DOCSLIB.ORG

Next Generation Sequencing Update

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Next Generation Sequencing Update Next Generation Sequencing Update Karl V. Voelkerding, MD Professor of Pathology University of Utah Medical Director for Genomics and Bioinformatics ARUP Laboratories AACC-AMP 2012 Molecular Pathology Course [email protected] Disclosures • Grant/Research Support: NIH • Salary/Consultant Fees: None • Committees: College of American Pathologists • Stocks/Bonds: None • Honorarium/Expenses: None • Intellectual Property/Royalty Income: None Learning Objectives • Explain Principles of NGS • Describe Current and Future NGS Platform Options • Discuss Spectrum of NGS Clinical Applications First Next Generation Sequencing Publication Nature 437 (7057) 376-380 454 Life Sciences 2005 Paradigm Shift Sanger Sequencing Electrophoretic Separation of Chain Termination Products Next Generation Sequencing Sequence Clonally Amplified DNA Templates in a Flow Cell Massively Parallel Configuration Process Genomic DNA or Enriched Genes Fragmentation (150 – 500 bp) End Repair and Adapter Ligation “Fragment Library” Adapter Fragment A Adapter Adapter Fragment B Adapter Adapter Fragment C Adapter Process A B “Fragment Library” C Clonal Amplification of Each Fragment Emulsion Bead PCR Surface Clusters B A B C A C Sequencing of Clonal Amplicons in a Flow Cell Process Sequencing of Clonal Amplicons in a Flow Cell Pyrosequencing Sequencing by Ligation 454 SOLiD Reversible Dye Terminators Illumina Generation of Luminescent or Fluorescent Images Conversion to Sequence 454/Roche Solexa/Illumina Bead Emulsion PCR Surface Bridge PCR Pyrosequencing Reversible dye terminators 200 – 400 base reads 36 – 75 base reads Solexa/Illumina Sequencing A T C G Qualitative and Quantitative Information Ref Seq Illumina G>A Coverage Next Generation Sequencing • Sequence up to billions of fragments simultaneously • Iterative/cyclic sequencing Luminescence Fluorescence pH Detection (Roche) (Illumina,SOLiD) (Ion Torrent) Signal to Noise Processing Cyclic Base Calls C G A T G C - - - Base Quality Scores C30 G28 A33 T30 G28 C30 - - - @HW-ST573_75:1:1:1353:4122/11 CAATCGAATGGAATTATCGAATGCAATCGA Next Generation Sequencing Data ATAGAATCATCGAATGGACTCGAATGGAAT CATCGAA + ggfggggggggggggfgggggggfgegggg fdfeefeggggggggegbgegegggdeYed gggggeg @HW-ST573_75:1:1:1347:4151/11 Primary Sequence Alignment ATCTGTTCTTGTCTTTAACTCTCAAGGCAC BWA CACCTTCCATGGTCAATAATGAACAACGCC AGCATGC + effffggggggggggggfgggggggggggg gdggggfgggfgdggaffffgfggffgdgg ggggdfg Refined Sequence Alignment @HW-ST573_75:1:1:1485:4153/11 GATK/Picard GAGGAGAGATATTTTGACTTCCTCTCTTCA TATTTGGATGCTTTTTACTTATCTCTCTTG ACTAATT + dZdddbXc`_ccccbeeedbeaedeeeee^ aeeedcaZca_`^c[eeeeed]eeecd[dd Variant Calling ^eeba[d SAMTools/GATK FastQ File Format Variant Annotation Variant g.34142190T>C in TPM1 Annovar Next Generation Sequencers First Wave Second Wave - SMS 454/Roche Solexa/Illumina ABI/Life Tech Pacific Helicos 2004/5 2006/7 2007/8 Biosciences Genome GS FLX SOLiD HeliScope SMRT Analyzer Third Wave GS GAIIx SOLiD 5500 Junior GAIIe SOLiD 5500xl Ion Torrent HiScanSQ Life Technologies PGM HiSeq 2011 MiSeq 2011 Clinical Dissemination 2 Independent Flow Cells Illumina HiSeq 2000 8 Lanes per Flow Cell 2 X 100 base pairs . Multiple Gene Panel Samples per Lane 540-600 Gb Output . 2-3 Exome(s) per Lane 8-11 Day Sequencing Run . 2 Genomes per Flow Cell Illumina MiSeq 2 X 150 bp 2 X 250 bp 2.0 – 7.0 Gb Output ~27 Hrs Sequencing Run . Multi-Gene Panels .Genetics .Oncology .Microbiology Reversible Dye Terminators . Viral and Bacterial Genomes . Transcriptomes Illumina MiSeq Transcriptome Sequencing GAPDH Sequence Reads Ion Torrent Hydrogen Ion Pyrophosphate Monitors H+ Release Ion Torrent 100 – 200 base pairs 10 Mb – 1.0 Gb Output ~2 Hrs Sequencing Run . Multi-Gene Panels .Genetics .Oncology .Microbiology Monitors H+ Release . Viral and Bacterial Genomes . Transcriptomes Ion Torrent BRAF, c.1799T>A, p.V600E 26.5% mutant alleles Technology Advances for 2012/13 Illumina HiSeq 2000 Late 2012 Upgrade Module 120 Gb 27+ Hours 2 X 100 base pairs . Single Genome in 27+ Hours 540-600 Gb Output . Multiple Exomes in 27+ Hours 11 Day Sequencing Run Late 2012 Ion Torrent - Proton Exomes/Genome “Several Hours” Oxford Nanopore Technologies Processive Enzyme Protein Nanopore in Polymer Membrane MinION – Late 2012 Current Disruption Based Electronic Signal The Meeting Place Biotechnology Bioinformatics Sequence Generation Sequence Analysis Interpretation Biomedical Question What is the Genetic Landscape of a Tumor What Pathogen is Responsible for an Outbreak What Genetic Contributors Account for a Phenotype Clinical Applications Whole Genome Whole Exome Multi-Gene Diagnostics Increasing Complexity Multi-Gene Diagnostics Clinical Phenotype Multiple Genes Mutational Spectrum Locus Heterogeneity Allelic Heterogeneity Multi-Gene Diagnostics “New First Tier” Genetic Testing Scaling Increases Interpretive Complexity Can Yield Non-Definitive Results Gateway to Exome/Genome Multi-Gene Diagnostics Genomic DNA Enrichment Target Genes NGS Library Preparation Next Generation Sequencing Bioinformatics Interpretation Gene Enrichment Approaches Genomic DNA Amplification Based Array Capture Based PCR or LR-PCR Solid Surface RainDance ePCR or Fluidigm In Solution HaloGenomics Enriched Genes NGS Gene Enrichment Approaches Genomic DNA Amplification Based Array Capture Based PCR or LR-PCR Solid Surface RainDance ePCR or Fluidigm In Solution HaloGenomics Advantage: Enrichment Specificity Advantage: Scalable to Exome Drawbacks: Drawbacks: Not as Scalable Homologous Sequence Capture Instrument and Chip Costs Manually Complex Clinical Applications Whole Genome Whole Exome Multi-Gene Diagnostics Increasing Complexity Human Exome “Journey to the Center of the Genome” ~ 30+ Megabases (~ 1.5% of the genome) ~ 180,000 exons (~ 20,500 genes) Harbors “Majority” of Mendelian Mutations Exome Sequencing History “Genetic Diagnosis by Whole Exome Capture and Massively Parallel DNA Sequencing” Choi et al PNAS 2009 – Congenital Chloride Diarrhea ~45 Gene Discovery Publications May 2012 Recessive Dominant De Novo Genomic DNA Library Preparation Next Generation Sequencing Library Hybridize to Exome Capture Probes Exome Enriched Library Next Generation Sequencing Bioinformatics Analysis Comparison of Exome DNA Sequencing Technologies Clark et al Nature Biotech Vol 29(10) Oct 2011 Comparison of Exome DNA Sequencing Technologies Clark et al Nature Biotech Vol 29(10) Oct 2011 Exome Sequencing - Coverage of Coding Regions is Variable Coverage Aligned reads Reference Capture probes MAZ HLA-DOB Exon 1 Exon 1 Nimblegen Exome Capture and Illumina HiSeq Exome Sequencing – Performance Characteristics Define Proportion of Exome “Adequately Covered” Conversely Define Proportion of Exome “Not Adequately Covered” Dependent On Capture Technology – Probe Design and Capture Efficiency Sequencing Depth Exome Sequencing – Performance Characteristics Define Proportion of Exome “Accurately Sequenced” Co-Capture Component Difficult to Sequence Regions Pseudogenes Repetitive Elements Paralogs and Homologs Mendelian Disorders – Working Hypothesis Seeking “Rare” Variants in a Single Gene(s) Needle(s) in the Haystack(s) Bioinformatics Annotated Variants Prioritization by Heuristic Filtering Prioritization by Likelihood Prediction Filter Out VAAST Algorithm Common Variants Pedigree Information Linkage/SGS/IBD dbSNP/1000 genomes Intersects Variant frequency Variant Binning Missense Pathogenicity Nonsense/Frameshift/Splice Site/Indels Prediction Filtering Cross Reference SIFT/PolyPhen Databases GERP HGMD/OMIM/Locus Specific Candidate Genes/Potential Causative Variants Genomic DNA Library Preparation Next Generation Sequencing Library Hybridize to Exome Capture Probes Genome Sequencing Exome Enriched Library Next Generation Sequencing Bioinformatics Analysis Genomic DNA Library Preparation Next Generation Sequencing Library Next Generation Sequencing Bioinformatics Analysis Exome Genome Sequencing vs Sequencing Cost – Coverage – Complexity Whole Genome Sequencing Chr 10: g.43,615,633C>G in RET Horizon Continued Evolution of Sequencing and Bioinformatics College of American Pathologists Checklist Requirements for Next Generation Sequencing Professional Societies Guidelines for Clinical Next Generation Sequencing Self Assessment Questions • Describe Process Steps for NGS • List NGS Platform Options and Capabilities • Relate Spectrum of Clinical NGS Applications .
Load more

Recommended publications
  • Make Illumina Part of Your DNA. the Most Comprehensive Set of DNA Analysis Tools Available
    Make Illumina part of your DNA. The most comprehensive set of DNA analysis tools available. Illumina’s portfolio of DNA analysis products delivers industry-leading data quality at the lowest cost per study. Accelerate discovery by looking at DNA from every angle. 4 SNP genotyping — Achieve significance with the industry’s best genomic coverage and data quality. 4 CNV analysis — Obtain the most comprehensive access to known and novel CNV regions. 4 DNA sequencing — Sequence virtually anything at a fraction of the cost and time. 4 DNA methylation — Get single CpG site resolution with high- multiplex standard or custom methylation panels. 4 ChIP-Seq — Obtain genome-wide maps of DNA-protein interactions with unprecedented resolution, quality and cost. Make us part of your DNA. Join the growing Illumina Community. Find out how to make Illumina part of your DNA: www.illumina.com/dna?gr Random Shear BAC Library Services Got Gaps? Eliminate gaps in genomic libraries with Lucigen’s exclusive Random Shear BAC Library technical expertise. Resulting in: • Complete genome sequence with as low as 5x coverage • Elimination of restriction site bias found in conventional libraries by utilizing random shearing of DNA into BAC-size fragments • Vast reduction of deleted and rearranged sequences by cloning in our Transcription-Free BAC vectors • Greatly reduced finishing costs. Detailed information on the benefits of Random Shear BAC Libraries for genome projects is available on-line: www.lucigen.com/BAC.pdf Closing centromeric gaps with a Random Shear BAC Library 80 M Notl cut Random Shear BAC clones M 60 40 Centromere 1 20 (~9 Mb) kb No.
    [Show full text]
  • Short Tandem Repeat Typing on the 454 Platform
    SHORT TANDEM REPEAT TYPING ON THE 454 PLATFORM: STRATEGIES AND CONSIDERATIONS FOR TARGETED SEQUENCING OF COMMON FORENSIC MARKERS Melissa Scheible1,2,*, Odile Loreille1,2, Rebecca Just1,2 and Jodi Irwin1,2,3 1American Registry of Pathology 2Armed Forces DNA Identification Laboratory, Armed Forces Medical Examiner System 3Present affiliation: Federal Bureau of Investigation, Quantico The past several years have seen a dramatic advance in the methods, chemistries and detection platforms available for DNA sequence data generation. Next generation sequencing (NGS) technologies, which produce large volumes of sequence data at extremely low cost relative to current platforms, are being broadly applied to various questions in medical genetics, evolutionary biology, molecular anthropology, phylogeny, epidemiology and metagenomics. For many of these applications, NGS is being used to produce sequence data covering thousands of loci, or even entire organismal genomes in a single sequencing run. Given this capacity, it’s not difficult to envision the potential implications of this technology for criminalistics, missing persons and disaster victim identification purposes. Historically, the recovery of large numbers of forensic markers in a single assay has been restricted by both the technical limitations of current, established capillary based sequencing genotyping technologies, as well as the quality and quantity of DNA originating from the damaged and degraded specimens regularly encountered in forensic casework. These limitations don’t apply in quite the same way to NGS, however. As a result, the simultaneous recovery of the standard autosomal DNA, mitochondrial DNA, and X and Y-chromosomal markers regularly assayed in forensic genetics, along with additional markers of interest, may be possible with these new technologies [1].
    [Show full text]
  • Nested Patch PCR for Highly Multiplexed Amplification of Genomic Loci
    Downloaded from http://cshprotocols.cshlp.org/ at WASHINGTON UNIV SCHOFMED on August 30, 2012 - Published by Cold Spring Harbor Laboratory Press Nested Patch PCR for Highly Multiplexed Amplification of Genomic Loci Katherine E. Varley and Robi D. Mitra Cold Spring Harb Protoc 2009; doi: 10.1101/pdb.prot5252 Email Alerting Receive free email alerts when new articles cite this article - click here. Service Subject Browse articles on similar topics from Cold Spring Harbor Protocols. Categories Amplification of DNA by PCR (51 articles) Bioinformatics/Genomics, general (130 articles) DNA Sequencing (52 articles) Genetic Variation (69 articles) Genetics, general (316 articles) Genome Analysis (97 articles) Genomic DNA (70 articles) High-Throughput Analysis, general (94 articles) Molecular Biology, general (977 articles) Polymerase Chain Reaction (PCR) (61 articles) Polymerase Chain Reaction (PCR), general (136 articles) To subscribe to Cold Spring Harbor Protocols go to: http://cshprotocols.cshlp.org/subscriptions Downloaded from http://cshprotocols.cshlp.org/ at WASHINGTON UNIV SCHOFMED on August 30, 2012 - Published by Cold Spring Harbor Laboratory Press Protocol Nested Patch PCR for Highly Multiplexed Amplification of Genomic Loci Katherine E. Varley and Robi D. Mitra1 Department of Genetics, Center for Genome Sciences, Washington University School of Medicine, St. Louis, MO 63108, USA INTRODUCTION Nested Patch polymerase chain reaction (PCR) amplifies a large number (greater than 90) of targeted loci from genomic DNA simultaneously in the same reaction. These amplified loci can then be sequenced on a second-generation sequencing machine to detect single nucleotide polymorphisms (SNPs) and mutations. The reaction is highly specific: 90% of sequencing reads match targeted loci. Nested Patch PCR can be performed on many samples in parallel, and by using sample-specific DNA barcodes, these can be pooled and sequenced in a single reaction.
    [Show full text]
  • The Pyrosequencing Process
    The Pyrosequencing Process Christopher Hack, Doug Smith, Ed Kirton, Zhiying Jean Zhao, Andy Yuen, Jamie Jett, Feng Chen, and Paul Richardson DOE Joint Genome Institute Introduction Strategy for Whole Genome Shotgun Strategy for Sequencing Sanger sequencing has been the predominant method for sequencing DNA since it was introduced in 1972. Recently, however, newer technologies have surfaced that have the potential to reshape the sequencing world. Sequencing for Microbial Genomes cDNA with 454 One such technology is pyrosequencing, as developed by 454 Life Sciences. The 454 sequencing platform is an integrated system of emulsion-based PCR amplification of hundreds of thousands of DNA fragments linked to Problem: Sanger Solution: • If sequence over the whole cDNA region is high throughput parallel pyrosequencing in picoliter-sized wells. The system can potentially deliver over 100 sequencing has difficulty 1. Sequence and assemble with 454 data. desired, the approach is the same as for whole million bases per run, with readlengths over 200 bases, from a 6-hour run. sequencing through certain 2. Fragment the 454 assembly in silico to genome shotgun sequencing. regions of DNA, such as 1000-base regions with 100-base ds cDNA hairpin turns. This leaves overhangs. GGG cDNA TTTTTTTTTTTTT Overview of the 454/Roche Pyrosequencing Process Figures below courtesy of 454 Life Sciences gaps in the final assembly. 3. Re-assemble genome using Phrap with both Sanger reads and 454 fragments. Sonication or Nebulization Sheared cDNA 454 sequencing pipeline • If sequence is desired only at the 5’ or 3’ end of the cDNA, incorporate 454 adapter sequence into PCR primers to amplify region of interest, then use Step 1: Library Creation Step 2: Emulsion PCR 454 to sequence the amplified PCR products.
    [Show full text]
  • Short Tandem Repeat Sequencing on the 454 Platform
    Forensic Science International: Genetics Supplement Series 3 (2011) e357–e358 Contents lists available at ScienceDirect Forensic Science International: Genetics Supplement Series jo urnal homepage: www.elsevier.com/locate/FSIGSS Short tandem repeat sequencing on the 454 platform Melissa Scheible, Odile Loreille, Rebecca Just, Jodi Irwin * Armed Forces DNA Identification Laboratory, Armed Forces Medical Examiner System, Rockville, Maryland, USA A R T I C L E I N F O A B S T R A C T Article history: To investigate the feasibility of next generation sequencing (NGS) technology for the multiplex detection Received 25 August 2011 and sequence production of short tandem repeats (STRs), thirteen STR markers (CSF1PO, D2S441, Accepted 15 September 2011 D3S1358, D5S818, D7S820, D8S1179, D10S1248, D13S317, D16S539, D21S11, D22S1045, TPOX, and vWA) were amplified using an optimized multiplex reaction with primer sequences designed for reduced Keywords: size amplicons. Each sample multiplex was barcoded with a different sample-specific multiplex identifier 454 sequencing (MID) for subsequent parallel tagged sequencing on the GS Junior System (454 Life Sciences, Branford, Short tandem repeat CT). Next generation sequencing Published by Elsevier Ireland Ltd. 1. Introduction according to manufacturer recommendations [10] rather than the bead preparation recommended by the 454 protocol that The development of reduced size amplicons for STR markers has intentionally selects for fragments larger than 300 base pairs increased the success of typing samples with degraded DNA [1–4]. [7]. Third, one molecule of sample library per capture bead was However, when separating these alleles using capillary electro- targeted for emPCR, as previous experiments showed that two phoresis, the number of loci that can be multiplexed together is molecules per bead produced an overabundance of beads contain- limited by the number of available dyes.
    [Show full text]
  • Droege and Hill – the Genome Sequencer FLX System…
    Journal of Biotechnology 136 (2008) 3–10 Contents lists available at ScienceDirect Journal of Biotechnology journal homepage: www.elsevier.com/locate/jbiotec Review The Genome Sequencer FLXTM System—Longer reads, more applications, straight forward bioinformatics and more complete data sets Marcus Droege a,∗, Brendon Hill b a Roche Applied Science, Global Marketing, 82372 Penzberg, Germany b 454 Life Sciences, Branford, USA article info abstract Article history: The Genome Sequencer FLX System (GS FLX), powered by 454 Sequencing, is a next-generation DNA Received 3 January 2008 sequencing technology featuring a unique mix of long reads, exceptional accuracy, and ultra-high through- Received in revised form 17 March 2008 put. It has been proven to be the most versatile of all currently available next-generation sequencing Accepted 31 March 2008 technologies, supporting many high-profile studies in over seven applications categories. GS FLX users have pursued innovative research in de novo sequencing, re-sequencing of whole genomes and target Keywords: DNA regions, metagenomics, and RNA analysis. 454 Sequencing is a powerful tool for human genetics 2nd generation sequencing technology research, having recently re-sequenced the genome of an individual human, currently re-sequencing the Human re-sequencing De novo sequencing complete human exome and targeted genomic regions using the NimbleGen sequence capture process, Transcriptome analysis and detected low-frequency somatic mutations linked to cancer. Microbial genome sequencing © 2008 Elsevier
    [Show full text]
  • Patterns of Damage in Genomic DNA Sequences from a Neandertal
    Patterns of damage in genomic DNA sequences from a Neandertal Adrian W. Briggs*†, Udo Stenzel*, Philip L. F. Johnson‡, Richard E. Green*, Janet Kelso*, Kay Pru¨ fer*, Matthias Meyer*, Johannes Krause*, Michael T. Ronan§, Michael Lachmann*, and Svante Pa¨ a¨ bo*† *Max Planck Institute for Evolutionary Anthropology, Deutscher Platz 6, D-04103 Leipzig, Germany; ‡Biophysics Graduate Group, University of California, Berkeley, CA 94720; and §454 Life Sciences, Branford, CT 06405 Contributed by Svante Pa¨a¨ bo, May 25, 2007 (sent for review April 25, 2007) High-throughput direct sequencing techniques have recently of their position in ancient DNA fragments. Although there is opened the possibility to sequence genomes from Pleistocene strong evidence that the majority of such misincorporations are organisms. Here we analyze DNA sequences determined from a due to deamination of cytosine residues to uracil residues (3), Neandertal, a mammoth, and a cave bear. We show that purines which code as thymine residues, it is unclear whether other are overrepresented at positions adjacent to the breaks in the miscoding lesions are present in any appreciable frequency in ancient DNA, suggesting that depurination has contributed to its ancient DNA or how miscoding lesions are distributed along degradation. We furthermore show that substitutions resulting ancient DNA molecules. When relevant, we use comparable data from miscoding cytosine residues are vastly overrepresented in the from an Ϸ43,000-year-old mammoth bone (9) from the DNA sequences and drastically clustered in the ends of the mole- Bol’shaya Kolopatkaya river, Russia, an Ϸ42,000-year-old cave cules, whereas other substitutions are rare.
    [Show full text]
  • 454 Sequencing System Guidelines for Amplicon Experimental Design
    454 Sequencing System Guidelines for Amplicon Experimental Design June 2013 Instrument Kit GS Junior Junior GS FLX+ XL+ GS FLX+ XLR70 GS FLX XLR70 For life science research only. Not for use in diagnostic procedures. Guidelines for Amplicon Experimental Design 454 Sequencing System 454 Sequencing System Guidelines for Amplicon Experimental Design Table of Contents 1 General Guidelines for Amplicon Sequencing Experimental Design ...................... 5 1.1 Basic Considerations ................................................................................................................................. 6 1.2 Depth of Coverage ..................................................................................................................................... 6 1.3 Multiplexing ................................................................................................................................................. 7 1.3.1 Multiplex PCR ........................................................................................................................................................................ 7 1.3.2 Multiplex Identifiers (MIDs) ............................................................................................................................................. 7 1.4 Bidirectional vs. Unidirectional Sequencing ........................................................................................ 8 1.5 Quantitative Results in Amplicon Sequencing ....................................................................................
    [Show full text]
  • Comparison of 454 Sequencing Platform with Traditional Sanger Sequencing: a Case Study with De Novo Sequencing of Prochlorococcus Marinus NATL2A Genome
    Advancing Science with DNA Sequence Comparison of 454 Sequencing Platform with Traditional Sanger Sequencing: a Case Study with de novo Sequencing of Prochlorococcus marinus NATL2A Genome Feng Chen, Joseph Alessi, Edward Kirton, Vasanth Singan, and Paul Richardson Introduction TYPE OF ERROR EXAMPLE UNTRAIN. TRAINED ALL LARGE READS READS CONTIGS CONTIGS The Department of Energy Joint Genome Institute (www.jgi.doe.gov) in Walnut Creek, CA is a high throughput DNA Miscalled base aaacttt c wrong 111,420 8,515 127 77 sequencing facility with a current throughput of approximately 3 billion basepairs per month. A major effort at JGI is the sequencing of microbial genomes of relevance to the DOE missions of carbon sequestration, bioremediation and Insertion tattcaa extra t 165,096 77,988 359 59 energy production. The JGI Microbial Program is responsible for the generation of over 300 microbial genomes . JGI is Deletion tgt-aag missing nt 97,954 30,184 44 16 running about 70 ABI sequencers on a 24/7 schedule and about 40 GE MegaBACE 4500 sequencers on a 24/5 schedule. Short homopolymer aaa-taa missing a 53,150 73,102 224 174 Our current whole genome shotgun sequencing strategy is to sequence 3kb and 8kb shotgun libraries to a combined 8x draft coverage and to sequence fosmid ends to 1x sequence coverage, which is equivalent to about 30x clone Long homopolymer gataaaat extra a 331,797 165,370 325 199 coverage. Homopolymer indel gggaag g should be a 1,361 808 1 1 454 Life Sciences recently developed a new scalable, highly parallel sequencing system with significantly greater Homopolymer incomplete extension aaaaactagg extra a 196,649 160,357 573 310 throughput than our current Sanger sequencing systems.
    [Show full text]
  • Genomics Technology
    GENOMICS TECHNOLOGY GENOTYPING, SEQUENCING AND/OR ANALYSIS Company Products/Activity Location URL 454 Life Sciences Next-generation sequencers Bradford, Connecticut www.454.com ACGT SNP genotyping and sequencing services Wheeling, Illinois www.acgtinc.com Affymetrix High-density customizable microarrays for genotyping Santa Clara, California www.affymetrix.com Agilent Technologies Customizable, high-density microarrays for CNV genotyping Santa Clara, California www.chem.agilent.com Ambry Genetics Next-generation sequencing and microarray services Aliso Viejo, California www.ambrygen.com Applied Biosystems Next-generation sequencing Carlsbad, California www.appliedbiosystems.com ATLAS BioLabs Microarray-based genomic services, targeted sequence Berlin, Germany www.atlas-biolabs.de capture and next-generation sequencing Beckman Coulter High-throughput SNP discovery and resequencing Brea, California www.beckmancoulter.com ● Complete Genomics Large-scale genome-sequencing services Mountain View, California www.completegenomics.com CynerGene SNP genotyping and fine-mapping services Frederick, Maryland www.cynergene.com deCODE genetics Gene-discovery services, genotyping and sequencing facilities Reykjavik, Iceland www.decode.com Eureka Genomics Next-generation sequencing and services, algorithms and Houston, Texas www.eurekagenomics.com data collections, resequencing and mapping services Expression Analysis Genotyping assays, DNA sequencing services, sequence Durham, North Carolina www.expressionanalysis.com ● enrichment technologies and bioinformatics
    [Show full text]
  • 454 Sequencing Platform
    PERSPECTIVE The development and impact of 454 sequencing Jonathan M Rothberg1 & John H Leamon2 The 454 Sequencer has dramatically increased the volume efforts in liquid-handling robotics moved the established methods of of sequencing conducted by the scientific community and library preparation (plasmid vectors and growth in bacterial colonies) expanded the range of problems that can be addressed by from test tubes to microtiter plates with a significant drop in cost and the direct readouts of DNA sequence. Key breakthroughs in labor to prepare samples for sequencing14. the development of the 454 sequencing platform included As the first next-generation technology to reach the market, the devel- higher throughput, simplified all in vitro sample preparation opment of the 454 Life Sciences (454; Branford, CT, USA; now Roche, and the miniaturization of sequencing chemistries, enabling Basel) sequencing platform (the 454 Sequencer) provides a compel- massively parallel sequencing reactions to be carried out at ling case study for the establishment of a new disruptive technology15. a scale and cost not previously possible. Together with other 454 initiated the next-generation movement by pioneering solutions to http://www.nature.com/naturebiotechnology recently released next-generation technologies, the 454 the three bottlenecks—library preparation, template preparation and platform has started to democratize sequencing, providing sequencing—that the research community faced. One indication of the individual laboratories with access to capacities that rival those benefits inherent in the solutions 454 provided is that in one form or previously found only at a handful of large sequencing centers. another, each of them has been adopted in all the next-generation tech- Over the past 18 months, 454 sequencing has led to a better nologies that followed 454 sequencing to market.
    [Show full text]
  • 4.10 Tech Feature Main.Indd MH AY.Indd
    TECHNOLOGY FEATURE GENOMICS NATURE|Vol 449|4 October 2007 are in fact quite different from one another 250 bases each with an accuracy of 99.5% or and at various stages of maturity. “The prin- better,” says Egholm. Although the 454 Life ciple that we use when applying these new Sciences system is not as accurate as conven- technologies is that there is a lot of expensive tional Sanger sequencing, Egholm notes that sequencing that we do with Applied Biosys- it is an order of magnitude more productive 454 LIFE SCIENCES tem’s 3730xl system and anything that we (see ‘Truth and accuracy’). can move over to the new technologies, as This upgraded Genome Sequencer FLX long as it is effective, is bound to be cheaper.” System allows more sequencing cycles The systems available now from Roche, Illu- and therefore longer reads than the previ- mina and Applied Biosystems do seem to be ous Genome Sequencer 20 System. Longer effective, as the Broad Institute and other reads help in whole-genome sequencing organizations are using them for various and assembly applications. “We believe that sequencing-based applications. shortly there will be many more de novo assembled genomes due to our technology,” Assembling the future says Egholm. He notes that the genomes of By the end of last year, 454 Life Sciences, which several microorganisms have been assembled was founded in 2000 and was recently acquired from scratch by use of 454 sequencing, and by Roche, had more than 60 of its sequencing the technology has also been used to supple- systems placed around the world.
    [Show full text]