered obligate symbionts (Schink, 1992). Syntrophic interactions can be established depending on environmental conditions, which are a function of time and thus, prevent a rigid distinction between different types of interactions. Depending on different metabolic transformations carried out by both aggregate members different types of interactions might be expected (Table 6.1). 128 Chapter 6

Table 6.1 Potential interactions between isolate Cad16 and Cad626 depending on the respective types of "chosen" metabolisms.

Type of metabolism Interaction Function Type of interaction A B Desulfocapsa-sp. Lamprocystis-sp. A ← → B (A) (B) Isolate Cad626 Isolate Cad16 Source Sink

S -disproportionation Photholithotrophic growth +(+)Y YSyntrophic, A needs B on sulfide

S -disproportionation Photholithotrophic growth -“0”NNGrowth of A is impeded on sulfur storage by the absence of B sink

S -disproportionation Chemolithotrophic growth +(+)Y YSyntrophic, A needs B (microoxic conditions)

S -disproportionation Dark metabolism, -“0”NNGrowth of A is impeded “chemoorganotrophic” on by the absence of B sink storage compounds

Sulfate reduction Photholithotrophic growth (+) (+) Y Y Mutualismus, degree on sulfide depend on substrate availability Sulfate reduction Photholithotrophic growth “0” “0” Y N “Neutralismus” on sulfur storage

Sulfate reduction Chemolithotrophic growth (+) (+) Y Y Mutualismus, degree (microoxic conditions) depend on substrate availability Sulfate reduction Dark metabolism “0” “0” Y N “Neutralismus” “chemoorganotrophic” on storage compounds

+ positive and obligate; (+) positive but not obligate; - negative; “0” no or small influence Y-yes; N-no

Substrate availability and concentration of sulfide at the aggregate level are probably the major factors influencing the metabolic transformations of bacteria related to D. thiozymogenes. Light availability, electron donor availability and oxygen partial pressure are probably major factors influencing the metabolic choice of the small-celled purple sulfur bacteria. The potential interaction of all these factors during day/night fluctuations, for example, makes it particularly difficult to predict the importance of a particular transformation or pathway in nature. For example, during the night, small-celled phototrophic sulfur bacteria might use their intracellularly stored glycogen and sulfur and excrete sulfide as an end product of their dark metabolism (Table 6.1) (Bachofen et al., 1991; Del Don et al., 1991, 1994; Mas and van Gemerden, 1995; van Gemerden et al., 1985). Under these conditions, they cannot serve as biotic sulfide scavenger for bacteria related to D. thiozymogenes growing by sulfur disproportionation. Nevertheless, the large versatility of the organisms involved in aggregate formation and association with respect to metabolic transformations and pathways (Table 6.1) provides the potential for synergic interactions in a wide range of environmental conditions, but, Discussion 129 also prevents the prediction of the exact nature of the interaction, especially when gradients of environmental conditions are encountered.

Ecological consequences of aggregate formation can be of importance for other members (i.e. not directly involved in aggregation) of the microbial community. Under natural conditions, for example, aggregation might significantly alter competition dynamics among phototrophic sulfur bacteria such as green and purple sulfur bacteria. During periods of intense sulfide photo-oxidation, for example, anoxygenic photosynthesis at the upper boundary of the bacterial layer is limited by the availability of reduced sulfur compounds, a situation encountered in Lake Mahoney (Overmann et al., 1991, 1994, 1997) as well as in Lake Cadagno (Fritz and Bachofen, 2000; Joss et al., 1994; Lüthy et al., 2000). Under these conditions, small-celled purple sulfur bacteria (Lamprocystis spp.) associated with bacteria related to D. thiozymogenes could have a growth advantage over non-associated sulfur bacteria since the sulfate-reducing partner could serve as a permanent source (i.e. supply) of sulfide.

Intermediate inorganic sulfur compounds such as elemental sulfur, thiosulfate and sulfite are primary substrates for disproportionation. It is still unclear whether these compounds are available for the aggregates at the oxic-anoxic discontinuity layer of Lake Cadagno even though the deposition of elemental sulfur in the benthic boundary layer potentially supports speculations about their availability (Lehmann and Bachofen, 1999). For environments other than Lake Cadagno that are rich in sulfate, high concentrations of elemental sulfur and polysulfides are generally reported compared to sulfite and thiosulfate concentrations (van Gemerden and Mas, 1995). In sediments, low concentrations of thiosulfate are not surprising because thiosulfate can be rapidly metabolized by various organisms, included disproportionating bacteria, and thus is not accumulating (Jørgensen, 1990a, b).

In microbial mats, concentrations of soluble sulfur compounds are in the picomolar range for thiosulfate and in the nanomolar range for polysulfide (Overmann and van Gemerden, 2000). In contrast, higher concentrations of thiosulfate (<1 to 10 µM) were also reported in marine and freshwater sediments (Jørgensen, 1990a; Jørgensen and Bak, 1991). In the chemocline of Lake Mahoney, concentrations of polysulfides were in the micromolar range (up to 500 µM), while sulfite was always below the detection limit of 1 µM and thiosulfate concentrations ranged between <1 to 20 µM (Overmann et al., 1996). Polysulfides result from abiotic reaction of elemental sulfur with sulfide and are in a chemical equilibrium with them (Overmann et al., 1996) with an oxidation state between sulfide and elemental sulfur (Brune, 1988). Polysulfides are often reported to occur in sulfur rich environments and as mentioned above are suspected to be crucial in governing interactions between Thiobacillus and Desulfovibrio (van den Ende et al., 1997) or competition between Chlorobium and Chromatium (van Gemerden, 1987). Polysulfides are electron-donating substrates for anoxygenic photosynthesis by Thiocapsa roseopersicina, Chromatium vinosum and other purple sulfur bacteria (Brune, 1995; Steudel et al., 1990; Visscher et al., 1990) and can also serve as electron acceptors for 130 Chapter 6 sulfate-reducing bacteria (Overmann et al., 1996; van den Ende et al., 1997). Unfortunately, it is still unknown if they could be metabolized by disproportionating bacteria as well.

In the aggregates found in the chemocline of Lake Cadagno intermediate inorganic sulfur compounds, could theoretically be excreted by either partner inside the aggregate and thus have an endogenous origin. A release of inorganic sulfur compounds other than sulfate by purple sulfur bacteria, however, has not been reported yet (Mas and van Gemerden, 1995). In contrast to green sulfur bacteria, purple sulfur bacteria store elemental sulfur intracellularly, which prevents it from being used directly by the sulfate-reducing partner in the aggregate (Mas and van Gemerden, 1995; Pfennig and Trüper, 1992), or from reacting with external sulfide to form polysulfides. However, Steudel (1990) reported that a minor fraction of sulfide can be oxidized transiently to thiosulfate by purple sulfur bacteria (7%) and recent findings in Lake Mahoney, based on δ34S determinations, indicated that intracellular sulfur of A. purpureus reacted chemically with dissolved sulfide to form polysulfides. In another study, Overmann et al. (1996) showed that polysulfides and intracellular sulfur constituted significant intermediates in the sulfur cycle of Lake Mahoney. A decrease of polysulfides during summer was accompanied by an increase in numbers of both sulfur-reducing bacteria and A. purpureus (Overmann et al., 1996). These results could be basis for further speculations and studies on the interaction between purple sulfur bacteria and sulfate-reducing bacteria related to D. thiozymogenes associated in aggregates in the chemocline of Lake Cadagno. Unfortunately, data on intermediate inorganic sulfur compounds in the chemocline of Lake Cadagno are scarce or not available; a situation that might be influenced by the fact that these compounds can be consumed, at the aggregate level, as soon as they are formed either by the small-celled phototrophic sulfur bacteria or the sulfate-reducing bacteria related to D. thiozymogenes and thus not be detectable in free water. Discussion 131

6.5 Future perspectives

In the course of this thesis, a spatially close association between purple sulfur and sulfate-reducing bacteria has been observed in its natural environment and was subsequently established in laboratory mixed culture. It was hypothesized that a biologically and ultimately light driven disproportionation of inorganic sulfur compounds might occur at the aggregate level in pelagic waters of Lake Cadagno. Therefore, we assume that disproportionation might be of importance for the biogeochemical sulfur cycle in Lake Cadagno, similar to marine and freshwater sediments (Bak and Pfennig, 1991; Canfield et al., 1994, 1998; Jørgensen, 1990a, b). The presence of bacteria disproportionating sulfur and processes mediated by microorganisms in aggregates has to be considered when the cycling of elements and nutrients is studied in Lake Cadagno, similar to other aquatic environments where marine or lake snow is present (Simon et al., 2002). In view of the results reported in this study, the presence and activity of sulfate-reducing bacteria in chemocline of stratified lakes deserves more attention since their interaction with purple sulfur bacteria may have important consequences on competition and sulfur dynamics and thus, on major pathways of electron flow.

The syntrophic interrelationship between phototrophic sulfur and sulfate-reducing bacteria is a well- understood and described phenomenon (Schlegel and Jannasch, 1992; Schink, 1992). Sulfate- reducing bacteria were successfully cultured with purple and green sulfur bacteria (Biebl and Pfennig 1978, Pfennig, 1980). However, such a specific and spatially close association between purple sulfur and sulfate-reducing bacteria as described in this thesis has not been characterized so far in another natural environment (Overmann, 1997; Overmann and van Gemerden, 2000; Pedrós-Alió and Guerrero, 1993; Pfennig, 1980; Schubert and Overmann, 2002; van Gemerden and Mas, 1995). As pointed out above, only close physical contact ensures an effective interspecies metabolite exchange in a natural environment. Thus, the isolation of both partners in the association encountered in the chemocline of Lake Cadagno now opens up the door to study this particular interaction with strains of ecological relevance. From the results presented and compiled in this thesis, it is evident that the role of both sulfur and carbon compounds in the interaction of the bacteria in this association needs to be elucidated in more detail and that both strains can certainly be used as model organisms for further in depth studies of the source-sink hypothesis.

One of the major topics in microbial ecology is the determination of in situ activities of specific microorganisms (Brock, 1987). A better understanding of the nature and stoichiometry of the processes involved in aggregates interaction could probably be accomplished by the use of radio- labeled substrates (either sulfur or carbon atoms) in pure and mixed cultures, as well as in field studies. The radioactive isotope 35S, for example, has been used to follow redox changes of sulfur in labeled substrates during oxidation by sulfur bacteria in both laboratory experiments (Brune, 1988) 132 Chapter 6 and in field studies (Bak and Pfennig, 1991; Jørgensen and Bak, 1991; Meier et al., 2000). An alternative to such studies can probably be found in molecular approaches that have been developed in order to link a specific activity to a specific organism (Amann and Kühl, 1998; Mølin and Givskov, 1999) or link gene expression (i.e. mRNA quantification) directly to in situ activity assessments. This approach would also permit a relation of in situ activity measurements with in situ identification of specific organisms (Ouverney and Fuhrmann, 1999). Microautoradiography combined with fluorescence in situ hybridization has already proven to be a powerful method to relate specific in situ activity to specific organisms (Andreasen and Nielsen, 1997; Ito et al., 2002; Lee et al., 1999; Ouverney and Fuhrmann, 1999). The usefulness of microautoradiography in microbial ecology studies was already pointed out 35 years ago (Brock and Brock, 1966), since it allows the analysis of the microbial activity on the microhabitat level. Experiments using microautoradiography on mixed cultures or natural samples could give direct evidence of incorporation of specific compounds and will result in new insights into the metabolic interactions of aggregate-associated organisms such as small-celled phototrophic sulfur and sulfate-reducing bacteria related to D. thiozymogenes under different environmental conditions.

Although phototrophic consortia occur in numerous lakes worldwide (Pfennig, 1980; 1989; Overmann et al., 1998; Overmann, 2001; Overmann and Schubert, 2002), up to date, associations between purple sulfur and sulfate-reducing bacteria have been reported only from Lake Cadagno. The lack of reports on this association in other well described environments such as Lake Mahoney or Lake Cisó seems to indicate their absence. However, this might also be caused by methodological problems since sulfate-reducing bacteria associated with small-celled purple sulfur bacteria can hardly be detected by conventional microscopy (bright-field microscopy) because of their spatial position in the aggregates, their small size and transparent occurrence compared to the much larger, purple colored sulfur bacteria. Therefore, despite the long record of observations of blooms of purple sulfur bacteria in Lake Cadagno, the presence of sulfate-reducing bacteria in aggregates of purple sulfur bacteria was revealed only recently when molecular methods such as in situ hybridization combined with epifluorescence microscopy became available. Future perspectives should therefore exploit these technologies and study aggregate composition in other environments where blooms of purple sulfur bacteria and aggregate formation were reported (Overmann, 1997; Pedrós-Alió and Guerrero, 1993). Discussion 133

6.6 References

Amann R. and Kühl M. (1998) In situ methods for assessment of microorganisms and their activities. Current Opinion in Microbiology 1:352-358. Andreasen K. and Nielsen P. H. (1997) Application of microautoradiography to the study if substrate uptake by filamentous microorganisms in activated sludge. Appl. Environ. Microbiol. 63: 3662-3668. Bachofen R., Israng R., Del Don C., Hanselmann K. and Tonolla M. (1991) Chemo- and phototactic behavior of phototrophic bacteria under natural conditions in lago di Cadagno a meromictic alpine lake (Abstract). VII Intl. Symp. Phototrop. Prokary. p. 158. Bachofen R. and Schenk A. (1998) Quorum sensing autoinducers: do they play a role in natural microbial habitats? Microbiol. Res. 153: 61-63. Bak F. (1993) Fermentation of inorganic sulfur compounds by sulfate-reducing bacteria. p. 75-78. In: R. Guerrero and C. Pedrós-Alió (eds.), Trends in Microbial Ecology, Spanish Society for Microbiology. Bak F. and Pfennig N. (1991) Microbial sulfate reduction in littoral sediment of lake Constance. FEMS Microbiol. Ecol. 85: 31-42. Biebl H. and Pfennig N. (1978) Growth yields of green sulfur bacteria in mixed cultures with sulfur and sulfate-reducing bacteria. Arch. Microbiol. 117: 9-16. Boetius A., Ravenschlag K., Schubert C. J., Rickert D., Widdel F., Gieseke A., Amann R., Jorgensen B. B., Witte U. and Pfannkuche O. (2000) A marine microbial consortium apparently mediating anaerobic oxidation of methane. Nature 407: 623-626.

Boone D. R., Johnson R. L. and Liu Y. (1989) Diffusion of the interspecies electron carriers H2 and formate in the methanogenic ecosystems and its implications in the measurement of Km for H2 or formate uptake. Appl. Environ. Microbiol. 55: 1735-1741. Brock T. D. (1987) The study of microorganisms in situ: progress and problems. p. 1-17. In: M. Fletcher, T. R. G. Gray and J. G. Jones (eds), Ecology of microbial communities, Symposium 41 The society of general Microbiology, Cambridge University press, Cambridge. Brock T. D. and Brock M. L. (1966) Autoradiography as a tool on microbial ecology. Nature 209: 734-736. Brock T. D. (1993) Origins and status of microbial ecology. p. 201-206. In: R. Guerrero and C. Pedrós-Alió (eds.) Trends in Microbial Ecology, Spanish Society for Microbiology. Brune D. C. (1995) Sulfur compounds as photosynthetic electron donors. p. 847-870. In: R. E. Blankenship, M. T. Madigan and C. E. Bauer (eds), Anoxygenic Photosynthetic Bacteria, Kluwer Academic Publishers, The Netherlands. Brune D. C. (1988) Sulfur oxidation by phototrophic bacteria. Biochimica et Biophysica Acta. 975: 189-221. Brune A., Frenzel P. and Cypionka H. (2000) Life at the oxic-anoxic interface: microbial activities and adaptations. FEMS Microbiol. Rev. 24: 691-710. Caldwell D.E. and Tiedje J. M. (1975) The structure of anaerobic bacterial communities in the hypolimnia of several Michigan lakes. Can. J. Microbiol. 21: 377-385. Canfield D. E. and Thamdrup B. (1994) The production o f 34S-depleted sulfide during bacterial disproportionation of elemental sulfur. Science 266: 1973-1975. 134 Chapter 6

Canfield D. E., Thamdrup B. and Fleischer S. (1998) Isotope fractionation and sulfur metabolism by pure and enrichment cultures of elemental sulfur-disproportionating bacteria. Limnol. Oceanog. 43: 253-264. Cha C., Gao P. Chen Y. C., Shaw P. D. and Farrand S. K. (1998) Production of acyl-homoserine lactone quorum-sensing signals by Gram-negative plant-associated bacteria. Mol. Plant-Microbe Interact. 11: 1119-1129. Christensen B. B., Haagensen J. A. J., Heydorn A. and Molin S. (2002) Metabolic commensalism and competition in a two-species microbial consortium. Appl. Environ. Microbiol. 68: 2495-2502. Conrad R., Phelps T. J. and Zeikus J. G. (1985) Gas metabolism evidence in support of the juxtaposition of hydrogen-producing and methanogenic bacteria in sewage sludge and lake sediments. Appl. Environ. Microbiol. 50: 595-601.

Conrad R., Schink B. and Phelps T. J. (1986) Thermodynamics of H2-consuming and H2-producing metabolic reactions in diverse methanogenic environments under in situ conditions. FEMS Microbiol. Ecol. 38: 353-360. Costerton J. W., Lewandowski Z., Caldwell D. E., Korber D. R. and Lappin-Scott H. M. (1995) Microbial biofilms. Annu. Rev. Microbiol. 49: 711-745. Cypionka H. (2000) Oxygen respiration by Desulfovibrio species. Annu. Rev. Microbiol. 54: 827- 848. Davies D. G., Parsek M. R. Pearson J.P., Iglewski B. H., Costerton J. W. and Greenberg E.P. (1998) The involvement of cell-to-cell signals in the development of a bacterial biofilm. Science 280: 295-298. Del Don C., Hanselmann K. W., Peduzzi R. and Bachofen R. (1994) Biomass composition and methods for the determination of metabolic reserve polymers in phototrophic sulfur bacteria. Aquat. Sci. 56:1-15. Del Don C., Hanselmann K. and Bachofen R. (1991) Metabolic responses of Chromatiaceae to diurnal cycles in a natural lake habitat (Abstract). VII Intl. Symp. Phototrop. Prokary. p. 106. Dubillier N., Mülders C., Ferdelmann T., de Beer D., Pernthaler A., Klein M., Wagner M., Erséus C., Thiermann F., Krieger J., Giere O. and Amann R. (2001) Endosymbiotic sulphate- reducing and sulphide–oxydizing bacteria in an oligochaete worm. Nature 411:298-302. Eichler B. and Pfennig N. (1988) A new purple sulfur bacterium from stratified freshwater lakes, Amoebobacter purpureus sp. nov. Arch. Microbiol. 149: 395-400. Fenchel T. (2002) Microbial behavior in heterogeneous world. Science. 296: 1068-1071. Finster K., Liesack W. and Thamdrup B. (1998) Elemental sulfur and thiosulfate disproportionation by Desulfocapsa sulfoexigens sp. nov., a new anaerobic bacterium isolated from marine surface sediment. Appl. Envir. Microbiol. 64: 119-125. Fritz M. and Bachofen R. (2000) Volatile organic sulfur compounds in a meromictic alpine lake. Acta hydrochim. Hydrobiol. 28: 185-192. Fröstl J. M. and Overmann J. (2000) Phylogenetic affiliation of the bacteria that constitute phototrophic consortia. Arch. Microbiol. 174: 50-58. Fröstl J. M. and Overmann J. (1997) Physiology and tactic response of “Chlorochromatium aggregatum”. Arch. Microbiol. 169: 129-135. Fukui M. and Takii S. (1990) Survival of sulfate-reducing bacteria in oxic surface sediment of a seawater lake. FEMS Microbiol. Ecol. 73: 317-322. Fuqua C. and Greenberg E. P (1998) Cell-to cell communication in Escherichia coli and Salmonella typhimurium: They may be talking, but who’s listening?. Proc. Natl. Acad. Sci. USA 95: 6571-6572. Discussion 135

Hansen L. B., Finster K., Fossing H. and Iversen N. (1998) Anaerobic methane oxidation in sulfate depleted sediments: effects of sulfate and molybdate additions. Aquat. Microb. Ecol. 14: 195-204. Hirsch P. (1984) Microcolony formation and consortia. p. 373-394. In: K. C. Marshall (eds), Microbial adhesion and aggregation. Dahlem Konferenzen, Springer-Verlag, Berlin. Hoehler T. M., Alperin M. J., Albert D. B. and Martens C. S. (1994) Field and laboratory studies of methane oxidation in anoxic marine sediments: evidence for a methanogen-sulfate reducer consortium. Global Biogeochem. Cycles 8: 451-463. Imhoff J. F. (2001) Transfer of Pfennigia purpurea Tindall 1999 (Amoebobacter purpureus Eichler and Pfennig 1988) to the genus Lamprocystis as Lamprocystis purpurea comb. nov. Int. J. Syst. Evol. Microbiol. 51:1699-701. Imhoff J. F. (2002) The anoxigenic phototrophic purple bacteria. p. 631-637. In: D. R. Boone and R. W. Castenholz (eds) Bergey's Manual of Systematic Bacteriology, Vol. 1. Williams and Wilkins, Baltimore. Ito T., Nielsen J. L., Okabe S., Watanabe Y. and Nielsen P. H. (2002) Phylogenetic identification and substrate uptake patterns of sulfate-reducing bacteria inhabiting an oxic-anoxic sewer biofilm determined by combining microautoradiography and fluorescent in situ hybridization. Appl. Environ. Microbiol. 68: 356-364. Janssen P. H., Schuhmann A., Bak F. and Liesack W. (1996) Disproportionation of inorganic sulfur compounds by the sulfate-reducing bacterium Desulfocapsa thiozymogenes gen. nov., sp. nov. Arch. Microbiol. 166: 184-192. Jørgensen B. B. (2001) Life in the diffusive boundary layer. p. 348-373. In: B. P. Boudreau and B. B. Jørgensen (eds.), The benthic boundary layer, transport processes and biogeochemistry, Oxford University Press, New York. Jørgensen B. B. (1990a) The sulfur cycle of freshwater sediments: role of thiosulfate. Limnol. Oceanogr. 35: 1329-1342. Jørgensen B. B. (1990b) A thiosulfate shunt in the sulfur cycle of marine sediments. Science 249: 152-154. Jørgensen B. B. and Bak F. (1991) Pathways and Microbiology of thiosulfate transformations and sulfate reduction in a marine sediment (Kattegat, Denmark). Appl. Environ. Microbiol. 57: 847-856. Jørgensen B. B. and Gallardo V. A. (1999) Thioploca spp.: filamentous sulfur bacteria with nitrates vacuoles. FEMS Microbiol. Ecol. 28:301-313. Joss A., Mez K., Känel B., Hanselmann K. W. and Bachofen R. (1994) Measurement of fluorescence kinetics of phototrophic bacteria in the natural environment. J. Plant. Physiol. 144: 333- 338. Krekeler D., Sigalevich P., Teske A., Cypionka H. and Cohen Y. (1997) A sulfate-reducing bacterium from the oxic layer of a microbial mat from Solar lake (Sinai), Desulfovibrio oxyclinae sp. nov. Arch. Microbiol. 167: 369-365. Krembs C., Juhl A. R., Long R. A. and Azam F. (1998) Nanoscale patchiness of bacteria in lake water studied with the spatial information preservation method. Limnol. Oceanogr. 43: 307-314. Lee N., Nielsen P. K., Andreasen K. H., Juretschko S., Nielsen J. L., Schleifer K. H. and Wagner M. (1999) Combination of fluorescent in situ hybridization and microautoradiography-a new tool for structure-function analysis in microbial ecology. Appl. Environ. Microbiol. 65: 1289-1297. Lehmann C. and Bachofen R. (1999) Images of concentrations of dissolved sulphide in the sediment of a lake and implications for internal sulphur cycling. Sedimentol. 46: 537-545. Lindholm T. (eds) (1987) Ecology of photosynthetic prokaryotes, with special reference to meromictic lakes and coastal lagoons. Åbo Academy Press, Åbo Finland. p. 151. 136 Chapter 6

Lüthy L., Fritz M., Bachofen R. (2000) In situ determination of sulfide turnover rates in a meromictic alpine lake. Appl. Environ. Microbiol. 66:712-717. Madigan M. T. (1988) Microbiology, physiology, and ecology of phototrophic bacteria. p. 39-111. In: A. J. B. Zehnder (eds) Biology of Anaerobic Organisms. John Wiley, New York. Manz W., Eisenbrecher M., Neu T. R. and Szewzyk U. (1998) Abundance and spatial organization of Gram-negative sulfate-reducing bacteria in activated sludge investigated by in situ probing with specific 16S rRNA targeted oligonucleotides. FEMS Microbiol. Ecol. 25:43-61. Mas J. and Van Gemerden H. (1995) Storage products in purple and green sulfur bacteria. p. 973- 990. In: R. E. Blankenship, M. T. Madigan and C. E. Bauer (eds), Anoxygenic Photosynthetic Bacteria, Kluwer Academic Publishers, The Netherlands. McClean K. H., Winson M. K., Fish L., Taylor A., Chabra S. R., Camara M., Daykin M., Lamb J. H., Swift S., Bycroft B. W., Stewart G. S. A. B. and Williams P. (1997) Quorum sensing and Chromobacterium violaceum: exploitation of violacein production and inhibition for the detection of N-acylhomoserine lactones. Microbiology 143: 3703-3711. 35 2- Meier J., Voigt A. and Babenzien H.-D. (2000) A comparison of S-SO4 radiotracer techniques to determine sulphate reduction rates in laminated sediments. J. Microbiol. Methods 41: 9-18. Minz D., Fishbain S., Green S. J., Muyzer G., Cohen Y., Rittmann B. E. and Stahl D. A. (1999) Unexpected population distribution in a microbial mat community: sulfate-reducing bacteria localized to the highly oxic chemocline in contrast to a eukaryotic preference for anoxia. Appl. Environ. Microbiol. 65: 4659-4665. Mobarry B. K., Wagner M., Urbain V., Rittmann B. E. and Stahl D. A. (1996) Phylogenetic probes for analyzing abundance and spatial organization on nitrifying bacteria. Appl. Environ. Microbiol. 62: 2156-2162. Mølin S. and Givskov M. (1999) Application of molecular tools for in situ monitoring of bacterial growth activity. Environmental Microbiology 1: 383-391. Ouverney C. C. and Fuhrmann J. A. (1999) Combined microautoradiography-16S rRNA probe technique for determination of radioisotope uptake by specific microbial cell types in situ. Appl. Environ. Microbiol. 65: 1746-1752. Overmann J. (2001) Phototrophic consortia: a tight cooperation between non-related bacteria. p. 239- 255. In: J. Seckbach (eds.), Symbiosis: mechanisms and model systems, Kluwer Academics Publishers, Netherlands. Overmann J. (1997) Mahoney lake: a case study of the ecological significance of phototrophic sulfur bacteria. Adv. Microb. Ecol. 15: 251-288. Overmann J., Beatty T., Krouse H. R. and Hall K. J. (1996) The sulfur cycle in the chemocline of a meromictic salt lake. Limnol. Oceanogr. 41: 147-156. Overmann J., Beatty T., Hall K. J. (1994) Photosynthetic activity and population dynamics of Amoebobacter purpureus in a meromictic saline lake. FEMS Microbiol. Ecol. 15: 309-320. Overmann J., Beatty T., Hall K. J., Pfennig N. and Northcote T. G. (1991) Characterization of a dense, purple sulfur bacterial layer in a meromictic lake. Limnol. Oceanogr. 36: 846-859. Overmann J. and Pfennig N. (1992) Buoyancy regulation and aggregate formation in Amoebobacter purpureus from Mahoney Lake. FEMS Microbiol. Ecol. 101: 67-79. Overmann J. and Schubert K. (2002) Phototrophic consortia: model systems for symbiotic interrelations between prokaryotes. Arch. Microbiol. 177: 201-208. Overmann J., Tuschak C., Fröstl J. M. and Sass H. (1998) The ecological niche of the consortium “Pelochromatium roseum”. Arch. Microbiol. 169: 120-128. Discussion 137

Overmann J and van Gemerden H. (2000). Microbial interactions involving sulfur bacteria: implications for the ecology and evolution of bacterial communities. FEMS Microbiol Rev. 24: 591- 599. Pace N. R. (1999) Microbial Ecology & Diversity. ASM News. 65: 328-333. Pedrós-Alió C. and Guerrero R. (1993) Microbial ecology in Lake Cisó. Adv. Microb. Ecol. 13: 155-209. Peduzzi S., Tonolla M. and Hahn D. (2003) Isolation and characterization of aggregate-forming sulfate-reducing and purple sulfur bacteria from the chemocline of meromictic Lake Cadagno, Switzerland. FEMS Microbiol. Ecol. 45: 29-37.

Pfennig N. (1989) Ecology of phototrophic purple and green sulfur bacteria. p. 97-176. In: H. G. Schlegel and B. Bowien (eds), Autotrophic bacteria, Science Tech Publishers and Springer-Verlag, Madison and New York. Pfennig N. (1980) Syntrophic mixed cultures and symbiotic consortia with phototrophic bacteria: a review. p. 127-131. In: G. Gottschalk, N. Pfennig and H. Werner (eds), Anaerobes and anaerobic infections, Fischer, Stuttgart. Pfennig N. and Trüper H. G. (1992) The family Chromatiaceae. p. 3199-3221. In: A. Balows, H. G. Trüper , M. Dworkin, W. Harder and K. H. Schleifer (eds), The Prokaryotes, Springer, New York. Pfennig N. and Biebl H. (1976) Desulfuromonas acetooxidans gen. nov. and sp. nov., a new anaerobic, sulfur reducing, acetate oxidizing bacterium. Arch. Microbiol. 110: 3-12. Pierson E. A., Wood D. W., Cannon J. A., Blachere F. M. and Oierson III L. S. (1998) Interpopulation signaling via N-acyl-homoserine lactones among bacteria in the wheat rhizosphere. Mol. Plant-Microbe Interact. 11: 1078-1084. Ploug H. and Jørgensen B. B. (1999) A net-jet flow system for mass transfer and microelectrode studies in sinking aggregates. Mar. Ecol. Prog. Ser. 176: 270-290. Pringault O., de Wit R. and Kühl M. (1999b) A microsensor study of the interactions between purple sulfur and green sulfur bacteria in experimental benthic gradients. Microbial. Ecol. 37: 173- 184. Pringault O., de Wit R. and Caumette, P. (1996) A benthic gradient chamber for culturing phototrophic sulfur bacteria on reconstituted sediments. FEMS Microbiol. Ecol. 20: 237-250. Pringault O., Epping E., Guyoneaud R., Khalili A. and Kühl M. (1999a) Dynamics of anoxygenic photosynthesis in an experimental green sulfur bacteria biofilm. Environ. Microbiol. 1: 295-305.

Ramsing N. B., Kühl M. and Jørgensen B. B. (1993) Distribution of sulfate-reducing bacteria O2 and H2S in photosynthetic biofilms determined by oligonucleotide probes and microelectrodes. Appl. Environ. Microbiol. 59: 3840-3849. Santegoeds C. M., Damgaard L. R., Hesselink G., Zopfi J., Lens P., Muyzer G. and de Beer D. (1999) Distribution of sulfate-reducing and methanogenic bacteria in anaerobic aggregates determined by microsensor and molecular analyses. Appl. Environ. Microbiol. 65: 4618-4629. Santegoeds C. M., Ferdelmann T. G., Muyzer G. and de Beer D. (1998) Structural and functional dynamics of sulfate-reducing populations in bacterial biofilms. Appl. Environ. Microbiol. 64: 3731- 3739. Schink B. (1992) Syntropism among prokaryotes. p. 276-299. In: A. Balows, H. G. Trüper, M. Dworkin, W. Harder and K. H. Schleifer (eds), The Prokaryotes, Springer, New York. Schink B. (1999) Ecophysiology and ecological niches of prokaryotes. p. 723-762. In: J. W. Lengeler, G. Drews, H. G. Schlegel (eds), Biology of the Prokaryotes, Thieme-Blackwell Science, New York. 138 Chapter 6

Schlegel H. G. and Jannasch H. W. (1992) Prokaryotes and their habitat. p. 75-124. In: A. Balows, H. G. Trüper, M. Dworkin, W. Harder and K. H. Schleifer (eds), The Prokaryotes, Springer, New York. Schramm A., Santegoeds C. M., Nielsen H. K., Ploug H., Wagner M., Pribyl M., Wanner J., Amann R. and De Beer D. (1999) On the occurrence of anoxic microniches, denitrification, and sulfate reduction in aerated activated sludge. Appl. Environ. Microbiol. 65: 4189-4196. Searcy D. G. (2001) Nutritional syntrophies and consortia as models for the origin of mitochondria. p. 163-183. In: J. Seckbach (eds.), Symbiosis: mechanisms and model systems, Kluwer Academics Publishers, Netherlands. Simon M., Grossart H.-P., Schweitzer B. and Ploug H. (2002) Microbial ecology of organic aggregates in aquatic ecosystems. Aquat. Microb. Ecol. 28: 175-211. Steudel R., Holdt G., Visscher P. T. and van Gemerden H. (1990) Search for polythionates in cultures of Chromatium vinosum after sulfide incubation. Arch. Microbiol. 153: 432-437. Thamdrup B., Finster K., Hansen J. W. and Bak F. (1993) Bacterial disproportionation of elemental sulfur coupled to chemical reduction of iron or manganese. Appl. Environ. Microbiol. 59: 101-108. Teske A., Ramsing N. B., Habicht K., Fukui M., Küver J., Jørgensen B. B. and Cohen Y. (1998) Sulfate-reducing bacteria and their activities in cyanobacterial mats of Solar Lake (Sinai, Egypt). Appl. Environ. Microbiol. 64: 2943-2951. Teske A. and Stahl D. A. (2002) Microbial mats and biofilms: evolution, structure, and function of fixed microbial communities. p. 49-100. In: J. T. Staley and A.-L. Reysenbach (eds), Biodiversity of microbial life, Wiley-Liss Inc., New York. Tolker-Nielsen T. and Mølin S. (2000) Spatial organization of microbial biofilm communities. Microbial. Ecol. 40: 75-84. Tsuchak C., Glaeser J. and Overmann J. (1999) Specific detection of green sulfur bacteria by in situ hybridization with fluorescently labeled oligonucleotide probe. Arch. Microbiol. 171: 265-272. Valentine D. L. (2001) Thermodynamic ecology of hydrogen based synthrophy. p.147-161. In: J. Seckbach (eds.), Symbiosis: mechanisms and model systems, Kluwer Academics Publishers, Netherlands. van den Ende F. P., Lavermann A. M. and van Gemerden H. (1996) Coexistence of aerobic chemotrophic and anaerobic phototrophic sulfur bacteria under oxygen limitation. FEMS Microb. Ecol. 19: 141-151. van den Ende F. P., Meier J. and van Gemerden H. (1997) Synthrophic growth of sulfate-reducing bacteria and colorless sulfur bacteria during oxygen limitation. FEMS Microbiol. Ecol. 23: 65-80. van Gemerden (1987) Competition between purple sulfur bacteria and green sulfur bacteria: role of sulfide, sulfur and polysulfides. p. 13-27. In: T. Lindholm (eds), Ecology of photosynthetic prokaryotes, with special reference to meromictic lakes and coastal lagoons. Åbo Academy Press, Åbo Finland. van Gemerden H. and Beeftink H. H. (1983) Ecology of phototrophic bacteria. p. 146-185. In: J. G. Ormerod (eds), The phototrophic bacteria: anaerobic life in the light, Studies in Microbiology Vol. 4, University of California Press, Berkeley and Los Angeles. van Gemerden H. and Beeftink H. H. (1981) Coexistence of Chlorobium and Chromatium in a sulfide-limited continuous culture. Arch. Microbiol. 129: 32-34. van Gemerden H. and Mas J. (1995) Ecology of phototrophic sulfur bacteria. p. 49-85. In: R. E. Blankenship, M. T. Madigan and C. E. Bauer (eds), Anoxygenic Photosynthetic Bacteria, Kluwer Academic Publishers, The Netherlands. Discussion 139 van Gemerden H., Montesinos E., Mas J. and Guerrero R. (1985) Diel cycle of metabolism of phototrophic purple sulfur bacteria in Lake Cisó (Spain). Limnol. Oceanogr. 30: 932-943. Visscher P. T., Nijburg J. W. and van Gemerden H. (1990) Polysulfide utilization by Thiocapsa roseopersicina. Arch. Microbiol. 155: 75-81. Visscher P. T., Prins R. A. and van Gemerden H. (1992a) Rates of sulfate reduction and thiosulfate consumption in a marine microbial mat. FEMS Microbiol. Ecol. 86: 283-294. Visscher P. T., van den Ende F. P., Schaub B. E. M. and van Gemerden H. (1992b) Competition between anoxygenic phototrophic bacteria and colorless sulfur bacteria in a microbial mat. FEMS Microbiol. Ecol. 101: 51-58. Vila X., Abella C. A., Figueras J. B. and Hurley J. P. (1998) Vertical models of phototrophic bacterial distribution in the metalimnetic microbial communities of several freshwater North- American kettle lakes. FEMS Microbiol. Ecol. 25: 287-299.

Warthmann R., Cypionka H. and Pfennig N. (1992) Photoproduction of H2 from acetate by syntrophic cocultures of green sulfur bacteria and sulfur-reducing bacteria. Arch. Microbiol. 157: 343- 348. Weiss P., Schweitzer B., Amann R. and Simon M. (1996) Identification in situ and dynamics of bacteria on limnetic organic aggregates (lake snow). Appl. Environ. Microbiol. 62: 1998- 2005. Whitehead N. A., Barnard A. M. L., Slater H., Simpson N. J. L. and Salmond G. P. C. (2001) Quorum-sensing in Gram-negative bacteria. FEMS Microbiol. Rev. 25: 365-404. Widdel F. and Hansen T. A. (1992) The dissimilatory sulfate- and sulfur-reducing bacteria. p. 584- 624. In: A. Balows, H. G. Trüper, M. Dworkin, W. Harder and K. H. Schleifer (eds), The Prokaryotes, Springer, New York. Widdel F. and Pfennig N. (1992) The genus Desulforomonas and other Gram-negative sulfur- reducing Eubacteria. p. 3379-3389. In: A. Balows, H. G. Trüper, M. Dworkin, W. Harder and K. H. Schleifer (eds), The Prokaryotes, Springer, New York. Wieringa E. B. A., Overmann J. and Cypionka H. (2000) Detection of abundant sulphate-reducing bacteria in marine oxic sediment layers by a combined cultivation and molecular approach. Environmental Microbiology 2: 417-427. Wimpenny J., Manz W. and Szewzyk U. (2000) Heterogeneity in biofilms. FEMS Microbiol. Rev. 24: 661-671. Wood D. W., Gong F., Daykin M. M., Williams P. and Pierson III L. S. (1997) N-Acyl- homoserine lactone production in Pseudomenas aureofaciens 30-84 in the wheat rhizosphere. J. Bacteriol. 79: 7663-7670.

Curriculum vitae

born on the 15th of October, 1973 in Lugano, Switzerland

1979-1992 Primary and secondary education in Lugano Gymnasium, scientific section

1993-1998 Studies of environmental engineering at the Swiss Federal Institute of Technology in Lausanne (EPFL)

1997-1998 Diploma thesis at the GECOS-Ecotox (Group of Ecotoxicology at the Environmental Engineering Department), Swiss Federal Institute of Technology in Lausanne (EPFL)

1998-2000 Research assistant at the Cantonal Institute of Microbiology, Microbial Ecology (University of Geneva), Lugano

Nov. 1999-Dec. 1999 Research visit at the Max-Planck Institute for Marine Microbiology in Bremen, Germany

2000-2002 Research scholar at the Dept. of Biological Sciences, Rutgers University and Department of Chemical Engineering, New Jersey Institute of Technology (NJIT), Newark, NJ, USA

2001-2003 PhD thesis at the EAWAG (Swiss Federal Institute for Environmental Science and Technology), Swiss Federal Institute of Technology in Zürich (ETHZ)

Aknowledgements

First of all I would like to thank Prof. Alexander J. B. Zehnder. He accepted to be the supervisor of this thesis giving me the opportunity to carry out this project.

In particular I wish to thank Prof. Dittmar Hahn for his strong, continuous, indispensable support and help accompanying every step of the thesis.

This thesis greatly benefited from the work of Dr. Mauro Tonolla. He deserves special thanks for his continuous support and for opening up the path for this thesis with his ideas and creativity.

A special thank to Prof. Raffaele Peduzzi for giving me the opportunity to initiate and carry out part of this thesis at the Centro di Biologia Alpina (Piora) and at the Cantonal Institute of Microbiology.

Along the thesis valuables inputs were given by Drs. Antonella Demarta and David Burke, technical support of AnnaPaola Caminada and Nadia Ruggeri was often decisive in the course of laboratory manipulations; I would like to thank them as well.

Part of this thesis was initiated during a two-month stay in Bremen, Germany and I'm indebted to Profs. Friedrich Widdel and Rudolf Amann and Dr. Karsten Zengler who kindly introduced me to the world of anaerobic cultures.

I would also like to thank all the people working at the Cantonal Institute of Microbiology, Prof. Kafkewitz for hosting me in his laboratories at Rutgers, as well as Lolly and Nunzia for maintaining good spirits during lab work.

I also owe my gratitude to my parents who always trusted and supported me. I'm deeply grateful to Manuela for her indispensable moral support and for understanding my needs.