Inhibition of CD47 Effectively Targets Pancreatic

Author Manuscript Published OnlineFirst on February 23, 2015; DOI: 10.1158/1078-0432.CCR-14-1399 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.

Inhibition of CD47 effectively targets pancreatic

cancer stem cells via dual mechanism

Michele Cioffi 1, Sara Trabulo1,2, Manuel Hidalgo 3, Eithne Costello4,

William Greenhalf4, Mert Erkan5, Joerg Kleeff 5, Bruno Sainz Jr1, and

Christopher Heeschen 1,2

1 Stem Cells & Cancer Group, Molecular Pathology Programme, Spanish National Cancer

Research Centre (CNIO), Madrid, Spain

2 Centre for Stem Cells in Cancer & Ageing, Barts Cancer Institute, a CR-UK Centre of

Excellence, Queen Mary University of London, UK

3 Gastrointestinal Cancer Clinical Research Unit, Clinical Research Programme, CNIO

4 Liverpool Cancer Research UK Centre, University of Liverpool, Liverpool, UK

5 Department of Surgery, Technical University Munich, Munich, Germany

Correspondence: Dr. Christopher Heeschen, MD, PhD, [email protected]; Centre for Stem

Cells in Cancer & Ageing, Barts Cancer Institute, Queen Mary University of London, UK.

Short title: CD47 targets pancreatic cancer stem cells

Conflict of Interest: The authors have no conflict of interest to declare.

Downloaded from clincancerres.aacrjournals.org on September 25, 2021. © 2015 American Association for Cancer Research. Author Manuscript Published OnlineFirst on February 23, 2015; DOI: 10.1158/1078-0432.CCR-14-1399 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.

STATEMENT OF TRANSLATIONAL RELEVANCE

Pancreatic ductal adenocarcinoma remains one of the most devastating cancers, and very few new

treatments have revealed meaningful improvements in patient survival over the past decades.

Based on our previous work demonstrating the existence of cancer stem cells in pancreatic cancer

and their strong resistance to standard chemotherapy, we now provide multiple lines of functional

and mechanistic evidence for a treatment regimen including inhibition of CD47 targeting both

cancer stem cells as well as their more differentiated progenies. Therefore, this new therapeutic

strategy should be further explored in the clinical setting as its success bears the potential to

improve the poor prognosis of patients with pancreatic ductal adenocarcinoma.

ABSTRACT

Purpose: Pancreatic ductal adenocarcinoma (PDAC) is a cancer of the exocrine pancreas with

unmet medical need and is strongly promoted by tumor-associated macrophages (TAMs). The

presence of TAMs is associated with poor clinical outcome and their overall role therefore

appears to be pro-tumorigenic. The “don’t eat me” signal CD47 on cancer cells communicates to

the signal regulatory protein-α on macrophages and prevents their phagocytosis. Thus, inhibition

of CD47 may offer a new opportunity to turn TAMs against PDAC cells including cancer stem

cells (CSCs) as the exclusively tumorigenic population.

Experimental Design: We studied in vitro and in vivo the effects of CD47 inhibition on CSCs

using a large set of primary pancreatic cancer (stem) cells as well as xenografts of primary human

PDAC tissue.

Results: CD47 was highly expressed on CSCs, but not on other non-malignant cells in the

pancreas. Targeting CD47 efficiently enhanced phagocytosis of a representative set of primary

human pancreatic cancer (stem) cells and, even more intriguingly, also directly induced their

apoptosis in the absence of macrophages during long-term inhibition of CD47. In patient-derived

xenografts models, CD47 targeting alone did not result in relevant slowing of tumor growth, but

the addition of Gemcitabine or Abraxane resulted in sustained tumor regression and prevention of

disease relapse long after discontinuation of treatment.

Conclusions: These data are consistent with efficient in vivo targeting of CSCs and strongly

suggest that CD47 inhibition could be a novel adjuvant treatment strategy for PDAC independent

of underlying and highly variable driver mutations.

BACKGROUND

Pancreatic ductal adenocarcinoma (PDAC) remains one of the most devastating cancers

with a 5-year survival rate of less than 5% (1). Despite expanding research activities, there has been

little therapeutic progress towards improving patients’ long-term survival. Gemcitabine (2),

FOLFIRINOX (3), and more recently the addition of nab-paclitaxel (Abraxane) (4) are able to

moderately extend median survival, but eventually the vast majority of patients still succumbs from

progressive disease. Therefore, developing new and more effective anti-PDAC treatments represent

an urgent and unmet medical need (5, 6). Since the cancer stem cell (CSC) hypothesis was

functionally validated for leukemia in 1994 (7), convincing evidence has emerged for several

solid tumors indicating that like adult tissues, tumors are sustained and promoted by cells that

exhibit features of stem cells including unlimited self-renewal (8). We and others have provided

conclusive evidence for a hierarchical organization in human PDAC and, even more importantly,

demonstrated that pancreatic CSCs, at the apex of the hierarchy, have exclusive tumorigenic and

metastatic potential and are inherently resistant to chemotherapy (9-11). Indeed, the survival of

such resistant CSCs during chemotherapy despite initial tumor regression represents a plausible

explanation for the later fatal relapse of the disease in most of the patients (3, 4),

Studies based on the inhibition of regulatory pathways that are crucially relevant for the

self-renewal capacity of CSC are promising (12, 13); however, the overly heterogeneous genetic

background of PDAC may render larger populations of cells resistant to the targeting of single

pathways. Consequently, we asked whether targeting pancreatic CSCs with broader immune-

based therapeutic approaches could represent a more viable and potent alternative for eliminating

these highly tumorigenic and chemoresistant cells. Macrophages play crucial roles in adaptive

and innate immunity. In PDAC, tumor-associated macrophages (TAMs) represent the major

immune cell type present in the PDAC tumor microenvironment (14) and these cells are believed

to drive cancer progression, presumably via promoting cancer cell proliferation, tumor

angiogenesis, extracellular matrix breakdown, and subsequently tumor invasion and metastasis

(15, 16). In addition, CD47, a transmembrane protein expressed on many cancer cells, serves as a

ligand to signal regulatory protein-α (SIRPα), a molecule expressed on macrophages (17),

resulting in the inhibition of phagocytosis by macrophages through a signaling cascade mediated

via phosphorylation of the immunoreceptor tyrosine-based inhibitory motif present on the

cytoplasmic tail of SIRPα (18).

Previous work in pre-clinical models of bladder cancer, leukemia, and lymphoma

demonstrated that inhibiting the interaction between CD47 and SIRPα using anti-CD47

monoclonal antibodies (mAbs) allows for increased phagocytosis of cancer cells in vitro and

decreased tumor burden in vivo (19-21). Recently, CD47 was shown to be preferentially

expressed in liver CSCs and inhibition of CD47 suppressed growth of hepatocellular carcinoma

xenografts and had a chemosensitizing effect (22), suggesting that CD47 may also be a promising

therapeutic target for hepatocellular CSCs. Here, we now demonstrate that CD47 is also highly

expressed on pancreatic cancer (stem) cells and that anti-CD47 mAbs did not only enable

phagocytosis of these cells by macrophages, but also directly induced apoptosis of the cancer

(stem) cells, while exerting no effect on non-malignant cells. Althoug CD47 targeting as a single

treatment strategy was not effective in vivo, the combination with chemotherapy resulted in long-

lasting tumor regression. Thus, our results demonstrate that targeting CD47 on PDAC cells

changes the behavior of resident TAMs to inhibit, rather than promote tumor growth and thus

may evolve as a potent addition to our still sparse armamentarium against PDAC.

MATERIALS AND METHODS

Primary human and mouse pancreatic cancer cells and macrophages. Human PDAC

tissues were obtained with written informed consent from all patients and expanded in vivo as

patient-derived xenografts (PDX), as previously described (12). For in vitro studies, PDX tissue

fragments were minced, enzymatically digested with collagenase (Stem Cell Technologies,

Vancouver, BC) for 90min at 37°C (12) and after centrifugation for 5min at 1,200rpm cell pellets

were resuspended and cultured in RPMI supplemented with 10% FBS and 50units/ml

penicillin/streptomycin. These primary cultures were used in vitro only until passage 10. Murine

PDAC cells were derived from the K-Ras+/LSL-G12D;Trp53LSL-R172H;PDX1-Cre mice

(KPC) as a model of advanced PDAC (23). KPC-derived tumors were minced, mechanically

(gentleMACS Dissociator; Miltenyi, Bergisch-Gladbach, Germany) and enzymatically

dissociated with collagenase (Stem Cell Technologies, Vancouver, BC) and subsequently

cultured in vitro as previously detailed (24). Epithelial clones were picked, pooled, and further

expanded to heterogeneous primary cancer cell cultures (AAU77G and CHX6).

Human peripheral blood-derived mononuclear cells were obtained from healthy donors

with informed consent. Monocyte-derived macrophage cultures were established in IMDM

supplemented with 10% human AB serum as previously described (25). Sixty ng/ml GM-CSF or

M-CSF (R&D, Minneapolis, MN) was added to the cultures to generate M1 and M2 monocyte-

derived macrophages, respectively (26). Murine monocytes were isolated from mechanically

disrupted spleens, passed through a 40µm mesh filter, and differentiated into macrophages under

adherent conditions on non-tissue culture-treated 100mm dishes in RPMI supplemented with 10%

FBS and 10ng/ml of murine M-CSF (PeproTech, London, UK). To generate M1- and M2-

polarized murine macrophages, 10ng/ml of IFN-γ (PeproTech) and LPS (Sigma, St. Louis, MO)

(M1) or 10ng/ml IL-4 (M2) (PeproTech) were added to the cultures.

Sphere formation assay. Spheres were generated by culturing 2104 pancreatic cancer

cells in suspension in serum-free DMEM/F12 supplemented with B27 (1:50, Invitrogen,

Karlsruhe, Germany), 20ng/ml bFGF and 50units/ml pen/strep for a total of 7 days, allowing

spheres to reach a size of >75µm. For serial passaging, 7-day-old spheres were retained using

40µm cell strainers, dissociated into single cells, and then re-cultured for 7 additional days as

previously described (13).

RNA preparation and quantitative real-time PCR. Total RNAs from human primary

pancreatic cancer cells and spheres were extracted with TRIzol (LifeTechnologies, Norwalk, CT)

according to the manufacturer’s instructions. One microgram of total RNA was used for cDNA

synthesis with SuperScript II reverse transcriptase (LifeTechnologies) and random hexamers.

Quantitative real-time PCR was performed using SYBR Green PCR master mix

(LifeTechnologies), according to the manufacturer’s instructions. Primers sequences used are:

ACTIN: Forward - GCGAGCACAGAGCCTCGCCTT

Reverse – CATCATCCATGGTGAGCTGGCGG

CD47: Forward - GCGATTGGATTAACCTCCTTCGTCA

Reverse - CCATGCATTGGTATACACGCCGC

Flow cytometry. Cells were adjusted to a concentration of 106 cells/ml in sorting buffer

[1X PBS; 3% FBS (v/v); 3mM EDTA (v/v)] before analysis or sorting with a FACS Canto II or

FACS Influx instrument, respectively (BD, Heidelberg, Germany). To identify distinct cancer

(stem) cells, the following antibodies were used: anti-CD133/1-APC or PE (Miltenyi Biotec);

CD47-APC, CXCR4-APC, SSEA-1-APC, or appropriate isotype-matched control antibodies (all

from BD). DAPI was used for exclusion of dead cells. Data were analyzed with FlowJo 9.2

software (Tree Star, Ashland, OR). For the assessment of apoptosis, cells were incubated with

DAPI and Annexin V fluorescein isothiocyanate (FITC) staining kit (BD) according to the

manufacturer’s instructions.

Antibody Preparation. The anti-hCD47 (B6H12) hybridoma was obtained from the

ATCC. Hybridoma cells were cultured using previously described conditions (27) and antibodies

were purified by Protein G.

In vitro phagocytosis assay. For in vitro phagocytosis analysis, 5×104 monocyte-derived

macrophages were plated in each well of 24-well tissue-culture plates and labeled with PKH26

according to the manufacturer’s instructions (Sigma). Macrophages were incubated in serum-free

medium for 2h before adding 2×105 GFP-labeled live cancer cells. Anti-CD47 (B6H12) antibody

(10μg/mL) or IgG1 control antibody was added and incubated for 2h at 37°C. Macrophages were

repeatedly washed and subsequently imaged using an inverted microscope (Leica DMI6000B).

The phagocytic index was calculated as the number of phagocytosed GFP+ cells per 100

macrophages.

Immunohistochemistry. For histopathological analysis, FFPE blocks were serially

sectioned (3μm thick) and stained with hematoxylin and eosin (H&E). Additional serial sections

were used for immunohistochemical (IHC) studies with anti-CD47 antibody (0.2μg/mL, Abcam

ab3283). Antigens were visualized using 3,3-diaminobenzidine tetrahydrochloride plus (DAB+).

Counterstaining was performed with hematoxylin. Histological quantification of digitalized slides

was performed using Pannoramic Viewer (3DHistech, Budapest, Hungary).

Tissue microarrays (TMAs). Four human TMAs containing quadruplicate 1mm cores

from selected areas of paraffin-embedded pancreatic surgical specimens including ducts, acini,

pancreatitis, PDAC and PDAC metastasis were constructed. A total of 42 tumors were included.

Two xenograft TMAs containing quadruplicate 1mm cores from selected tumor areas of 56

paraffin-embedded human PDACs grafted in nude mice were also constructed. The use of human

tissue samples for the construction of the TMAs was approved by the Ethics Committee of the

Hospital de Madrid Norte Sanchinarro. All sections were assessed and scored by an in-house

pathologist (Maria Lozano).

In vivo tumorigenicity assay. Primary pancreatic cells were treated in vitro with anti-

CD47 and serial dilutions of single-cells were resuspended in MatrigelTM (BD) and

subcutaneously injected into female 6-8 week old NU-Foxn1nu nude mice (Harlan, Laboratories,

UK). In some experiments, macrophages were depleted with the following treatment schedule:

200μl of clodronate was injected intravenously twice a week. Tumor formation was evaluated

after 2 months. Mice were housed according to institutional guidelines and all experiments were

approved by the local Animal Experimental Ethics Committee of the Instituto de Salud Carlos III

(PA 34-2012) and performed in accordance with the guidelines for Ethical Conduct in the Care

and Use of Animals as stated in The International Guiding Principles for Biomedical Research

involving Animals, developed by the Council for International Organizations of Medical Sciences

(CIOMS).

In vivo treatment. Primary tumor tissue pieces of ~2mm3 were implanted subcutaneously

into the flanks of NU-Foxn1nu nude mice, and once tumors were established mice were randomized to

the respective treatment groups. Gemcitabine was administered twice a week (125mg/kg i.p.),

Abraxane was administered every 4 days (50mg/kg i.v.) and anti-CD47 was administered daily

(500μg/mouse i.p.) (20).

Statistical analyses. Results for continuous variables are presented as means ± standard

deviation unless stated otherwise and significance was determined using the Mann-Whitney test.

All analyses were performed using SPSS 22.0 (SPSS, Chicago, IL).

RESULTS

CD47 is expressed at higher levels in PDAC compared to normal pancreatic tissue. We

evaluated the level of CD47 expression by immunohistochemical analysis of paraffin sections of

tissue microarrays containing primary human tissues from “normal” adjacent non-tumor

pancreatic tissue, pancreatitis, PDAC, and regional lymph, and liver metastases. CD47 expression

was significantly overexpressed in primary PDAC tumors (p<0.001) and metastasis (p<0.05)

versus pancreatitis and normal pancreatic tissue (Fig. 1A). Importantly, while CD47 was still

detectable in normal (non-cancer) pancreatic tissue, the level of expression was significantly

lower compared with PDAC, patient-derived PDAC xenograft and metastasis samples, where

CD47 expression was markedly stronger, but restricted to epithelial cancer cells and absent in the

stroma (Fig. 1B and Supplementary Fig. 1A). We next analyzed independent large collections of

primary tissues for the expression of CD47. The results indicated that CD47 expression varies

considerably within tissues (Supplementary Fig. 1B) and between patients with about 1/3 of the

patients bearing low to undetectable levels of CD47. Patients represented on each of the two

independent sets of TMAs were dichotomized according to low to undetectable CD47 expression

(CD47 negative) and intermediate to high CD47 expression (CD47 positive), however, no

association between CD47 expression and outcome could be identified (Supplementary Fig. 1C).

We next determined CD47 mRNA expression in a set of nine primary patient-derived

pancreatic cancer cell cultures, two normal pancreas samples, and primary pancreatic stellate cells

(PSC). We observed low to undetectable levels of CD47 mRNA expression in normal tissue and

in PSCs as compared to PDAC cells. The latter could be subdivided into three groups based on

their CD47 mRNA expression: low (JH029 and 247), medium (198, 253, 215, and 354), and high

(163, 185, and A6L) (Fig. 1C). In order to confirm the expression of CD47 at the protein level,

flow cytometry analysis was performed on both adherent cells and sphere-derived cells, the latter

of which are enriched in CSCs (13). We observed relatively homogenous expression of CD47 in

differentiated cells (ranging from 40% to 57%) while in sphere culture-enriched CSCs, the

surface expression of CD47 was higher although more variable (ranging from 54% to 85%),

suggesting an enrichment of CD47 in CSCs (Fig. 1D). We next assessed the percentage of

CD47+ cells within the CD133+ [a well-established pancreatic CSC marker (9)] sub-population,

and as shown in Fig. 1E, the majority of CD133+ cells expressed CD47 albeit with different

percentages (ranging from 77% to 97%).

Pancreatic cancer stem cells are mostly confined to CD47+ cells. Since our data

suggested that CD47 is preferentially expressed in pancreatic CSC (i.e. CD133+ cells), we aimed

to assess whether CD47+ cells were more “stem-like”. We first FACSorted primary pancreatic

cancer cells for CD47 (Fig. 2A) and then determined their self-renewal capacity using sphere

formation as readout. We observed that CD47+ cells isolated from 185, 215, and 354 primary

cells formed significantly more and larger spheres compared with CD47– cells (Fig. 2B),

suggesting that CD47+ cells are indeed enriched in CSCs. However, to obtain conclusive

evidence for the latter, we performed in vivo limiting dilution tumorigenicity assays. Ten weeks

post-injection, CD47+ cells had formed more tumors indicating that CSCs are mostly contained

in the CD47+ cell population (Fig. 2C). To further evaluate the function of CD47 in the CSCs

context, we sorted four populations based on CD133 and CD47 expression and observed that

CD47+CD133+ cells possessed the highest sphere formation capacity (Fig. 2D). Building upon

the latter, we sorted cells for both CD133 and CD47 and injected them into nude mice depleted

for macrophage by means of treatment with clodronate. Macrophage depletion was performed to

more definitively demonstrate that the tumorigenic capacities observed in vivo were indeed due to

differences in functional CSC content and not related to the inherent resistance of a cell to

macrophage phagocytosis based on cell surface CD47 expression. Not only did we confirm that

in vivo tumorigenicity is indeed mostly confined to the CD47+ population, as previously seen

(Fig. 2C), but we also show that CD47+CD133+ cells are more highly enriched for CSCs and

thus more tumorigenic, whereas CD47–CD133– cells bear the least tumorigenic potential (Fig.

2E). Taken together, these data suggest that targeting CD47 should achieve a major reduction in

CSC activity.

Anti-CD47 treatment enables phagocytosis of pancreatic CSCs. It has been previously

demonstrated that blocking CD47-mediated SIRPα signaling using targeted monoclonal

antibodies (mAbs) induces phagocytosis of leukemia, lymphoma, and bladder cancer cells by

human and mouse macrophages (19, 21, 28). Using primary PDAC cells stably infected with a

lentivirus expressing GFP (green) and PKH26 dye (red)-labeled primary human monocyte-

derived macrophages isolated from healthy donors (ratio cancer cells:macrophages 4:1), we show

that in contrast to cells treated with an isotype-matched mouse IgG control antibody, primary

PDAC cells treated with the blocking anti-human CD47 (hCD47) mAb B6H12.2 were efficiently

phagocytosed by macrophages. This effect was observed for adherent cells, which mainly contain

non-CSC, and sphere-derived cells or CD47+CD133+ sorted cells, which are enriched for CSCs

(Fig. 3A/B) and was independent of the method of macrophage polarization (Supplementary Fig.

2A).

We next attempted to mimic the tumor in vivo microenvironment conditions by

polarizing macrophages cultures towards an “M1” phenotype with GM-CSF and an “M2”

phenotype with M-CSF, respectively (26), or by exposing them to CSC-conditioned media from

primary cultures of PDAC spheres (29). We first confirmed that GM-CSF treated macrophages

possessed a classic M1 circular morphology, while M-CSF treated and CSC conditioned

macrophages both showed a more elongated shape typical of M2-polarized macrophages (Fig. 3C,

upper panel). In the absence of anti-CD47 blocking antibodies, CSC-conditioned “M2”

macrophages had the lowest phagocytic index levels compared to the other macrophage subtypes

(0.9 vs 2.8 for M2-polarized macrophages), consistent with a truly protective and pro-tumorigenic

role for these macrophages. Treatment with the blocking mAb B6H12.2, however, significantly

enhanced phagocytosis of cancer cells across all macrophage subtypes, with a more pronounced

increase for M2 (6.7-fold increase) and CSC-conditioned (13-fold increase) macrophages (Fig.

3C, lower panel). Importantly, primary monocyte-derived murine macrophages, regardless of

their initial polarization, were also capable of phagocytosing human PDAC cells when CD47 was

blocked (Fig. 3D).

Importantly, we evaluated the percentage of CD133+ CSCs following anti-CD47

treatment and observed a significant reduction compared with isotype-treated cells (Fig. 3E).

Moreover we observed a consistent and significant reduction in the sphere formation capacity of

surviving/non-phagocytosed cells, indicating that anti-hCD47 treatment indeed eliminated the

CSCs pool (Fig. 3F). Using a more stringent ratio of macrophage:cancer cells (1:1) we observed

similar effects in terms of phagocytosis as well as significant reduction in sphere formation and

CD133+ CSC content (Supplementary Fig. 2B-D). In contrast, for non-transformed cells no

significant induction of phagocytosis was found (Supplementary Fig. 2B, right panel), which

might be attributed to the lack of “eat-me” signals on these cells. Lastly, in order to validate the

specificity of anti-CD47-induced phagocytosis, we tested a different antibody that also binds a

large fraction of PDAC cells (i.e. anti-CD44). However, treatment with anti-CD44 did not induce

phagocytosis while in the same experiments treatment with anti-CD47 showed strong induction

of phagocytosis (Supplementary Fig. 2F). These data demonstrate that induction of

phagocytosis by anti-CD47 is likely independent of FcR stimulation of macrophages. It is worth

noting, however, that blocking CD47 using a Fab molecule would be necessary to definitively

demonstrate that Fc receptor is not required. Nonetheless, the data suggest that CD47 is a

legitimate therapeutic target for PDAC.

Anti-CD47 treatment induces apoptosis of pancreatic cancer stem cells. Antibodies

directed against CD47 have also been shown to directly induce apoptosis of several

hematopoietic malignancies (30-32). We therefore incubated sphere-derived cells with anti-

hCD47 mAb B6H12.2 but in the absence of macrophages, and subsequently assessed apoptosis 2

and 12 h post treatment by Annexin V staining. While we observed no induction of apoptosis in

non-transformed human cells (Fig. 4A) or in primary murine PDAC tumor cells (Supplementary

Fig. 3A), we did detect a significant increase in apoptotic cells across several primary human

PDAC cell lines following treatment with the anti-CD47 antibody compared to IgG mAb-treated

controls (Fig. 4B). Importantly, no apoptosis was observed in any of the samples tested following

two hours of treatment (Supplementary Fig. 3B). Thus, since phagocytosis of CSCs by

macrophages was detected as early as 15 minutes post incubation with the anti-CD47 antibody

(data not shown), we identify two distinct mechanisms of action, the first being phagocytosis

while the second being an apparent PDAC-specific elimination of CSCs via direct induction of

apoptosis without involvement of macrophages.

Anti-CD47 treatment inhibits in vivo tumorigenicity and tumor progression, preventing

relapse. In order to test the efficiency of CSCs elimination in vitro, we tested the ability of

surviving/non-phagocytosed cells after anti-CD47 treatment to form tumors in vivo. We observed

a significant reduction in the tumorigenicity of anti-CD47-treated cells compared to isotype-

treated cells (Fig. 5A) and the few tumors that formed from the anti-CD47 treated cultures were

significantly smaller in size compared to isotype control tumors (Fig. 5B). In addition, while a

similar amount of EPCAM expression was observed across all samples regardless of the

treatment, anti-CD47 treated tumors contained a significantly lower percentage of cells

expressing the CSC surface markers CD133 and SSEA1 (Fig. 5C). Again, when we used a more

stringent ratio of macrophage:cancer cells (1:1), we observed that tumorigenicity following

injection of surviving cells was essentially abrogated (Supplementary Fig. 2E).

Encouraged by these promising in vivo tumorigenicity data, we next performed in vivo

therapeutic intervention studies with human-derived PDAC xenografts expressing intermediate

levels of CD47. Once tumors had formed (~100mm3), mice we randomized to one of the

following six treatment groups: Diluent control; Gemcitabine (biweekly 125mg/kg i.p.) from day

14 to 56; Abraxane (every 4 days 50mg/kg i.v.) from day 14 to 28; Anti-CD47 (daily

500μg/mouse i.p.) from day 14 to 35; Gemcitabine + anti-CD47; and Abraxane + anti-CD47.

Interestingly, for both utilized PDX models no significant differences were observed for

chemotherapy and anti-CD47 single treatment, however, tumors treated with a combination of

chemotherapy + anti-CD47 were significantly reduced compared to control tumors and single

treatment tumors. Specifically, for PDAC-185, treatment with Abraxane plus anti-CD47

significantly stalled tumor growth. While mice previously treated with Abraxane alone showed

similar initial response, tumors eventually relapsed. No relapse (i.e. de novo growth of tumors),

however, was observed when mice were treated with both Abraxane and anti-CD47 (Fig. 5D).

PDAC-185 tumors in the Gemcitabine + anti-CD47 treatment group had to be harvested early due

to ulcerations. Of note, tumors did not differ in gross morphology, as assessed by H&E and CK19

immunohistochemistry (Fig. 5E), and were also similarly vascularized and contained M2

macrophages (Supplementary Fig. 4A). Importantly, flow cytometry analysis of digested tumors

showed a significant decrease in the percentage of cells expressing the CSC marker CD133 only

in mice that had received anti-CD47 treatment (Fig. 5F), suggesting that anti-CD47 treatment

effectively targeted the CSC population. In the PDAC-215 PDX model similar treatment benefits

were observed when anti-CD47 was combined with a chemotherapeutic, although in this PDX

model Gemcitabine was more effective then Abraxane when used in combination with anti-CD47

as evidenced by the lack of tumor relapse during long-term follow-up (Supplementary Fig.

4B/C).

DISCUSSION

Macrophages can undergo specific differentiation/polarization depending on the

environment and surrounding cellular context. Two distinct states of macrophage polarization

have been defined (33): (1) the classically activated (M1) macrophage that plays an important

pro-inflammatory effector role in TH1 cellular immune responses, including the secretion of

cytokines and phagocytosis of target cells or (2) the alternatively activated (M2) macrophage that

is involved in type II helper T-cell processes, such as wound healing and humoral immunity. In

cancer, pro-tumorigenic M2 TAMs enhance neoplasia via matrix remodeling, angiogenesis and

the secretion of pro-tumor growth factors, such as TGF- (34). In contrast, M1 macrophages are

believed to inhibit tumor growth via anti-tumor-adaptive immunity mechanisms that include

phagocytosis. The latter, however, mainly depends on macrophage recognition of pro-phagocytic

(“eat me”) signals on target cells, but can be inhibited by simultaneous expression of anti-

phagocytic (“don’t eat me”) signals, such as CD47. In the context of cancer, CD47 has been

found to be strongly overexpressed on different tumor cells, conferring an anti-phagocytic benefit

to these cells (35, 36). Importantly, inhibition of CD47 using monoclonal antibodies efficiently

induces phagocytosis of cancer cells by macrophages in experimental models of leukemia,

lymphoma, and bladder carcinomas (19-21); however, the relevance of this molecule and its

therapeutic targeting in PDAC (stem) cells had yet to be studied.

Herein we show that CD47 is overexpressed in the majority, but not in all primary PDAC

patient samples tested using multiple tissue microarrays (>150 patients represented). While CD47

was significantly overexpressed in about 2/3 of neoplastic tissues, we did not observe a

correlation between high CD47 protein expression and poor clinical outcome (Supplementary

Fig. 1C), which is in contrast to what has been shown for other cancers including AML, HCC,

glioma, and ovarian cancer (19-21, 36). The analysis of tissue microarrays may not be sufficient

to capture the general CD47 expression profile for each individual tumor. Indeed, we observed

significant variation between different cores that were available from the same patients

(Supplementary Fig. 1A-B). Thus, analysis of complete sections of primary patient PDAC

samples is likely needed before a correlative connection can be definitively determined for PDAC.

Notably, while CD47 was not “clinically predictive” in our tissue microarrays, we did note that

CD47 expression increased in sphere-derived CSC-enriched cultures, was expressed at even

higher levels in CD133+ cells, and CD47+ PDAC cells exhibited higher self-renewal and

tumorigenic properties compared to CD47– cells. Thus, like leukemia, bladder cancer, and HCC

(19-21), CD47 expression is strongly expressed on pancreatic CSCs, however, it is likely not a

suitable surrogate CSC marker as its strong expression on a large fraction of non-CSCs limits the

level of enrichment for CSCs in CD47+ cells and thus would require the use of other CSC

markers (e.g. CD133) in combination.

Using a neutralizing antibody for CD47, we found that inhibiting the anti-phagocytic

function of CD47 allowed for both human and mouse macrophages to phagocytose CSCs cells in

vitro, and the non-phagocytosed surviving PDAC cells exhibited significantly reduced expression

of CSC markers and functional phenotypes, such as self-renewal and in vivo tumorigenicity.

Importantly, this phenotype was independent of the polarization state of the macrophage, as M1

and M2 macrophages were equally capable of phagocytosing PDAC cells treated with anti-CD47

mAbs compared to unpolarized macrophages. In the context of the tumor microenvironment, M1

macrophages infiltrate the tumor during immune surveillance, but once recruited into tumor sites,

M1 macrophages can differentiate into M2 macrophages upon exposure to cytokines released by

tumor cells and tumor stromal cells (e.g. TGF, IL-4, IL-13, and IL-10) (33). Therefore, our

finding that MCSF-polarized M2 macrophages as well as CSC-conditioned M2-like macrophages

were able to phagocytose PDAC cells treated with anti-CD47 mAbs highlights the potential of

M2 macrophages, the predominant macrophage subtype present with the PDAC tumor

microenvironment, as biological tools to target CSCs and their more differentiated non-CSCs

progenies.

From a therapeutic perspective, we additionally show in two xenotransplantation models

of PDAC that treatment with monoclonal antibodies for CD47 in combination with Gemcitabine

or Abraxane significantly reduced primary tumor growth. Specifically, we found that anti-CD47

therapy alone only marginally reduced the size and rate of tumor growth, which again contrasts

with previous findings for other epithelial cancers (19-21) and may be attributed to the more

aggressive growth nature of PDAC, which cannot be completely controlled by phagocytic

macrophages. Alternatively, untreated tumors with their dense stroma may represent too strong a

barrier for the CD47 antibodies to reach the cancer cells. Importantly, however, in mice treated

with Gemcitabine or Abraxane, the addition of anti-CD47 therapy resulted in efficient growth

control of tumors and prevented relapse after discontinuation of treatment. The later was

particularly apparent when Abraxane was used in combination with anti-CD47. Specifically,

tumors in mice treated with both Abraxane and anti-CD47 mAbs diminished in size, such that one

tumor was completely eliminated and the remaining tumors failed to relapse as compared to mice

treated with Abraxane alone where relapse was evident in all mice by day 77. Regarding the

tumor CSC content, we observed that only the anti-CD47 therapy was able to reduce the

percentage of CD133+ cells in the tumor, which confirms our in vitro results and indicate that

anti-CD47 mAbs preferentially target CSCs. Taken together, these results strongly suggest that

anti-CD47 therapy could be an effective means of treating primary PDAC tumors, but

combination with other anti-cancer therapeutic agents, such as Abraxane, is needed.

While the main acute mechanism of action of anti-CD47 therapy relies on macrophage-

mediated phagocytosis of CSCs, we did observe that long-term treatment of PDAC cells with

anti-CD47 mAbs induced a prominent and cancer cell specific induction of apoptosis. It has

previously been shown that ligation of CD47 triggers caspase-independent programmed cell

death (PCD) in normal and leukemic cells (31, 32, 37), thus in addition to blocking the anti-

phagocytic CD47 ligand on PDAC cells, anti-CD47 mAbs may also function to eliminate CSCs

via a separate apoptotic-specific mechanism of action. Additional studies are still needed to

resolve whether anti-CD47 therapy induces apoptosis of tumor cells in vivo. In addition, it is

important to note that during cell death, pro-phagocytic (“eat me”) signals such as calreticulin are

shuttled to the cell membrane (38). Thus, it is also logical to hypothesize that anti-CD47 mAb-

induced apoptosis may also facilitate macrophage-mediated apoptosis via upregulation of the pro-

phagocytic (“eat me”) signal calreticulin. Therefore, anti-CD47 therapy may have multiple

mechanisms of action, each of which likely facilitate macrophage phagocytosis of CSCs.

Is CD47 targeting in PDAC suitable and ready for further clinical exploration? While our

in vivo study provides proof-of-concept for CD47 targeting in PDAC, indeed several open

questions remain to be addressed in further preclinical studies, but could not be tackled in the

present studies based on the currently prohibitive costs of low scale antibody production. Once

high-affinity clinical-grade antibodies or high-affinity SIRPα monomers are available in larger

amounts (39), it should be determined if the abundant stroma in PDAC tumors represents a

relevant physical barrier for the antibodies to reach the cancer cells. Therefore, it should be tested

if co-administration of a stroma targeting agents leads to better response rates for CD47 antibody

treatment. However, a cautionary note comes from recent studies demonstrating that stroma

targeting alone could result in adverse outcomes. Specifically, mouse studies demonstrated that

loss of stroma leads to de-differentiation of cancer cells rendering them more aggressive (40, 41).

In addition, a recent clinical trial on hedgehog pathway inhibition was prematurely stopped based

on excessive death rates in the treatment group. Whether enhanced delivery of CD47 antibodies

to stroma-depleted tumors and subsequently enhanced treatment response will outweigh these

putative adverse effects of stroma-targeting remains to be determined in carefully designed

preclinical studies. Secondly, we observed considerable variation in CD47 expression across a

large panel of primary PDAC samples. Specifically, 10% of patients showed no detectable or

very low levels of CD47 staining. Those patients may not gain significant therapeutic benefit

from anti-CD47 treatment. Such stratification could be based on CD47 expression on circulating

tumor cells as these have been shown to also express CD47 (42). Thirdly, it seems reasonable to

explore the possibility of combining anti-CD47 mAb therapy with treatments that either target

TAM recruitment (e.g. anti-CSF1 therapy) or their polarization towards M2 macrophages (e.g.

anti-TGF therapy).

In conclusion, we have found that CD47 is expressed on primary PDAC cells and we

have demonstrated that inhibiting CD47 function using monoclonal antibodies is an effective

method of treating PDAC in vitro and in vivo, thereby forming the rationale for evaluating the

clinical efficacy of anti-CD47 therapy in more comprehensive pre-clinical studies, which may

eventually lead to first trials in human patients with PDAC. While further mechanistic studies are

still needed to determine how anti-CD47 treatment reduces tumor growth (i.e. phagocytosis

and/or apoptosis), the data presented herein add to the growing repertoire of tumors that can be

potentially treated with anti-CD47 mAb-based therapies.

DISCLOSURE OF POTENTIAL CONFLICTS OF INTEREST

No potential conflicts of interest were disclosed by the authors.

AUTHOR CONTRIBUTIONS

Michele Cioffi developed the study concept, acquired, analyzed, interpreted the data, and

wrote the manuscript; Michele Cioffi and Sara M. Trabulo designed and performed the in vivo

experiments. Bruno Sainz, Jr. helped in the study design, interpretation of the data, and wrote the

manuscript; Manuel Hidalgo provided extensively characterized PDAC samples; Eithne Costello,

William Greenhalf, Mert Erkan, and Joerg Kleeff provided PDAC samples and/or tissue micro

arrays. Christopher Heeschen developed the study concept, obtained funding, interpreted the data,

and wrote the manuscript.

GRANT SUPPORT

The research was supported by the ERC Advanced Investigator Grant (Pa-CSC 233460),

European Community's Seventh Framework Programme (FP7/2007-2013) under grant agreement

n°256974, the Subdirección General de Evaluación y Fomento de la Investigación, Fondo de

Investigación Sanitaria (PS09/02129 & PI12/02643) and the Programa Nacional de

Internacionalización de la I+D, Subprogramma: FCCI 2009 (PLE2009-0105; both Ministerio de

Ciencia e Innovación, Spain), all to C.H.; and the Spanish Ministry of Economy and

Competitiveness (SAF2011-30173 to M.B.). The authors declare no conflict of interest. M.C. is

supported by the La Caixa Predoctoral Fellowship Program.

ACKNOWLEDGEMENTS

We are indebted to Magdalena Choda for excellent technical assistance. We would also

like to thank Maria Lozano for assistance with the PDAC TMA analyses.

FIGURE LEGENDS

Figure 1: CD47 is expressed in pancreatic cancer (stem) cells. (A) Quantification of

CD47 expression in a primary patient TMA containing cores of normal pancreas, pancreatitis,

PDAC, and metastases. Shown are the mean relative intensity values of CD47 staining within

each core. (B) Representative pictures of CD47 stained TMA cores including FFPE section of

human-derived xenografts. (C) RTqPCR analysis of CD47 in normal pancreas samples, PSC cells,

and several primary human pancreatic cancer cultures. -actin was used as a normalization

control. (D) Flow cytometry analysis of CD47 cell surface expression comparing adherent cells

and sphere-derived cells. (E) Flow cytometry analysis of CD47 and CD133 expression on sphere-

derived cells (left panel) and quantification of CD133+ cells also expressing CD47 (right panel).

Figure 2: Pancreatic cancer stem cells are mostly confined to CD47+ cells.

(A) Representative flow cytometry plots of CD47 staining showing the gating strategy for sorting.

(B) Representative images of spheres (left panel) and quantification of spheres (right panel) in

185, 354 and 215 primary pancreatic cancer cells sorted for CD47. (C) In vivo tumorigenicity of

FACSorted 185, 354, and 215 primary pancreatic tumor cells for CD47. (D) Sphere formation

capacity for cells FACSorted for CD47 and CD133. (E) In vivo tumorigenicity of cells

FACSorted for CD47 and CD133 injected in mice depleted for macrophages by treatment with

clodronate (twice a week).

Figure 3: Anti-CD47 enables phagocytosis of pancreatic cancer stem cells.

(A) Representative confocal images (upper panel) and phagocytic index (lower panel) of human

peripheral blood (PB)-derived macrophages (red) phagocytosing patient-derived CSCs (green) in

the presence of blocking anti-CD47 mAb (B6H12) or IgG1 isotype control Ab. (B) Phagocytic

index of macrophages phagocytosing human PDAC cells FACSorted for CD47 and CD133 in the

presence of blocking anti-CD47 mAb or IgG1 isotype control Ab. (C) Phagocytic index of human

unpolarized, M1, M2 and CSC media polarized macrophages. (D) Phagocytic index of murine

M1 and M2 polarized macrophages in the presence of blocking anti-CD47 mAb or IgG1 isotype

control Ab. (E) Flow cytometry analysis of CD133 cell surface expression on surviving cells

following incubation with primary human macrophages and treatment with anti-CD47 mAb

(B6H12) or IgG1 isotype control mAb. (E) Sphere formation quantification of cells after

treatment with anti-CD47 mAbs, compared to IgG1 control treated cells.

Figure 4: Anti-CD47 treatment directly induces apoptosis of pancreatic cancer stem

cells. (A) Flow cytometry analysis of apoptosis as determined by Annexin V/DAPI staining, in

non-transformed human cells and (B) several primary human pancreatic sphere-derived cell

cultures after treatment for 12 h with anti-CD47 mAb (B6H12) or IgG1 isotype control mAb.

Figure 5: Anti-CD47 treatment inhibits in vivo tumorigenicity and tumor progression,

preventing relapse. (A) In vivo tumorigenicity, (B) tumor weight and (C) flow cytometry analysis

for EPCAM, CD133 and SSEA1 for primary pancreatic sphere-derived cells after treatment with

anti-CD47 mAb (B6H12) or IgG1 isotype control mAb. (D) Experimental setup for in vivo

treatment (upper left panel) and effects of allocated treatment regiments in 185 tissue xenografts

transplanted in immunocompromised mice (lower left panel). The mean tumor volume is given;

n=6 tumors per group. Representative images of tumors extracted from mice at the end of the

respective observation period (right panel). (E) H&E staining and IHC analysis of CK19

expression in paraffin section from the tumors. (F) Flow cytometry analysis of CD133 cell

surface expression in cells isolated from tumors of mice treated as indicated.

References

1. Paulson AS, Tran Cao HS, Tempero MA, Lowy AM. Therapeutic advances in pancreatic cancer. Gastroenterology. 2013;144:1316-26. 2. Burris HA, 3rd, Moore MJ, Andersen J, Green MR, Rothenberg ML, Modiano MR, et al. Improvements in survival and clinical benefit with gemcitabine as first-line therapy for patients with advanced pancreas cancer: a randomized trial. J Clin Oncol. 1997;15:2403-13. 3. Conroy T, Desseigne F, Ychou M, Bouche O, Guimbaud R, Becouarn Y, et al. FOLFIRINOX versus gemcitabine for metastatic pancreatic cancer. N Engl J Med. 2011;364:1817-25. 4. Von Hoff DD, Ervin T, Arena FP, Chiorean EG, Infante J, Moore M, et al. Increased survival in pancreatic cancer with nab-paclitaxel plus gemcitabine. N Engl J Med. 2013;369:1691-703. 5. Rothenberg ML, Moore MJ, Cripps MC, Andersen JS, Portenoy RK, Burris HA, 3rd, et al. A phase II trial of gemcitabine in patients with 5-FU-refractory pancreas cancer. Ann Oncol. 1996;7:347-53. 6. Siegel R, Naishadham D, Jemal A. Cancer statistics, 2012. CA Cancer J Clin. 2012;62:10-29. 7. Lapidot T, Sirard C, Vormoor J, Murdoch B, Hoang T, Caceres-Cortes J, et al. A cell initiating human acute myeloid leukaemia after transplantation into SCID mice. Nature. 1994;367:645-8. 8. Clarke MF, Dick JE, Dirks PB, Eaves CJ, Jamieson CH, Jones DL, et al. Cancer Stem Cells-- Perspectives on Current Status and Future Directions: AACR Workshop on Cancer Stem Cells. Cancer Res. 2006;66:9339-44. 9. Hermann PC, Huber SL, Herrler T, Aicher A, Ellwart JW, Guba M, et al. Distinct populations of cancer stem cells determine tumor growth and metastatic activity in human pancreatic cancer. Cell Stem Cell. 2007;1:313-23. 10. Li C, Heidt DG, Dalerba P, Burant CF, Zhang L, Adsay V, et al. Identification of pancreatic cancer stem cells. Cancer Res. 2007;67:1030-7. 11. Miranda-Lorenzo I, Dorado J, Lonardo E, Alcala S, Serrano AG, Clausell-Tormos J, et al. Intracellular autofluorescence: a biomarker for epithelial cancer stem cells. Nat Methods. 2014;11:1161-9. 12. Mueller MT, Hermann PC, Witthauer J, Rubio-Viqueira B, Leicht SF, Huber S, et al. Combined targeted treatment to eliminate tumorigenic cancer stem cells in human pancreatic cancer. Gastroenterology. 2009;137:1102-13. 13. Lonardo E, Hermann PC, Mueller MT, Huber S, Balic A, Miranda-Lorenzo I, et al. Nodal/Activin signaling drives self-renewal and tumorigenicity of pancreatic cancer stem cells and provides a target for combined drug therapy. Cell Stem Cell. 2011;9:433-46. 14. Kurahara H, Shinchi H, Mataki Y, Maemura K, Noma H, Kubo F, et al. Significance of M2-polarized tumor-associated macrophage in pancreatic cancer. J Surg Res. 2011;167:e211-9. 15. Pylayeva-Gupta Y, Lee KE, Hajdu CH, Miller G, Bar-Sagi D. Oncogenic Kras-induced GM-CSF production promotes the development of pancreatic neoplasia. Cancer Cell. 2012;21:836-47. 16. Qian BZ, Pollard JW. Macrophage diversity enhances tumor progression and metastasis. Cell. 2010;141:39-51. 17. Brown EJ, Frazier WA. Integrin-associated protein (CD47) and its ligands. Trends in cell biology. 2001;11:130-5. 18. Matozaki T, Murata Y, Okazawa H, Ohnishi H. Functions and molecular mechanisms of the CD47- SIRPalpha signalling pathway. Trends in cell biology. 2009;19:72-80. 19. Majeti R, Chao MP, Alizadeh AA, Pang WW, Jaiswal S, Gibbs KD, Jr., et al. CD47 is an adverse prognostic factor and therapeutic antibody target on human acute myeloid leukemia stem cells. Cell. 2009;138:286-99. 20. Willingham SB, Volkmer JP, Gentles AJ, Sahoo D, Dalerba P, Mitra SS, et al. The CD47-signal regulatory protein alpha (SIRPa) interaction is a therapeutic target for human solid tumors. Proc Natl Acad Sci U S A. 2012;109:6662-7. 21. Chan KS, Espinosa I, Chao M, Wong D, Ailles L, Diehn M, et al. Identification, molecular characterization, clinical prognosis, and therapeutic targeting of human bladder tumor-initiating cells. Proc Natl Acad Sci U S A. 2009;106:14016-21. 22. Lee TK, Cheung VC, Lu P, Lau EY, Ma S, Tang KH, et al. Blockade of CD47 mediated CTSS-PAR2 signaling provides a therapeutic target for hepatocellular carcinoma. Hepatology. 2014;60:179-91.

23. Hingorani SR, Wang L, Multani AS, Combs C, Deramaudt TB, Hruban RH, et al. Trp53R172H and KrasG12D cooperate to promote chromosomal instability and widely metastatic pancreatic ductal adenocarcinoma in mice. Cancer Cell. 2005;7:469-83. 24. Hermann PC, Sancho P, Canamero M, Martinelli P, Madriles F, Michl P, et al. Nicotine promotes initiation and progression of KRAS-induced pancreatic cancer via Gata6-dependent dedifferentiation of acinar cells in mice. Gastroenterology. 2014;147:1119-33 e4. 25. Chao MP, Alizadeh AA, Tang C, Myklebust JH, Varghese B, Gill S, et al. Anti-CD47 antibody synergizes with rituximab to promote phagocytosis and eradicate non-Hodgkin lymphoma. Cell. 2010;142:699-713. 26. Sierra-Filardi E, Puig-Kroger A, Blanco FJ, Nieto C, Bragado R, Palomero MI, et al. Activin A skews macrophage polarization by promoting a proinflammatory phenotype and inhibiting the acquisition of anti-inflammatory macrophage markers. Blood. 2011;117:5092-101. 27. Lindberg FP, Lublin DM, Telen MJ, Veile RA, Miller YE, Donis-Keller H, et al. Rh-related antigen CD47 is the signal-transducer integrin-associated protein. J Biol Chem. 1994;269:1567-70. 28. Jaiswal S, Jamieson CH, Pang WW, Park CY, Chao MP, Majeti R, et al. CD47 is upregulated on circulating hematopoietic stem cells and leukemia cells to avoid phagocytosis. Cell. 2009;138:271-85. 29. Sainz B, Jr., Moreno B, Tatari M, Heeschen C, Guerra S. ISG15 is a critical microenvironmental factor for pancreatic cancer stem cells. Cancer Res. 2014. 30. Kikuchi Y, Uno S, Kinoshita Y, Yoshimura Y, Iida S, Wakahara Y, et al. Apoptosis inducing bivalent single-chain antibody fragments against CD47 showed antitumor potency for multiple myeloma. Leukemia research. 2005;29:445-50. 31. Mateo V, Lagneaux L, Bron D, Biron G, Armant M, Delespesse G, et al. CD47 ligation induces caspase-independent cell death in chronic lymphocytic leukemia. Nat Med. 1999;5:1277-84. 32. Bras M, Yuste VJ, Roue G, Barbier S, Sancho P, Virely C, et al. Drp1 mediates caspase-independent type III cell death in normal and leukemic cells. Molecular and cellular biology. 2007;27:7073-88. 33. Biswas SK, Mantovani A. Macrophage plasticity and interaction with lymphocyte subsets: cancer as a paradigm. Nat Immunol. 2010;11:889-96. 34. Flavell RA, Sanjabi S, Wrzesinski SH, Licona-Limon P. The polarization of immune cells in the tumour environment by TGFbeta. Nat Rev Immunol. 2010;10:554-67. 35. Chao MP, Weissman IL, Majeti R. The CD47-SIRPalpha pathway in cancer immune evasion and potential therapeutic implications. Current opinion in immunology. 2012;24:225-32. 36. Chao MP, Majeti R, Weissman IL. Programmed cell removal: a new obstacle in the road to developing cancer. Nat Rev Cancer. 2012;12:58-67. 37. Pettersen RD, Hestdal K, Olafsen MK, Lie SO, Lindberg FP. CD47 signals T cell death. J Immunol. 1999;162:7031-40. 38. Buoncervello M, Borghi P, Romagnoli G, Spadaro F, Belardelli F, Toschi E, et al. Apicidin and docetaxel combination treatment drives CTCFL expression and HMGB1 release acting as potential antitumor immune response inducers in metastatic breast cancer cells. Neoplasia. 2012;14:855-67. 39. Weiskopf K, Ring AM, Schnorr PJ, Volkmer JP, Volkmer AK, Weissman IL, et al. Improving macrophage responses to therapeutic antibodies by molecular engineering of SIRPalpha variants. Oncoimmunology. 2013;2:e25773. 40. Ozdemir BC, Pentcheva-Hoang T, Carstens JL, Zheng X, Wu CC, Simpson TR, et al. Depletion of carcinoma-associated fibroblasts and fibrosis induces immunosuppression and accelerates pancreas cancer with reduced survival. Cancer Cell. 2014;25:719-34. 41. Rhim AD, Oberstein PE, Thomas DH, Mirek ET, Palermo CF, Sastra SA, et al. Stromal elements act to restrain, rather than support, pancreatic ductal adenocarcinoma. Cancer Cell. 2014;25:735-47. 42. Baccelli I, Schneeweiss A, Riethdorf S, Stenzinger A, Schillert A, Vogel V, et al. Identification of a population of blood circulating tumor cells from breast cancer patients that initiates metastasis in a xenograft assay. Nat Biotechnol. 2013;31:539-44.

Downloaded from clincancerres.aacrjournals.org on September 25, 2021. © 2015 American Association for Cancer Research. Figure 1 – CD47 is variably expressed in pancreatic cancer (stem) cells B A 4 p<0.001

3 10x 20x 10x 20x 10x 20x p<0.05 Normal Pancreas Pancreatitis PDAC

10x 20x 10x 20x 10x 20x

Mean Relative Intensity Intensity Relative Mean PDAC Metastasis Metastasis

10x 20x 10x 20x 10x 20x 0 Normal Pancreatitis PDAC Metastasis Xenograft Xenograft Xenograft

C D Adherent Spheres 80 * Non-tumor PDAC 100% * Author Manuscript Published OnlineFirst on February 23, 2015; DOI: 10.1158/1078-0432.CCR-14-1399 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. 80% 60 *

60%

40%

20 20% CD47 mRNA expression (absolute values) (absolute expression CD47 mRNA

0 cells) positive (% of expression CD47 surface 0% norm1norm2 PSC JH029 247 198 253 215 354 163 185 A6L A6L 185 354 215 253

* p<0.05 E

A6L 185 354 100% 0.62 4.27 0.618 2.95 9.52 23.4 5 5 5 10 87.3% 10 82.7% 10 71.1%

4 4

10 10 104

3 3

1 1

D D

C C

80%

: :

3 3 : 3

A A

10 10 A -

- 10

E E

P P P cells + 2 2 10 10 102

0 0 0 17.1 78 29.2 67.2 24.6 42.5

2 3 4 5 2 3 4 5 60% 0 10 10 10 10 0 10 10 10 10 0 102 103 104 105 APC-A: CD47 APC-A: CD47 APC-A: CD47

CD133 CD133 215 253

1.35 4.91 0.289 12.3 5 5 10 78.4% 10 97.7% 40%

104 10

: 3 3 A

A 10

10 -

E P P 20%

2 CD133 in CD47 expression 102 10

0 0 27.1 66.6 2.96 84.5 2 3 4 5 0 102 103 104 105 0 10 10 10 10 APC-A: CD47 APC-A: CD47 0% CD47 A6L 185 354 215 253

A B 1000 CD47– CD47+ CD47– CD47+ **

800 185 215

CD47+ 600 ** ** 215 400 Number Number of spheres

354 200 354

CD47+ 0 CD47 - 185CD47 + CD47 - 215 CD47 + CD47 -354 CD47 + 185 215 354 ** p<0.01 *** p<0.001 C

Tumorigenicity Tumorigenicity (# tumors / # injections) (# tumors / # injections) Enrich- 104 103 102 P value 104 103 102 CSC Freq ment

CD47– 4/4 2/4 1/4 215 3x 0.130 CD47- 0.02% CD47+ 4/4 3/4 3/4 354 Author Manuscript Published OnlineFirst on February 23, 2015; DOI: 10.1158/1078-0432.CCR-14-1399 Author manuscriptsCD47– have been3/4 peer2/4 reviewed 0 and/4 accepted for publication but have not yet been edited. 354 n.a. <0.0001 CD47+ 100% CD47+ 4/4 4/4 4/4

D 185 215 250 250 *

200 200

* * 150 150 * * 100 100 Number of spheres Number of

50 50

0 0 CD47-CD133–CD47+ CD47-CD133+CD47+ CD47-CD133–CD47+ CD47-CD133+CD47+ CD133-CD47– CD133-CD47+ CD133+CD47– CD133+CD47+ CD133-CD47– CD133-CD47+ CD133+CD47– CD133+CD47+ E Tumorigenicity (# tumors / # injections) Enrich- 103 102 P value ment

CD47– CD133– 1/4 0/4 2x n.s. CD47– CD133+ 2/4 0/4 215 264x <0.0001 CD47+ CD133– 4/4 2/4 <2x n.s. CD47+ CD133+ 4/4 4/4

Downloaded from clincancerres.aacrjournals.org on September 25, 2021. © 2015 American Association for Cancer Research. Figure 3 – Anti-CD47 treatment enables phagocytosis of pancreatic cancer stem cells

A IgG1 Isotype Anti-CD47 B

IgG1-Iso Anti-CD47

185 215

40 40 * * IgG1-Iso Anti-CD47 60 60 ** 35 * 35

** * 50 50 30 30 ** * 25 25 40 40

20 20

30 30

Phagocytic Index Phagocytic 15 15

Phagocytic Index Phagocytic 20 20 10 10

10 10 5 5

Author Manuscript Published OnlineFirst on February 23, 2015; DOI: 10.1158/1078-0432.CCR-14-1399 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. 0 0 0 0 215 354 215 354 CD47+CD133- CD47+CD133+ CD47+CD133- CD47+CD133+ Adherent Spheres * p<0.05; ** p<0.01 * p<0.05

C Human Macrophages E F

250K 250K 31.2% 6.1% 200K 200K

150K 150K

A A

- - C

C 31.2 S

S 6.05

S S 100K 100K

30 50K 50K IgG1-Iso Anti-CD47

* 0 0 0 102 103 104 105 0 102 103 104 105 PE-A: CD133 APC-A: CD133 ** CD133 20 IgG1-Iso Anti-CD47 IgG1-Iso Anti-CD47 ** 200 120 * 10

Phagocytic Index Phagocytic 100 150 0 Unpolarized M1 M2 CSC media 80 * * Mouse Macrophages * D 60 100 * IgG1-Iso Anti-CD47 40 ** 40 ** spheres Number of 50 30 20 ** Fold Change of CD133expression of Change Fold 20 ** 0 0 354 215 354 215 10 Phagocytic Index Phagocytic * p<0.05 * p<0.05 ** p<0.01 ** p<0.01

0 * p<0.05 Unpolarized M1 M2 ** p<0.01

Downloaded from clincancerres.aacrjournals.org on September 25, 2021. © 2015 American Association for Cancer Research. Figure 4 – Anti-CD47 treatment directly induces apoptosis of pancreatic cancer stem cells

HPDE HFF PSC Early Apoptosis Late Apoptosis 1.5 1.5 3.7% 0.98% 1.1% Iso Iso

1 1 3.2% 5.4% 1.5%

Annexin V DAPI DAPI 2.69% 1.65% 1.74% 0.5 0.5 Anti-CD47 Anti-CD47 Fold change in AnnV+DAPI- AnnV+DAPI- expression in change Fold Fold change in AnnV+DAPI+ AnnV+DAPI+ expression in change Fold 3.9% 6.7% 2.2% 0 0 Iso Anti-CD47 Iso Anti-CD47

A6L 185 354 Early Apoptosis Late Apoptosis 4.5 4.5 9% 7.6% 11.6% *

3 3 * 4.6% 19% 15%

Annexin V DAPI DAPI 13.6% 19.6% 28.5%

1.5 1.5 Anti-CD47 Anti-CD47 Fold change in AnnV+DAPI- AnnV+DAPI- expression in change Fold 31% 45% 35% AnnV+DAPI+ expression in change Fold 0 0 Iso Anti-CD47 Iso Anti-CD47 * p<0.05

Downloaded from clincancerres.aacrjournals.org on September 25, 2021. © 2015 American Association for Cancer Research. Figure 5 – Anti-CD47 treatment inhibits in vivo tumorigenicity and tumor progression B C A IgG1-Iso Anti-CD47 IgG1-Iso Anti-CD47 IgG1-Iso Anti-CD47 in 354 Anti-CD47 in 215 120 2.0 120

100 100

1.5

80 ) 80 gr

60 1.0 60 * *

40 * ( weight Tumor * 40 0.5

20 20 Surface expression (% IgG1-Iso)(% of expression Surface Tumorigenicity (tumor take rate in %) in %) rate take(tumor Tumorigenicity

0 * p<0.05 0.0 * p<0.05 0 354 215 354 215 EPCAMEpCAM CD133 SSEA1 D Experimental setup:

Day 0 14 28 35 56 70 100

Abraxane Gemcitabine Implantation Anti-CD47 Assessment of CSC content of xenografts Control * p<0.01 vs. single treatment 1000 ** p<0.01 vs. control

Anti-CD47 )

3 Anti-CD47

600 Gemcitabine Gemcitabine Abraxane + Anti-CD47 * Gemcitabine 400 + Anti-CD47 **

Tumor volume (mm volume Tumor * Abraxane ** 200 Abraxane + Anti-CD47 Abraxane + Anti-CD47

0 d0 d7 d14 d21 d28 d35 d42 d49 d56 d63 d70 d77 d84 d91 d100 Time (days) E F

60 250K Control GEM Anti-CD47 CD133 surface expression (%) * p<0.05 37.8% 200K

150K

A -

C 37.8 S 50 S Contro 100K HE l

50K

0 0 102 103 104 105 40 APC-A: CD133 250K 48.2%

200K CK19 *

150K

A -

C 48.2 30 S S ABX 100K GEM+Anti-CD47 ABX ABX+Anti-CD47 * * 50K

0 2 3 4 5

20 0 10 10 10 10 APC-A: CD133 250K CD133 expression (%) (%) CD133expression

HE 20.0%

200K

150K

A -

10 C 20 ABX

S S 100K +Anti-CD47

50K CK19 0 0 2 3 4 5 Control Gemcitabine CD47 Gemcitabine + Abraxane Abraxane + 0 10 10 10 10 Contro GEM Anti-CD47 GEM ABX ABX APC-A: CD133 CD47 CD47 CD133 Downloaded from clincancerres.aacrjournals.org on September 25, 2021. © 2015 American Association for Cancerl +Anti-CD47 +Anti-CD47 Research. Author Manuscript Published OnlineFirst on February 23, 2015; DOI: 10.1158/1078-0432.CCR-14-1399 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.

Inhibition of CD47 effectively targets pancreatic cancer stem cells via dual mechanism

Michele Cioffi, Sara Maria Trabulo, Manuel Hidalgo, et al.

Clin Cancer Res Published OnlineFirst February 23, 2015.

Updated version Access the most recent version of this article at: doi:10.1158/1078-0432.CCR-14-1399

Supplementary Access the most recent supplemental material at: Material http://clincancerres.aacrjournals.org/content/suppl/2015/02/25/1078-0432.CCR-14-1399.DC1

Author Author manuscripts have been peer reviewed and accepted for publication but have not yet been Manuscript edited.

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://clincancerres.aacrjournals.org/content/early/2015/02/21/1078-0432.CCR-14-1399. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.