The Bacillus Subtilis Spooj Gene:Evidence for Involvement In

Home , Catabolite repression

JOURNAL OF BACTERIOLOGY, Mar. 1991, p. 1911-1919 Vol. 173, No. 6 0021-9193/91/061911-09$02.00/0 Copyright C 1991, American Society for Microbiology The Bacillus subtilis spoOJ Gene: Evidence for Involvement in Catabolite Repression of Sporulation TAMI H. MYSLIWIEC,1 JEFFREY ERRINGTON,2 AKHIL B. VAIDYA,' AND MICHAEL G. BRAMUCCI1* Department of Microbiology and Immunology, Hahnemann University, Philadelphia, Pennsylvania 19102-1192,1 and Chemical Pathology Unit, Sir William Dunn School of Pathology, University of Oxford, Oxford, United Kingdom2 Received 10 August 1990/Accepted 8 January 1991

Previous observations concerning the ability of the Bacillus subtilis bacteriophages SP10 and PMB12 to suppress mutations in spoOJ and to make wild-type sporulation catabolite resistant suggested that spoOJ had a role in catabolite repression of sporulation. This suggestion was supported in the present report by the ability of the catabolite-resistant sporulation mutation crsF4 to suppress a Tn917 insertion mutation of the B. subtilis spoOJ locus (spoOJ::Tn917fQHU261) in medium without glucose. Although crsF4 and SP10 made wild-type B. Downloaded from subtilis sporulation catabolite resistant, neither crsF4 nor SP10 caused a mutant with spoOJ::Tn917Q1HU261 to sporulate in medium with glucose. Sequencing the spoOJ locus revealed an open reading frame that was 179 codons in length. Disruption of the open reading frame resulted in a sporulation-negative (Spo-) phenotype that was similar to those of other spoOJ mutations. Analysis of the deduced amino acid sequence of the spoOJ locus indicated that the spoOJ gene product contains an ot-helix-turn-a-helix unit similar to the motif found in proteins. Cro-like DNA-binding jb.asm.org

Bacillus subtilis sporulation is a model system that is used PMB12 and SP10 are also able to suppress the Spo- and to study procaryotic gene expression and cellular differenti- mutations oligosporogenic phenotypes of various spoOJ (6, at UNIV CLAUDE BERNARD on February 12, 2010 ation as responses to environmental stimuli. Sporulation is 20, 34). As a result, both PMB12-infected and SP10-infected subject to catabolite repression; i.e., the presence of glucose spoOJ mutants sporulate at a significantly higher frequency or other readily metabolized carbon sources inhibits sporu- than uninfected spoOJ mutants. The observations that lation by wild-type cells (33). Initiation of sporulation is PMB12- and SP10-infected bacteria display catabolite-resis- controlled by at least seven genes, spoOA, spoOB, spoOE, tant sporulation and that these bacteriophages suppress spoOF, spoOH, spoOJ, and spoOK (23). Glucose represses spoOJ mutations suggest that spoOJ has a role in catabolite transcription of spoOA and spoOF (3, 43). However, it is not repression of sporulation. known how availability of nutrients regulates initiation of The spoOJ locus was originally thought to be represented sporulation. Several spoO genes have been sequenced (5, 9, 14, 15, 30, 41). It is evident from this work that the spoOH by two mutations, spoOJ87 and spoOJ93 (17). However, spoIIA and spaIID are expressed in a strain with spoOJ87, gene codes for a sigma subunit of RNA polymerase and that genes (7, 13). some spoO genes are responsible for sensing environmental whereas spoOJ93 blocks expression of these conditions. The spoOA and spoOF gene products are homol- The wild-type alleles of both mutations have been cloned ogous to the effector molecules of the two-component re- into bacteriophage 0105 vectors (10, 12). The cloned wild- sponse regulator systems that have been described for a type allele of spoOJ87 does not complement spoOJ93, and the variety of bacteria (15, 41). The effector molecule of a wild-type allele of spoOJ93 does not complement spoOJ87. two-component system is phosphorylated by a cognate Hence, spoOJ87 and spoOJ93 are in different genes. The histidine kinase in response to an appropriate environmental spoOJ93 mutation marks the locus referred to as spoOJ in this stimulus, such as the presence of an important nutrient (36). report. Unfortunately, little information concerning spoOJ is It is possible that the spoIIJ gene product (KinA) is the available in the literature, because many studies concerning cognate kinase of spoOA or spoOF or both (1, 29). Although the activity of spoO genes have utilized spoOJ87 as a repre- recent data indicate that the spoOA gene product is a sentative of the spoOJ locus rather than spoOJ93. Neverthe- DNA-binding protein, it is not known how the spoOA gene less, it is clear that spoOJ behaves differently than the other product acts to regulate initiation of sporulation (37). spoO genes, as evidenced by the effects of spoOJ93 on Although sporulation by B. subtilis is normally repressed expression of spoIIA and spoVG. Expression of spoIIA is by glucose, wild-type cells infected by bacteriophage PMB12 blocked by mutations in any of the spoO genes, including or SP10 initiate sporulation in medium containing enough spoOJ93 (13). In contrast, mutations in spoOA, spoOB, spoOE, glucose to repress sporulation by uninfected bacteria (34). spoOF, spoOH, and spoOK interfere with expression of Essentially, bacteria infected by PMB12 or SP10 have a spoVG, but expression of spoVG is not significantly affected catabolite-resistant sporulation (Crs) phenotype. The Crs by spoOJ93 (45). phenotype of PMB12- and SP10-infected bacteria is similar The data presented in this report provide additional evi- to the phenotype of the crs mutations that have been dence for the involvement of spoOJ in catabolite repression reported to occur in several different genes (38, 39). In of sporulation. This contention was supported by the obser- addition to conferring a Crs phenotype upon host bacteria, vation that two independently isolated spoOJ mutations were suppressed by a crs mutation. Determination of the nucleotide sequence of spoOJ indicated that the spoOJ gene product * Corresponding author. may be a DNA-binding protein. 1911 1912 MYSLIWIEC ET AL. J. BACTERIOL.

TABLE 1. B. subtilis strains Strain Description' Source or reference Derivatives of strain 168 168 Wild type PY79 Wild type 31 BR151 lys-3 metBlO trpC2 44 CM-1 lys-3 metBlO trpC2 spoCM-1 6 93.2 trpC2 spoOJ93 12 KS261 spoOJ::Tn9J7fQHU261 31 1A579 crsAl Bacillus Genetic Stock Center 1A582 crsB40 Bacillus Genetic Stock Center 1A583 crsCI Bacillus Genetic Stock Center 1A584 crsC2 Bacillus Genetic Stock Center 1A585 crsDI Bacillus Genetic Stock Center 1A586 crsEI Bacillus Genetic Stock Center 1A587 crsF4 Bacillus Genetic Stock Center MGB3006 Ermr transformant of 1A579 that contains spoOJ::Tn9178HU261 This study MGB3007 Ermr transformant of 1A587 that contains spoOJ::Tn917QHU261 This study

MGB3008 Chir transformant of BR151 that has pSMGU32 inserted into spoOJ This study Downloaded from MG133009 Chlr transformant of 168 that has pSMGU32 inserted into spoOJ This study MGB3010 Chir transformant of 1A587 that has pSMGU32 inserted into spoOJ This study MGB3013 Ermr transformant of BR151 that contains spoOJ::Tn9l7fQHU261 This study Derivatives of ATCC 7003 3-13 His- 24 MGB3004 His-, spoOJ::Tn9J70HU261 34 jb.asm.org aHis-, Auxotrophic requirement for histidine; Chir, resistance to chloramphenicol; Ermr, erythromycin-lincomycin resistance encoded by Tn917.

MATERIALS AND METHODS of phosphate-buffered 2x SG were described previously at UNIV CLAUDE BERNARD on February 12, 2010 (34). Bacterial strains, culture conditions, and sporulation as- All bacteria were made competent for transformation by says. The bacterial strains used in this study are described in standard procedures (4). Erythromycin-lincomycin-resistant Table 1. (Erm9) transformants were selected on tryptose blood agar All liquid culture experiments were performed in phos- plates containing erythromycin (1 txg/Ml) and lincomycin (25 phate-buffered 2x SG, which was the same as 2x SG (22) ,ug/ml). Chloramphenicol-resistant (ChlV) transformants except that FeCl2 was omitted and the medium contained 14 were selected on tryptose blood agar plates containing 5 ,ug g ofK2HPO4 and 6 g ofKH2PO4 per liter (pH 7.0). The effect of the antibiotic per ml. Of glucose on sporulation was tested by supplementing Construction of 1OSJ113 deletion mutants. All methods phosphate-buffered 2x SG with glucose to a final concentra- for propagation and manipulation of 4105J113 and its deriv- tion of 2% from a 50% stock solution at the time of atives have been described previously (10, 12, 18). 4105J106, inoculation. All liquid cultures were incubated at 37°C with the vector from which 4405J113 was denived, has no BglII gyratory shaking at approximately 100 rpm. Sporulation was restriction sites (10). Therefore, the 0.7-kb BglII fragment obtained by inoculating 10 ml of culture medium with a was deleted from 4405J113 (Fig. 1) to produce +105J113AV single colony from an overnight tryptose blood agar plate by cutting +105J113 with BglII and ligating the DNA to (Difco Laboratories) and aSlowing the bacteria to enter the rejoin the right and left arms of +105J113 without the 0.7-kb stationary phase of growth and exhaust the medium. After BglII fragment. Restriction endonucleases. and T4 DNA the indicated time ofincubation (16 to 24 h after inoculation), ligase were used in accordance with the directions of the the frequency of sporulation was determined as the percent- manufacturer (IBI, Inc.). Strain 93.2 protoplasts were trans- age of the total viable count that was heat resistant (70°C for fected with the ligated DNA, and lysogenic bacteria from the 20 min). The cross-streak assay for PMB12-enhanced sporulation of spoOJ mutants has been described previously (20, 25, 34) I and was performed as follows. PMB12 lysate was applied as -E1 -z a narrow band across the center of a petri plate containing i 2x SG solidified with 1.5% agar that was no more than 24 h *isrn 711m 01 5I - mI 5 .1.1 old. Strains with spoOJ- mutations were streaked across the Mul ------b-4-- CIRF62 dried lysate. After incubation at 37°C for the specified time, bacteria from the uninfected and bacteriophage-infected regions of the cross-streaks were viewed in wet mounts under a phase-contrast microscope. The frequency of sporulation was determined by calculating the mean percentage of 1.0 kb T phase-bright bodies in samples containing at least 100 cells x that were counted in five different fields of the same wet FIG. 1. Restriction map of 4105J113 and deletion mutants. Bold mount. letters indicate endonuclease restriction sites within the cloned The procedures concerning SP10-mediated sporulation DNA. Plain letters indicate the endonuclease restriction sites of the and measurement of a-amylase activity in overnight cultures vector's polylinker region. VOL. 173, 1991 B. SUBTILIS spoOJ GENE 1913

5'. CACTTTGATGACGAGGCATTAGTGAACTAAAAGAATCTGAGTITQGAgCATGGCATTCTTCAGCCGCTTATCGTC AGAAAATCTTTAAAAGGCTATGATATTGTTGCGGGTGAACGGCGTTTTCGAGCGGCAAAGCTGGCAGGTTTAGATACAGTTCC GGCCATTGTCCGTGAATTATCAGAGGCGTTA ATG AGG GAA ATT GCT TTA TTA GAA AAC CTT CAG CGT GAA met arg glu ile ala leu leu glu asn leu gln arg glu GAT TTA TCT CCG CTT GAA GAG GCT CAG GCA TAT GAC TCC CTT TTG AAA CAC TTA GAT CTC ACA asp leu ser pro leu glu glu ala gln ala tyr asp ser leu leu lys his leu asp leu thr CAA GAG CAG CTT GCC AAA CGT CTT GOG AAA AGC AGA CCG CAT ATT GCG AAT CAT TTA AGA CTG gln glu gln leu ala lys arg leu gly lys ser arg pro his ile ala asn his leu arg leu CTG ACA CTG CCA GAA AAT ATT CAA CAG CTT ATT GCC GAA GGC ACG CTT TCT ATG GGA CAT GGA leu thr leu pro glu asn ile gln gln leu ile ala glu gly thr leu ser met gly his gly CGC ACG CTT CTT GGC TTA AAA AAC AAA AAT AAG CTT GAA CCG CTG GTA CAA AAA GTG ATT GCG arg thr leu leu gly leu lys asn lys asn lys leu glu pro leu val gln lys met asn ala GAG CAG CTC AAT GTT CGC CAA CTT GAG CAG CTG ATT CAG CAG TTG AAT CAG AAT GTT CCA CGT glu gln leu asn val arg gln leu glu gln leu ile gln gln leu asn gln asn val pro arg

GAA ACA AAG AAA AAA GAA CCT GTG AAA GAT GCG GTT CTA AAA GAA CGG GAA TCC TAT CTC CAA Downloaded from glu thr lys lys lys glu pro val lys asp ala val leu lys glu arg glu ser tyr leu gln AAT TAT TTT GGA ACA ACA GTT AAT ATT AAA AGA CAG AAG AAA AAA GGC AAA ATC GAA ATT GAA asn tyr phe gly thr thr val asn ile lys arg gln lys lys lys gly lys ile glu esn glu TTT TTC TCT AAT GAA GAC CTT GAC CGG ATT TTA GAG CTT TTG TCT GAA CGA GAA TCA TAA ATG

phe phe ser asn glu asp leu asp arg ile leu glu leu leu ser glu arg glu ser jb.asm.org AA TTCAAACGCGCCCAGTGAGCCTTTGCAAGGTTAGGCGTTCTTGCCTC CACTCTGTCCGATCTGTTAAACTCAAACCTTCCGCTAGAACATTAGCCATATTCATGACCAACTTGAGTCTAGTATTTTGCAA TACAAAATATTCCATAAAACCGCTCACATTCACGATTCCGTTAATATGAAGATC ...... 3' at UNIV CLAUDE BERNARD on February 12, 2010 FIG. 2. Sequence of the spoOJ locus. A single underline marks the position of PstI, BgIIH, and Hindlll restriction sites that are located on the left end of the cloned insert of4lO5J113. A double underline designates the conserved portion of a putative Shine-Dalgarno sequence. The stop codon that terminates the spoOJ ORF is in bold lettering. The stem-loop structure that may terminate transcription of the spoOJ ORF is designated by a dotted underline. The amino acid residues constituting an a-helix-turn-a-helix unit are italicized. centers of the resulting plaques were patched onto 2 x SG versal primer (2) and custom synthesized oligonucleotides. solidified with 1.5% agar and examined for sporulation. A The sequencing reactions were performed with Sequenase Spo- lysogen was selected for further characterization. The according to the manufacturer's instructions (United States bacteriophage produced by that lysogen was designated Biochemicals, Inc.), using the single-stranded method for lO0J113AV. the M13mpl8 subclones and the double-stranded method for .4105J113AX, which lacked the DNA to the right of the the pBluescript KS(+) subclone. 0.7-kb BgIII restriction fragment of (105J113, was con- Insertion of pSGMU32 into ORF1. Plasmid pSGMU32 structed by replacing the right arm of 4105J113 with the right does not replicate in B. subtilis (11). This plasmid contains a arm of 4l105J106 as follows. 4105J113 was cut with BglII. chloramphenicol resistance (cat) gene that is expressed in B. The left arm of il05J113 (which contained the leftmost subtilis and a promoterless lacZ gene. The cat and lacZ portion of the cloned DNA) and the 0.7-kb BglII restriction genes make up a lac-cat cartridge that is flanked by restric- fragment of 4105J113 (which contained the center portion of tion sites for BamHI and a variety of other restriction the cloned DNA) were separated from the right arm of endonucleases. Several attempts to fuse the promoterless 4l105J113 (which contained the right portion of the cloned lacZ to open reading frame 1 (ORF1) were unsuccessful. DNA) by extraction from a 0.8% low-melting-point agarose However, a mutant in which pSGMU32 had integrated into gel (2). 4105J106 DNA was cut with BamHI, and the right ORFi was identified as follows. Since the BglII restriction arm of the vector was extracted from a 0.8% low-melting- site located near the beginning of ORFi was the only BglII point agarose gel. The left arm of 4105J113, the 0.7-kb BglII restriction site of 4AO5J113AX (Fig. 1 and 2), 0105J113AX restriction fragment, and the right arm of t105J106 were DNA was cut with BglII and ligated to pSGMU32 DNA that mixed and ligated. Strain 93.2 protoplasts were transfected had been cut with BamHI. The ligated DNA was trans- with the ligated DNA, and the resulting bacteriophages were formed into BR151(4105J113AX) with selection for chloram- harvested from the overlays of the transfection plates. phenicol resistance. BR151(4105J113AX) was used in this 4105J113AX was identified by screening the lysates for a procedure to minimize loss of transformants due to zygotic bacteriophage that complemented spoOJ::Tn9J7fQHU261 in induction of 4105J113AX genomes contained in the trans- strain KS261. forming DNA. Since pSGMU32 could not replicate in B. Sequencing of DNA. The 0.7-kb BglII fragment of subtilis, Chl' transformants were expected to result from 4l05J113 was subcloned in both orientations into the BamHI integration of the cat gene into the B. subtilis chromosome site of M13mpl8 (2). The 1.6-kb XbaI-HindIII restriction because of homologous recombination between the chromo- fragment of 4105J113AX was subcloned into pBluescript some and the 4105J113AX sequences flanking the cat gene. KS(+) (Stratagene, La Jolla, Calif.). Dideoxy-chain termi- MGB3008 was a Spo- ChlF transformant that resulted from nation sequencing reactions (2, 32) were initiated with uni- transferring the cat gene by transformation from a Spo+ Chl' 1914 MYSLIWIEC ET AL. J. BACTERIOL.

TABLE 2. Suppression of spoOJ::Tn9178HU261 by a catabolite- TABLE 3. Sporulation by SP10-infected MGB3004 resistant sporulation mutation in medium with glucosea Strain Glucose % Sporulation Strain Glucose SP1O % Sporulation 168 - 100.0 3-13 - - 100.0 3-13 + - 0.3 1A579 24.7 3-13 + + 100.0 MGB3006 0.1 MGB3004 - - 22.6 MGB3004 - + 81.8 1A587 - 100.0 MGB3004 + - o.0004 MGB3007 72.0 MGB3004 + + 0.007 168 + 0.001 a SPl-infected cultures were inoculated with SP10-infected carrier colonies. 1A587 + 100.0 MGB3007 + 0.02 transformation with DNA from MGB3007. Twenty Ermr Spo- tranformants with the auxotrophic requirements of BR151 were tested for complementation by 4405J113AX. BR151(QlO5J113AX) transformant to BR151. The 0.7-kb 4105J113AX was a deletion mutant of +105J113 that com- Downloaded from BgII restriction fragment of 4105J113 was end labeled with plemented spoOJ93, spoCM-1, and spoOJ::Tn917QkHU261 32P and hybridized to MGB3008 DNA by the Southern (Fig. 1; see Table 5). The mutation causing the Spo- technique (2, 35) to verify that ORFi had been disrupted. phenotype of all 20 Ermr transformants was complemented Nucleotide sequence accession number. The GenBank ac- by 105J113AX. This observation indicated that MGB3007 cession number of the sequence in Fig. 2 is M59938. contained spoOJ::Tn9J7QHU261. Therefore, the spoOJ gene

product was not necessary for sporulation in the presence of jb.asm.org RESULTS the crsF4 mutation but was necessary for crsF4 to make sporulation catabolite resistant. Suppression of spoOJ::Tn917QHU261 by crsF4 in B. subtilis Necessity of wild-type spoOJ for bacteriophage-induced ca- 168. The observation that bacteriophages PMB12 and SP10 tabolite-resistant sporulation in a derivative of B. subtilis at UNIV CLAUDE BERNARD on February 12, 2010 suppressed spoOJ mutations and made wild-type B. subtilis ATCC 7003. Suppression of spoOJ::Tn917flHU261 by crsF4 catabolite resistant for sporulation suggested the possibility in MGB3007 in phosphate-buffered 2x SG was similar to the that spoOJ was involved in catabolite repression of sporula- previously described effect of PMB12 and SP10 on the tion (34). Therefore, several crs mutations were tested for oligosporogenic mutant MGB3004 in the same culture me- the ability to suppress spoOJ::Tn9J7fiHU261. The strain 168 dium (34). The observation that MGB3007 sporulation was crs mutants 1A579, 1A582, 1A583, 1A584, 1A585, 1A586, not catabolite resistant (Table 2) suggested the possibility and 1A587 were tested for glucose-resistant sporulation that bacteriophage-induced MGB3004 sporulation might also under the conditions in which PMB12 and SP10 induce be sensitive to catabolite repression. Since SP10-infected catabolite-resistant sporulation; i.e., the crs mutants were cells generally sporulate at higher frequencies than PMB12- grown to stationary phase in phosphate-buffered 2x SG infected cells (34), the effect of glucose on SP10-induced containing 2% glucose. After 24 h, only 1A579 and 1A587 MGB3004 sporulation was examined (Table 3). After 19 h of produced significant levels of heat-resistant spores under incubation, sporulation by strain 3-13 was repressed in these conditions (data not shown). The transposon insertion phosphate-buffered 2x SG with 2% glucose, and SP10- mutation spoOJ::Tn917flHU261 was transferred from KS261 infected 3-13 cells displayed catabolite-resistant sporulation to 1A579, 1A584, 1A585, 1A586, and 1A587 by transforma- in this medium. MGB3004 had an oligosporogenic phenotype tion. None of the 1A579, 1A584, 1A585, or 1A586 transfor- in phosphate-buffered 2x SG, and SP10-infected MGB3004 mants examined sporulated at a level detectable by phase- cells sporulated at a frequency that was nearly fourfold contrast microscopy, whereas all ofthe 1A587 transformants higher than uninfected cells. These observations were essen- examined sporulated at a high level. The sporulation fre- tially the same as reported previously (34). The data from quencies of a typical Ermr 1A579 transformant (MGB3006) this experiment indicated that MGB3004 sporulation was and a typical Ermr 1A587 transformant (MGB3007) were considerably more sensitive to catabolite repression than determined in phosphate-buffered 2x SG (Table 2). After 24 3-13 sporulation. The sporulation frequency of MGB3004 h, the sporulation frequency of MGB3006 was <0.5% of the cultured in phosphate-buffered 2 x SG was more than 4 sporulation frequency of 1A579. In contrast, MGB3007 orders of magnitude higher than the sporulation frequency of sporulated nearly as well as wild-type 168 and 1A587. MGB3004 cultured in phosphate-buffered 2x SG with 2% Hence, spoOJ::Tn9J7flHU261 was suppressed by crsF4 but glucose, whereas 3-13 sporulation in phosphate-buffered 2x not by crsAl. SG was only about 300-fold higher than 3-13 sporulation in Although sporulation by wild-type 168 was severely inhib- phosphate-buffered 2x SG with 2% glucose. SP10-infected ited in phosphate-buffered 2x SG with 2% glucose, sporu- 3-13 cells sporulated in phosphate-buffered 2x SG with 2% lation by 1A587 was not significantly affected by addition of glucose at the same level as uninfected 3-13 in phosphate- glucose to the medium (Table 2). However, in spite of the buffered 2 x SG. However, SP10 had little effect on ability of the crsF4 mutation to make sporulation glucose MGB3004 sporulation in phosphate-buffered 2x SG with 2% resistant and to suppress spoOJ::Tn9J7Q1HU261, MGB3007 glucose. All of the colonies on the viable count assay plates sporulation was severely inhibited by glucose. Since the for the SP10-infected MGB3004 cultures in this experiment sporulation phenotype of MGB3007 was similar to wild type, had the smooth morphology of SP10-infected carrier colo- the presence of spoOJ::Tn917fQHU261 in MGB3007 was nies (34), indicating that SP10-infected MGB3004 had not verified as follows. Ermr was transferred to strain BR151 by sporulated in phosphate-buffered 2 x SG with 2% glucose VOL. 173, 1991 B. SUBTILIS spoOJ GENE 1915

TABLE 4. Production of o-amylase by MGB3004 TABLE 5. Complementation of spoOJ mutations Strain a-Amylase Strain % Sporulation Glucose (U/mg of activitycells) 168 82.1 3-13 14.5 PY79 76.3 3-13 + 4.0 MGB3004 - 41.1 93.2 0.3 MGB3004 + 1.1 93.2(4105J113) 76.0 93.2(4105J113AX) 88.8 93.2(4105J113AV) 0.01 CM-1 0.10 even though all of the cells in the culture were infected with CM-1(@j105J113) 54.2 SP10. These data indicated that infection with SP10 was CM-1(r1O5J113AX) 68.4 similar to the activity of crsF4; i.e., SP10 and crsF4 made CM-1(f1I5J113AV) 0.01 sporulation by wild-type bacteria catabolite resistant and effectively suppressed spoOJ: :Tn917Q1HU261 in phosphate- KS261 1.1 buffered 2x SG, but suppression of spoOJ::Tn9J7fQHU261 KS261(4105J113) 79.1 was sensitive to catabolite repression. KS261(4i105J113AX) 80.6 Suppression of spoOJ::Tn917f1HU261 by crsF4 and SP10 KS261(4105J113M V) 0.01 Downloaded from was consistent with the conclusion that spoOJ was involved in catabolite-mediated regulation of sporulation and suggested that sporulation was inappropriately catabolite repressed in spoOJ mutants. If spoOJ::Tn917fQHU261 caused a KS261(,4105J113MV) were Spo- (Table 5). This observation generalized repression of catabolite-regulated systems, then indicated that the 0.7-kb BglII restriction fragment of production of a catabolite-repressible enzyme by MGB3004 4105J113 was essential for complementation of spoCM-J, jb.asm.org would be diminished in comparison to a wild-type strain. We spoOJ93, and spoOJ::Tn9J7fQHU261. The second deletion demonstrated previously that, as in other strains of B. mutant, 4105J113AX, lacked the DNA between the right subtilis, production of ot-amylase by strain 3-13 is repressed BglII site and the fourth PstI site of 4105J113 in Fig. 1. Since by glucose (34). The ot-amylase activity in a typical overnight (105J113AX was constructed with the right arm of 4l05J106 at UNIV CLAUDE BERNARD on February 12, 2010 culture of MGB3004 lacking glucose was severalfold higher which contained a portion of the vector's polylinker region, than for a culture of strain 3-13, and production of ot-amylase JlO5J113AX had two XbaI sites flanking the cloned DNA. by MGB3004 was repressed in medium containing glucose The sporulation frequencies of 93.2(105Jll3AX), CM- (Table 4). The cause of increased ot-amylase activity in 1(4105J113AX), and KS261(4i105J113AX) were virtually the cultures of MGB3004 was not investigated. Nevertheless, same as the lysogens containing l105J113 (Table 5). Hence, these data demonstrated that spoOJ::Tn917fQHU261 did not the cloned DNA located to the right of the 0.7-kb BglII cause generalized repression of catabolite-regulated systems fragment of (105J113 was not necessary for complementa- in MGB3004. tion of spoOJ93, spoCM-J, and spoOJ::Tn9J7fQHU261. Localization of spoOJ on +105J113. Since spoOJ apparently Sequence of spoOJ. Since the 0.7-kb BglII fragment was had an important role in catabolite-mediated regulation of essential for complementation of spoOJ mutations, this re- sporulation, characterization of spoOJ and the deduced striction fragment was sequenced first (Fig. 2). The BglII spoOJ gene product was initiated. Cloning of spoOJ and fragment contained the 3' portions of two long ORFs. isolation of the nondefective bacteriophage 4OSJ113 from a Relative to the 4105J113 restriction map, ORF1 would be jl05 library was described previously (10). 4105J113 con- transcribed from left to right across the left BglII site, and tains cloned B. subtilis 168 DNA that complements spoOJ93. ORF2 would be transcribed from right to left across the right Lysogenic derivatives of 93.2, CM-1, and KS261 were BglII restriction site (Fig. 1). ORF1 was separated by 7 constructed by infecting these sporulation mutants with nucleotides from a putative transcription termination se- 4i105J113. The data in Table 5 confirmed that l05J113 quence that had 12 nucleotides in the stem and 7 unpaired complemented spoOJ93 and spoOJ: :Tn9J7QlHU261 as re- bases in the loop. ORF2 terminated within this stem-loop ported previously (10, 34). In addition, 4105J113 comple- structure. A similar arrangement has been reported for mented spoCM-J. (105J113 did not complement spoOJ87 spoIIJ (kinA) and ORF Y (29). Since l0105J113AX had a (data not shown). This observation was consistent with the deletion that would remove the 5' portion of ORF2 and previous report that the cloned wild-type allele of spoOJ87 4105J113AX complemented spoOJ93, spoCM-J, and does not complement spoOJ93 (12). The restriction map of spoOJ: :Tn9J7fQHU261 (Table 5), it was likely that ORFI was the cloned DNA in 4105J113 is illustrated in Fig. 1. The the 3' portion of the spoOJ sequence. ORF1 was extended cloned DNA was approximately 3.9 kb in size. The BglII leftward beyond the left BglII restriction site by sequencing restriction sites were unique to the cloned DNA. The fol- part of the 1.6-kb XbaI-HindIII restriction fragment of lowing endonucleases did not cut within the cloned DNA: 4105J113AX. A possible ATG start codon was identified 89 ApaI, BalI, ClaI, EcoRI, EcoRV, HpaI, KpnI, Sall, SmaI, nucleotides upstream from the left BglII restriction site. The SstI, XbaI, and XhoI. The 44105J113 restriction map did not putative start codon was separated by 3 nucleotides from a overlap the restriction map described by Moriya et al. (26) likely Shine-Dalgarno sequence. Sequences that were simi- for the 10-kb region surrounding the chromosomal origin of lar to the -10 or -35 portions of consensus sequences for replication. various sigma factors were found upstream of ORF1, but an The spoOJ gene was localized on il05J113 by isolating obvious promoter sequence for ORF1 was not identifiable. two deletion mutants. The first deletion mutant, Disruption of ORF1. MGB3008 was originally isolated in +105J113AV, lacked the 0.7-kb BglII fragment of il05J113 an attempt to fuse ORF1 to a promoterless lacZ gene. (Fig. 1). Strains 93.2(4105J113AV), CM-1(4l05J1130JV), and MGB3008 was resistant to chloramphenicol and produced 1916 MYSLIWIEC ET AL. J. BACTERIOL.

pSGML32

Insert in MMGBWC1

BR151 chromosome 1.0 kb II I I I Downloaded from

rcr I ORtF*I- Region cloned into 01 05J1 13 jb.asm.org 2.7 kb fragment of BR151 L 5 k 1 .8 kb fragment in BR151and1 tB3008 2.5 kb fragnment of W1G3008 at UNIV CLAUDE BERNARD on February 12, 2010 FIG. 3. Insertion of pSGMU32 into spoOJ. low levels of 3-galactosidase (data not shown). Hence, the Suppression by the spore-converting bacteriophage phenotype of MGB3008 indicated that the lac-cat cartridge PMB12 distinguishes mutations in spoOJ from mutations in of pSGMU32 was present in this strain. However, the results most other stage 0 sporulation genes (6, 20). In addition, of Southern hybridization analysis were consistent with the spoOJ::Tn917f1HU261 was suppressed by crsF4 (Table 2). vector portion of pSGMU32 being located between the Therefore, the effects of PMB12 and crsF4 on the Spo- promoter region of ORF1 and lacZ in MGB3008. MGB3008 phenotype of MGB3008 were examined. Suppression by DNA and BR151 DNA had two Hindlll fragments that PMB12 of the Spo- mutation caused by disrupting ORF1 hybridized with the 0.7-kb BglII restriction fragment of was compared with PMB12-mediated suppression of two jl05J113. As expected, a small 1.8-kb restriction fragment spoOJ mutations in a cross-streak assay (Table 6). MGB3008 was detected in both strains. This restriction fragment cor- and two spoOJ mutants derived from BR151 (CM-1 and responded to the HindlIl restriction fragment that was MGB3013) failed to sporulate at a detectable frequency after contained entirely within the cloned insert of 4l05J113. 20 h of incubation at 37°C on 2x SG agar. However, the BR151 had a large Hindlll restriction fragment that was 2.7 sporulation frequencies of PMB12-infected MGB3008, kb and corresponded to the chromosomal fragment that PMB12-infected CM-1, and PMB12-infected MGB3013 were would include the left portion of the cloned insert of similar to each other and at least 10-fold higher than the ji105J113. MGB3008 had a large HindlIl restriction fragment sporulation frequencies of uninfected cells. Therefore, these that was approximately 0.2 kb smaller than the large Hindlll data indicated that the Spo- mutation caused by disruption fragment of BR151. Since the left BglII restriction site of of ORF1 was suppressed by PMB12 as is characteristic of +105J113 was 160 bp from the left HindlIl restriction site other spoOJ mutations. The ability of crsF4 to suppress the (Fig. 1 and 2) and pSGMU32 had a Hindlll restriction site Spo- mutation caused by disruption of ORF1 was tested by immediately adjacent to one of the BamHI restriction sites, transferring the insertion mutation by transformation from it was most likely that pSGMU32 was integrated in the MGB3008 chromosome at the BglII restriction site located within ORF1. These results are summarized in Fig. 3. TABLE 6. Cross-streak assay for PMB12-enhanced sporulation Since lacZ was not directly fused to ORF1 in MGB3008, it by MGB3008 was not possible to use this mutant to study expression of ORF1. However, it was possible to demonstrate that disrup- % Sporulation Strain Genotype tion of ORF1 in MGB3008 resulted in a Spo- phenotype. Uninfected Infected The sporulation frequency of MGB3008 was 0.04%. MGB3008(4105J113AX) sporulated as well as the Spo+ BR151 Wild type 22.3 35.0 parental strain BR151. These two strains sporulated at CM-1 spoCM-J <0.2 4.3 Therefore, MGB3013 spoOJ::Tn917flHU261 <0.2 2.3 frequencies of 61.4 and 50.0%, respectively. MGB3008 ORFI disrupted by <0.2 3.0 jAO5J113AX complemented the insertion mutation that re- pSMGU32 sulted from disrupting ORF1. VOL. 173, 1991 B. SUBTILIS spoOJ GENE 1917

TABLE 7. Suppression of an insertion mutation likelihood of being a DNA-binding domain than other re- in ORF1 by crsF4 gions of KorB (8, 40). Strain Glucose % Sporulation Dodd and Egan used a master set of X Cro-like DNA- binding proteins to determine the likelihood of each amino 168 - 100.0 acid appearing at each position in the at-helix-turn-a-helix 168 + 0.3 motif frequently found in DNA-binding proteins (8, 27). MGB3009 - 0.3 Comparison of each amino acid in a potential DNA-binding MGB3009 + 0.02 site to the matrix developed by Dodd and Egan yields a score that reflects the probability of a protein a 1A587 - 93.8 being X Cro-like 1A587 + 57.4 DNA-binding protein. Dodd and Egan judged all of the MGB3010 - 95.8 proteins examined that had scores of >1,699 to be X Cro- MGB3010 + 0.3 like. Application of the Dodd and Egan method to SpoOJ amino acid residues 35 to 54 yielded a score of 2,101 and indicated that highly favored amino acids occupied 16 of the 20 positions in the putative DNA-binding domain of SpoOJ (Fig. 4). Furthermore, highly conserved alanine, glycine, MGB3008 to wild-type strain 168 and the catabolite-resistant and isoleucine residues occupied positions 5, 9, and 15, sporulation mutant 1A587. The sporulation frequencies of a respectively, of the SpoOJ a-helix-turn-at-helix unit as has typical Chl' 168 transformant (MGB3009) and a typical Chlr been observed for many DNA-binding proteins (27). Hence, Downloaded from 1A587 transformant (MGB3010) were determined in phos- this analysis indicated that the sequence of amino acids 35 to phate-buffered 2x SG alone and with 2% glucose (Table 7). 54 of SpoOJ strongly resembled the a-helix-turn--a-helix After 24 h, MGB3009 had sporulated at a frequency of 0.3% motif found in X Cro-like in medium lacking glucose, whereas MGB3010 had sporu- DNA-binding proteins. lated at essentially the same frequency as wild-type 168 and 1A587 in the same medium. Hence, crsF4 improved the DISCUSSION ability of a strain with an insertion mutation of ORFi to jb.asm.org sporulate by >300-fold in medium lacking glucose. Although Involvement of spoOJ in catabolite repression of sporula- the sporulation frequency of 1A587 was nearly 200-fold tion was first suggested by the ability of bacteriophages higher than that of wild-type strain 168 in medium that PMB12 and SP10 to make wild-type sporulation catabolite initially contained 2% glucose, sporulation by MGB3010 was resistant and to suppress mutations in spoOJ (34). It is at UNIV CLAUDE BERNARD on February 12, 2010 repressed to the same extent as sporulation by strain 168 in possible that mutants with defects in spoOJ are Spo- due to medium containing glucose. This observation was similar to inability to escape catabolite repression of sporulation; i.e., the observation that was already described concerning sup- sporulation is repressed in the mutants even when catabo- pression of spoOJ::Tn9J7QIHU261 by crsF4 (Table 2). lites such as glucose are not present. The idea that spoOJ is The data above and in Tables 6 and 7 supported the involved in catabolite repression of sporulation was sup- conclusion that ORFi encoded the spoOJ gene product. ported by the observation that spoOJ mutations were sup- Potential DNA-binding domain in SpoOJ. Beginning with pressed by the catabolite-resistant sporulation mutation the putative ATG start codon, translation of ORFi yielded a crsF4. predicted polypeptide (SpoOJ) that was 179 amino acids in The nature of crsF4 is not known. This mutation is located length with a molecular weight of approximately 21,000. in the same region of the chromosome as spoOE and spoIIJ SpoOJ had an estimated pl of 9.47, indicating that the (38), suggesting the possibility that crsF4 is an allele of one predicted polypeptide had a net positive charge. A FASTA of these two sporulation genes. Although crsF4 allowed search (28) of protein sequence data bases was conducted to spoOJ mutants to sporulate at wild-type levels in medium determine whether SpoOJ shared homology with any previ- without glucose, crsF4 did not enable these mutants to ously characterized proteins. None of the proteins selected sporulate in medium with glucose. Kawamura et al. (19) in the search contained long amino acid sequences that were previously described a similar situation in which crsA47 (an highly homologous to SpoOJ. However, 17 of the 20 amino allele of rpoD, the structural gene of the sigma factor "43) acids in the region of amino acids 35 to 54 of SpoOJ were and spoOK141 suppressed each other, i.e., a mutant with identical to or conservative changes of KorB amino acid crsA47 and spoOK141 sporulated nearly as well as wild type, residues 171 to 190 (Fig. 4). KorB represses transcription of but sporulation of the double mutant was repressed by the trfA operon of the broad-host-range plasmid RK2 (21, glucose. Mutations in spoOJ and spoOK are similar in that 40). Analysis of KorB by the method of Dodd and Egan both are suppressed by PMB12 (6, 20). However, the inabil- indicated that amino acid residues 171 to 190 have a greater ity of crsAl (an allele of rpoD that is identical to crsA47 [19])

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 SpoOJ aln alu aln leu ala lvs ara leu qly lys ser ara vro his ile ala asn his a2aleu lorB lys gly asp ile ala lys glu ile gly lys ser pro ala phe ile thr gln his val thr

x Cro gln thr lys thr aalyas asp leu gly val tyr gln ser ala ile aen lys ala ile his FIG. 4. Comparison of the SpoOJ a-helix-turn-a-helix unit and the KorB a-helix-turn-a-helix unit. Double dots indicate identical amino acids, and single dots indicate conservative differences. In the SpoOJ sequence, a single underline designates amino acid residues that are highly favored and a double underline designates amino acid residues that are highly conserved in DNA-binding proteins that have an a-helix-turn-a-helix motif (8, 27). The sequence of the X Cro a-helix-turn-a-helix unit is included for comparison. 1918 MYSLIWIEC ET AL. J. BACTERIOL. to suppress spoOJ::Tn917fQHU261 suggests that the function 6. Bramucci, M. G., K. M. Keggins, and P. S. Lovett. 1977. of spoOJ differs from that of spoOK in stationary-phase cells. Bacteriophage PMB12 conversion of the sporulation defect in The spoOA gene product has a central role in controlling a RNA polymerase mutants of Bacillus subtilis. J. Virol. 24:194- variety of stationary-phase functions in B. subtilis, including 200. 7. Clark, S., and J. Mandelstam. 1987. Regulation of stage II of sporulation (16, 23, 37). Initiation of sporulation apparently sporulation in Bacillus subtilis. J. Gen. Microbiol. 133:2371- involves conversion of the spoOA gene product from an 2380. inactive form to an active form through reversible phosphor- 8. Dodd, I. B., and J. B. Egan. 1987. Systematic method for the ylation (16, 29, 37). It is possible to imagine several models detection of potential A Cro-like DNA-binding regions in pro- in which spoOJ and crsF interact with spoOA to regulate teins. J. Mol. Biol. 194:557-564. catabolite repression of sporulation. However, the simplest 9. Dubnau, E., J. Weir, G. Nair, L. Carter, C. Moran, and I. model may be one in which crsF and spoOJ affect phosphor- Smith. 1988. Bacillus sporulation gene spoOH codes for ar30 (CH). ylation of the spoOA gene product in response to the avail- J. Bacteriol. 170:1054-1062. ability of carbon sources such as glucose. If crsF influenced 10. East, A. K., and J. Errington. 1989. A new bacteriophage vector for cloning in Bacillus subtilis and the use of 4105 for protein phosphorylation of the spoDA gene product to repress sporu- synthesis in maxicells. Gene 81:3543. lation in the presence of glucose, then a crsF mutant might 11. Errington, J. 1986. A general method for fusion of the Esche- display catabolite-resistant sporulation because there would richia coli lacZ gene to chromosomal genes in Bacillus subtilis. be no crsF gene product to exert negative control. The J. Gen. Microbiol. 132:2953-2966. presence of an a-helix-turi--a-helix motif in the putative 12. Errington, J., and D. Jones. 1987. Cloning in Bacillus subtilis by spoOJ gene product suggests that the spoOJ gene product transfection with bacteriophage vector +105J27: isolation and Downloaded from could be a transcriptional repressor. If transcription of crsF4 preliminary characterization oftransducing phages for 23 sporu- were negatively regulated by the spoOJ gene product in lation loci. J. Gen. Microbiol. 133:493-502. then a mutant 13. Errington, J., and J. Maudeisam. 1986. Use of lacZ gene fusion response to low catabolite levels, spoOJ might to study the dependence pattern ofsporulation operon spolIA in be Spo- because crsF could not be inactivated as catabolites spoO mutants of Bacillus subtilis. J. Gen. Microbiol. 132:2967- became depleted. According to this model, double mutants 2976. would be because it with defects in spoOJ and crsF Spo+ 14. Ferrari, F. A., K. Trach, and J. Hoch. 1985. Sequence analysis jb.asm.org would be unnecessary for spoOJ to repress transcription of of the spoOB locus reveals a polycistronic transcription unit. J. crsF to derepress sporulation. In addition, this model sug- Bacteriol. 161:556-562. gests the possibility that PMB12 and SP10 suppress spoOJ 15. Ferrari, F. A., K. Trach, D. LeCoq, J. Spence, E. Ferrari, and J. Hoch. 1985. Characterization ofthe locus and its mutations and make wild-type sporulation catabolite resis- spoOA product. at UNIV CLAUDE BERNARD on February 12, 2010 tant by inactivating crsF. Proc. Natl. Acad. Sci. USA 82:2647-2651. The observation that sporulation by spoOJ crsF double 16. Hoch, J. A., K. Trach, F. Kawamura, and H. Saito. 1985. Identification of the transcriptional suppressor sof-l as an mutants was repressed by glucose suggests that catabolite alteration in the spoOA protein. J. Bacteriol. 161:552-555. repression of sporulation is controlled at more than one 17. Hraiueli, D., P. J. Piggot, and J. Mandelstam. 1974. Statistical level. Transcription of spoOA and spoOF is repressed by estimate of the total number of operons specific for Bacillus glucose (3, 43). A conserved catabolite repression operator subtilis sporulation. J. Bacteriol. 119:684-690. sequence has been found to precede spoOA (42). Therefore, 18. Jones, D., mid J. Errington. 1987. Construction of improvied it is possible that, if one level of catabolite repression of bacteriophage 4i105 vectors for cloning by transfection in Bacil- sporulation is removed by mutations in spoOJ and crsF, lus subtilis. J. Gen. Microbiol. 133:483492. catabolite repression of sporulation may still be exerted at 19. Kawamura, F., L. Wang, and R. H. Doi. 1985. Catabolite- another level by repressing transcription of key sporulation resistant sporulation (crsA) mutations in Bacillus subtilis RNA as and polymerase e3 gene (rpoD) can suppress and be suppressed by genes such spoOA spoOF. mutations in spoO genes. Proc. Natl. Acad. Sci. USA 82:8124- 8128. ACKNOWLEDGMENTS 20. Kinney, D. M., and M. G. Bramucci. 1981. Analysis ofBacillus We thank the Bacillus Genetic Stock Center for providing several subtilis sporulation with spore-converting bacteriophage strains. PMB12. J. Bacteriol. 145:1281-1285. Work in the laboratory of M.G.B. was supported by Biomedical 21. Kornacki, J. A., P. J. Balderes, and D. H. Figurski. 1987. Research Support grant 1 S07RR07241. Work in the laboratory of Nucleotide sequence of korB, a replication control gene of J.E. was supported by the Science and Engineering Research broad-host range plasmid RK2. J. Mol. Biol. 198:211-222. Council. 22. Leighton, T. J., and R. H. Doi. 1971. The stability of messenger ribonucleic acid during sporulation in Bacillus subtilis. J. Biol. REFRENCES Chem. 246:3189-3195. 1. Antoniewski, C., B. Savelli, and P. Stragier. 1990. The spoIlJ 23. Losick, R., P. Youngman, and P. J. Piggot. 1986. Genetics of gene, which regulates early developmental steps in Bacillus endospore formation in Bacillus subtilis. Annu. Rev. Genet. subtilis, belongs to a class of environmentally responsive genes. 20:625-669. J. Bacteriol. 172:86-93. 24. Lovett, P. S., and M. G. Bramucci. 1975. Plasmid deoxyribonu- 2. Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. cleic acid in Bacillus subtilis and Bacillus pumilus. J. Bacteriol. Seidman, J. A. Smith, and K. Struhl (ed.). 1987. Current proto- 124:484490. cols in molecular biology. John Wiley & Sons, Inc., New York. 25. Lovett, P. S., M. G. Bramucci, and K. M. Keggins. 1978. 3. Bai, U., M. Lewandoski, E. Dubnau, and I. Smith. 1990. Control of bacterial sporulation by nonchromosomal replicons: Temporal regulation of the Bacillus subtilis early sporulation a novel example of bacteriophage conversion, p. 227-230. In D. gene spoOF. J. Bacteriol. 172:5432-5439. Schlessinger (ed.), Microbiology-1978. American Society for 4. Bott, K., and G. A. Wilson. 1967. Development of competence Microbiology, Washington, D.C. in the Bacillus subtilis transformation system. J. Bacteriol. 26. Moriya, S., N. Ogasawara, and H. Yoshikawa. 1985. Structure 94:562-570. and function ofthe region ofthe replication origin ofthe Bacillus 5. Bouvier, J., P. Stragier, C. Bonamy, and J. Szuhnajster. 1984. subtilis chromosome. III. Nucleotide sequence of some 10,000 Nucleotide sequence of the spoOB gene of Bacillus subtilis and base pairs in the origin region. Nucleic Acids Res. 13:225i- regulation of its expression. Proc. Natl. Acad. Sci. USA 81: 2265. 7012-7016. 27. Pabo, C. O., and R. T. Sauer. 1984. Protein-DNA recognition. VOL. 173, 1991 B. SUBTILIS spoOJ GENE 1919

Annu. Rev. Biochem. 53:293-321. SpoOA protein of Bacillus subtilis is a repressor of the abrB 28. Pearson, W. R., and D. J. Lipman. 1988. Improved tools for gene. Proc. Natl. Acad. Sci. USA 87:1801-1805. biological sequence comparison. Proc. Natl. Acad. Sci. USA 38. Sun, D., and I. Takahashi. 1982. Genetic mapping of catabolite- 85:2444-2448. resistant mutants of Bacillus subtilis. Can. J. Microbiol. 28: 29. Perego, M., S. P. Cole, D. Burbulys, K. Trach, and J. A. Hoch. 1242-1251. 1989. Characterization of the gene for a protein kinase which 39. Takahashi, I. 1979. Catabolite repression-resistant mutants of phosphorylates the sporulation-regulatory proteins SpoOA and Bacillus subtilis. Can. J. Microbiol. 25:1283-1287. SpoOF of Bacillus subtilis. J. Bacteriol. 171:6187-6196. 40. Theophilus, B. D. M., and C. M. Thomas. 1987. Nucleotide 30. Perego, M., and J. A. Hoch. 1987. Isolation and sequence of the sequence of the transcriptional repressor gene korB which plays spoOE gene: its role in initiation of sporulation in Bacillus a key role in regulation of the copy number of broad host range subtilis. Mol. Microbiol. 1:125-132. plasmid RK2. Nucleic Acids Res.' 15:7443-7450. 31. R. Losick, and P. Youngman. 1987. Genetic Sandman, K., 41. Trach, K., J. W. Chapman, P. Piggot, and J. A. Hoch. 1985. analysis of Bacillus subtilis spo mutations generated by Tn9O7- mediated insertional mutagenesis. Genetics 117:603-617. Deduced product of the stage 0 sporulation gene spoOF shares with the OmpR, and SfrA protein. Proc. Natl. 32. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequenc- homology SpoOA, ing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. Acad. Sci. USA 82:7260-7264. USA 74:5463-5467. 42. Weickert, M. J., and G. H. Chambliss. 1990. Site-directed 33. Schaeffer, P., J. Millet, and J. P. Aubert. 1965. Catabolite mutagenesis of a catabolite repression operator sequence in repression of bacterial sporulation. Proc. Natl. Acad. Sci. USA Bacillus subtilis. Proc. Natl. Acad. Sci. USA 87:6238-6242. 54:704-711. 43. Yamashita, S., F. Kawamura, H. Yoshikawa, H. Takahashi, Y. 34. Silver-Mysliwiec, T. H., and M. G. Bramucci. 1990. Bacterioph- Kobayashi, and H. Saito. 1989. Dissection of the expression Downloaded from age-enhanced sporulation: comparison of the spore-converting signals of the spoOA gene of Bacillus subtilis: glucose represses bacteriophages PMB12 and SP10. J. Bacteriol. 172:1948-1953. sporulation-specific expression. J. Gen. Microbiol. 135:1335- 35. Southern, E. 1975. Detection of specific sequences among DNA 1345. fragments separated by gel electrophoresis. J. Mol. Biol. 98: 44. Young, F. E., C. Smith, and B. E. Reilly. 1969. Chromosomal 503-517. location of a gene regulating resistance to bacteriophages in 36. Stock, J. B., A. J. Ninfa, and A. M. Stock. 1989. Protein Bacillus subtilis. J. Bacteriol. 98:1087-1097. phosphorylation and regulation of adaptive responses in bacte- 45. Zuber, P., and R. Losick. 1983. Use of a lacZ fusion to study the jb.asm.org ria. Microbiol. Rev. 53:450-490. role of the spoO genes of Bacillus subtilis in developmental 37. Strauch, M., V. Webb, G. Spiegelman, and J. Hoch. 1990. The regulation. Cell 35:275-283. at UNIV CLAUDE BERNARD on February 12, 2010