Forensic Applications of Y Chromosome Strs and Snps
Total Page:16
File Type:pdf, Size:1020Kb
Load more
										Recommended publications
									
								- 
												  Association Between Haplotypes and Specific Mutations in Swiss Cystic Fibrosis Families003 I -3'19Xj9 1/3004-0304903.00/0 PEDIATRIC RESEARCH Vol. 30. No. 4, 199 1 Copyright (5 1991 International Pediatric Research Foundation. Inc. h.i~~rc,d~n U..S .,I Association between Haplotypes and Specific Mutations in Swiss Cystic Fibrosis Families SABINA LIECHTI-GALLATI. NASEEM MALIK, MUALLA ALKAN, MARC0 MAECHLER, MICHAEL MORRIS, FRANCINE THONNEY, FELIX SENNHAUSER. AND HANS MOSER Mrclic.al Gcnctics Unii, Dcy~ur/mo~to/'Pedinfrics (In.vel.~pitol). Universirv of Bun. 3010 Bern. S+t.itzerlancl [S.L.-G.. H. \I./: Dc,[)a~.~n~e/i/c!f Gc~ndics, Urli~~rr:cilj~ C'lli/dr.c,n'.c Ho.sl)ital. 4058 Rct.scl. S~.t'il~er.lr~tlrl/N.iC/., M.A I, 117slitrrcc~of iLlcelicol G'enclic.~,U~ri~~er.eitj~ c?fZuric/z, 8001 Zz~ricIi,Swi~z~rland /.IJLI.Mu.]; 11i.cfil~rle of Medicrcl Genetics, Uni1~wvi11,of Geticvu, Centre M6dical Uniro-situire, I21 1 Gencva 4. S~t~irzerluncl/Mi.Mo.J; Mediccrl Gcnrtic.~L'/li/. Uni~~c~r.sit~~of Lu~l.sc~nne, C'c~nrrc Hospitnlier U~iil~c~~sitaircI.i~ucloi.c.. 101 1 Larl.trrtlne. S~~~itserlanci [F T.];NIICI C/II/C/~CII'SHo.el~;tal. SI. Gallen, S~t.itzerlu~lc//F.S.] ABSTRACT. Cystic fibrosis (CF) is the most common CF is the most common severe autosomal recessive genetic severe autosomal recessive genetic disorder in Caucasian disorder in Caucasian populations. with an incidence of about 1 populations, with an incidence of about 1 in 2000 live in 2000 live births, implying a carrier frequency of about 1 in births, implying a carrier frequency of about 1 in 22.
- 
												  Y-Chromosome Short Tandem Repeat, Typing Technology, Locus Information and Allele Frequency in Different Population: a ReviewVol. 14(27), pp. 2175-2178, 8 July, 2015 DOI:10.5897/AJB2015.14457 Article Number: 2E48C3F54052 ISSN 1684-5315 African Journal of Biotechnology Copyright © 2015 Author(s) retain the copyright of this article http://www.academicjournals.org/AJB Review Y-Chromosome short tandem repeat, typing technology, locus information and allele frequency in different population: A review Muhanned Abdulhasan Kareem1, Ameera Omran Hussein2 and Imad Hadi Hameed2* 1Babylon University, Centre of Environmental Research, Hilla City, Iraq. 2Department of Molecular Biology, Babylon University, Hilla City, Iraq. Received 29 January, 2015; Accepted 29 June, 2015 Chromosome Y microsatellites seem to be ideal markers to delineate differences between human populations. They are transmitted in uniparental and they are very sensitive for genetic drift. This review will highlight the importance of the Y- Chromosome as a tool for tracing human evolution and describes some details of Y-chromosomal short tandem repeat (STR) analysis. Among them are: microsatellites, amplification using polymerase chain reaction (PCR) of STRs, separation and detection and advantages of X-chromosomal microsatellites. Key words: Forensic, population, review, STR, Y- chromosome. INTRODUCTION Microsatellites are DNA regions with repeat units that are microsatellite, but repeats of five (penta-) or six (hexa-) 2 to 7 bp in length or most generally short tandem nucleotides are usually classified as microsatellites as repeats (STRs) or simple sequence repeats (SSRs) well. DNA can be used to study human evolution. (Ellegren, 2000; Imad et al., 2014). The classification of Besides, information from DNA typing is important for the DNA sequences is determined by the length of the medico-legal matters with polymorphisms leading to more core repeat unit and the number of adjacent repeat units.
- 
												  Combinatorial Genomic Data Refute the Human Chromosome 2 Evolutionary Fusion and Build a Model of Functional Design for Interstitial Telomeric RepeatsThe Proceedings of the International Conference on Creationism Volume 8 Print Reference: Pages 222-228 Article 32 2018 Combinatorial Genomic Data Refute the Human Chromosome 2 Evolutionary Fusion and Build a Model of Functional Design for Interstitial Telomeric Repeats Jeffrey P. Tomkins Institute for Creation Research Follow this and additional works at: https://digitalcommons.cedarville.edu/icc_proceedings Part of the Biology Commons, and the Genomics Commons DigitalCommons@Cedarville provides a publication platform for fully open access journals, which means that all articles are available on the Internet to all users immediately upon publication. However, the opinions and sentiments expressed by the authors of articles published in our journals do not necessarily indicate the endorsement or reflect the views of DigitalCommons@Cedarville, the Centennial Library, or Cedarville University and its employees. The authors are solely responsible for the content of their work. Please address questions to [email protected]. Browse the contents of this volume of The Proceedings of the International Conference on Creationism. Recommended Citation Tomkins, J.P. 2018. Combinatorial genomic data refute the human chromosome 2 evolutionary fusion and build a model of functional design for interstitial telomeric repeats. In Proceedings of the Eighth International Conference on Creationism, ed. J.H. Whitmore, pp. 222–228. Pittsburgh, Pennsylvania: Creation Science Fellowship. Tomkins, J.P. 2018. Combinatorial genomic data refute the human chromosome 2 evolutionary fusion and build a model of functional design for interstitial telomeric repeats. In Proceedings of the Eighth International Conference on Creationism, ed. J.H. Whitmore, pp. 222–228. Pittsburgh, Pennsylvania: Creation Science Fellowship. COMBINATORIAL GENOMIC DATA REFUTE THE HUMAN CHROMOSOME 2 EVOLUTIONARY FUSION AND BUILD A MODEL OF FUNCTIONAL DESIGN FOR INTERSTITIAL TELOMERIC REPEATS Jeffrey P.
- 
												  The Role of Haplotypes in Candidate Gene StudiesGenetic Epidemiology 27: 321–333 (2004) The Role of Haplotypes in Candidate Gene Studies Andrew G. Clarkn Department of Molecular Biology and Genetics, Cornell University, Ithaca, New York Human geneticists working on systems for which it is possible to make a strong case for a set of candidate genes face the problem of whether it is necessary to consider the variation in those genes as phased haplotypes, or whether the one-SNP- at-a-time approach might perform as well. There are three reasons why the phased haplotype route should be an improvement. First, the protein products of the candidate genes occur in polypeptide chains whose folding and other properties may depend on particular combinations of amino acids. Second, population genetic principles show us that variation in populations is inherently structured into haplotypes. Third, the statistical power of association tests with phased data is likely to be improved because of the reduction in dimension. However, in reality it takes a great deal of extra work to obtain valid haplotype phase information, and inferred phase information may simply compound the errors. In addition, if the causal connection between SNPs and a phenotype is truly driven by just a single SNP, then the haplotype- based approach may perform worse than the one-SNP-at-a-time approach. Here we examine some of the factors that affect haplotype patterns in genes, how haplotypes may be inferred, and how haplotypes have been useful in the context of testing association between candidate genes and complex traits. Genet. Epidemiol. & 2004 Wiley-Liss, Inc. Key words: haplotype inference; haplotype association testing; candidate genes; linkage equilibrium Grant sponsor: NIH; Grant numbers: GM65509, HL072904.
- 
												  Microdeletion of the Azfc Locus with High Frequency of Mosaicism 46,XY/47XYY in Cases of Non Obstructive Azoospermia in Eastern Population of IndiaMicrodeletion of the AZFc locus with high frequency of mosaicism 46,XY/47XYY in cases of non obstructive azoospermia in eastern population of India A.K. Saxena and K. Aniket Department of Pathology/Lab Medicine, Molecular Cytogenetics Laboratory, All India Institute of Medical Sciences, Patna (Bihar), India Corresponding author: A.K. Saxena E-mail: [email protected] Genet. Mol. Res. 18 (2): gmr18349 Received May 07, 2019 Accepted June 06, 2019 Published June 18, 2019 DOI http://dx.doi.org/10.4238/gmr18349 ABSTRACT. The etiopathology of male infertility is highly complex, involving gene - environment interactions to regulate spermatogenesis. Consequently, genetic analysis becomes imperative for cases of non-obstructive azoospermia (NOA) to identify the causative factors. Cases (n = 111) of NOA referred to the cytogenetics and molecular genetics laboratory of the All India Institute of Medical Sciences in -Patna from 2013-2018 were subjected to 1) karyotyping using GTG bandings techniques, 2) fluorescence in situ hybridization (FISH) for the sex determining region (SRY), and 3) PCR based analysis of STS markers based on microdeletion of the Y- chromosome after isolation of genomic DNA from whole blood. A flow cytometer was used for a cell- kinetic and DNA methylation study after incorporation of 5-azacytidine (5- AzaC) (1.0 ug/mL) in lymphocyte culture. PCR products were analyzed on an agarose gel (1.5%) and bands were visualized on Gel Doc after ethidium bromide staining. Chromosomal abnormalities, including structural numerical variations, were observed in 14 of the karyotypes. Eight cases showed a 46,XY/47,XYY i.e. mosaic pattern; two cases 46, XY/45/XO; a single case with 47,XY +16; two cases with 46,X+ ring Y; a single case with 46,XY+dicentric in Genetics and Molecular Research 18 (2): gmr18349 ©FUNPEC-RP www.funpecrp.com.br A.K.
- 
												  Haplotype Tagging Reveals Parallel Formation of Hybrid Races in Two Butterfly SpeciesbioRxiv preprint doi: https://doi.org/10.1101/2020.05.25.113688; this version posted May 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Title: Haplotype tagging reveals parallel formation of hybrid races in two butterfly species One-sentence summary: Haplotagging, a novel linked-read sequencing technique that enables whole genome haplotyping in large populations, reveals the formation of a novel hybrid race in parallel hybrid zones of two co-mimicking Heliconius butterfly species through strikingly parallel divergences in their genomes. Short title: Haplotagging reveals parallel formation of hybrid races Keywords: Butterfly, Genomes, Clines, Hybrid zone, [local] adaptation, haplotypes, population genetics, evolution bioRxiv preprint doi: https://doi.org/10.1101/2020.05.25.113688; this version posted May 27, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Authors: Joana I. Meier1,2,*, Patricio A. Salazar1,3,*, Marek Kučka4,*, Robert William Davies5, Andreea Dréau4, Ismael Aldás6, Olivia Box Power1, Nicola J. Nadeau3, Jon R. Bridle7, Campbell Rolian8, Nicholas H. Barton9, W. Owen McMillan10, Chris D. Jiggins1,10,†, Yingguang Frank Chan4,† Affiliations: 1. Department of Zoology, University of Cambridge, Downing Street, Cambridge, CB2 3EJ, United Kingdom 2. St John’s College, University of Cambridge, Cambridge, CB2 1TP, United Kingdom 3.
- 
												  Haplotype Inference from Pedigree Data and Population DataHAPLOTYPE INFERENCE FROM PEDIGREE DATA AND POPULATION DATA by XIN LI Submitted in partial ful¯llment of the requirements For the Degree of Doctor of Philosophy Dissertation Advisor: Jing Li Department of Electrical Engineering and Computer Science CASE WESTERN RESERVE UNIVERSITY January, 2010 CASE WESTERN RESERVE UNIVERSITY SCHOOL OF GRADUATE STUDIES We hereby approve the thesis/dissertation of _____________________________________________________ candidate for the ______________________degree *. (signed)_______________________________________________ (chair of the committee) ________________________________________________ ________________________________________________ ________________________________________________ ________________________________________________ ________________________________________________ (date) _______________________ *We also certify that written approval has been obtained for any proprietary material contained therein. Table of Contents List of Tables iv List of Figures v Acknowledgments vi Abstract vii Chapter 1. Introduction 1 1.1 Statistical methods . 3 1.2 Rule-based methods . 4 1.2.1 MRHC . 4 1.2.2 ZRHC . 5 Chapter 2. Problem statement and solutions 8 2.1 Large Pedigrees: manipulation of Mendelian constraints . 9 2.2 Families with many markers: dealing with recombinations . 9 2.3 Mixed data: use of population information . 10 Chapter 3. Preliminaries 12 3.1 Mendelian and zero-recombinant constraints . 14 3.2 Locus graphs . 15 3.3 Linear constraints on h variables . 17 Chapter 4. Linear Systems on Mendelian Constraints 19 4.1 Methods to solve the linear systems . 19 4.1.1 Split nodes to break cycles . 20 4.1.2 Detect path constraints from locus graphs . 21 4.1.3 Encode path constraints in disjoint-set structure D . 26 ii 4.2 Analysis of the algorithm on tree pedigrees with complete data 31 4.3 Extension to General Cases . 33 4.3.1 Pedigrees with mating loops .
- 
												  A Genetic Map of Chromosome 11 Q. Including the Atopy LocusOriginal Paper EurJ Hum Genet 1995;3:188-194 A.J. Sandforda A Genetic Map of Chromosome M.F. Moffat t* S.E. Danielsa 11 q. Including the Atopy Locus Y. Nakamura'0 GM. Lathropc J.M. Hopkind W.O.CM. Cooksona 1608202 a Nuffield Department of Medicine, John Radcliffe Hospital, Oxford, UK; b Division of Biochemistry, Abstract Cancer Institute, Tokyo, Japan; Atopy is a common and genetically heterogeneous syndrome c CEPHB, Paris, France; and predisposing to allergic asthma and rhinitis. A locus linked to d Osier Chest Unit, Churchill Hospital, Oxford, UK the atopy phenotype has been shown to be present on chromo some llql2-13. Linkage has only been seen in maternally derived alleles. We have constructed a genetic linkage map of Key Words the region, using 15 markers to span approximately 27 cM, Atopy and integrate previously published maps. Under a model of Genetic map maternal inheritance, the atopy locus is placed within a 7-cM Linkage analysis interval between D11S480 and D11S451. The interval con Chromosome 11 tains the important candidate gene FCERIB. Introduction The linkage has been replicated in nuclear families [3], and has been independently con Atopy is a common familial syndrome firmed in extended Japanese families [4], and which underlies allergic asthma and rhinitis. Dutch asthmatic sib pairs [5]. All these posi It is characterised by immunoglobulin E re tive linkage results were seen in families with sponses to common aero-allergens such as severe symptomatic atopy. Linkage at this grass pollens or house dust mite. An atopy- locus is made more difficult because it is seen associated phenotype may be defined by mea predominately through maternal meioses [3- suring prick skin test responses to these aller 7], Linkage is also confounded by a high pop gens, by measuring specific IgE responses and ulation prevalence, and low penetrance in ear by estimating the total serum IgE.
- 
												  Statistical Genetics – Part IStatistical Genetics –Part I Lecture 3: Haplotype reconstruction Su‐In Lee, CSE & GS, UW [email protected] 1 Outline Basic concepts Allele, allele frequencies, genotype frequencies Haplotype, haplotype frequency Recombination rate Linkage disequilibrium Haplotype reconstruction Parsimony‐based approach EM‐based approach Next topic Disease association studies 2 1 Alleles Alternative forms of a particular sequence Each allele has a frequency, which is the proportion of chromosomes of that type in the population C, G and -- are alleles …ACTCGGTTGGCCTTAATTCGGCCCGGACTCGGTTGGCCTAAATTCGGCCCGG … …ACTCGGTTGGCCTTAATTCGGCCCGGACTCGGTTGGCCTAAATTCGGCCCGG … …ACCCGGTAGGCCTTAATTCGGCCCGGACCCGGTAGGCCTTAATTCGGCCCGG … …ACCCGGTAGGCCTTAATTCGGCC--GGACCCGGTAGGCCTTAATTCGGCCCGG … …ACCCGGTTGGCCTTAATTCGGCCGGGACCCGGTTGGCCTTAATTCGGCCGGG … …ACCCGGTTGGCCTTAATTCGGCCGGGACCCGGTTGGCCTTAATTCGGCCGGG … single nucleotide polymorphism (SNP) allele frequencies for C, G, -- 3 Allele Frequency Notations For two alleles Usually labeled p and q = 1 –p e.g. p = frequency of C, q = frequency of G For more than 2 alleles Usually labeled pA, pB, pC ... … subscripts A, B and C indicate allele names 4 2 Genotype The pair of alleles carried by an individual If there are n alternative alleles … … there will be n(n+1)/2 possible genotypes In most cases, there are 3 possible genotypes Homozygotes The two alleles are in the same state (e.g. CC, GG, AA) Heterozygotes The two alleles are different (e.g. CG, AC) 5 Genotype Frequencies Since alleles occur in pairs, these
- 
												  The Role of the C-Terminus Merlin in Its Tumor Suppressor Function Vinay MandatiThe role of the C-terminus Merlin in its tumor suppressor function Vinay Mandati To cite this version: Vinay Mandati. The role of the C-terminus Merlin in its tumor suppressor function. Agricultural sciences. Université Paris Sud - Paris XI, 2013. English. NNT : 2013PA112140. tel-01124131 HAL Id: tel-01124131 https://tel.archives-ouvertes.fr/tel-01124131 Submitted on 19 Mar 2015 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. 1 TABLE OF CONTENTS Abbreviations ……………………………………………………………………………...... 8 Resume …………………………………………………………………………………… 10 Abstract …………………………………………………………………………………….. 11 1. Introduction ………………………………………………………………………………12 1.1 Neurofibromatoses ……………………………………………………………………….14 1.2 NF2 disease ………………………………………………………………………………15 1.3 The NF2 gene …………………………………………………………………………….17 1.4 Mutational spectrum of NF2 gene ………………………………………………………..18 1.5 NF2 in other cancers ……………………………………………………………………...20 2. ERM proteins and Merlin ……………………………………………………………….21 2.1 ERMs ……………………………………………………………………………………..21 2.1.1 Band 4.1 Proteins and ERMs …………………………………………………………...21 2.1.2 ERMs structure ………………………………………………………………………....23 2.1.3 Sub-cellular localization and tissue distribution of ERMs ……………………………..25 2.1.4 ERM proteins and their binding partners ……………………………………………….25 2.1.5 Assimilation of ERMs into signaling pathways ………………………………………...26 2.1.5. A. ERMs and Ras signaling …………………………………………………...26 2.1.5. B. ERMs in membrane transport ………………………………………………29 2.1.6 ERM functions in metastasis …………………………………………………………...30 2.1.7 Regulation of ERM proteins activity …………………………………………………...31 2.1.7.
- 
												  Glossary/IndexGlossary 03/08/2004 9:58 AM Page 119 GLOSSARY/INDEX The numbers after each term represent the chapter in which it first appears. additive 2 allele 2 When an allele’s contribution to the variation in a One of two or more alternative forms of a gene; a single phenotype is separately measurable; the independent allele for each gene is inherited separately from each effects of alleles “add up.” Antonym of nonadditive. parent. ADHD/ADD 6 Alzheimer’s disease 5 Attention Deficit Hyperactivity Disorder/Attention A medical disorder causing the loss of memory, rea- Deficit Disorder. Neurobehavioral disorders character- soning, and language abilities. Protein residues called ized by an attention span or ability to concentrate that is plaques and tangles build up and interfere with brain less than expected for a person's age. With ADHD, there function. This disorder usually first appears in persons also is age-inappropriate hyperactivity, impulsive over age sixty-five. Compare to early-onset Alzheimer’s. behavior or lack of inhibition. There are several types of ADHD: a predominantly inattentive subtype, a predomi- amino acids 2 nantly hyperactive-impulsive subtype, and a combined Molecules that are combined to form proteins. subtype. The condition can be cognitive alone or both The sequence of amino acids in a protein, and hence pro- cognitive and behavioral. tein function, is determined by the genetic code. adoption study 4 amnesia 5 A type of research focused on families that include one Loss of memory, temporary or permanent, that can result or more children raised by persons other than their from brain injury, illness, or trauma.
- 
												  Exploring Extracellular Vesicles Biogenesis in Hypothalamic Cells Through a Heavy Isotope Pulse/Trace Proteomic Approachcells Article Exploring Extracellular Vesicles Biogenesis in Hypothalamic Cells through a Heavy Isotope Pulse/Trace Proteomic Approach Chee Fan Tan 1,2 , Hui San Teo 2, Jung Eun Park 2, Bamaprasad Dutta 2, Shun Wilford Tse 2, Melvin Khee-Shing Leow 3,4,5 , Walter Wahli 3,6 and Siu Kwan Sze 2,* 1 NTU Institute for Health Technologies, Interdisciplinary Graduate School, Nanyang Technological University, Singapore 637335, Singapore; [email protected] 2 School of Biological Sciences, Nanyang Technological University, Singapore 637551, Singapore; [email protected] (H.S.T.); [email protected] (J.E.P.); [email protected] (B.D.); [email protected] (S.W.T.) 3 Lee Kong Chian School of Medicine, Nanyang Technological University, Singapore 636921, Singapore; [email protected] (M.K.-S.L.); [email protected] (W.W.) 4 Department of Endocrinology, Tan Tock Seng Hospital, Singapore 308433, Singapore 5 Cardiovascular and Metabolic Disorder Program, Duke-NUS Medical School, Singapore 169857, Singapore 6 Center for Integrative Genomics, University of Lausanne, Le Génopode, CH-1015 Lausanne, Switzerland * Correspondence: [email protected]; Tel.: +65-6514-1006; Fax: +65-6791-3856 Received: 24 March 2020; Accepted: 21 May 2020; Published: 25 May 2020 Abstract: Studies have shown that the process of extracellular vesicles (EVs) secretion and lysosome status are linked. When the lysosome is under stress, the cells would secrete more EVs to maintain cellular homeostasis. However, the process that governs lysosomal activity and EVs secretion remains poorly defined and we postulated that certain proteins essential for EVs biogenesis are constantly synthesized and preferentially sorted to the EVs rather than the lysosome.