Akawi et al. Orphanet Journal of Rare Diseases (2016) 11:139 DOI 10.1186/s13023-016-0526-8 RESEARCH Open Access A homozygous splicing mutation in ELAC2 suggests phenotypic variability including intellectual disability with minimal cardiac involvement Nadia A. Akawi1,4, Salma Ben-Salem1, Jozef Hertecant1,2, Anne John1, Thachillath Pramathan3, Praseetha Kizhakkedath1, Bassam R. Ali1† and Lihadh Al-Gazali3*† Abstract Background: The group of ELAC2-related encephalomyopathies is a recent addition to the rapidly growing heterogeneous mitochondrial disorders. Results: We describe a highly inbred consanguineous Pakistani family with multiple affected children in 2 branches exhibiting moderately severe global developmental delay. Using homozygosity mapping, we mapped the phenotype in this family to a single locus on chromosome 17. In addition, whole-exome sequencing identified a homozygous splicing mutation (c.1423 + 2 T > A) in ELAC2 gene that disrupted the canonical donor splice site of intron 15 of all known isoforms. A noticeable reduction in ELAC2 expression was observed in patients compared to controls. In addition, patients exhibited significantly increased levels of 5′ end unprocessed mt-RNAs compared to the control fibroblast cells. Conclusions: The only three previously reported families with defects in ELAC2 gene exhibited infantile hypertrophic cardiomyopathy and complex I deficiency. In contrast, our patients exhibited intellectual disability as the main feature with minimal cardiac involvement. Therefore our findings expand the phenotypic spectrum of ELAC2- associated disorders illustrating clinical heterogeneity of mutations in this gene. In addition, ELAC2 mutations should be considered when evaluating patient with mainly intellectual disability phenotypes. Keywords: ELAC2, Mitochondrial disorder, 5′ end unprocessed mt-RNAs, Splice site mutation, Intellectual disability, Respiratory chain complex I (RCCI) deficiency Background they are almost always involving the muscle and the Mitochondria are the key suppliers of cellular-energy brain, where energy is highly required [1]. Other clinical through five protein complexes known as respiratory manifestations such as blindness, deafness, and move- chain complexes (RCCI, RCCII, RCCIII, RCCIV, RCCV). ment disabilities may also be present in the spectrum of These complexes catalyze the oxidation of nutrients and the mitochondrial group of disorders. Mitochondrial the associated energy transduction into ATP via a path- encephalomyopathies are mainly caused by mutations way known as oxidative phosphorylation. Mitochondrial that directly affect the maternally inherited mitochon- disorders refer to a group of extremely heterogeneous drial DNA (mt-DNA). In addition, a considerable num- multisystemic clinical presentations. These disorders are ber of the mitochondrial encephalomyopathies were also known as mitochondrial encephalomyopathies since found to be associated with mutations in nuclear genes and hence segregating in autosomal recessive or domin- * Correspondence: [email protected] ant patterns [1, 2]. The pathogenic mutations in nuclear †Equal contributors 3Department of Paediatrics, College of Medicine and Health Sciences, United genes mostly encode enzymes implicated in the replica- Arab Emirates University, P.O. Box 17666, Al-Ain, United Arab Emirates tion, transcription or translation of the mt-DNA and Full list of author information is available at the end of the article © The Author(s). 2016 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Akawi et al. Orphanet Journal of Rare Diseases (2016) 11:139 Page 2 of 9 therefore, affecting the biogenesis and maintenance of DNA were loaded into the software package Homozygosi- the mitochondria [1, 2]. tyMapper (http://www.homozygositymapper.org) and sub- Recently, whole-exome sequencing has been used to un- jected to homozygosity mapping analysis [5]. ravel the genetic defect underlying a multisystemic mito- chondorial disorder in three unrelated families [3]. The phenotype of these patients included infantile hypertrophic High-throughput sequencing of nuclear and cardiomyopathy, developmental delay, lactic acidosis and mitochondrial DNA RCCI deficiency (MIM 252010). The authors identified Whole-exome sequencing of the extracted nuclear different compound heterozygous and homozygous patho- DNA was performed by Oxford Gene Technology genic mutations in ELAC2 gene (MIM 605367) as the (Oxfordshire, UK). Nuclear DNA was extracted from underlying causes in these families. ELAC2 is a nuclear- the blood of patients V2 and V10 using Flexigene gene located on the short arm of chromosome 17 encoding DNA extraction kit (Qiagen, USA). Exome capturing Zinc phosphodiesterase ELAC protein 2 (tRNaseZ 2). The and enrichment was carried out using SureSelect All encoded protein has a mitochondrial tRNA 3′-processing Exon V4 kit (Agilent Technologies, USA) following endonuclease activity. It plays a key role in mitochondrial the manufacturers’ protocols. Whole-exome sequen- tRNA maturation by removing a 3′-trailer from precursor cing was carried out on Illumina HiSeq 2000 system tRNA, a crucial step in tRNA processing [4]. (Illumina). All the variants were mapped, annotated In this paper, we report a large highly inbred Pakistani and filtered as described previously [5]. Sequencing of family of Baluchi origin with five individuals in two themt-DNAwascarriedoutasaservicebyNijmegen branches affected by intellectual disability and develop- Centre for Mitochondrial Disorders (NCMD, the mental delay. We mapped the disease-causing gene in Netherlands). The complete mt-DNA was isolated this family to a segment on chromosome 17 and identi- from DNA extracted from the skin fibroblasts of pa- fied a homozygous splicing mutation in ELAC2 gene. Al- tient V10. The mt-DNA (Genbank accession# though previous mutations in this gene were found to NC_012920.1, 16569 bp) was screened for rearrange- cause hypertrophic cardiomyopathy and complex I defi- ments and mismatches using the Ion torrent personal ciency, affected individuals in this report had minimum genome machine (Life Technologies, USA). cardiac involvement with intellectual disability and de- velopmental delay being the main presenting features. Therefore, the clinical and molecular data described in Transcript analysis this manuscript expand the phenotypes associated with Total RNA was isolated from fresh blood with QIAamp ELAC2 mutations and highlight the clinical heterogen- RNA blood kit (Qiagen, USA). Single-stranded cDNA was eity of ELAC2-related mitochondrial disorders. synthesized from the same starting materials of RNA (1 μg) using the GoScript reverse transcription system in accord- Methods ance with the manufacturer’s instructions (Promega, USA). Research subjects To avoid genomic amplification, reverse transcription Multiple affected children in two branches of a consan- nested-PCR was carried out with primers spanning the guineous family exhibiting severe developmental delay exon–exon junctions of NM_018127.6. The primers for the with very mild hypertrophy of the interventricular septum first round PCR F: 5′ TGTGAGAATGCCACCTTTCA 3′ have been evaluated (Fig. 1). The study was approved by and R: 3′ GCACCAGACAGGTCTGAAACT 5′ generating Al-Ain District Human Research Ethics Committees product of 967 bp in size. The primer for the second round (protocol number 10/09) and the family provided a writ- nested-PCR NF: 5′ CACCAGTTTCCGCTGTAAGA 3′ ten informed consent for participating in the study. and NR: 3′ CAAGGCGCGTTCTCTCTG 5′ generating product of 499 bp in size. The nested-PCR products were Genome-wide SNP genotyping and homozygosity separated on 2 % agarose gels. mapping Genomic DNA was isolated from peripheral blood col- lected in EDTA tubes from all the family members using Sanger DNA sequencing the Flexigene DNA extraction kit (Qiagen, USA). Genotyp- Direct DNA sequencing was carried out using the BigDye ing of their whole genome was undertaken using GeneChip Terminator kit v3.1 (Applied Biosystems, USA). PCR Genome-Wide Human SNP Array 6.0 (Affymetrix, USA). amplification products were sequenced using the DNA se- SNP genotypes were obtained by following the standard quencing with fluorescent automated sequencing on the protocols supplied by the manufacturer. Genotypes were ABI 3130xl genetic analyzer (Applied Biosystems, USA). called with the Genotype Console program (Affymetrix, Sequencing data were analyzed using ClustalW2 referen- USA). Generated SNPs derived from the family members’ cing the NM_018127.6 for ELAC2 gene Refseq sequence. Akawi et al. Orphanet Journal of Rare Diseases (2016) 11:139 Page 3 of 9 Fig. 1 Pedigree of the family and key clinical features of patient V10 in this study. a) The main characteristics of autosomal recessive inheritance including consanguinity and multiple affected children of both sexes can be seen in this pedigree. Circles and squares denote females and males respectively, filled symbols represent affected members, double