DOCSLIB.ORG

Like Sensor of External Amino Acids and F-Box Protein Grr1p Are Re

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Like Sensor of External Amino Acids and F-Box Protein Grr1p Are Re Amino Acid Signaling in Saccharomyces cerevisiae: a Permease- Like Sensor of External Amino Acids and F-Box Protein Grr1p Are Required for Transcriptional Induction of the AGP1 Gene, Which Encodes a Broad-Specificity Amino Acid Permease Ismaîl Iraqui, Stephan Vissers, Florent Bernard, Johan-Owen de Craene, Eckhard Boles, Antonio Urrestarazu, Bruno André To cite this version: Ismaîl Iraqui, Stephan Vissers, Florent Bernard, Johan-Owen de Craene, Eckhard Boles, et al.. Amino Acid Signaling in Saccharomyces cerevisiae: a Permease- Like Sensor of External Amino Acids and F-Box Protein Grr1p Are Required for Transcriptional Induction of the AGP1 Gene, Which Encodes a Broad-Specificity Amino Acid Permease. Molecular and Cellular Biology, American Society for Microbiology, 1999, 99, pp.270 - 7306. hal-01771884 HAL Id: hal-01771884 https://hal.archives-ouvertes.fr/hal-01771884 Submitted on 20 Apr 2018 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. MOLECULAR AND CELLULAR BIOLOGY, Feb. 1999, p. 989–1001 Vol. 19, No. 2 0270-7306/99/$04.0010 Copyright © 1999, American Society for Microbiology. All Rights Reserved. Amino Acid Signaling in Saccharomyces cerevisiae: a Permease- Like Sensor of External Amino Acids and F-Box Protein Grr1p Are Required for Transcriptional Induction of the AGP1 Gene, Which Encodes a Broad-Specificity Amino Acid Permease ISMAI¨L IRAQUI,1 STEPHAN VISSERS,1 FLORENT BERNARD,1 JOHAN-OWEN DE CRAENE,1 2 1 1 ECKHARD BOLES, ANTONIO URRESTARAZU, AND BRUNO ANDRE´ * Laboratoire de Physiologie Cellulaire et de Ge´ne´tique des Levures, Universite´ Libre de Bruxelles, B-1050 Brussels, Belgium,1 and Institut fuer Mikrobiologie, Universitaet Duesseldorf, D-40225 Duesseldorf, Germany2 Received 14 July 1998/Returned for modification 19 August 1998/Accepted 22 October 1998 Downloaded from The SSY1 gene of Saccharomyces cerevisiae encodes a member of a large family of amino acid permeases. Compared to the 17 other proteins of this family, however, Ssy1p displays unusual structural features reminiscent of those distinguishing the Snf3p and Rgt2p glucose sensors from the other proteins of the sugar transporter family. We show here that SSY1 is required for transcriptional induction, in response to multiple amino acids, of the AGP1 gene encoding a low-affinity, broad-specificity amino acid permease. Total nonin- duction of the AGP1 gene in the ssy1D mutant is not due to impaired incorporation of inducing amino acids. mcb.asm.org Conversely, AGP1 is strongly induced by tryptophan in a mutant strain largely deficient in tryptophan uptake, but it remains unexpressed in a mutant that accumulates high levels of tryptophan endogenously. Induction of AGP1 requires Uga35p(Dal81p/DurLp), a transcription factor of the Cys6-Zn2 family previously shown to participate in several nitrogen induction pathways. Induction of AGP1 by amino acids also requires Grr1p, the Grr1 F-box protein of the SCF ubiquitin-protein ligase complex also required for transduction of the glucose at SCD UNIV LOUIS PASTEUR on October 16, 2008 signal generated by the Snf3p and Rgt2p glucose sensors. Systematic analysis of amino acid permease genes showed that Ssy1p is involved in transcriptional induction of at least five genes in addition to AGP1. Our results show that the amino acid permease homologue Ssy1p is a sensor of external amino acids, coupling availability of amino acids to transcriptional events. The essential role of Grr1p in this amino acid signaling pathway lends further support to the hypothesis that this protein participates in integrating nutrient avail- ability with the cell cycle. Yeast cells can selectively use the wide variety of nitroge- partially starved for glutamine due to a thermosensitive muta- nous compounds that they find in their rich natural environ- tion in the glutamine synthetase GLN1 gene (25, 87). ment. Some of these molecules can be directly used as ready- Whether yeast cells also possess regulatory systems respond- made metabolites. Many of them can also be catabolized to ing specifically to the extracellular concentration of nitroge- sustain the synthesis of glutamate and glutamine, the predom- nous compounds has been studied very little to date. It seems inant nitrogen donors in biosynthetic reactions (20, 87). The reasonable, however, to speculate that such nitrogen sensors synthesis of many enzymes and permeases involved in nitrogen exist. For instance, two sensors of external glucose concentra- metabolism and the activity of some of these proteins are tion (Snf3p and Rgt2p) have recently been discovered in yeast tightly regulated according to the nitrogen source(s) available cells (67). These proteins are members of the sugar transporter in the medium (20, 35, 45, 59, 87). It is generally assumed that superfamily (14, 15) and play a central role in the transcrip- these regulations are triggered solely by variations in the in- tional regulation of the HXT genes encoding glucose transport- tracellular concentrations of specific metabolites. For instance, ers (55, 66, 67). Although Snf3p and Rgt2p show significant many enzymes involved in nitrogen anabolism are inhibited sequence similarity with hexose transporters, they seem unable and/or their synthesis is repressed upon accumulation of the to mediate glucose transport, or if they do, this activity is not end or intermediate products of biosynthetic pathways (35, 45). sufficient to confer a measurable glucose uptake activity or to Similarly, expression of most genes encoding amino acid bio- restore the ability to use glucose in a mutant lacking the six synthetic enzymes is stimulated severalfold in response to star- main glucose transporters (Hxt1, -2, -3, -4, -6, and -7) (55, 66, vation for any one of several amino acids (35, 45). Nitrogen 73). Two other proteins of the sugar transport family, namely, repression (NR) is yet another example of regulation appar- the Rco3 regulator of conidiation in Neurospora crassa (58) ently triggered upon variation of the concentration of intracel- Amita muscaria lular effectors (59). For instance, repression in the presence of and the Mst1 protein from the ectomycorrhiza 1 NH of at least some NR-sensitive genes is relieved in cells (64), may also serve as glucose sensors. Similarly, the uhpC 4 gene of Escherichia coli encodes a protein highly similar in sequence to UhpT, a permease for several organophosphate compounds including glucose-6-phosphate (47). The UhpC protein seems unable to mediate uptake of glucose-6-phos- * Corresponding author. Mailing address: Laboratoire de Physiolo- gie Cellulaire et de Ge´ne´tique des Levures, Universite´ Libre de Brux- phate and is involved, rather, in transcriptional induction of elles, Campus Plaine CP 244, Bld. de Triomphe, B1050 Brussels, Bel- the uhpT permease gene in response to micromolar levels of gium. Phone: 32-2-6505428. Fax: 32-2-6505421. E-mail: [email protected] external glucose-6-phosphate (48). Some cell surface proteins .be. that effectively mediate transmembrane solute transport also 989 990 IRAQUI ET AL. MOL.CELL.BIOL. TABLE 1. Yeast strains used in this study (NH4)2SO4 (10 mM) as the sole nitrogen source. Analogue concentrations were as follows: 20 mg/ml, b-(2-thienyl)-DL-alanine; 20 mg/ml, p-fluoro-DL-phenylala- Reference m D L m Strain Genotype nine; 20 g/ml, , -ethionine; 500 g/ml, 6-fluoro-tryptophan; and 1 mg/ml, or source hydroxy-tryptophan. All procedures for manipulating DNA were standard ones (6, 74). The E. coli strain used was JM109. a a 23344c MAT ura3 LPCGL Construction of ssy1D, agp1D, gap1D, and grr1D deletion strains. The ssy1D, 23346c MATa ura3 LPCGL agp1D, grr1D, and gap1D null mutations were constructed by the PCR-based gene 32501a MATa ura3 This study deletion method (86). The DNA segments used to introduce these mutations 32501b MATa gap1D::kanMX2 ura3 This study were generated by using the kanMX2 gene from plasmid pFA6a-kanMX2 as a 32501c MATa ssy1D::kanMX2 ura3 This study template and the following PCR primers: ssy1D:kanMX2,59-CTCTAGGGGAA D D AAAAGGAAACAGGCGTGTGATAAGAGGCCGCGGCCGCCAGCTGAA 32501d MATa gap1 ::kanMX2 ssy1 ::kanMX2 ura3 This study 9 9 30629c MATa gap1D::kanMX2 ura3 This study GCTTCGTACGC-3 and 5 -CAGTTACCCGCACAATCTAGTGCGTAAAG CAGTGTCAATAGCGGCCGCATAGGCCACTAGTGGATCTG-39; agp1D: a D D 30633c MAT gap1 ::kanMX2 agp1 ::kanMX2 ura3 This study kanMX2,59-CCAGAAGGCAACGACCCTTTTCCAATAAGGTCCGTTCCG 32502b MATa gap1D::kanMX2 agp1D::kanMX2 This study 9 9 D CGGCCGC GCATAGGCCACTAGTGGATCTG-3 and 5 -TCGTCGTCGAA ssy1 ::kanMX2 ura3 GTCTCTATACGAACTGAAAGACTTGGCGGCCGCCAGCTGAAGCTTC 30622a MATa gap1-92 agp1-1 ura3 36a GTACGA-39; gap1D:kanMX2,59-CTATCAGGCAGCCTCACTAATCTACCC 30701a MATa aro80D::kanMX2 ura3 36a ATTGACCTCATGCGCGGCCGCCAGCTGAAGCTTCGTACGC-39 and 59- 26247b MATa trp2fbr 82 GAAGCTCACACAGATTAGTTTTCATCTCGCTGTCTACTAAGCGGCC RE1 MATa trp2fbr ura3D::kanMX2 This study GCATAGGCCACTAGTGGATCTG-39; and grr1D:kanMX2,59-ATGGATCA a D GGATAACAACAACCACAATGACAGCAATAGGCTGCACCCATTCGTA Downloaded from JA115 MAT grr1 ::kanMX2 ura3 This study 9 9 CD17 MATa uga35D::TYR1 tyr1 ura3 21 CGCTGCAGGTCGAC-3 and 5 -GGGCGTTCCTGATGCTTCATCCATTT
Load more

Recommended publications
  • The Switch from Fermentation to Respiration in Saccharomyces Cerevisiae Is Regulated by the Ert1 Transcriptional Activator/Repressor
    INVESTIGATION The Switch from Fermentation to Respiration in Saccharomyces cerevisiae Is Regulated by the Ert1 Transcriptional Activator/Repressor Najla Gasmi,* Pierre-Etienne Jacques,† Natalia Klimova,† Xiao Guo,§ Alessandra Ricciardi,§ François Robert,†,** and Bernard Turcotte*,‡,§,1 ‡Department of Medicine, *Department of Biochemistry, and §Department of Microbiology and Immunology, McGill University Health Centre, McGill University, Montreal, QC, Canada H3A 1A1, †Institut de recherches cliniques de Montréal, Montréal, QC, Canada H2W 1R7, and **Département de Médecine, Faculté de Médecine, Université de Montréal, QC, Canada H3C 3J7 ABSTRACT In the yeast Saccharomyces cerevisiae, fermentation is the major pathway for energy production, even under aerobic conditions. However, when glucose becomes scarce, ethanol produced during fermentation is used as a carbon source, requiring a shift to respiration. This adaptation results in massive reprogramming of gene expression. Increased expression of genes for gluconeogenesis and the glyoxylate cycle is observed upon a shift to ethanol and, conversely, expression of some fermentation genes is reduced. The zinc cluster proteins Cat8, Sip4, and Rds2, as well as Adr1, have been shown to mediate this reprogramming of gene expression. In this study, we have characterized the gene YBR239C encoding a putative zinc cluster protein and it was named ERT1 (ethanol regulated transcription factor 1). ChIP-chip analysis showed that Ert1 binds to a limited number of targets in the presence of glucose. The strongest enrichment was observed at the promoter of PCK1 encoding an important gluconeogenic enzyme. With ethanol as the carbon source, enrichment was observed with many additional genes involved in gluconeogenesis and mitochondrial function. Use of lacZ reporters and quantitative RT-PCR analyses demonstrated that Ert1 regulates expression of its target genes in a manner that is highly redundant with other regulators of gluconeogenesis.
    [Show full text]
  • The Yeast SNF3 Gene Encodes a Glucose Transporter Homologous to the Mammalian Protein (1Acz Fusions/Membrane Proteins/Immunofluorescence/Glucose Repression) JOHN L
    Proc. Nail. Acad. Sci. USA Vol. 85, pp. 2130-2134, April 1988 Biochemistry The yeast SNF3 gene encodes a glucose transporter homologous to the mammalian protein (1acZ fusions/membrane proteins/immunofluorescence/glucose repression) JOHN L. CELENZA, LINDA MARSHALL-CARLSON, AND MARIAN CARLSON* Department of Genetics and Development and Institute for Cancer Research, Columbia University College of Physicians and Surgeons, New York, NY 10032 Communicated by David Botstein, December 23, 1987 ABSTRACT The SNF3 gene is required for high-affinity Construction of SNF3-lacZ Fusions. SNP'3-lacZ gene fu- glucose transport in the yeast Saccharomyces cerevisiae and sions were constructed by inserting SNF3 DNA fragments has also been implicated in control of gene expression by containing at least 0.8 kilobases of 5' noncoding sequence glucose repression. We report here the nucleotide sequence of into the 2-Am plasmid vectors YEp353 and YEp357R (11). the cloned SNF3 gene. The predicted amino acid sequence The SNF3(3)-lacZ fusion was constructed by inserting an shows that SNF3 encodes a 97-kilodalton protein that is EcoRI-BamHI fragment into YEp353, SNF3(321)-lacZ by homologous to mammalian glucose transporters and has 12 inserting a Sal I-Spe I fragment into YEp357R, and SNF3- putative membrane-spanning regions. We also show that a (797)-lacZ by inserting a Sal I-EcoRI fragment into YEp- functional SNF3-lacZ gene-fusion product cofractionates with 357R. membrane proteins and is localized to the cell surface, as Preparation of Glucose-Derepressed Cells. Wild-type judged by indirect immunofluorescence microscopy. Expres- (SNF3) yeast cells carrying each of the SNF3-lacZ gene sion of the fusion protein is regulated by glucose repression.
    [Show full text]
  • Dominant and Recessive Suppressors That Restore Glucose Transportin a Yeast Snf3 Mutant
    Copyright 0 1991 by the Genetics Society of America Dominant and Recessive Suppressors That Restore Glucose Transportin a Yeast snf3 Mutant Linda Marshall-Cadson*, Lenore Neigeborn*, David Coons?, Linda Bisson? and Marian Carlson* *Department of Genetics and Development and Institute of Cancer Research, Columbia University College of Physicians and Surgeons, New York, New York 10032, and tDepartment of Viticulture and Enology, University of Calijornia, Davis, Calvornia 95616 Manuscript received October 29, 1990 Accepted for publication March 23, 1991 ABSTRACT The SNF3 gene of Saccharomycescereuisiae encodes a high-affinity glucose transporter that is homologous to mammalian glucose transporters. To identify genes that are functionally related to SNF3, we selected for suppressorsthat remedy the growth defect ofsnf3 mutants on low concentrations of glucose or fructose. We recovered 38 recessive mutations that fall into a single complementation group, designated rgtl (restores glucose transport).The rgtl mutations suppressa snf3 null mutation and are not linked to snf3. A naturally occurring rgtl allele was identified in a laboratory strain. We also selected five dominant suppressors. At least two are tightly linked to one another and are designated RGT2. The RGT2 locus was mapped 38 cM from SNF3 on chromosome N.Kinetic analysis of glucose uptake showedthat the rgtl and RGT2 suppressors restore glucose-repressible high-affinity glucose- transport in a snf3 mutant. These mutations identify genes that may regulate or encode additional glucose transport proteins. HE transport of glucose into eukaryotic cells is gene, was first identified by isolating mutants defec- T mediated by specific carrier proteins. The genes tive in growth on sucrose or raffinose (NEIGEBORN encoding a variety of glucosetransporters from mam- and CARLSON1984).
    [Show full text]
  • Wo 2010/025374 A2
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date 4 March 2010 (04.03.2010) WO 2010/025374 A2 (51) International Patent Classification: AO, AT, AU, AZ, BA, BB, BG, BH, BR, BW, BY, BZ, C12P 7/64 (2006.01) C07C 57/00 (2006.01) CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, DO, C12N 1/19 (2006.01) C12N 15/87 (2006.01) DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, HR, HU, ID, IL, IN, IS, JP, KE, KG, KM, KN, KP, (21) International Application Number: KR, KZ, LA, LC, LK, LR, LS, LT, LU, LY, MA, MD, PCT/US2009/055376 ME, MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, (22) International Filing Date: NO, NZ, OM, PE, PG, PH, PL, PT, RO, RS, RU, SC, SD, 28 August 2009 (28.08.2009) SE, SG, SK, SL, SM, ST, SV, SY, TJ, TM, TN, TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (25) Filing Language: English (84) Designated States (unless otherwise indicated, for every (26) Publication Language: English kind of regional protection available): ARIPO (BW, GH, (30) Priority Data: GM, KE, LS, MW, MZ, NA, SD, SL, SZ, TZ, UG, ZM, 61/093,007 29 August 2008 (29.08.2008) US ZW), Eurasian (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM), European (AT, BE, BG, CH, CY, CZ, DE, DK, EE, (71) Applicant (for all designated States except US): E.
    [Show full text]
  • Engineering Diverse Yeast Species for Optimal Sugar Consumption and Enhanced Product Formation
    ENGINEERING DIVERSE YEAST SPECIES FOR OPTIMAL SUGAR CONSUMPTION AND ENHANCED PRODUCT FORMATION BY STEPHAN LANE THESIS Submitted in partial fulfillment of the requirements for the degree of Master of Science in Food Science and Human Nutrition with a concentration in Food Science in the Graduate College of the University of Illinois at Urbana-Champaign, 2016 Urbana, Illinois Master’s Committee: Associate Professor Yong-Su Jin Associate Professor Michael J. Miller Professor Chris Rao ABSTRACT Yeasts are employed ubiquitously within industry and academia for basic studies in biology and production of value-added compounds. Although the term yeast generally reminds people of the common baker’s yeast, Saccharomyces cerevisiae, yeasts are a diverse group of organisms with an extensive evolutionary history. This thesis focuses on two vastly differing yeasts: Yarrowia lipolytica and S. cerevisiae. Y. lipolytica is an obligate aerobic oleaginous yeast best known for its capabilities at digesting alkanes and strong capacity for producing lipids. The species is commonly used as a model yeast for studying lipogenesis and has an extensive history in the academic literature. In industry, this yeast has been highlighted as having strong potential for production of a wide range of molecules. Recently, a genetically engineered strain of this yeast has been employed by DuPont in production of omega-3 fatty acids. Additionally, the species has been proposed for usage in environmental cleanup applications as well as bioconversion of industrial wastes, specifically glycerol from biodiesel production. While recent work has identified that this species possesses genes within the cellobiose and xylose metabolic pathways, most strains of species do not naturally possess the ability to digest lignocellulosic sugars.
    [Show full text]
  • The Glucose Signal Transduction Pathway Mediated by the Rgt2 and Snf3 Glucose Sensors in the Budding Yeast Saccharomyces Cerevisiae
    The Glucose Signal Transduction Pathway Mediated by the Rgt2 and Snf3 Glucose Sensors in the Budding Yeast Saccharomyces cerevisiae by Adhiraj Roy B.Sc. in Microbiology, May 2005, University of Calcutta, India M.Sc. in Microbiology, May 2007, University of Calcutta, India A Dissertation submitted to The Faculty of The Columbian College of Arts and Sciences of The George Washington University in partial fulfillment of the requirements for the degree of Doctor of Philosophy May 18, 2014 Dissertation directed by Jeong-Ho Kim Assistant Professor of Biochemistry and Molecular Medicine The Columbian College of Arts and Sciences of The George Washington University certifies that Adhiraj Roy has passed the Final Examination for the degree of Doctor of Philosophy as of March 18, 2014. This is the final and approved form of the dissertation. The Glucose Signal Transduction Pathway Mediated by the Rgt2 and Snf3 Glucose Sensors in the Budding Yeast Saccharomyces cerevisiae Adhiraj Roy Dissertation Research Committee: Jeong-Ho Kim, Assistant Professor of Biochemistry and Molecular Medicine, Dissertation Director William Weglicki, Professor of Biochemistry and Molecular Medicine, Committee Member Wenge Zhu, Assistant Professor of Biochemistry and Molecular Medicine, Committee Member ii © Copyright 2014 by Adhiraj Roy All rights reserved iii Dedication I dedicate my dissertation to my family, my grandparents, (Late) Sourindra K. Roy and Mrs. Jyotsna Roy, my parents, Mr. Soven Roy and Mrs. Mamata Roy and my beloved sister Ms. Sanjana Roy. iv Acknowledgements This dissertation would not have been possible without the help of so many people in so many ways. It is also a product of a large measure of serendipity, fortuitous encounter with people who changed the course of my academic career.
    [Show full text]
  • Multi-Level Response of the Yeast Genome to Glucose Comment Ruud Geladé, Sam Van De Velde, Patrick Van Dijck and Johan M Thevelein
    Minireview Multi-level response of the yeast genome to glucose comment Ruud Geladé, Sam Van de Velde, Patrick Van Dijck and Johan M Thevelein Addresses: Laboratory of Molecular Cell Biology, Institute of Botany and Microbiology, Katholieke Universiteit Leuven and Department of Molecular Microbiology, Flemish Interuniversity Institute of Biotechnology (V.I.B.), Kasteelpark Arenberg 31, B-3001 Leuven-Heverlee, Flanders, Belgium. Correspondence: Johan M Thevelein. E-mail: [email protected] reviews Published: 15 October 2003 Genome Biology 2003, 4:233 The electronic version of this article is the complete one and can be found online at http://genomebiology.com/2003/4/11/233 © 2003 BioMed Central Ltd reports Abstract The yeast Saccharomyces cerevisiae shows a great variety of cellular responses to glucose via several glucose-sensing and signaling pathways. Recent microarray analysis has revealed multiple levels of genomic sensitivity to glucose and highlighted the power of genome-wide analysis to detect cellular responses to minute environmental changes. deposited research Over the years, the yeast Saccharomyces cerevisiae has con- glucose is faster than on other carbon sources and a range of solidated its position as an excellent model for the analysis of glucose-dependent effects can be observed on properties signal transduction pathways and their control of metabolic correlated with growth and stationary phase. During its evo- pathways, stress responses, growth and differentiation. In par- lution, S. cerevisiae has gained sophisticated regulatory ticular, the molecular mechanisms underlying the metabolic mechanisms to sense fluctuating levels of glucose, and as a refereed research responses to different nutrient conditions have been studied result has many different glucose-sensing and signaling extensively.
    [Show full text]
  • Alternative Substrate Metabolism in Yarrowia Lipolytica
    fmicb-09-01077 May 23, 2018 Time: 11:46 # 1 REVIEW published: 25 May 2018 doi: 10.3389/fmicb.2018.01077 Alternative Substrate Metabolism in Yarrowia lipolytica Michael Spagnuolo1, Murtaza Shabbir Hussain1, Lauren Gambill1,2 and Mark Blenner1* 1 Department of Chemical and Biomolecular Engineering, Clemson University, Clemson, SC, United States, 2 Program in Systems, Synthetic, and Physical Biology, Rice University, Houston, TX, United States Recent advances in genetic engineering capabilities have enabled the development of oleochemical producing strains of Yarrowia lipolytica. Much of the metabolic engineering effort has focused on pathway engineering of the product using glucose as the feedstock; however, alternative substrates, including various other hexose and pentose sugars, glycerol, lipids, acetate, and less-refined carbon feedstocks, have not received the same attention. In this review, we discuss recent work leading to better utilization of alternative substrates. This review aims to provide a comprehensive understanding of the current state of knowledge for alternative substrate utilization, suggest potential pathways identified through homology in the absence of prior characterization, discuss recent work that either identifies, endogenous or cryptic metabolism, and describe metabolic engineering to improve alternative substrate utilization. Finally, we describe the critical questions and challenges that remain for engineering Y. lipolytica for better alternative substrate utilization. Edited by: Ryan S. Senger, Keywords: Yarrowia lipolytica, pentose, hexose, xylose, fat, waste, acetate, metabolic engineering Virginia Tech, United States Reviewed by: Rodrigo Ledesma-Amaro, INTRODUCTION Imperial College London, United Kingdom The oleaginous yeast Yarrowia lipolytica has great potential for the production of a large range Zengyi Shao, Iowa State University, United States of biochemicals and intermediates.
    [Show full text]
  • The Regulatory Role of Key Metabolites in the Control of Cell Signaling
    biomolecules Review The Regulatory Role of Key Metabolites in the Control of Cell Signaling Riccardo Milanesi, Paola Coccetti * and Farida Tripodi Department of Biotechnology and Biosciences, University of Milano-Bicocca, 20126 Milan, Italy; [email protected] (R.M.); [email protected] (F.T.) * Correspondence: [email protected]; Tel.: +39-02-6448-3521 Received: 8 May 2020; Accepted: 3 June 2020; Published: 5 June 2020 Abstract: Robust biological systems are able to adapt to internal and environmental perturbations. This is ensured by a thick crosstalk between metabolism and signal transduction pathways, through which cell cycle progression, cell metabolism and growth are coordinated. Although several reports describe the control of cell signaling on metabolism (mainly through transcriptional regulation and post-translational modifications), much fewer information is available on the role of metabolism in the regulation of signal transduction. Protein-metabolite interactions (PMIs) result in the modification of the protein activity due to a conformational change associated with the binding of a small molecule. An increasing amount of evidences highlight the role of metabolites of the central metabolism in the control of the activity of key signaling proteins in different eukaryotic systems. Here we review the known PMIs between primary metabolites and proteins, through which metabolism affects signal transduction pathways controlled by the conserved kinases Snf1/AMPK, Ras/PKA and TORC1. Interestingly, PMIs influence also the mitochondrial retrograde response (RTG) and calcium signaling, clearly demonstrating that the range of this phenomenon is not limited to signaling pathways related to metabolism. Keywords: Snf1/AMPK/SnRK1; Ras/PKA; TORC1; RTG; calcium; glucose; glycolysis; TCA; amino acids; protein-metabolite interaction 1.
    [Show full text]
  • Author Correction: MIG1 As a Positive Regulator for the Histidine Biosynthesis Pathway and As A
    www.nature.com/scientificreports OPEN Author Correction: MIG1 as a positive regulator for the histidine biosynthesis pathway and as a Published: xx xx xxxx global regulator in thermotolerant yeast Kluyveromyces marxianus Mochamad Nurcholis, Masayuki Murata, Savitree Limtong, Tomoyuki Kosaka & Mamoru Yamada Correction to: Scientifc Reports https://doi.org/10.1038/s41598-019-46411-5, published online 09 July 2019 Te Supplementary Information fle that accompanies this Article contains an error in Supplementary Table S2, where the reference numbers shown in the table are incorrect. Te correct Table S2 appears below as Table 1. TFsa Description/Function Reference A stress- and nutrient-sensitive regulator of ribosomal protein (RP) gene expression and biogenesis genes; Novel Sfp1 36, 37 heat shock TFs and regulates RP gene expression in response to heat shock. Glucose-responsive transcription factor; regulates expression of several glucose transporter (HXT) genes in Rgt1 38, 39 response to glucose; bind to promoters and acts both as a transcriptional activator and repressor Negative regulator of the glucose-sensing signal transduction pathway; required for repression of transcription by Mth1 40, 41, 42 Rgt1; interacts with Rgt1 and the Snf3 and Rgt2 glucose sensors. Acting at a subset of Ste12-inducible genes in the pheromone-dependent expression; a karyogamy-specifc Kar4 43 component; required for the induction of KAR3 and CIK1. A carbon source-responsive zinc-fnger transcription factor; required for transcription of the glucose-repressed Adr1 44, 50 genes for ethanol, glycerol and fatty acid utilization. Putative zinc cluster protein of unknown function; proposed to be involved in the regulation of energy metabolism Gsm1 45 based on pattern of expression.
    [Show full text]
  • Sugar Sensing and Regulation of Conidiation
    SUGAR SENSING AND REGULATION OF CONIDIATION IN NEUROSPORA CRASSA A Dissertation by XIN XIE Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY August 2003 Major Subject: Genetics SUGAR SENSING AND REGULATION OF CONIDIATION IN NEUROSPORA CRASSA A Dissertation by XIN XIE Submitted to Texas A&M University in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY Approved as to style and content by: Daniel J. Ebbole Clint W. Magill (Chair of Committee) (Member) Marian N. Beremand Deborah Bell-Pedersen (Member) (Member) Dennis C. Gross Geoffrey M. Kapler (Head of Department) (Chair of Genetics Faculty) August 2003 Major Subject: Genetics iii ABSTRACT Sugar Sensing and Regulation of Conidiation in Neurospora crassa. (August 2003) Xin Xie, B.S., Central China Normal University; M.S., Wuhan University Chair of Advisory Committee: Dr. Daniel J. Ebbole The orange bread mold Neurospora crassa is a useful model for the study of filamentous fungi. One of the asexual reproduction cycles in N. crassa, macroconidiation, can be induced by several environmental cues, including glucose starvation. The rco-3 gene is a regulator of sugar transport and macroconidiation in N. crassa and was proposed to encode a sugar sensor (Madi et al., 1997). To identify genes that are functionally related to RCO-3, three distinct suppressors of the sorbose resistance phenotype of rco-3 were isolated and characterized. The dgr-1 mutant phenotypically resembles rco-3 and may be part of the rco-3 signaling pathway. Epistatic relationship among rco-3, dgr-1 and the suppressors were carried out by analyzing rco-3; dgr-1 and sup; dgr-1 double mutants.
    [Show full text]
  • Glucose Signaling and Transcriptional Regulation
    Sinha et al RJLBPCS 2019 www.rjlbpcs.com Life Science Informatics Publications Original Review Article DOI: 10.26479/2019.0503.15 GLUCOSE SIGNALING AND TRANSCRIPTIONAL REGULATION OF HEXOSE TRANSPORTERS IN SACCHAROMYCES CEREVISIAE Smriti Sinha, Villayat Ali, Sonu Kumar Gupta, Malkhey Verma* Department of Biochemistry and Microbial Sciences, Central University of Punjab Bathinda, Punjab, India. ABSTRACT: Saccharomyces cerevisiae as a model eukaryotic organism, various studies have been done for investigating the signal transduction components and pathways in the multicellular and complex eukaryotes. Due to similarities in the mechanism, yeast serves to be a great model for this study. The hexose transporters (HXTs) genes present with different affinities for glucose along with Snf3/Rgt2, Snf1 and Hxk2 are studied in this review. The genes and its regulators work in an overlapping fashion which has been dealt in detail. Although S. cerevisiae utilizes a big range of carbon sources but sometimes the presence of glucose subdues various molecular activities necessary for the use of alternative carbon sources and it suppresses other processes such as respiration and gluconeogenesis. This effect of glucose is established by various metabolic, sensing and signaling interactions. Recently, several components of the glucose induction pathway are studied such as Ras-cAMP pathway. This review describes glucose induction and repression various HXTs genes in yeast and their effect on its metabolism. KEYWORDS: Saccharomyces cerevisiae, hexose transporters, glucose induction, repression, signalling, metabolism. Corresponding Author: Dr. Malkhey Verma* Ph.D. Department of Biochemistry and Microbial Sciences, Central University of Punjab Bathinda, Punjab, India. Email Address: [email protected] 1. INTRODUCTION Yeast is a fungus and needs a supply of energy for its growth and maintenance.
    [Show full text]