protects the through the central circadian clock and CD39

Matheus Correa-Costaa, David Galloa, Eva Csizmadiaa, Edward Gompertsb, Judith-Lisa Lieberuma, Carl J. Hausera,c, Xingyue Jid,e, Binghe Wangd,e, Niels Olsen Saraiva Câmaraf, Simon C. Robsonc, and Leo E. Otterbeina,1

aTransplant Institute, Department of Surgery, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, MA 02215; bHillhurst Biopharmaeuticals Inc., Montrose, CA 91020; cTransplant Institute, Department of Medicine, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, MA 02215; dDepartment of Chemistry, Georgia State University, Atlanta, GA 30303; eCenter for Diagnostics and Therapeutics, Georgia State University, Atlanta, GA 30303; and fLaboratory of Transplantation Immunobiology, Department of Immunology, Institute of Biomedical Sciences, University of Sao Paulo, 05508-900, Sao Paulo, Brazil

Edited by Gregg L. Semenza, Johns Hopkins University School of Medicine, Baltimore, MD, and approved January 24, 2018 (received for review September 22, 2017) (IRI) is the predominant tissue insult tective phenotype that results. Biliverdin and CO are accepted as associated with organ transplantation. Treatment with carbon mon- the primary underlying bioactive molecules that provide potent oxide (CO) modulates the innate immune response associated with IRI protective benefits to the cell by modulating , inflam- and accelerates tissue recovery. The mechanism has been primarily mation, and proliferation (13–15). Administration of CO or bili- descriptive and ascribed to the ability of CO to influence inflamma- verdin can, in most cases, recapitulate that observed with HO-1 tion, cell death, and repair. In a model of bilateral kidney IRI in mice, itself. Treatment with CO at low concentrations imparts potent we elucidate an intricate relationship between CO and purinergic protection in numerous models of disease, including transplantation signaling involving increased CD39 ectonucleotidase expression, de- (16–18), colitis (19), sepsis (20), and lung injury (21). CO has been creased expression of Adora1, with concomitant increased expression well-studied and characterized to prevent IRI in small and large > of Adora2a/2b. This response is linked to a 20-fold increase in ex- animal models (22–24), which in turn resulted in the first clinical pression of the circadian rhythm protein Period 2 (Per2) and a fivefold trial where CO was administered to kidney transplant recipients increase in serum erythropoietin (EPO), both of which contribute −/− intraoperatively (https://clinicaltrials.gov/). to abrogation of kidney IRI. CO is ineffective against IRI in Cd39 Per2−/− Circadian rhythms are critical determinants of organ function and mice or in the presence of a neutralizing antibody to and susceptibility to injury dictated by a family of proteins col- EPO. Collectively, these data elucidate a cellular signaling mecha- lectively known as the “clock genes.” Disruption of one or more of nism whereby CO modulates purinergic responses and circadian these genes increases susceptibility to tissue injury (25). IRI leads rhythm to protect against injury. Moreover, these effects involve CD39- and adenosinergic-dependent stabilization of Per2. As CO to impairment of the circadian clock (26) and is independent of also increases serum EPO levels in human volunteers, these findings . Adenosine-elicited A2b-mediated Period 2 (Per2) stabi- continue to support therapeutic use of CO to treat IRI in association lization modulates adaptation to ischemic injury of the heart in with organ transplantation, stroke, and myocardial . mice (27). In fact, tolerance to ischemic injury has been shown to be dependent upon the time of day that the injury occurs (28). heme oxygenase | circadian rhythm | DAMPS | innate immunity | Adenosine from the breakdown of extracellular ATP by ′ adenosine CD39 and CD73 (ecto-5 -nucleotidase) is generated during tissue

schemia reperfusion injury (IRI) is obligatory and unavoidable Significance Iin patients who undergo an organ transplant. The sudden un- availability of oxygen and glucose initiate a cascade of events Tissue injury caused by lack of blood flow results in a series of including activation of tissue leukocytes and endothelium. Sim- adaptive responses of the body to ensure survival. Cellular ilarly, the reestablishment of blood flow to an ischemic organ production of carbon monoxide (CO) preserves organ function elicits a second set of events that include rapid reactive oxygen and promotes healing. How this occurs has remained elusive. species (ROS) generation, leukocyte infiltration, and additional Here we demonstrate using a model of ischemia reperfusion mechanical injury. The severity of the IRI and the relative health injury (IRI) of the kidney, mimicking kidney transplant, that of the organ is speculated to contribute to long-term graft sur- safe administration of CO protects against IRI. Remarkably, this vival (1–4). While a number of therapeutic approaches have occurs through specific modulation of a gene that regulates been tested, including a variety of preservation solutions, so- energy metabolism (CD39) and one that controls circadian phisticated organ transport apparatus, anti-inflammatory agents, rhythm (Period 2). Collectively, we define here an innovative live donors, and even ischemic preconditioning, there has been signaling pathway linking the brain and the kidney vis a vis a little change in IRI (5–7). What is perhaps even more important gas molecule. These data may have important therapeutic is that when a solution to IRI is identified, organs that are consequences for transplant recipients and victims of stroke. otherwise considered too risky to use could be rescued and as Author contributions: M.C.-C., D.G., C.J.H., B.W., S.C.R., and L.E.O. designed research; such impact the number of transplants that could be performed M.C.-C., D.G., E.C., J.-L.L., and X.J. performed research; E.C., E.G., X.J., and B.W. contrib- and decrease an otherwise continuously growing waiting list. uted new reagents/analytic tools; M.C.-C., J.-L.L., N.O.S.C., S.C.R., and L.E.O. analyzed data; Given the impossibility of transplanting an organ without some and M.C.-C., C.J.H., N.O.S.C., S.C.R., and L.E.O. wrote the paper. amount of ischemic time, a focus on interventions that may Conflict of interest statement: L.E.O. is a scientific consultant for Hillhurst Biopharmaceuticals protect the organ before harvest as well as promoting faster re- and has stock options. E.G. is a founder of Hillhurst Biopharmaceuticals and owns stock. covery and repair after reperfusion is warranted (8–12). This article is a PNAS Direct Submission. Heme oxygenase-1 (HO-1) is a member of a stress response Published under the PNAS license. gene family and is considered a protective gene. HO-1 catalyzes 1To whom correspondence should be addressed. Email: [email protected]. the breakdown of heme to bilirubin. In so doing, three products This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. are generated and include carbon monoxide (CO), biliverdin, 1073/pnas.1716747115/-/DCSupplemental. and iron. When HO-1 activity is increased, there is a potent pro- Published online February 20, 2018.

E2302–E2310 | PNAS | vol. 115 | no. 10 www.pnas.org/cgi/doi/10.1073/pnas.1716747115 Downloaded by guest on September 29, 2021 hypoxia as an adaptive response. In previous work, we have shown determined by the crystal violet staining method. Briefly, surviving cells in six- PNAS PLUS that CO enhances functional expression of adenosine receptors well plates were washed twice with PBS, and then crystal violet solution and stabilization of HIF1α in macrophages (29, 30). Employing a (Sigma-Aldrich) was added to the cells. After washing with water, plates were murine model of kidney IRI, we have now tested the hypothesis left to dry overnight. On the following day, a solution of 10% acetic acid was that CO protects against kidney IRI through CD39 and adenosine added to each well, and the number of surviving cells was determined by measuring absorbance at 562 nm. A2b-mediated receptor stabilization of Per2. Additionally, eryth- ropoietin (EPO), a critical effector protein regulated in a circadian ROS Measurement. Intracellular ROS generation was assessed using 2′,7′- manner, is required for CO-induced renal protection. Collectively, dichlorofluorescin diacetate (DCF-DA; 10 mM), and microscopy was per- our findings may be related in part to the response of the cellular formed. Cells on coverslips were perfused under controlled O2 and CO O2 sensors that drives expression and stabilization of genes that conditions in a flow-through chamber at 37 °C on an inverted fluorescent regulate cellular bioenergetics. microscope. Images were acquired with an Olympus camera (excitation, 488 nm; emission, 535 nm). Materials and Methods − − Animals. Isogenic male C57BL/6 mice (WT and Per2 / ) were purchased from Gene Expression. Total RNA was extracted from homogenized tissues using − − Charles River or Jackson Labs (at 25–30 g). CD39-knockout mice (Cd39 / )were RNeasy Mini Kit (Qiagen). For cDNA synthesis, 2 μg of total RNA was used and bred at the BIDMC as described previously (31). All animals had access to water transcribed with SuperScript II Reverse Transcriptase (Invitrogen) and ran- and food ad libitum. All animal care, housing and procedures were approved by dom primers (Invitrogen). The real-time PCR was performed in duplicate the Beth Israel Deaconess Medical Center (BIDMC) Institutional Animal Care and with the Cyber Green PCR Master Mix (BioRad) with the following primers: Use Committee (IACUC) and were in accordance with the Association for the Assessment and Accreditation of Laboratory Animal Care (AAALAC) guidelines. Beta-Actin: forward (F)-ACTGGCATTGTCATGGACTC, revers (R)- GCACAGCTTCTCCTTGATGT; CO Exposure. CO exposure as an inhaled gas was achieved by placing mice into TNF: F-CCTCCCTCTCATCAGTTCTATGG, R-TGTCCCTTGAAGAGACCTGG; a sealed Plexiglas chamber at 250 parts per million (ppm) with compressed air IL-10: F-CCAAGCCTTATCGGAAATGA, R-TTTTCACAGGGGAGAAAT; (32). Mice were exposed to CO for 1 h before surgery and then returned to room air. Controls received air only for the same time period. BW-101 as PER2: F-GGTGGACAGCCTTTCGATTA, R-AGGGCCTACCCTGACTTTGT; a CO prodrug (33) was prepared by solubilizing in solutol and used at a dose Adora1 (A1): F-AGAACCACCTCCACCCTTCT, R-TACTCTGGGTGGTGGTCACA; of 100 mg/kg, i.p. HBI-002 as a liquid CO formulation was orally dosed at 0.2 mg/kg. HBI-002 was provided by Hillhurst Biopharmaceuticals Inc. Adora2a (A2a): F-GAAGCAGATGGAGAGCCAAC, R-GAGAGGATGATGGCCAGGTA; Adora2b (A2b): F-TGCATGCCATCAACTGTATC, R-TGGAAACTGTAGCGGAAGTC. Pharmacologic Agents. ZM241385 (A2a receptor antagonist) and MRS1754 (A2b receptor antagonist) were obtained from Tocris Bioscience and given in The cycling conditions were as following: 95 °C for 15 s, 56 °C for 40 s. a dose of 5 mg/kg i.p. 30 min before CO treatment and 6 h after reperfusion. Recombinant erythropoietin (rEPO) was obtained from eBioscience, and TNF, cGMP, and EPO Measurement. Protein levels of cAMP, TNF, and EPO were animals were treated in a dose of 5,000 IU/kg i.p. EPO blocking antibody determined by ELISA (Enzo and R&D) according to the manufacturer’sin- (R&D) was reconstituted with 1 mL of sterile PBS, and each mouse received structions. cAMP content was normalized to protein concentration and μ μ 80 L(40 g per animal, i.p.) immediately before CO and 6 h after reper- expressed as picomole of cAMP/milligram of total protein. fusion. IgG nonspecific antibody (R&D) was used as the control. ATP Measurements. ATP levels were determined using a fluorimetric reaction Experimental Model of Renal IRI. Surgery was performed as previously de- assay (Biovision) according to the manufacturer’s instructions. scribed (34). Briefly, mice were anesthetized with Ketamine-Xylazine, a midline incision was made, and both renal pedicles were cross-clamped for Western Blotting. Kidney samples were sonicated in tissue lysis buffer (5 M 45 min. During the procedure, animals were kept well hydrated with saline NaCl, 5 mM EDTA, 1% Triton, 10 mM Tris•Cl, pH 7.4) and clarified by cen- and at a constant temperature (∼37 °C) through a heating pad device. trifugation for 10 min at 17,709 × g. The supernatants were aliquoted and Subsequently, microsurgery clamps were removed, the abdomen closed, and stored at −80 °C. Protein concentration was measured using the bicincho- animals placed in single cages, warmed by indirect light until completely ninic acid (BCA) method following the manufacturer’s protocol, as described recovered from anesthesia. Animals were kept under adjustable conditions until sacrifice—namely, 2, 6 and 24 h after renal reperfusion. For the in Pierce BCA protein assay kit (Pierce). Thirty micrograms of protein extract nephrectomy experiment, mice were anesthetized, and bilateral nephrec- were added on SDS/PAGE, transferred to nitrocellulose, and detected using α tomy was performed after renal pedicle occlusion. In this set of experiments, SuperSignal (Thermo). HIF-1 antibody was purchased from Novus (CO). animals were killed 6 h after CO treatment. Histologic Analysis. During animal sacrifice, one of the kidneys was removed, Analysis of Renal Function. Serum and (BUN) and after sectioning and removing the renal capsule, it was cut sagittally in were used for evaluation of renal function. Blood samples were collected at two approximately symmetrical fragments. The material was fixed in 10% the indicated time points from the heart, immediately before induced death. buffered formalin until paraffin blocks were assembled. After processing, at Serum samples were analyzed on an IDEXX Catalyst DX analyzer (IDEXX least one cut of each fragment was studied in hematoxylin and eosin (H&E) Laboratories). staining. Immunohistochemical staining for infiltrating cells was performed on 5-μm sections using the HRP method with primary antibodies specific for In Vitro Hypoxia-Reoxygenation Model. LLCPK-1 cells were grown to sub- macrophages (F4/80) or /granulocytes (GR1; BD Bioscience). An- tigenic recovery was initially performed with 10 mM citrate buffer, pH 6.0. confluency, serum-starved overnight, and exposed to hypoxia (0.1% O2/5% CO2, balance N) for 16 h followed by reoxygenation (21% O2/5% CO2/bal- Then blocking solution (horse serum, 7%) was added to for 30 min. Primary ance N2 and/or 21% O2/5% CO/250 ppm CO/balance N2) for 8 h. A group of validated antibodies were then added (dilution 1:100 of F4/80 and 1:400 of cells received 250 ppm CO for 4 h before hypoxia. Control cells were exposed GR1), and the slides were incubated overnight. The slides were then washed, to either normoxia or 250 ppm CO for the same duration. and a solution of H2O2 was added for 10 min, followed by further washing. Secondary antibody (with 1 h incubation) was then added, followed by Cell Death. LLCPK-1 were subjected to a regimen of 16-h anoxia and 8-h application of the avidin/biotin complex. After these steps, hematoxylin reoxygenation (±250 ppm CO) to determine cell death. At each time point, counterstaining was performed. For analysis, the slides were observed in a both adherent and suspended cells were harvested and labeled with pro- blinded fashion under light microscopy, and 25 randomly selected fields per pidium iodide as a marker of cell death and to determine cell cycle and DNA slide were evaluated and enumerated for positively stained cells (100– content by FACS. 200 cells counted per field) and compared to naïve control kidney staining and secondary antibody controls. This area of interest covered nearly the Cytotoxicity Assay. Crystal violet staining was used to assess the number of entire outer medullary regions of each section and thus is highly represen-

surviving cells under either normoxic or hypoxic conditions, with or without tative of the extent of positive-stained cells. We used this method of CO pretreatment. At the end of treatment, the number of surviving cells was quantitative analyses previously (32). IMMUNOLOGY AND

Correa-Costa et al. PNAS | vol. 115 | no. 10 | E2303 Downloaded by guest on September 29, 2021 Hypoxia Staining. Hypoxia levels were evaluated in kidney tissue and cells. inine and BUN, which correlated with less inflammatory cell Animals and cells were treated with hypoxyprobe (Hypoxyprobe Inc.) at infiltrate and preservation of kidney architecture (Fig. 1 A–C). 60 mg/kg and 400 mM, respectively, 1 h before harvesting. For tissue sections, IRI-induced monocyte and infiltration measured by slides were stained following the protocol described above. The detection of staining with F4/80 and GR1, respectively, was markedly reduced hypoxia in the cells was done by immunofluorescence. Briefly, the cells were D–F grown on slides and washed 2× with PBS, and a 2% paraformaldehyde so- in mice treated with CO (Fig. 1 ). Inflammatory cytokines lution was added. Thereafter, a further wash was performed, and a 0.5% are elevated as a hallmark of IRI. We observed a significant in- triton solution was added. After further washing, blocking solution (7% crease in the proinflammatory mediator TNF in air-treated horse serum) was added for 30 min, followed by addition of the primary controls, which was significantly abrogated in the presence of antibody (diluted 1:100 in PBS) with overnight incubation. The sections were CO (Fig. 2A, P < 0.05). As has been shown in other models then incubated for 1 h in secondary antibody and labeled with the TexasRed (35–37), CO exposure simultaneously increased expression of fluorophore (Abcam). The nuclear dye (Hoechst-Life Technologies) was then the anti-inflammatory cytokine IL-10 (Fig. 2B). These results added, and the slides were analyzed on a fluorescence microscope (Zeiss). suggest that protection afforded by CO is in part attributable to modulation of the inflammatory response. Whether these data Statistical Analyses. Results are expressed at means ± SD. Statistical analyses were performed using the Student’s t test and ANOVA. P values less than suggest an overall mechanism by which CO protects against IRI 0.05 were considered significant. or if they simply reflect the health of the kidney is unclear. Testing treatment with CO beginning either 1 h or 4 h after Results reperfusion did not offer significant benefit. This is not con- CO Attenuates Renal Dysfunction Caused by IRI. Others and we have cerning since pretreating the donor or recipient are feasible demonstrated in rat and pig models that inhaled CO given before options. Vera et al. (38) showed similar protective effects ischemia and reperfusion is protective. Therefore, our first ex- against IRI-induced kidney injury with a CO releasing molecule periment was to validate the model. Pretreatment with CO (in- (CORM-3). Taken together, these data show that exposure to haled, orally, or via a CO prodrug) before IRI surgery prevented CO gas modulated cytokine expression to favor a protective kidney injury as determined by decreased levels in serum creat- phenotype with decreased infiltration of granulocytes and

Fig. 1. CO prevents kidney IRI in mice. (A and B) Mice were treated with inhaled CO (iCO), oral CO (HBI-002), or a CO-prodrug (BW-101) 1 h before a 45-min bilateral kidney ischemia. Serum creatinine (A)andBUN(B) were measured 24 h after reperfusion. Results represent mean ± SD of 5–10 mice per group. *P < 0.001 vs. iCO, P < 0.05 vs. HBI-002, and P < 0.01 vs. BW-101. (C) Representative H&E-stained sections from control kidney and from mice subjected to IRI treated with Air or iCO as above. Images are representative of 10 sections from five mice. Arrows indicate leukocyte infiltration. (D–F) Quantitation of F4/80- and GR1- positive staining for macrophage and neutrophils, respectively. Results represent mean ± SD of 6–8 sections from five mice in each group. **P < 0.05 vs. CO.

E2304 | www.pnas.org/cgi/doi/10.1073/pnas.1716747115 Correa-Costa et al. Downloaded by guest on September 29, 2021 cells showed that exposure to CO reduced (H/R)-induced ele- PNAS PLUS vations in ROS generation and completely prevented cell death (Fig. 3 A–C). As observed in the kidney, CO also reduced ele- vations in TNF, MCP-1, and IL-1β expression (Fig. S1). Previous studies in the liver and lung showed that exposure to CO can paradoxically reduce tissue hypoxia, likely involving the ability of CO to displace cellular O2 stores (39–41). We therefore tested the effects of CO on kidney epithelial cells exposed to H/R and in vivo in a kidney subjected to ischemia/reperfusion Fig. 2. CO modulates cytokine expression in the kidney after IRI. (A and B) (I/R). CO effectively reduced cell and tissue hypoxia measured Tissue expression of TNF and IL-10 mRNA in the kidney in naïve mice or kidneys D E from mice 24 h after IRI treated with either Air or CO. CO blocked TNF and with the O2-sensitive hypoxyprobe (Fig. 3 and ). The lack of simultaneously enhanced IL-10 expression. Results represent mean ± SD of hypoxia observed in H/R and I/R corresponded to the reduction 5 per group. *P < 0.05 vs. CO; **P < 0.01 vs. control and IRI + Air. in ROS shown in Fig. 3A. Further, we measured ATP in H/R samples and observed a significant decrease in ATP (0.9 ± 0.14 nmol) by H/R versus normoxic controls (1.25 ± 0.10 nmol, macrophages and maintenance of renal function otherwise lost P < 0.01; Fig. 3F). CO restored ATP levels to 1.12 ± 0.04 nmol, in air-treated controls. which could be explained by enhancing oxidative phosphoryla- tion given the results of the hypoxyprobe experiments. CO may CO Prevents Hypoxia/Reoxygenation (H/R)-Induced Cellular Stress. act to reduce oxygen consumption, thereby making more available; Exposure of cells to a period of hypoxia followed by transfer to generate more ATP via regulation of cytochrome oxidase activity; a normoxia atmosphere results in a very similar cellular response or influence O2 availability by displacement from intracellular to that observed with IRI cytokine expression, ROS generation stores. Work is ongoing toward delineating the biochemical and cell death. Parallel experiments in vitro in kidney epithelial effects low concentrations of CO impart on overall cellular

Fig. 3. Effects of CO on promoting kidney epithelial cell bioenergetics and viability in response to H/R conditions. (A) Exposure to CO (250 ppm) prevented H/R- induced elevations in DCF fluorescence, as a marker for reactive oxygen species production. Images are representative of at least three independent experiments in triplicate. (B and C) LLCPK-1 kidney epithelial cell viability measured by crystal violet (B) or propidium iodine incorporation (C) was determined in response to H/R in the presence and absence of CO (250 ppm). Results represent mean ± SD of 4–6 samples in triplicate. *P < 0.02 vs. normoxia or H/R + CO. (D and E)CO

reduced tissue hypoxia measured with the O2-sensitive hypoxyprobe. Cells and animals were treated with hypoxyprobe at 400 mM and 60 mg/kg 1 h before

harvesting, and cells and tissue sections from H/R and IRI, respectively, were stained as described in Materials and Methods.(F) ATP levels in LLCPK-1 cells shows CO INFLAMMATION reversing an H/R-induced decrease in ATP at 24 h of H/R. Results represent mean ± SD of three independent experiments in triplicate. *P < 0.05, **P < 0.02. IMMUNOLOGY AND

Correa-Costa et al. PNAS | vol. 115 | no. 10 | E2305 Downloaded by guest on September 29, 2021 controls (P < 0.05). However, unlike the protection observed by −/− CO in WT mice, CO was completely ineffective in Cd39 mice in reducing IRI-induced elevations in serum creatinine, BUN, and TNF levels (Fig. 5 A–C). Pharmacologic inhibition of A2 receptors using Zm241385 plus MRS1754 mirrored the results observed in −/− the Cd39 mice. The protection afforded by CO to prevent IRI, as measured by serum creatinine, BUN, and TNF, was lost in these mice with decreased adenosine generation with Cd39 de- letion or A2b/A2a inhibition (Fig. 5 D–F).

CO Regulates Per2 via CD39 and A2 Receptor Signaling. Adenosine binding to the A2b receptor has been shown to increase ex- pression of the circadian rhythm molecule Per2, which directs a protective response to cardiac ischemia (27). It is also known that CO can regulate circadian rhythm gene expression, specif- ically NPAS2 (45), which regulates the period genes (46). Given the above, we next tested if CO modulated Per2 expression via A2 receptor signaling. Data presented in Fig. 6A show that

Fig. 4. Effects of IRI and CO on CD39 and A2 receptor expression. (A–D) Expression levels of CD39, A1, A2a, and A2b were measured by PCR over time after reperfusion. Animals treated with CO increased expression of CD39 and the A2 receptors but inhibited IRI-induced increases in A1 receptor expression. Results represent mean ± SD of 4–6 mice per group at each time point. *P < 0.02 vs. Air.

function and metabolism. Control animals treated with CO or air in the absence of H/R or I/R showed no increase in hypoxyprobe positivity, ROS generation, or cell death. These data suggest that CO acts in part to reduce the severity of cellular and tissue hypoxia that ultimately contributes in part to attenuation of kidney damage that occurs at the time of reoxygenation.

CO Increases CD39 and Modulates Adenosine Receptor Expression in the Kidney. We previously described the effects of CO on aden- osine receptor expression in endotoxin-stimulated macrophages yet had no in vivo correlate (29). Adenosine levels are increased in response to tissue hypoxia and are important in renal cytoprotection (42, 43). The abrogation of cellular and tissue hypoxia by CO de- scribed above directed us to next look at the effects of CO on tissue levels of the 5′ectonucleotidase CD39 and the adenosine receptors A1 and A2 in the kidney subjected to IRI. CD39 is known to be up-regulated in response to changes in tissue O2 levels dictated by oxygen sensors (44). Following reperfusion, we observed a 20- fold up-regulation of CD39 by 2 h that returned to baseline by 6 h. Animals treated with CO showed enhanced expression of CD39 50 ± 3% over IRI alone at 2 h, which remained nearly eightfold higher at 6 h before returning to baseline at 24 h (Fig. 4A). The increase in CD39 expression correlated with a threefold down-regulation in the expression of A1 in the kidney following reperfusion at 2, 6, and 24 h and conversely a twofold up- regulation of A2a and A2b receptor expression at these same time points (Fig. 4 B–D). Kidneys harvested from control naïve mice exposed to CO showed up-regulation of A2b, no change in A2a, and a down-regulation of A1 expression over kidneys from naïve air controls (Fig. S2). Collectively, these data suggest that Fig. 5. CD39 activity and A2 receptor signaling are required for CO to prevent exposure to CO by modulating adenosine receptor expression kidney IRI in mice. (A–C) CO blocks IRI-induced elevations in creatinine and −/− levels influences susceptibility to injury by differentially altering BUN and tissue levels of TNF, but these effects are lost in Cd39 mice. Results ± – sensitivity to adenosine. represent mean SD of 4 6 mice per group. Moreover, animals lacking CD39 and subjected to IRI showed enhanced severity of injury compared with − − WT mice with IRI regardless of CO. (D–F)SimilartoCd39 / mice, WT mice CO Requires CD39 to Prevent Kidney IRI. Up-regulation of treated with selective inhibitors of A2a and A2b receptors, Zm241385 and CD39 and the A2b receptor by both IRI and CO suggested an MRS1754, respectively, were also nonresponsive to the protection afforded by important role in the injury response. We next tested the ability of −/− CO against IRI. Serum creatinine, BUN, and tissue TNF levels were similar to CO to prevent IRI in Cd39 mice. The IRI injury in the absence that observed in Cd39−/− mice. Results represent mean ± SD of 4–6miceper of CD39 was modest yet significantly elevated over wild-type group. *P < 0.05 vs. control and CO-WT; **P < 0.001 vs. other groups.

E2306 | www.pnas.org/cgi/doi/10.1073/pnas.1716747115 Correa-Costa et al. Downloaded by guest on September 29, 2021 increased levels of cAMP and HIF1α levels in the kidney after PNAS PLUS IRI (Fig. 7). The elevation in cAMP, HIF1α, and Per2 is im- portant in protection against IRI (27). Eckle and coworkers demonstrated that A2b-dependent Per2 stabilization promotes HIF-dependent gene regulation; Per2 is also known to stabilize HIF-1α expression, as does CO (27, 30, 39). The protective role of HIF-1α in renal ischemia has been described previously and thought to be important for a faster recovery of the injured tissue (39, 46). Indeed, Hill and coworkers (48, 49) showed that re- + − nal IRI in HIF-1α / animals showed significant worsening of renal dysfunction, while pharmacologically increasing the half- life of HIF-1α led to improved renal function and reduced inflammation.

EPO Mediates CO-Induced Protection Against IRI. Stabilization of HIF-1α results in translocation to the nucleus to promote tran- scription of a number of target genes including endothelin and EPO. The remarkable effects of CO on HIF1α described above and in previous reports and the fact that increased carbox- yhemoglobin leads to elevations in EPO led us to next test the Fig. 6. Expression of the circadian rhythm gene Per2 is required for CO to hypothesis that EPO was the penultimate target gene involved in protect the kidney against IRI and is dependent on A2 receptor activation. the protective effects observed with CO against IRI. Exposure of ± (A) Expression levels of Per2 over time in the kidney in response to IRI CO. naïve mice to CO led to increased serum EPO levels within 2 h CO markedly increases Per2 in conjunction with IRI versus no change ob- A served in IRI+Air-treated mice. *P < 0.05 vs. Air. (B) Blockade of A2 receptors (Fig. 8 ). The increased serum EPO partially originated from prevents the CO-induced increase in Per2 expression. *P < 0.05 vs. Air. (C)CO the kidney as CO-exposed binephrectomized animals also is unable to prevent IRI-induced elevations in serum BUN in Per2−/− mice. exhibited significant elevations in serum EPO, which we posit is *P < 0.05 vs. other groups. (D) Since Per2 cycles throughout the day and liver-derived (Fig. 8B). Assessment of EPO pharmacodynamics peaks at ZT9, we tested susceptibility to kidney IRI compared with ZT3 when showed that administration of recombinant mouse EPO was Per2 expression is low (Fig. S3). Mice that underwent IRI at ZT9 showed less similar with or without CO exposure (Fig. S4). The CO-induced severe IRI measured by elevations in BUN versus those subjected to IRI at ZT3. ± – < < increase in serum EPO was also observed in animals subjected to Results represent mean SD of 4 6 mice per group. *P 0.05, **P 0.001. IRI compared with air-treated mice subjected to IRI (Fig. 8A). −/− Interestingly, CO-treated Per2 mice showed an up-regulation C animals subjected to kidney IRI and exposed to CO have a sig- of serum EPO, compared with nontreated littermates (Fig. 8 ), nificant increase in Per2 expression at 6 and 24 h versus no suggesting that CO could increase EPO through an indirect Per2 change in air-exposed IRI alone-treated mice. This expression manner, or perhaps lies downstream of EPO signaling. required A2 receptor activity, as inhibition with Zm241385 plus Neutralization of EPO with an anti-mouse EPO antibody MRS1754 completely abrogated Per2 expression in CO-treated completely abrogated the effects of CO to protect against kidney A–C micesubjectedtokidneyIRI(Fig.6B). The increase in A2 IRI versus IgG control (Fig. 9 ). CO-induced increases in receptor expression by CO has been demonstrated in macro- cAMP levels remained unchanged in the antibody-treated ani- – α phages where A2 receptors were increased on the cell mem- mals, suggesting that the upstream A2 HIF1 /Per2 signaling was brane. This resulted in potent activation of intracellular signal transduction that resulted in a more tolerogenic profile and lower production of TNF (22, 29). The increased expression of Per2 led us to test whether absence −/− of Per2 would abrogate the reno-protective effects of CO. Per2 mice subjected to the standard 45-min IRI did not survive the insult, and CO was unable to provide protection. We therefore reduced the IRI to 30 min, which was not sufficient to induce −/− injury in WT mice but resulted in significant injury in the Per2 mice with elevations in serum BUN without mortality. The in- −/− creased BUN in the Per2 was unaffected by CO treatment (Fig. 6C). Characterization of the Per2 circadian expression profile showed that Per2 expression in naïve mice peaked in the kidney in the late afternoon (Zeitgeber 9, ZT9; Fig. S3). All studies de- scribed above were performed in the morning (ZT3) when Per2 expression was lowest. To further validate a role for Per2 in IRI, we subjected a cohort of WT mice to IRI (45 min) at ZT9 and observed significantly less IRI versus IRI performed at ZT3 (Fig. 6D). Collectively, we identify Per2 as a cytoprotective gene im- portant in protecting against kidney IRI. Such modulation, known as “immunochronotherapy,” aids in tissue recovery and elimina- tion of potentially harmful intracellular molecules (47). Adenosine A2 receptors are coupled to stimulatory G protein, Fig. 7. A2 receptor signaling is activated in CO-treated mice and associated with increased expression of HIF-1α.(A) Mice subjected to kidney IRI ± CO and their activation leads to increased levels of cAMP and reg- were killed at different times after reperfusion, and cAMP levels were ulation of Per2. With the increase in A2 receptor expression and measured by ELISA. *P < 0.01 vs. Air. (B) Kidney lysates were evaluated at

elevated levels of CD39 and ATP by CO, we next looked at A2- different time points after reoxygenation for HIF-1α expression as indicated. INFLAMMATION linked cAMP activation. Exposure to CO resulted in significantly Results represent mean ± SD of 4–6 mice per group. IMMUNOLOGY AND

Correa-Costa et al. PNAS | vol. 115 | no. 10 | E2307 Downloaded by guest on September 29, 2021 EPO found expression to be regulated and completely de- pendent on purinergic signaling initiated by stabilization of ATP production and increased expression of CD39, an ecto- nucleoside triphosphate diphosphohydrolase/ectonucleotidase. The resulting generation of adenosine correlated with a marked increase in CD39 and CD73. Downstream of the A2 receptor, we find increased cAMP and Per2 expression and stabilization of HIF1α and likely other O2 sensors that in large part would regulate EPO expression. Curiously, both extracellular ATP (eATP) and hypoxia, in the setting of inflammation might trigger aryl hydrocarbon receptor (AHR) inactivation by HIF1α.Ina reciprocal manner, the presence of CD39, which might be in- duced by AHR, would deplete eATP and suppress HIF1α- mediated activity by generating adenosine in tandem with CD73. Several studies have tried to unravel the cytoprotective role of EPO in models of renal injury. The kidneys are particularly sen- sitive to high glucose levels, and EPO administration prevented recurrent dysfunction during transient hyperglycemia. While un- Fig. 8. CO exposure increases serum EPO levels. (A) Serum EPO levels were able to prevent tubular , treatment with EPO was able to evaluated in naive, Air-, and CO-treated mice ± IRI. Blood samples were attenuate apoptosis and glomerular dysfunction (50). Perhaps the collected at different times after reoxygenation. *P < 0.05 vs. Air; **P < best described mechanism supporting the beneficial properties of 0.001 vs. Air. (B) EPO levels were measured in naive and bilateral nephrec- − − EPO is its potent anti-inflammatory effects. In a model of acute tomized mice. *P < 0.05. (C) EPO levels were measured in per2 / mice. *P < 0.05 vs. baseline. Results represent mean ± SD of 4–6 mice per group. kidney injury (AKI) in response to sepsis, treatment with EPO resulted in lower renal expression of TLR4, NF-κB, CD68, and a battery of proinflammatory molecules compared with the vehicle still operational (Fig. 9D). Finally, we tested the effects of CD39 controls. In contrast, levels of EPOR were elevated after treat- on the signaling cascade that resulted in EPO up-regulation. ment (51–53). Hu and colleagues have shown that treatment with CD39-null mice exposed to CO showed no increase in Per2 EPO before ischemic injury promoted an improvement in renal and EPO expression (Fig. 9 E and F). Collectively we delineate a function with a reduction in tubular necrosis, which correlated to signaling cascade for CO in the kidney that involves increases in decreased neutrophil infiltration, lower expression of proin- ATP and CD39 that ultimately leads to Per2-dependent up- flammatory chemokines, and decreased translocation of NF-κB regulation of EPO and protection against IRI. into the nucleus (54). As to Per and A2A versus A2B functionality, it has been shown that A2A and A2B interact to promote ex- Discussion pression of a chimeric receptor. A2B can only be expressed with Results obtained in this study demonstrate that CO protects the A2A and would thus explain the Per2 data (55). kidney against IRI, at least in part by increasing circulating levels There are several studies that have demonstrated that EPO of EPO. Further mechanistic investigation of the increase in regulates the expression of HO-1. In a model of experimental

Fig. 9. EPO is associated with a better outcome after CO treatment, and CD39 is an important mediator of the CO-induced protection in the IRI model. Mice were subjected to IRI ± CO in the presence or absence of anti-EPO blocking antibody or an IgG control antibody and were evaluated by Serum Creatinine (A), BUN (B), kidney TNF (C), and cAMP levels (D). *P < 0.05 vs. the other groups. (E and F) Per2 mRNA and serum EPO levels in WT and CD39 KO mice, subjected to IRI ± CO. *P < 0.02 vs. all of the other groups. Results represent mean ± SD of 5 mice per group.

E2308 | www.pnas.org/cgi/doi/10.1073/pnas.1716747115 Correa-Costa et al. Downloaded by guest on September 29, 2021 autoimmune encephalomyelitis (EAE), EPO administration led its transcriptional activity induced by CO (64). Liao et al. (65) PNAS PLUS to increased expression of HO-1 and modulation of adaptive showed that CD39 expression is also regulated by increased cy- immunity, leading to a suppression of the inflammatory response toplasmic levels of cAMP, which involves activation of the PKA/ (56). Another study showed that the increased expression of HO- CREB, PKA/PI3K/ATF2, and PKA/ERK/ATF2 pathways. Be- 1 by EPO occurs through the activation of PI3K pathways, cause we also observed an increase in cAMP levels in the kidneys MAPK, and Nrf2 (57). Finally, Burger et al. (58) showed that of our treated animals, we conclude that the regulation of CD39 EPO-induced up-regulation of HO-1 was responsible for the may occur in part via activation of this second messenger (65). reduction of apoptosis of cardiomyocytes after IRI because Both ATP and adenosine are important in protection against renal −/− blockade of HO-1 or administration of EPO to Hmox1 mice injury (66). It is also worth noting that renal tubular, vascular resulted in loss of EPO protection. Based on these data, we endothelial, as well as mesangial cells express ectonucleotidases propose a cycle or feed-forward loop amplification in the kidney on their surfaces with enzymatic properties that have high simi- where HO-1, likely via CO generation, leads to increased ex- larity to CD39. Finally, during an ischemic injury, the enzymatic pression of EPO as defined by the signaling described above. The capacity to convert ATP to ADP and then to AMP is reduced by EPO, in turn, imparts protection but requires the presence of up to 71% (67–69) Thus, these results support our findings that HO-1, perhaps as continuous protection. CO-induced up-regulation of CD39 on renal cells is a critical We have published previously that exposure of macrophages to event necessary in protecting the kidney from injury. CO resulted in increased expression of the A2a receptor and a Cell regeneration after an ischemic insult is favored by the significant increase in sensitivity to adenosine (29). Given the role presence of energy sources capable of accelerating such re- −/− of CD39 in the generation of adenosine, we tested Cd39 animals parative process. Thus, the availability of ATP is crucial for an to examine whether CO-mediated ectonucleotidase signaling was efficient recovery. In this light, CO exposure leads to an increase important in the protection afforded by CO and therein the effects in protein levels of PGC-1α and mitochondrial biogenesis (70– on EPO expression. Indeed, lack of CD39 resulted in worse renal 72), which has been observed by others and both of which are function after ischemia and reperfusion, with increased serum regulated by adenosine signaling (73, 74). The greater number of levels of creatinine and BUN and expression of TNF. CO was mitochondria in the animals exposed to CO could explain the −/− unable to rescue Cd39 animals, likely explained by a poor EPO continued presence of ATP that is otherwise lost in response to response. Finally, with decreased pericellular adenosine levels, we IR. Mitochondrial dysfunction is a mediator of a variety of cel- observed no increase in cAMP or Per2 compared with wild-type lular insults and a common element in the initiation of various littermates exposed to Air. HIF1α hasbeenshowntoaffectcir- diseases. The importance of mitochondrial biogenesis is reflec- cadian expression of Per2 in kidney cells, and inhibition in HIF1α ted in its ability to increase the activity of metabolic pathways decreased the amplitude of the circadian rhythm of the Per2 pro- such as fatty acid oxidation, in addition to increasing the anti- moter (59). Adamovich et al. (60) recently reported that oxygen, oxidant defense mechanisms, mitigating damage from aging, via HIF1α, is a resetting cue for circadian clocks and includes tissue hypoxia, excess glucose, or fatty acids, which contribute to regulation of transcript levels of Rev-erbα and Per2. The requisite the pathogenesis of acute and chronic renal injuries (70, 71). A competition that CO has for similar binding sites also bound by recently published study showed that the use of compounds that oxygen in numerous heme-containing proteins such as Rev-erbα,it may promote an increased capacity for mitochondrial biogenesis is plausible that CO targets similar signaling pathways directly or in the cell could be a promising therapeutic target in the future indirectly via HIF1α activity. Perhaps the most compelling and (72). Without the loss in ATP, cells can proliferate, as evidenced elegant data linking HIF1α and Per2 were reported by Eckle et al. by increased ERK expression, better viability, and normal cell (27), who showed that stabilization of Per2 is controlled by HIF1α cycle pattern, suggesting that the presence of CO favors tissue and that this effect limited ischemic damage of the heart. Further, , promoting faster recovery when necessary. they show that Per2 could be stabilized with exposure of the mouse Based on our findings, we conclude that CO promotes a to intense light. With regard to organ transplantation, perhaps the beneficial effect on ischemic renal injury by a mechanism de- recipient or the organ itself, during the preservation time and while pendent on purinergic signaling and Per2 expression. Treat- in transit, could be exposed to light to improve function in con- ment with CO generates an increased expression of CD39 and junction with optimal protective rhythms. Whether AKI has a cir- type 2 adenosine receptors, which once activated lead to a cadian rhythmicity is unclear, but studies in the heart and lung have cascade of events that stabilizes HIF-1α via Per2, allowing its clearly demonstrated that the dyssynchrony or reorganization of the transcriptional activity to be more sustainable. One of the central clock in the brain can impact susceptibility to cardiovascular target genes for HIF1α is EPO, which is important in protection disease and lung injury (61, 62). The association between AKI and of the kidney. Collectively, our work provides a critical mech- circadian rhythm has not been well studied and validated. How- anism by which CO is able to protect the kidney in a model of ever, it has been substantiated by literature evidence showing the IRI. Translation to organ transplant utilizing a pretreatment clear impact of the central and local circadian clocks on sodium regimen is certainly viable when considering treating the donor regulation and susceptibility to organ injury in individuals with low and/or recipients before harvest or implantation, as has been nocturnal blood pressures versus those with high nocturnal pres- demonstrated in large and small animal models (23, 24). In sures. Understanding how and when an organ might be most pigs, having COHb peaking at the time the renal vessels are sensitive to injury may offer innovative therapeutic opportunities. unclamped is very effective at reducing delayed graft function Methodologies for continuously measuring real-time kidney func- (23). Additional postoperative dosing with CO as well as tion in animals has been described and will be useful in models of treatment of the donor and graft itself during preservation may IRI and AKI. offer additional benefits. Given that clinical trials for CO are Due to its physicochemical characteristics, CO easily crosses the ongoing, these findings lend insight into the cellular and mo- plasma membrane and acts as a potent intracellular messenger. lecular mechanisms of action. We further conclude that the The genetic regulation of CD39 appears to be exerted by the protective effects of CO treatment also extend to cellular transcription factor Sp1, a member of a family referred to as Sp/ metabolic changes, which improve energy charge, functional XKLF, which also regulates VEGF and cystathionine-β-synthase capacity, and as such, favor tissue recovery. (44). Furthermore, ischemic injury leads to a reduction in ex- pression of Sp1 in the renal tissue (63). There is one report ACKNOWLEDGMENTS. The studies were supported by NIH Award R44

showing that treatment with CO leads to increased expression of DK111260-01 and Department of Defense Award W81XWH-16-0464 (to L.E.O.) INFLAMMATION Sp1 and overexpression of a mutant form of this factor abrogated and the Sao Paulo Research Foundation (FAPESP) Grant 2011/19581-8 (to M.C.-C.). IMMUNOLOGY AND

Correa-Costa et al. PNAS | vol. 115 | no. 10 | E2309 Downloaded by guest on September 29, 2021 1. Eltzschig HK, Eckle T (2011) Ischemia and reperfusion–From mechanism to translation. 39. Faleo G, et al. (2008) Carbon monoxide ameliorates renal cold ischemia-reperfusion Nat Med 17:1391–1401. injury with an upregulation of vascular endothelial growth factor by activation of 2. Chertow GM, Burdick E, Honour M, Bonventre JV, Bates DW (2005) Acute kidney hypoxia-inducible factor. Transplantation 85:1833–1840. injury, mortality, length of stay, and costs in hospitalized patients. J Am Soc Nephrol 40. Fujita T, et al. (2001) Paradoxical rescue from ischemic lung injury by inhaled carbon 16:3365–3370. monoxide driven by derepression of fibrinolysis. Nat Med 7:598–604. 3. Jang HR, Ko GJ, Wasowska BA, Rabb H (2009) The interaction between ischemia- 41. Zuckerbraun BS, et al. (2005) Carbon monoxide prevents multiple organ injury in a reperfusion and immune responses in the kidney. J Mol Med (Berl) 87:859–864. model of hemorrhagic shock and resuscitation. Shock 23:527–532. 4. Munshi R, Hsu C, Himmelfarb J (2011) Advances in understanding ischemic acute 42. Bauerle JD, Grenz A, Kim JH, Lee HT, Eltzschig HK (2011) Adenosine generation and – kidney injury. BMC Med 9:11. signaling during . J Am Soc Nephrol 22:14 20. 5. Bonventre JV, Weinberg JM (2003) Recent advances in the pathophysiology of is- 43. Vallon V, Mühlbauer B, Osswald H (2006) Adenosine and kidney function. Physiol Rev – chemic acute renal failure. J Am Soc Nephrol 14:2199–2210. 86:901 940. 6. Thurman JM (2007) Triggers of inflammation after renal ischemia/reperfusion. Clin 44. Eltzschig HK, et al. (2009) Central role of Sp1-regulated CD39 in hypoxia/ischemia – Immunol 123:7–13. protection. Blood 113:224 232. 7. Ysebaert DK, et al. (2000) Identification and kinetics of leukocytes after severe is- 45. Gilun P, et al. (2013) Carbon monoxide-mediated humoral pathway for the trans- – chaemia/reperfusion renal injury. Nephrol Dial Transplant 15:1562–1574. mission of light signal to the hypothalamus. J Physiol Pharmacol 64:761 772. 8. Hwang HS, et al. (2013) Pretreatment with paricalcitol attenuates inflammation in 46. Stow LR, Gumz ML (2011) The circadian clock in the kidney. J Am Soc Nephrol 22: 598–604. ischemia-reperfusion injury via the up-regulation of cyclooxygenase-2 and prosta- 47. Scheiermann C, Kunisaki Y, Frenette PS (2013) Circadian control of the immune sys- glandin E2. Nephrol Dial Transplant 28:1156–1166. tem. Nat Rev Immunol 13:190–198. 9. Kinsey GR, et al. (2012) Autocrine adenosine signaling promotes regulatory T cell- 48. Bonventre JV, Yang L (2011) Cellular pathophysiology of ischemic acute kidney injury. mediated renal protection. J Am Soc Nephrol 23:1528–1537. J Clin Invest 121:4210–4221. 10. Ko GJ, et al. (2011) Blocking Fas ligand on leukocytes attenuates kidney ischemia- 49. Hill P, et al. (2008) Inhibition of hypoxia inducible factor hydroxylases protects against reperfusion injury. J Am Soc Nephrol 22:732–742. renal ischemia-reperfusion injury. J Am Soc Nephrol 19:39–46. 11. Wang PH, et al. (2008) [corrected] B1 receptor antagonism is beneficial in 50. Hochhauser E, et al. (2008) Recombinant human erythropoietin attenuates hepatic injury renal ischemia-reperfusion injury. PLoS One 3:e3050. induced by ischemia/reperfusion in an isolated mouse liver model. Apoptosis 13:77–86. 12. Yang SH, et al. (2011) Sulfatide-reactive natural killer T cells abrogate ischemia- 51. Caetano AM, et al. (2011) Erythropoietin attenuates apoptosis after ischemia- reperfusion injury. J Am Soc Nephrol 22:1305–1314. reperfusion-induced renal injury in transiently hyperglycemic Wister rats. 13. Wegiel B, Nemeth Z, Correa-Costa M, Bulmer AC, Otterbein LE (2014) Heme Transplant Proc 43:3618–3621. – oxygenase-1: A metabolic nike. Antioxid Redox Signal 20:1709 1722. 52. Souza AC, et al. (2012) Erythropoietin prevents sepsis-related acute kidney injury in – 14. Jarmi T, Agarwal A (2009) Heme oxygenase and renal disease. Curr Hypertens Rep 11:56 62. rats by inhibiting NF-κB and upregulating endothelial synthase. Am J 15. Wagener FA, et al. (1999) Differential effects of heme oxygenase isoforms on heme Physiol Renal Physiol 302:F1045–F1054. mediation of endothelial intracellular adhesion molecule 1 expression. J Pharmacol 53. Rodrigues CE, et al. (2012) Effects of continuous erythropoietin receptor activator in – Exp Ther 291:416 423. sepsis-induced acute kidney injury and multi-organ dysfunction. PLoS One 7:e29893. 16. Amano MT, Camara NO (2013) The immunomodulatory role of carbon monoxide 54. Hu L, et al. (2012) Erythropoietin ameliorates renal ischemia and reperfusion injury during transplantation. Med Gas Res 3:1–15. via inhibiting tubulointerstitial inflammation. J Surg Res 176:260–266. 17. Ozaki KS, et al. (2012) Carbon monoxide inhibits apoptosis during cold storage and 55. Moriyama K, Sitkovsky MV (2010) Adenosine A2A receptor is involved in cell surface protects kidney grafts donated after cardiac death. Transplant Int 25:107–117. expression of A2B receptor. J Biol Chem 285:39271–39288. 18. Wang H, et al. (2012) Activation of peroxisome proliferator-activated receptor γ 56. Chen SJ, et al. (2010) Erythropoietin enhances endogenous haem oxygenase-1 and prolongs islet allograft survival. Cell Transplant 21:2111–2118. represses immune responses to ameliorate experimental autoimmune encephalo- 19. Onyiah JC, et al. (2013) Carbon monoxide and heme oxygenase-1 prevent intestinal myelitis. Clin Exp Immunol 162:210–223. inflammation in mice by promoting bacterial clearance. Gastroenterology 144:789–798. 57. Genc K, Egrilmez MY, Genc S (2010) Erythropoietin induces nuclear translocation of 20. MacGarvey NC, et al. (2012) Activation of mitochondrial biogenesis by heme Nrf2 and heme oxygenase-1 expression in SH-SY5Y cells. Cell Biochem Funct 28:197–201. oxygenase-1-mediated NF-E2-related factor-2 induction rescues mice from lethal 58. Burger D, Xiang F, Hammoud L, Lu X, Feng Q (2009) Role of heme oxygenase-1 in the Staphylococcus aureus sepsis. Am J Respir Crit Care Med 185:851–861. cardioprotective effects of erythropoietin during myocardial ischemia and re- 21. Zuckerbraun BS, et al. (2006) Carbon monoxide reverses established pulmonary hy- perfusion. Am J Physiol Heart Circ Physiol 296:H84–H93. pertension. J Exp Med 203:2109–2119. 59. Okabe T, et al. (2014) The impact of HIF1α on the Per2 circadian rhythm in renal 22. Hou J, et al. (2013) 5-Aminolevulinic acid combined with ferrous iron induces carbon cancer cell lines. PLoS One 9:e109693. monoxide generation in mouse kidneys and protects from renal ischemia-reperfusion 60. Adamovich Y, Ladeuix B, Golik M, Koeners MP, Asher G (2017) Rhythmic oxygen levels injury. Am J Physiol Renal Physiol 305:F1149–F1157. reset circadian clocks through HIF1α. Cell Metab 25:93–101. 23. Hanto DW, et al. (2010) Intraoperative administration of inhaled carbon monoxide 61. Haspel JA, et al. (2014) Circadian rhythm reprogramming during lung inflammation. reduces delayed graft function in kidney allografts in Swine. Am J Transplant 10: Nat Commun 5:4753. 2421–2430. 62. Khaper N, et al. (2017) Implications of disturbances in circadian rhythms for cardio- 24. Caumartin Y, et al. (2011) Carbon monoxide-releasing molecules protect against vascular health: A new frontier in free radical biology. Free Radic Biol Med, S0891- ischemia-reperfusion injury during . Kidney Int 79:1080–1089. 5849(17)31199-1. 25. Curtis AM, Bellet MM, Sassone-Corsi P, O’Neill LA (2014) Circadian clock proteins and 63. Wu N, Siow YL, O K (2010) Ischemia/reperfusion reduces transcription factor Sp1- immunity. Immunity 40:178–186. mediated cystathionine beta-synthase expression in the kidney. J Biol Chem 285: – 26. Kung TA, et al. (2007) Rapid attenuation of circadian clock gene oscillations in the rat 18225 18233. 64. Lin HH, Lai SC, Chau LY (2011) Heme oxygenase-1/carbon monoxide induces vascular heart following ischemia-reperfusion. J Mol Cell Cardiol 43:744–753. 27. Eckle T, et al. (2012) Adora2b-elicited Per2 stabilization promotes a HIF-dependent endothelial growth factor expression via p38 kinase-dependent activation of Sp1. J Biol Chem 286:3829–3838. metabolic switch crucial for myocardial adaptation to ischemia. Nat Med 18:774–782. 65. Liao H, Hyman MC, Baek AE, Fukase K, Pinsky DJ (2010) cAMP/CREB-mediated tran- 28. Durgan DJ, et al. (2010) Short communication: Ischemia/reperfusion tolerance is time-of- scriptional regulation of ectonucleoside triphosphate diphosphohydrolase 1 (CD39) day-dependent: Mediation by the cardiomyocyte circadian clock. Circ Res 106:546–550. expression. J Biol Chem 285:14791–14805. 29. Haschemi A, et al. (2007) Cross-regulation of carbon monoxide and the adenosine 66. Szoleczky P, et al. (2012) Identification of agents that reduce renal hypoxia- A2a receptor in macrophages. J Immunol 178:5921–5929. reoxygenation injury using cell-based screening: Purine nucleosides are alternative 30. Chin BY, et al. (2007) Hypoxia-inducible factor 1alpha stabilization by carbon mon- energy sources in LLC-PK1 cells during hypoxia. Arch Biochem Biophys 517:53–70. oxide results in cytoprotective preconditioning. Proc Natl Acad Sci USA 104: 67. Ribeiro MC, et al. (2012) Characterization of ecto-ATPase activity in the surface of LLC- 5109–5114. PK1 cells and its modulation by ischemic conditions. Biochim Biophys Acta 1820:2030–2036. 31. Beldi G, et al. (2008) Regulated catalysis of extracellular nucleotides by vascular CD39/ 68. Candinas D, et al. (1996) Loss of rat glomerular ATP diphosphohydrolase activity – ENTPD1 is required for liver regeneration. Gastroenterology 135:1751 1760. during reperfusion injury is associated with reactions. Thromb 32. Otterbein LE, et al. (2003) Carbon monoxide suppresses arteriosclerotic lesions asso- Haemost 76:807–812. – ciated with chronic graft rejection and with balloon injury. Nat Med 9:183 190. 69. Kishore BK, et al. (2005) Expression of NTPDase1 and NTPDase2 in murine kidney: 33. Ji X, et al. (2016) Toward carbon monoxide-based therapeutics: Critical drug delivery Relevance to regulation of P2 receptor signaling. Am J Physiol Renal Physiol 288: – and developability issues. J Pharm Sci 105:406 416. F1032–F1043. 34. Correa-Costa M, et al. (2012) Transcriptome analysis of renal ischemia/reperfusion injury 70. Lancel S, et al. (2009) Carbon monoxide rescues mice from lethal sepsis by supporting and its modulation by ischemic pre-conditioning or hemin treatment. PLoS One 7:e49569. mitochondrial energetic metabolism and activating mitochondrial biogenesis. 35. Kawanishi S, et al. (2013) Inhalation of carbon monoxide following resuscitation J Pharmacol Exp Ther 329:641–648. ameliorates hemorrhagic shock-induced lung injury. Mol Med Rep 7:3–10. 71. Tran M, et al. (2011) PGC-1α promotes recovery after acute kidney injury during 36. Piantadosi CA, et al. (2011) Heme oxygenase-1 couples activation of mitochondrial systemic inflammation in mice. J Clin Invest 121:4003–4014. biogenesis to anti-inflammatory cytokine expression. J Biol Chem 286:16374–16385. 72. Piantadosi CA, Suliman HB (2012) Redox regulation of mitochondrial biogenesis. Free 37. Pulido JN, et al. (2011) Inhaled carbon monoxide attenuates myocardial inflammatory cyto- Radic Biol Med 53:2043–2053. kine expression in a rat model of cardiopulmonary bypass. J Extra Corpor Technol 43:137–143. 73. Wills LP, et al. (2012) The β2-adrenoceptor agonist formoterol stimulates mitochon- 38. Vera T, Henegar JR, Drummond HA, Rimoldi JM, Stec DE (2005) Protective effect of drial biogenesis. J Pharmacol Exp Ther 342:106–118. carbon monoxide-releasing compounds in ischemia-induced acute renal failure. JAm 74. Motterlini R, Otterbein LE (2010) The therapeutic potential of carbon monoxide. Nat Soc Nephrol 16:950–958. Rev Drug Discov 9:728–743.

E2310 | www.pnas.org/cgi/doi/10.1073/pnas.1716747115 Correa-Costa et al. Downloaded by guest on September 29, 2021