UNIVERSITY OF CINCINNATI

Date:______

I, ______, hereby submit this work as part of the requirements for the degree of: in:

It is entitled:

This work and its defense approved by:

Chair: ______

Functional Genomics of Xenobiotic Detoxifying Fungal Cytochrome P450 system

A dissertation submitted to the

Division of Research and Advanced Studies of the University of Cincinnati

In partial fulfillment of the requirements for the degree of

DOCTORATE OF PHILOSOPHY (Ph.D.)

In the Department of Environmental Health of the College of Medicine

March 2008

by

Venkataramanan Subramanian

M.S., University of Southern Mississippi, 2002 M.Sc., University of Mumbai, India, 1997 B.Sc., University of Mumbai, India, 1995

Committee Chair: Jagjit. S. Yadav, Ph.D. Associate Professor Department of Environmental Health University of Cincinnati Abstract

The white rot fungus Phanerochaete chrysosporium is primarily known for its ability to degrade a wide range of xenobiotic compounds including the highly recalcitrant polycyclic aromatic hydrocarbons. The natural substrate of this basidiomycete fungus is however, lignin, the most abundant aromatic polymer on earth. The versatililty of this fungus in breaking down a wide array of compounds arises from the presence of a highly nonspecific enzyme system (peroxidase enzyme system) in its repertoire. Most of the research involving degradation of toxic chemicals has focused on this biodegrading enzyme machinery. Cytochrome P450 monooxygenases

(P450s) on the other hand, are heme-thiolate proteins that are known to be involved in metabolism of endogenous compounds as well as xenobiotic compounds in higher eukaryotes.

Nearly 150 P450s are present in this organism, which is the highest number known till date among fungal species. Based on the sequence similarity criteria and our phylogenetic analysis, these P450s have been classified under 12 families and 23 sub-families. Despite indirect evidences suggesting the role of P450s in oxidation of xenobiotics, there have been hardly any reports on characterization and role of individual P450s either in regulation of physiological processes or in direct metabolism of xenobiotics in this organism. Here we characterized and investigated the role of P450 enzymes in two different mechanisms in this fungus. One, indirect involvement of P450s in peroxidase–mediated oxidation of xenobiotics, and two, direct involvement of P450s in metabolism of xenobiotics. In order to achieve the first objective, we investigated the role of PC-bph gene, the only member of the P450 CYP53 in synthesis of a secondary metabolite, veratryl alcohol, which regulates the activity of the peroxidase enzyme system of this fungus. In order to achieve the second objective, we used the functional genomic approach based on a custom-designed microarray and heterologous expression of the

iii components of the P450 enzyme system (P450 and its associated electron transfer proteins) in this white rot fungus.

iv

v Acknowledgements

First and foremost I offer my sincerest gratitude to my graduate advisor, Dr. Jagjit Yadav for his supervision, advice and guidance since day one of my research in his laboratory. He has always been a great motivating factor providing me with unflinching encouragement and support for all these years. Being in his laboratory has provided me with the extraordinary scientific exposure that has inspired me and enriched my growth as a student, researcher and a scientist want to be.

My heartfelt thanks to each of my committee members, Drs. David Askew, Brian Kinkle, Jodi Shann, and Howard Shertzer for their constructive suggestions and criticisms that has resulted in the generation of this thesis. They have always been available for me whenever I needed them for any technical advice. I gratefully acknowledge Dr. David Warshawsky for initially being part of my thesis committee.

Many thanks to Dr. Askew for providing me with the necessary resources to work on the Aspergillus niger transformation in his laboratory. I also thank Mike Miley for imparting me a hands-on training in Dr. Askew’s laboratory.

Collective and individual acknowledgements are also owed to my lab colleagues for their constant support and encouragement extended to me for all these years. My special thanks to Harshavardhan Doddapaneni for being a great friend and colleague in the laboratory, for involving me in many of his projects, and for always being available with his valuable scientific advice. Many thanks to Izhar Khan, Suresh Babu Selvaraju, Renuka Kapoor, Manish Gupta, Hansraj Bangar, Huiyan Wang, Eunice Varughese, and Fannie Papatoli for creating such a pleasant atmosphere to work in the lab and for sharing both the good and bad times together during my tenure.

I convey special acknowledgements to Dr. George Smulian and Dr. Francisco Gomez for training me to use the Maldi-TOF instrument in their laboratory, as well as providing the Pichia and the Agrobacterium strains used in my thesis. I also thank Dr. Rajiv Soman for training me to use the Mass spectrometry instrument in his laboratory.

vi It is a pleasure to pay tribute to the faculty and staff of the first floor, who always kept their doors open for me and helped me with both scientific and personal issues in every possible way. I was constantly helped by all the faculty, staff, and students of this division in one way or the other. It is also my pleasure to mention the names of Scott Schneider and Saikumar Karyala for being such wonderful friends and for giving me a cherishable time and for accompanying me to the Indian restaurants. I will definitely miss their companionship.

On a personal front, I would like to thank my ‘Cinci gang’ - Ritesh, Prodipto, Anu, Anup, Rohit, Chris, Bikram, Renuka, Ramya, Subbu and many others, for their everlasting friendship, entertaining company, and thoughtful support especially during those days when I needed them the most.

What would I do without my family? My parents deserve special applause for their perpetual support and prayers. I offer my deepest gratitude to my father Late K.N. Subramanian and my mother Brahada Subramanian for their blessings and prolonged encouragement that has motivated me to achieve my goal as what I am today. Words fail me to express my appreciation to my brother S.L. Narayan who has been an indispensable moral support for me thereby strengthening my confidence especially after my father’s demise. Last but not the least, I owe a big “thank you” to my dear wife Mathangi whose love, patience and persistent confidence in me has taken the load off my shoulder towards the completion of my degree.

vii Table of Contents

List of tables……………………………………………………………………………………...11

List of figures.……………………………………………………………………………………12

Chapter I

Introduction to the white-rot fungus, Phanerochaete chrysosporium and its biodegradative enzyme systems

Introduction……………………………………………………………………………....16

Peroxidase enzyme system……….………………….…………………………………..22

Cytochrome P450 enzyme system.………………………………………………………23

Chapter II

Proposed direct and indirect involvement of P450s in detoxification of xenobiotics

Proposed role of P450s in peroxidase-mediated oxidation of xenobiotics (PAHs)..…….28

Proposed role of P450s in direct oxidation of xenobiotic compounds (PAHs)……...... 32

Hypothesis………………………………………………………………………………..38

Chapter III

Role of P450s in regulation of peroxidase-mediated degradation of xenobiotics via veratryl alcohol synthesis

Introduction………………………………………………………………………………39

Materials and Methods…………………………………………………………………...40

Results…………………………..………………………………………………………..54

Discussion………………………………………………………………………………..65

Chapter IV

Regulation and heterologous expression of p450 enzyme system components of the white rot fungus Phanerochaete chrysosporium

Abstract…………………………………………………………………………………..73

viii

Introduction………………………………………………………………………………75

Materials and Methods…………………………………………………………...... 76

Results and discussion…………………………………………………………...... 80

Conclusions………………………………………………………………………………90

References………………………………………………………………………………..92

Chapter V

P450 redox enzymes in the white rot fungus Phanerochaete chrysosporium: gene transcription, heterologous expression, and purification of the expressed proteins

Abstract…………………………………………………………………………………104

Introduction……………………………………………………………………………..105

Materials and Methods………………………………………………………………….107

Results…………………………………………………………………………………..114

Discussion………………………………………………………………………………118

References………………………………………………………………………………125

Chapter VI

Role of P450 monooxygenases in degradation of the endocrine disrupting chemical nonylphenol by the white rot fungus Phanerochaete chrysosporium: biochemical and functional genomic evidences

Summary………………………………………………………………………………..141

Introduction……………………………………………………………………………..142

Results…………………………………………………………………………………..144

Discussion………………………………………………………………………………148

Experimental Procedures……………………………………………………………….154

References………………………………………………………………………………159

ix Chapter VII

Heterologous expression and purification of white rot fungal cytochrome P450 monooxygenase PC-2, a PAH-inducible P450

Introduction……………………………………………………………………………..173

Materials and Methods………………………………………………………………….174

Results…………………………………………………………………………………..179

Discussion………………………………………………………………………………181

Chapter VIII

Conclusions……………………..………………………………………………………203

Chapter IX

Scope of the study………………………………………………………………………207

Future directions………………………………………………………………………..214

References for Chapters I, II, III, VII, VIII, and IX..…………………………………………..216

Appendix………………………………………………………………………………………..227

x List of Tables

Chapter I

Table 1 List of chemicals biodegraded by Phanerochaete chrysosporium………………18

Chapter II

Table 1 Fold induction of PC-bph and GPD genes in response to benzoate……………..28

Table 2 Microarray- and qRT-PCR- based transcriptional induction (fold induction) of P450 genes in response to polycyclic aromatic hydrocarbons……………...... 34

Chapter III

Table 1 Primers used in generation of knock-out and knock-down vectors………...... 42

Chapter IV

Table 1 Deduced protein sequence distances among the members of CYP63 family as determined using MegAlign 5.05……………………...... 100

Table 2 Effect of different physiological conditions and xenobiotic treatments on induction of the tandemly-linked P450 members of the CYP63 family………..101

Table 3 Purification of the recombinant white rot fungal POR heterologously expressed in E. coli, monitored in terms of specific activity, yield, and fold purification……………………………………………………………….……..102

Chapter V

Table 1 Primers used for isolation of cDNAs, real time RT-PCR analyses and cloning in the expression vector……………………………………………………….…...138

Table 2 The specific activity, yield, and fold purification of the recombinant fungal POR heterologously expressed in S. cerevisiae………………………………………139

Chapter VI

Table 1 List of primers used in this study……………………………………………….171

Table 2 Verification of the microarray-based induction patterns of selected genes by quantitative RT-PCR analysis……………………………………………….….172

xi List of Figures

Chapter I

Figure 1 Common reactions catalyzed by P450.…………………………………………..25

Chapter II

Figure 1 Veratryl alcohol synthesis pathway………………………………………...... 29

Figure 2 Changes in LiP activity in response to the addition of a P450 inhibitor (piperonyl butoxide) ………………………………………………………………………...30

Figure 3 Proposed scheme on the role of P450-bph in veratryl alcohol synthesis pathway…………………………………………………………………………..31

Figure 4 Effect of the P450 inhibitor piperonyl butoxide on the degradation of anthracene (panel A) and benzo(a)pyrene (panel B) by Phanerochaete chrysosporium……………………………………………………………………36

Figure 5 Effect of different P450 inhibitors on degradation of pyrene by Phanerochaete chrysosporium……………………………………………………………………37

Chapter III

Figure 1 Strategy for generating the plasmid vector pVBG containing the PC-bph knock- out cassette..……………………………………………………………………...43

Figure 2 Strategy for generating the plasmid vector pVH containing the hygromycin knock-out cassette………………………………………………………………..45

Figure 3 Formation of 19 -22 base siRNA from 300 bp hairpin structure……………...... 49

Figure 4 Double stranded DNA structure formed by complementary forward and reverse oligo nucleotides…………………………………………………...... 50

Figure 5 Effect of P450 inhibitor on levels of veratryl alcohol……………………………55

Figure 6 Phenotypic analysis of pCFNRc transformants………………………………….58

Figure 7 Phenotypic analysis of pCAMBIA 1201 transformants…………………………59

Figure 8 Phenotypic analysis of pC-Bph-a transformants…………………………………60

xii Figure 9 Effect of pCFNRc transformation on PC-bph transcription levels………………62

Figure 10 Effect of pCAMBIA 1201 transformation on PC-bph transcription levels…...... 63

Figure 11 Effect of pC-Bph-a transformation on PC-bph transcription levels……………..64

Chapter IV

Figure 1 Sequence alignment of the native sequence (pc-1) and the codon-optimized sequence (pc-1-syn) of CYP63A1 cDNA of P. chrysosporium…………………96

Figure 2 Heterologous expression of the white rot fungal P450 monooxygenases PC-1 and PC-3 in E. coli…………………………………...... 97

Figure 3 Heterologous expression of the white rot fungal P450 monooxygenase PC-1 in eukaryotic expression systems…………………………………………………...98

Figure 4 Heterologous expression of the white rot fungal P450 oxidoreductase (POR) in E. coli and its purification………………………………………………………..99

Chapter V

Figure 1 Time course of transcription of POR, cyt b5 and cyt b5r under different nutrient conditions in P. chrysosporium…………………………………………………132

Figure 2 Transcriptional and translational levels of the P. chrysosporium POR under different nutrient conditions…………………………………………………….133

Figure 3 Partial purification of heterologously expressed P. chrysosporium POR from the yeast S. cerevisiae...... 134

Figure 4 Amino acid sequence alignment and phylogenetic analysis of the cloned cyt b5 and cyt b5r proteins of P. chrysosporium against their homologs from other organisms…………………………………………………………………...... 135

Figure 5 Heterologous expression and purification of the fungal cyt b5 in E. coli………136

Figure 6 Heterologous expression and purification of the fungal cyt b5r in E. coli……..137

Chapter VI

Figure 1 Effect of P450 enzyme inhibitor on degradation of nonylphenol by P. chrysosporium under different nutrient conditions……………………………..166

xiii Figure 2 Induction of P450 genes in response to nonylphenol in P. chrysosporium cultures grown under ME and LN conditions, as determined by the custom-P450 microarray analysis……………………………………………………………..167

Figure 3 Comparative profiling of the P450 genes inducible by nonylphenol under different nutrient conditions……………………………………………………………...168

Figure 4 Regulation of the peroxidase genes in response to nonylphenol under Low N (LN) condition as revealed by microarray analysis…………………………………..169

Figure 5 Transcription factors and other signal transduction genes responsive to nonylphenol under different nutrient conditions as revealed by microarray analysis………………………………………………………………………….170

Chapter VII

Figure 1 Time course of induction of PC-2 expression in Pichia pastoris ..…………….189

Figure 2 Heterologous expression of PC-2 in Pichia pastoris…………………………...190

Figure 3 P450 spectrum of the expressed white rot P450 PC-2……………………….....191

Figure 4 Solubilization of Pichia microsomes extract expressing PC-2…………...... 192

Figure 5 Purification of the heterologously expressed white rot P450 PC-2 from the yeast P. pastoris ………………………………………………………….……...... 193

Figure 6 Electrophoretic analysis of the purified PC-2 protein ……………………….....194

Figure 7 Biotransformation of dodecene using whole cells of Pichia GS115 expressing PC-2………………………………………………………………...195

Figure 8 Biotransformation of phenyldodecane using whole cells of Pichia GS115 expressing PC-2…..…………………………………………………………….196

Figure 9 Biotransformation of β-estradiol using whole cells of Pichia GS115 expressing PC-2..…………………………………………………………………………...197

Figure 10 Biotransformation of linoleic acid using whole cells of Pichia GS115 expressing PC-2..…………………………………………………………………………...198

Figure 11 Biotransformation of DDT using whole cells of Pichia GS115 expressing PC-2…..………………………………………………………………………...199

Figure 12 Biotransformation of phenanthene using whole cells of Pichia GS115 expressing PC-2..…………………………………………………………………………...200

xiv

Figure 13 Biotransformation of pyrene using whole cells of Pichia GS115 expressing PC-2..…………………………………………………………………………...201

Figure 14 Biotransformation of BaP using whole cells of Pichia GS115 expressing PC-2..…………………………………………………………………………...202

xv Chapter I

Introduction to the white-rot fungus, Phanerochaete chrysosporium and its

biodegradative enzyme systems

Introduction

Over the last several decades, there has been an increase in environmental pollution due

to the release of diverse toxic industrial chemicals. Primarily, aromatic chemicals have gained

importance because of their highly recalcitrant nature (resistance to degradation). There is an

increasing concern over their longer persistence in nature, where in they enter the food-chain and

ultimately lead to human health effects. Common examples of such recalcitrant compounds in

the environment are polycyclic aromatic hydrocarbons, organochlorine pesticides,

polychlorinated biphenyls, chlorophenols, chloro-aliphatics, plastics, among others. Many of these toxic compounds are also proven carcinogens. A comprehensive list of these carcinogenic

compounds is summarized in Warshawsky and Landolph (2006).

Polycyclic aromatic hydrocarbons (PAHs) constitute an important group of recalcitrant

environmental toxicants that are generated from different industrial processes like petroleum

refineries, fossil fuel power plants, coal-tar production plants, coking plants, bitumen and asphalt

production plants, paper mills, wood products manufacturers, aluminum production plants and

industrial machinery manufacturers. They are also generated from natural processes like forest fires and active volcanoes, in addition to routine processes like home heating, cooking, indoor or outdoor grills, smoking tobacco products, automobile exhaust fumes etc. There are more than

100 known PAH compounds. PAHs in particular are poorly soluble in water. They end up sticking to particulate matter and settle down in the bottom of water bodies or remain attached to soil particles. The reason for their persistence in the environment is that they are either not

16 biodegraded by microorganisms or are only slowly degraded (Alexander 1981, Rothmel and

Chakrabarty 1990). In the recent past, microorganisms, plants, and fungi that can breakdown

such toxic chemical compounds have gained significant interest. Fungi have been shown to have

enormous biodegradative potential (Gadd 2001). Especially, white rot fungi are known to be one

such group of fungi that are capable of breaking down a plethora of toxic xenobiotic pollutants

including PAHs. Phanerochaete chrysosporium is the most extensively studied member of white

rot fungi and is considered as a model white-rot fungus. A list of compounds that are degraded

by this basidiomycete fungus is given in table 1. The most significant ones are the polycyclic aromatic hydrocarbons.

It is generally accepted that the immense biodegradative potential of white rot fungi is due to their inherent ability to depolymerize and metabolize plant cell wall polymers. The intriguing question is “how is the biodegradative capacity linked to breakdown of plant materials?” The answer lies in the fact that these wood rotting fungi are present ubiquitously in the forest litter,

where they have to breakdown the plant cell wall (comprising mainly lignin, hemicellulose, and

cellulose) in order to gain access to the cellulose component as a carbon source. Plant cell walls

are rich in lignin, which is a complex aromatic polymer, resistant to both chemical and biological

oxidation. Ability to breakdown lignin is therefore the key underlying factor for the ability of

these organisms to breakdown other compounds. Hence understanding the structure of lignin and

its mechanism of breakdown is therefore crucial for our understanding about the biodegradation of xenobiotic chemicals by white rot fungi in nature.

Lignin is the second most abundant natural polymer and the most abundant aromatic polymer on earth. Lignin confers mechanical resistance, strength and rigidity to wood. Many cellulolytic and ligninolytic fungi are known to make use of a range of hydrolytic enzymes to

17 Table 1: List of chemicals biodegraded by Phanerochaete chrysosporium

Chemicals Reference Poly aromatic chemicals 4,4'-dichlorobiphenyl Dietrich et al. (1995) 3,3',4,4'-tetrachlorobiphenyl Dietrich et al. (1995) 2,2',4,4',5,5'-hexachlorobiphenyl Dietrich et al. (1995) 2,7-dichlorodibenzo-p-dioxin Mori and Kondo (2002) Creosote Bogan and Lamar (1995) PCBs (Aroclors 1242, 1254, and 1260) Yadav et al. (1995) Phenanthrene Bumpus (1989) Fluorene, phenanthrene, anthracene, pyrene and benzo(a)anthracene Tekere et al. (2005) Herbicides / Pesticides / Insecticides DDT (1,1,1-trichloro-2,2-bis(4-chlorophenyl)ethane Bumpus and Aust (1987) beta-cyfluthrin Saikia and Gopal (2004) 2,4,6-trichlorophenol Reddy et al. (1998) Methoxychlor Grifoll and Hammel (1997) Chlorpyrifos, fonofos, and terbufos (Insecticide) Bumpus et al. (1993) 2,4-dichlorophenol Valli and Gold (1991)

Alkyl halide insecticides (aldrin, dieldrin, heptachlor, chlordane, Kennedy et al. (1990) lindane, and mirex) 4-nitro-2,4-diazabutanal (NDAB) Fournier et al. (2004b) 2,4-D (2,4-Dichlorophenoxyacetic acid) Yadav and Reddy (1993) 2,4,5-T (2,4,5-trichlorophenoxyacetic acid) Yadav and Reddy (1993) Pentachlorophenol (PCP) Mileski et al (1988) Atrazine (Herbicide) Mougin et al. (1994) Alachlor Ferrey et al. (1994) Munition wastes / Explosives TNT (2,4,6-trinitrotoluene) Fernando et al. (1990) octahydro-1,3,5,7-tetranitro-1,3,5,7-tetrazocine (HMX) Fournier et al. (2004) 2,4,6,8,10,12-hexanitro-2,4,6,8,10,12-hexaazaisowurtzitane (CL-20) Fournier et al. (2006) 2,4-dinitrotoluene Jackson et al. (1999) 2-Amino,4,6-dinitrotoluene Jackson et al. (1999) Nitroglycerin Servent et al. (1991)

18 Other chemicals Benzene, toluene, ethylbenzene, and xylenes (BTEX) Yadav and Reddy (1993) Mono and Dichloro benzenes Yadav et al. (1995) 3,4-dichloroaniline Sandermann et al. (1998) Trichloroethylene (TCE) Yadav et al. (2000) 4-chlorophenol Zouari et al. (2002) 4-chloroaniline Chang and Bumpus (1993) linear alkylbenzene sulfonate Yadav et al. (2001) 4-tert-octylphenol Tamagawa et al. (2007) Nonyl phenol Soares et al. (2005) 4-nitrophenol Teramoto et al. (2004) Irgarol 1051 (Anti-algal) Ogawa et al. (2004) Dibenzylsulfide Van Hamme et al. (2003) p-cresol and phenol Kennes and Lema (1994) Dyes Phthalocyanine textile dye remazol turquoise blue Conneely et al. (1999) Azo dyes - 4-phenylazophenol, 4-phenylazo-2-methoxyphenol, Disperse Yellow 3 [2-(4'-acetamidophenylazo)-4-methylphenol], 4- phenylazoaniline, N,N-dimethyl-4-phenylazoaniline, Spadaro et al. (1992) Disperse Orange 3 [4-(4'-nitrophenylazo)-aniline], Solvent Yellow 14 (1-phenylazo-2-naphthol) Azo and heterocyclic dyes (Orange II, Tropaeolin O, Congo Red, and Cripps et al. (1990) Azure B) Crystal violet Bumpus and Brock (1988) Polymeric Dyes (Poly B-411, Poly R-481, and Poly Y-606) Glenn and Gold (1983) Polymers Acrylic copolymers Mai et al. (2004) Phenolic resins Gusse et al. (2006) Styrene monomers Lee et al. (2006) lignopolystyrene graft copolymers Milstein et al. (1992) Polyethylene Lee et al. (1991) Organic wastes Vinasse Potentini et al. (2006) Bleach plant effluent Michel et al. (1991)

19 breakdown the wood polymers, cellulose and hemicellulose. However, these components occur as a complex with the lignin matrix, and are therefore inaccessible to the hydrolytic enzymes making them resistant to such biological degradation. Thus breakdown of lignin seems to be the rate-limiting step in this biodegradation process. Lignin breakdown has several important biotechnological applications. Ligninolysis is important for the efficient utilization of cellulose and hemicellulose as ruminant feed and as substrates for production of fuels and organic chemicals. The annual production of wood is estimated at 20.3 x 1012 kg (Pointing S.B. 2001). In addition, since depolymerization of cellulose significantly depends on breakdown of the lignin matrix, ligninolysis also plays an important role in the nature’s carbon cycle. Further, industrial processes like the production of high quality paper also requires the breakdown of lignin and its metabolites (Kirk et al. 1978).

Lignin is a phenylpropanoid polymer that is synthesized from three phenolic precursors namely coniferyl, sinapyl, and p-coumaryl alcohols (Davin and Lewis 2005, Fruendenberg 1968,

Sarkanen and Ludwig 1971). The phenolic hydroxyl groups of these precursors undergo peroxidase-mediated one-electron oxidation giving rise to phenoxy radicals. The radicals in turn undergo random coupling in order to give rise to a highly crosslinked, stereochemically complex three-dimensional structure. This complex polymer contains a variety of intermonomer linkages; few of them are listed here: β- O-4 linkage (major linkage constituting 40-60% of the total linkages), phenylcoumaran, biphenyl, diarylpropane, diphenyl ether, pinoresinol, α-aryl ether linkage (Boominathan and Reddy 1992). The uniqueness of lignin is that it has no precise polymeric structure and varies in lignins from different sources.

The most efficient degraders of lignin in nature are the basidiomycete fungi, collectively known as white-rot fungi. They are the only known group of organisms that are capable of

20 completely breaking down the wood cell wall component lignin to carbon dioxide and water

(Kirk and Farrell 1987), a process referred to as “mineralization”. The white-rot fungi fall under

the phylogenetic division Eumycota, subdivision Basidiomycotina, class Hymenomycetes,

subclass Holobasidiomycetidae (Hawksworth et al., 1995). The name white-rot originated from

the white appearance of degraded wood that results from exposing of the holocellulose complex

(white in color) after fungal removal of the brown component lignin. Lignin degradation does

not result in net energy gain for these fungi. Instead, ligninolysis occurs only during the

secondary phase of growth thereby giving access to the holocellulose, which is the source of

carbon and energy for these fungi (Jeffries 1990).

Ligninolysis by the white rot fungus, Phanerochaete chrysosporium, involves highly non-specific enzymatic activity. This non-specific enzyme machinery is capable of breaking down lignin as well as chemical structures that contain chemical bonds similar to those found in lignin. For example, oxidation of certain structurally-related toxic chemical compounds also occurs by the same enzymatic process that is responsible for lignin oxidation. It has been long

known that white-rot fungi contain a wide array of oxidative enzymes namely Lignin

peroxidases (LiP, E.C.1.11.1.14), Manganese peroxidases (MnP, E.C.1.11.1.13), and laccases

(Lac, E.C.1.10.3.2) (Orth and Tien 1995, Thurston 1994) that are involved in this “enzymatic

combustion” process.

Phanerochaete chrysosporium genome was sequenced in the year 2004, which revealed

that there are ten lignin peroxidase (lip) genes, and five manganese-dependent peroxidase (mnp)

genes that form the core of the well-studied peroxidase enzyme system found in this fungus

(Martinez et al. 2004). The major set of oxidative enzymes, not yet studied in this organism are

the cytochrome P450 monooxygenases. Based on the genome sequence, there are a minimum of

21 148 P450 sequences in this organism (Martinez et al. 2004). These two enzyme systems are

discussed in the following sections.

Peroxidase enzyme system

Peroxidases are the most intensively studied class of enzymes from this organism. This is

because of their potential in several applications such as biopulping and biobleaching,

bioconversion into chemicals and fuels, and bioremediation (Reviewed in Tien 1987, Reddy

1995, Pointing 2001). There are two major families of peroxidases – Lignin peroxidases (LiPs)

and Manganese-dependent peroxidases (MnPs). They are extracellular, glycosylated, heme

proteins that are produced during secondary phase of growth in response to nutrient starvation,

especially nitrogen, carbon, or sulfur. Both groups of these enzymes have been purified to

homogeneity, with LiPs showing pI range of 3.2 to 4.0 (Farrell et al. 1989) and MnPs showing pI

range of 4.2 to 4.9 (Glenn and Gold 1985). For their in vivo catalytic activity, LiPs and MnPs

require H2O2, which is produced by H2O2-generating enzymes like glucose oxidase (Eriksson, et

al. 1986, Kelley and Reddy 1986), glyoxal oxidases (Kersten and Kirk, 1987, Kersten and Cullen

1993), and methanol oxidases (Nishida and Erikkson 1987). Lignin peroxidases catalyze

oxidation of a variety of phenolic and nonphenolic substrates with an ionization potential value

of up to 9.0 eV (ten Have et al. 1998). The catalytic cycle of LiP begins with the native enzyme

being oxidized by one molecule of H2O2 (withdrawal of two electrons) to form compound I.

Compound I in turn undergoes two one-step reductions to the native form via an intermediate compound II. Reduction of compound II being slow can therefore interact with H2O2 leading to

22 the generation of an inactive compound III (reviewed in ten Have and Teunissen 2001, Arora et

al. 1992).

An endogenously generated secondary metabolite veratryl alcohol (VA) plays a major

role in LiP-mediated catalysis (ten Have and Teunissen 2001). VA is secreted during the early

phase of secondary metabolism and its production parallels with the onset of production of LiPs

in response to N-limitation. VA acts as a mediator in electron-transfer reactions (Tien and Ma

1997, Goodwin et al. 1995, Koduri and Tien 1995). It is also a substrate for compound II, and is

thus essential in completing the catalytic cycle of LiP (Koduri and Tien 1994). Addition of VA

to the growing P. chrysosporium cultures have resulted in an increase in LiP titers (Collins et al.

1997, Faison and Kirk 1985). This observation indicated role of VA in protecting LiP from H2O2

dependent reactions. Further, VA prevents the H2O2 dependent inactivation of LiP by reducing compound II back to its native form (Cancel et al. 1993, Tonon and Odier 1988, Valli et al.

1988).

Manganese peroxidases on the other hand require Mn(II) as the preferred substrate

(Wariishi et al. 1988, Wariishi et al. 1989, Wariishi et al. 1992). Mn(II) is oxidized to Mn(III), which diffuses from the enzyme surface and in turn oxidizes phenolic substrates. Further, Mn also acts as an inducer for MnPs (Brown et al. 1990, Brown et al. 1991). This observation has been further confirmed by the identification of the MnP-responsive element in the promoter of

MnP genes (Ma et al. 2004).

Cytochrome P450 enzyme system

Cytochrome P450 enzymes (henceforth P450s), also referred to as mixed function oxidases or

23 monooxygenases, belong to a superfamily of heme-thiolate proteins that can catalyze a variety of enzymatic reactions to convert chemicals to potentially reactive products as well as detoxify compounds, making them less toxic. The most commonly performed reaction by P450s is hydroxylation, although they can also perform a wide variety of other enzymatic reactions that include epoxidations, dealkylations, dehalogenations, reduction, desaturation, ester cleavage, ring expansion, ring formation, aldehyde scission, dehydration etc. P450 monooxygenases belong to a superfamily of enzymes. Recent explosion of whole genome sequences has led to an unexpected expansion of this enzyme superfamily. Till date, ~ 7700 member genes have been reported across different species (http://drnelson.utmem.edu/Genome.list.htm). In contrast to the higher eukaryotic animals, including humans, lower eukaryotic forms contain a significantly higher number of P450s in their genome; e.g. 60-109 in insects versus 57 P450s in humans.

However, plants possess an extraordinary P450 diversity (30-417 P450s). Rice genome has revealed the highest number (417 genes) of P450s (http://drnelson.utmem.edu/Genome.list.htm).

Fungi possess an extraordinary P450 diversity with > 100 P450 genes revealed in Magnaporthe and Aspergillus species. Prokaryotes, unlike eukaryotes have shown fewer P450 genes, with maximum number of P450s (20 genes) in Mycobacterium tuberculosis (McLean et al. 2006).

The relatively higher number in plants has been attributed to the fact that plants have developed this as a detoxification mechanism to combat the exposure to chemicals as compared to animals, which can physically escape from the site of toxic chemical exposure. Recent whole genome sequence of Phanerochaete chrysosporium, a versatile pollutant degrading white-rot fungus has revealed the presence of 148 P450 genes (Martinez et al. 2004), the largest P450 contingent known in fungal genomes till date (http://drnelson.utmem.edu/Genome.list.htm).

24 P450s, which stands for “Pigment 450s” obtain their name from the typical soret peak

that is observed when P450 enzymes in their Fe+2 form is bound to CO and displays an absorption maxima at 450 nm (Omura and Sato 1962). The two common reactions catalyzed by

P450s are as shown in Fig. 1:

P450 NADPH + H+ + O + R NADP+ + H O + RO 2 2

P450 - + R-H + O2 + 2e + 2 H R-OH + H2O

Figure 1: Common reactions catalyzed by P450 (Guengerich 2001, Urlacher et al. 2004)

There are four classes of P450s depending on how the electrons are transferred from NADPH to the catalytic site:

Class 1: Require both FAD-containing reductase and iron sulfur redoxin

Class 2: Require only FAD-FMN containing P450 reductase

Class 3: Do not require an electron donor protein

Class 4: Transfer electrons directly from NADPH

The P450 catalytic cycle begins with the substrate binding to the enzyme in Fe +3 (ferric) state and is followed by reduction of the heme iron. This step can be catalyzed by the cytochrome

P450 oxidoreductase (POR) enzyme that transfers the electron from NADPH. The Fe+2 iron then binds to oxygen molecule. A second electron then enters the system, which can be catalyzed

25 again by POR, or in some cases by cyt b5 (b5)-cyt b5 reductase chain (Hildebrandt and

Estabrook 1971, Noshiro et al. 1981), followed by addition of a proton and subsequent cleavage

of the O-O bond, ultimately generating H2O.

The most commonly found P450 enzymes in eukaryotes belong to class II. They require the presence of an electron transfer protein such as NADPH-P450 oxidoreductase enzyme. Both the P450 and the P450 oxidoreductase are associated with outer membrane of the endoplasmic reticulum via hydrophobic amino acids on the N-terminus. Class II P450 enzymes have diverse functions. In plants, they play critical roles in synthesis of lignin, UV protectants, pigments, defense compounds, oxygenation of fatty acids, hormones, and signaling molecules (Shet 2007,

Schuler and Werck-Reichhart 2003, Morant et al. 2003). In fungi, they are involved in the synthesis of sterols and mycotoxins, metabolism of lipids, detoxification of phytoalexins, and synthesis of ergot alkaloids (Schardl et al. 2006. van den Brink et al. 1998, Bhatnagar et al.

2003). Apart from their biosynthetic roles in living systems, the P450s play a significant role in oxidative biodegradation of toxic compounds. This study focuses on the latter role of P450s in white rot fungus. Current working hypothesis is that the P450 enzymes of this organism are involved in further oxidation of the peroxidase-depolymerized lignin derivatives in nature.

Lipophilic toxic compounds such as the polycyclic aromatic compounds (PAHs) are directly internalized by the fungus for oxidation by the P450 monooxygenases.

According to the existing P450 nomenclature, enzymes with >40% amino acid (aa) similarity fall under the same family, and those with >55% aa similarity fall under the same subfamily. However, the final determination to classify a P450 into an existing family/subfamily depends on how it clusters in the P450 phylogenetic tree and not on the absolute value of percentage identity (Nelson 2004). In order to further improve the P450 nomenclature, the

26 concept of a higher order grouping called “clan” has been introduced and is gaining acceptance

in the P450 community. Phylogenetic analysis based on 126 full-length or near full-length (>

300 aa) P450 genes coupled with standard sequence homology criterion allowed us to group the

P450s from P. chrysosporium into 12 families and 23 subfamilies (Doddapaneni et al. 2005,

Yadav et al. 2006)

Of the 148 P450 genes present in Phanerochaete chrysosporium, the first two genes (pc-1 and pc-2) that belonged to the CYP63 family of P450s were cloned full-length and characterized by our laboratory (Yadav et al. 2003). Subsequently, a third gene (pc-3/CYP63A3) was isolated and heterologously expressed (Doddapaneni et al. 2005). Subsequently, the P450 gene PcCYP1f was functionally characterized by Matsuzaki and Wariishi (2005). Based on in vitro analysis, the authors concluded that PcCYP1f was capable of hydroxylating benzoic acid. Although this organism contains such a large contingent of P450s, the role of individual P450s in regulation of biosynthetic pathways or in direct oxidation of xenobiotics has not been studied.

In this study, I investigated the involvement of cytochrome P450 monooxygenases in both these pathways (biosynthesis and biodegradation), required by the white rot fungus (directly or indirectly), Phanerochaete chrysosporium for the process of detoxification of xenobiotics.

27 Chapter II

Proposed direct and indirect involvement of P450s in detoxification of

xenobiotics

Proposed role of P450s in peroxidase-mediated oxidation of xenobiotics (PAHs)

The secondary metabolite, veratryl alcohol, plays a major role in maintaining the activity of

lignin peroxidases in this white rot fungus (explained earlier). Synthesis of VA occurs via the shikimate pathway, where in phenylalanine is converted to cinnamate via a reaction catalyzed by phenylalanine lyase (Hattori et al. 1999). Cinnamate is then converted to benzoate and/or benzaldehyde by claisen-cleavage mechanism, which is then hydroxylated and methylated to form veratrate or veratraldehyde and subsequently reduced back to VA (Jensen et al. 1993). This is the only known pathway in P. chrysosporium where involvement of benzoate hydroxylation

has been proposed (Fig. 1). Our lab first cloned the benzoate-para hydroxylase gene of this

fungus and submitted to the NCBI database (AAQ84022). It was shown both by us and by

Matsuzaki and Wariishi (2005) that benzoate is an inducer for this gene, as shown by

quantitative RT-PCR analysis (Table 1).

Table 1. Fold induction of PC-bph and GPD genes in response to benzoate.

∆∆Ct Fold change PC-bph GPD ∆Ct ∆∆Ct Treatment (∆Ct DMSO-∆Ct (2 ) (Ct values) (Ct values) (PC-bph–GPD) Benzoate) Benzoate 21.83 ± 0.48 15.63 ± 0.16 6.18 3.0 8.0 DMSO 23.20 ± 1.31 14.21 ± 0.10 9.18

28

Glucose Shikimate pathway

Phenylalanine

Cinnamic Acid

Lignin Benzoate

P450 Bph ?

OH-Benzoate / Benzaldehyde

Veratric acid / Veratraldehyde

Veratryl alcohol

Figure 1. Veratryl alcohol synthesis pathway (Adapted from Jensen et al.1993, Hattori et al. 1999)

As shown, in table 2, benzoate was found to induce the transcription of benzoate-

parahydroxylase (PC-bph) by nearly 8 fold as compared to the DMSO-treated control.

Moreover, it is known that substrates for P450s are also inducers for their genes in some cases.

This is especially true with eukaryotic P450s (Denison and Whitlock 1985). Thus benzoate hydroxylation, in the veratryl alcohol synthesis pathway, could be catalyzed by PC-bph. This information provided an impetus to investigate if P450-bph plays a role in VA synthesis. If a

29 cytochrome P450 is indeed involved in the synthesis of VA, inhibition of its activity by addition of a P450 chemical inhibitor, should result in decrease/cessation of VA synthesis.

VA synthesis can be measured indirectly by measuring the LiP activity since LiP activity is directly proportional to the levels of VA. This possibility was tested in my experiment where in,

P. chrysosporium cultures were treated with 100 µM piperonyl butoxide (P450

60

y t 50 i v i t c

a 40 e s da i 30 rox 20 n pe

gni 10 Li

0 LN-VA-Inh LN-VA+Inh

Figure 2. Changes in LiP activity in response to the addition of a P450 inhibitor (piperonyl butoxide). Culture conditions: Low Nitrogen medium (LN) without veratryl alcohol without inhibitor (LN-VA-Inh); Low Nitrogen medium without veratryl alcohol with inhibitor (LN-VA+Inh).

inhibitor). LiP titer was reduced by 50% after addition of the P450 inhibitor (Fig. 2). These data clearly suggest a role of a cytochrome P450 in VA synthesis. Since benzoate hydroxylation step is involved in VA synthesis pathway and a P450 benzoate p-hydroxylase gene exists in this

30 organism, the role of this P450 in VA synthesis is hypothesized. A diagrammatic representation of the hypothesized mechanism involving this P450 is given in Fig. 3.

R ROH P450 bph Phenylalanine Benzoate V.A

R

V.A LiP . R

Figure 3. Proposed scheme on the role of P450-bph in veratryl alcohol synthesis pathway. R; xenobiotic compound, ROH; Hydroxylated xenobiotic compound, R.; one electron abstracted xenobiotic radical.

In the proposed pathway (Fig. 3), benzoate, generated as an intermediate from phenylalanine, is hydroxylated by a P450 (P450-bph) leading to the formation of VA. VA is excreted into the environment and is required for maintaining the activity of LiPs. In our initial experiment (Fig.

2), inhibition of P450-bph by the P450 inhibitor resulted in the reduction of LiP activity (Fig. 3), presumably via reduced levels of VA synthesized inside the cell. Lower the VA synthesis, lower is the LiP activity, considering the known role of VA in stabilizing LiPs.

31 Proposed role of P450s in direct oxidation of xenobiotic compounds (PAHs)

Although, P. chrysosporium is well known for its ability to oxidize xenobiotic compounds such

as PAHs using its non-specific peroxidase system, till date there is very little evidence which

suggests the direct involvement of specific cytochrome P450s in this process. For instance, it was

shown that PAH compounds (namely phenanthrene) can be degraded by this fungus even under

peroxidase-suppressing nutrient-rich conditions (Sutherland et al. 1991). Based on the use of a

P450 inhibitor, an involvement of P450 monooxygenases in this degradation process was

proposed. Similarly the role of P450 system in degradation of a chlorinated cyclic sulfite diester,

endosulfan, was proposed under similar conditions (Kullman and Matsumura 1996).

Subsequently it was shown by Masaphy et al. (1996) that benzo(a)pyrene hydroxylation can be

catalyzed in in vitro reactions using microsomal extracts. The authors thus suggested the

involvement of cytochrome P450 enzymes in this hydroxylation process. Organophosphorous

pesticides were also shown to be transformed by microsomes of this fungus, suggesting the

involvement of P450 enzymes in this oxidation process (Jauregei et al. 2003). Several other

compounds like benzoic acid, cinnamic acid, 1,12-dodecanediol, 1,12-dodecanedioic acid, 1-

dodecanol, 4-hydroxybenzoic acid, 7-hydroxycoumarin, and vanillic acid were also suggested to

be biotransformed by the P450 system (Matsuzaki and Wariishi 2004). All these evidences

demonstrated the possible involvement of P450 system in degradation of xenobiotics in P.

chrysosporium. However, role of any specific P450(s) in PAH oxidation has not yet been

demonstrated. Our laboratory used a different approach to study the involvement of P450 in

degradation of polycyclic aromatic hydrocarbon (PAH). Since it is known that substrates for the

P450s are also inducers for the genes, we used quantitative RT-PCR and microarray-based

32 approach to study the induction of P450 genes in response to individual PAHs as a tool to

identify and predict specific P450 genes that could be directly involved in PAH degradation.

Based on this functional genomic analysis, we identified 12 genes that showed differential

induction in response to PAHs of different ring-sizes (naphthalene, phenanthrene, pyrene, benzo(a)pyrene). A list of PAH-responsive P450 genes identified and their fold-induction in response to these compounds is shown in table 2. Five genes namely pc-1, pc-2, PC-pah1, PC- pah2, PC-pah3 were induced by more than one PAH compound, where as 8 genes (PC-pah4 through PC-pah11) were induced specifically by one PAH compound. This observation suggests that PAH regulation of these genes is at the level of transcription and that the inducing PAH

compounds could also be the substrates for the induced P450(s).

33 Table 2. Microarray- and qRT-PCR- based transcriptional induction (fold induction) of P450 genes in response to polycyclic aromatic hydrocarbons.

P450 P450 I.D Naphthalene Phenanthrene Pyrene Benzo(a)pyrene family 4.35 ± 0.09 2.82 ± 0.12 3.93 ± 0.10 1.55 ± 0.03 pc-1 CYP63 (RT) (RT) (RT) (RT) pc-2 CYP63 2.34 ± 0.28 2.29 ± 0.28

PC-pah 1 CYP617 6.96 ± 2.27 2.95 ± 0.78

PC-pah 2 CYP64 2.98 ± 0.47 3.69 ± 0.58 PC-pah 3 CYP64 8.05 ± 1.58 2.82 ± 0.55 14.13 ± 5.74 PC-pah 4 CYP617 8.48 ± 0.63 PC-pah 5 CYP58 6.85 ± 1.38

PC-pah 6 CYP64 5.09 ± 2.4

PC-pah 7 CYP64 4.65 ± 1.56 PC-pah 8 CYP64 2.31 ± 0.86 PC-pah 9 CYP64 2.22 ± 0.32 PC-pah 10 CYP64 2.09 ± 0.91

PC-pah 11 CYP64 2.02 ± 0.76

Another line of evidence that suggested a direct involvement of P450s in the oxidation of PAH compounds originated from the in vivo degradation study of some of the PAH compounds. P. chrysosporium cultures were grown under nutrient-rich malt extract (ME) conditions (high N, high C); also considered to be non-ligninolytic conditions, i.e. conditions in which the peroxidase enzymes are not expressed. Young cultures (24 h old) were treated with an individual PAH compound namely anthracene (3-ring), pyrene (4-ring), or benzo(a)pyrene (BaP, 5-ring). A parallel set of cultures was spiked with a P450 inhibitor (piperonyl butoxide, 500 µM and 1000

µM final concentration) and the test PAH compound after 24 h of growth. After further

34 incubation for 72 h post addition of PAH/P450 inhibitor, the fungal cultures were extracted with

methylene chloride, dried under MgSO4 and analyzed by HPLC for the PAH concentration remaining in the cultures. Two of the three test PAH compounds namely anthracene and benzo(a)pyrene showed ~ 50 % disappearance in 72 h. However in presence of the inhibitor, the degradation was completely abolished suggesting that P450s are directly involved in degradation of these compounds in vivo by this fungus (Fig. 4, Fig. 5). On the other hand, although pyrene showed about 50% degradation under these culture conditions, hardly any effect of the P450

inhibitor, piperonyl butoxide, was observed. In order to confirm whether the observed effect is

specific to piperonyl butoxide, this experiment with pyrene was repeated using another P450

inhibitor, metopirone. The level of pyrene degradation was basically unaffected by addition of

this inhibitor as well. These results suggested that degradation of certain PAH compounds

(anthracene and BaP) definitely involves P450 enzymes; the observation that pyrene degradation

was unaffected by addition of the inhibitor could be due to the reason that those P450s that are

involved in degradation of pyrene are probably not inhibited by the tested inhibitors, or there are

alternate degradative enzyme systems for pyrene that are also functional under the test conditions

(nutrient-rich ME).

35

Anthracene degradation by P. chrysosporium ) l 160.00

1000 u 140.00 /

g u

( 120.00 g n i n i 100.00

A a m e 80.00 e r

60.00 acen r h t

n 40.00 A f o 20.00 t n u

o 0.00

m

A Uninoculated Chem killed w /o inhibitor w ith 500 µm w ith 1000 µm culture control inh inh

BaP degradation by P. chrysosporium 1400.00 ) ul

0 0 1200.00 0 g/1

u 1000.00 ( g n

B ini 800.00

a m e

r 600.00

p a B

f 400.00 o nt

ou 200.00

m A 0.00 Uninoculated Chem killed w /o inhibitor w ith 500 µm w ith 1000 µm culture control inh inh

Figure 4. Effect of the P450 inhibitor piperonyl butoxide on the degradation of anthracene (panel A) and benzo(a)pyrene (panel B) by Phanerochaete chrysosporium. Test conditions: Chem killed control (chemically killed control); w/o inhibitor (culture without the P450 inhibitor); inh (culture with the P450 inhibitor).

36

Pyrene degradation by P. chrysosporium

) 1400.00 ul 0 0 0

1 1200.00

1000.00

ng (ug/ i n i 800.00 A ma e r 600.00 ne e

r y 400.00

200.00 ount of P m

A 0.00 Uninoculated Chem killed w /o inhibitor w ith 500 µm w ith 1000 µm culture control inh inh

Pyrene degradation by P. chrysosporium

0

0 900 0 1 /

g 800

u 700 ng ( i

n 600 i a

B m 500 ) e r ul 400 ne e

r 300

y

P 200 of t 100

oun 0

m Uninoculated Chem killed w /o inhibitor w ith 2 mM inh w ith 5 mM inh A culture control

Figure 5. Effect of different P450 inhibitors on degradation of pyrene by Phanerochaete chrysosporium. Panel A: Effect of piperonyl butoxide (500 µM and 1000 µM), Panel B: Effect of metopirone (2 mM and 5 mM).

37

Hypothesis:

Based on the above generated preliminary evidences, I hypothesize that

Cytochrome P450s play key role in detoxification of polycyclic aromatic chemicals (PAC)

in P. chrysosporium,

- indirectly by regulating VA synthesis, required for LiP enzyme activity

- directly by initial oxidation of the PACs via P450 enzyme activity

In order to support my hypothesis I have three specific aims:

1) Study regulatory role of P450-bph (benzoate-ρ-hydroxylase) in peroxidase-mediated

oxidation of PACs via veratryl alcohol synthesis. (Chapter III)

2) Cloning/characterization and heterologous expression of PAC-inducible P450s and P450

electron transfer proteins (b5 and b5 reductase) from P. chrysosporium (Chapter IV, Chapter

V, and Chapter VII)

3) Study catalytic role of the selected fungal P450 in direct oxidation of PACs (Chapter VI and

Chapter VII).

38 Chapter III

Role of P450s in regulation of peroxidase-mediated degradation of xenobiotics

via veratryl alcohol synthesis

3.1. Introduction

Based on the P450 inhibitor experiment, it was proposed that PC-bphT plays an indirect role in the peroxidase-mediated degradation of xenobiotics via VA synthesis. This was shown by the reduced activity of LiP in the presence of the P450 inhibitor. Here I present further evidence that the observed reduction in LiP activity is actually due to the reduced VA synthesis in the P450 inhibitor-treated cells. This suggests that P450 (PC-bph) plays a role in the VA synthesis pathway.

Secondly, in order to directly demonstrate that PC-bph is involved in VA synthesis, attempts

were made to generate a PC-bph knock-out / knock-down strain P. chrysosporium using the

following two different approaches: A) Conventional homologous recombination-based knock-

out and B) siRNA-based knock-down.

In this chapter, I have summarized my attempts to achieve the following two different objectives

that were proposed under specific aim 1.

1) to confirm the involvement of a P450(s) in the synthesis of VA using P450 inhibitors

2) to generate PC-bph knock-out / knock-down strain of P. chrysosporium to show that these mutants synthesize reduced levels of VA under ligninolytic conditions.

39

3.2. Materials and Methods

3.2.1. Strains and culture conditions. A homokaryotic strain of P. chrysosporium (RP78) was

used for the homologous recombination-based knock-out experiments and the wild-type

dikaryotic strain BKM-F-1767 was used for siRNA based knock-down experiment. P.

chrysosporium was routinely maintained on malt extract agar.

3.2.2. Effect of inhibitor on levels of VA. P. chrysosporium cultures were grown in low N (LN) media (without VA) for 24 h at 180 rpm. Piperonyl butoxide (P450 inhibitor) was added to these cultures at a concentration of 100 µM. After 72 h of incubation at 370C following addition of the inhibitor, cultures were extracted three times with methylene chloride, dried under vacuum in presence of sodium sulfate and resuspended in methanol. VA levels were then quantified by

HPLC analysis in a Prostar 210/215 Varian HPLC system (Varian, Inc., USA) equipped with a

UV detector. Veratryl alcohol was detected at 277 nm and quantified using a standard curve generated with known concentrations of the chemical.

3.2.3. Generation of PC-bph knock-out plasmids. Two different sets of plasmids were generated for this approach. Both the plasmid sets were based on a pUC19 vector backbone. The first set contained the PC-bph-knockout cassette and the second set contained the antibiotic selection cassette. Two different versions of the antibiotic selection cassette were generated; they contained hygromycin and phleomycin resistance genes, respectively.

40 A. PC-bph knock-out plasmid: Briefly, 1500 bp PC-bph promoter was amplified from the

genomic DNA using the primers BphP-F-XbaI and BphP-R-SphI (Table 1), such that XbaI and

Sph I restriction sites were added to the 5’ and 3’ ends of the promoter, respectively. The

amplification cycles included denaturation at 950C for 5 min, followed by 35 cycles, each using

950C for 1 min, 550C for 1 min, and 720C for 2 min. A 70 bp oligo of the glyceraldehyde-3 phosphate dehydrogenase gene (GPD) starting from the translation initiation codon (ATG), was then amplified using the primers GPD-F-SphI and GPD-R-PstI (Table 1) such that SphI and PstI restriction sites were added to the 5’ and 3’ ends, respectively. Amplification conditions were the same as for the PC-bph promoter. This amplified sequence (70 bp) included the first intron (55 bp) of the GPD gene. The EGFP coding region was then amplified using EGFP-F-PstI and

EGFP-R2-DraIII primers (Table 1), such that the EGFP coding region (starting from aa sequence

VSK…) was in-frame with the ATG of the GPD gene coding sequence (after considering the

GPD intron splicing). Thus the aa sequence coded by GPD gene included the first two aa before the intron (–MP-) followed by the aa stretch VTA (after the intron). So basically, the aa sequence read as follows: MPVTAVSK…… The plasmid, pEGFP-C3 (kindly provided by Dr. Ying Xia) was used as a template for this amplification. Amplification conditions were denaturation at 950C for 2 min, followed by 35 cycles of amplification, each at 950C for 30 sec, 580C for 30 sec, and

720C for 2 min. A 1000 bp PC-bph terminator sequence (immediately downstream of the stop codon) was then amplified using the primers BphT-F-DraIII and BphT-R-HindIII (Table 1), such that DraIII and HindIII restriction sites were added to the 5’ and 3’ ends, respectively.

Amplification conditions were similar to those used for the PC-bph promoter sequence amplification. Pfu Ultra DNA polymerase (Stratagene Corp., USA) was used for amplification of all the above sequences to ensure fidelity. All these sequences were cloned into a temporary

41 vector, TOPO 2.1 vector (Invitrogen Corp. USA) after performing an extension with ExTaq

DNA polymerase (TakaRa) to add an additional nucleotide “A” overhang to these products, since Pfu Ultra polymerase does not add “A” to the products.

Table 1. Primers used in the generation of knock-out and knock-down vectors

Primers Sequence (5’ – 3’)

BphP-F-XbaI TCTAGAGGGACGTAACTTCCAAC BphP-R-SphI GCATGCTGTCGGTGCAAGGAG GPD-F-SphI GCATGCCGGTCAGTACAC GPD-R-PstI CTGCAGTGACCTGGAAAGCG EGFP-F-PstI CTGCAGTGAGCAAGGGCGAGG EGFP-R2-DraIII CACTTAGTGCTTGTACAGCTCGTCCATG BphT-F-DraIII CCACTAAGTGCCTGTGAAACGC BphT-R-HindIII TAAGCTTAGCATCTCGCTCG GPD-PstI-F ACTGCAGTGCTGGCACGCATCCG GPD-SphI-R GCATGCTCAAGTAGTGTAGGGGTG HphI-SphI-F AGCATGCCTGAACTCACCGC HphI-SpeI-R CACTAGTCCTTTGCCCTCG TrpCt-SpeI-F GACTAGTGGTGATATCATAAAATGTG TrpCt-BamHI-R AGGATCCGCATGTCTGGCGTG pCambia-For CAATCCCACTATCCTTCGC pCambia-Rev CCGGCAACAGGATTCAATC Bph-NcoI-F ACCATGGCATACGGTCATA Bph-Nsi-R1-Revised AATGCATCTTGCTCATGGTCG Bph-Nsi-F2 AATGCATACGATCTTGCGCTTC Bph-BstEII-R2 AGGTCACCCCATGGCATACGGTC

42 All the four sequences were then restricted with the respective enzymes (mentioned in the primer

design) and ligated with XbaI and HindIII digested fragment of pUC19 vector to obtain the

designed vector pVBG. (See Appendix for the complete plasmid construct). A diagrammatic

representation of the above mentioned strategy of cloning is shown in Fig. 1.

Bph Promoter

TCTAG AGGGACGTAACTTCCAAC GAGGAACGTGGCTGTCGTACG

GPD

GCATGCCGGTCAGTACAC

GCGAAAGGTCCAGTGACGTC

EGFP

CTGCAGTGAGCAAGGGCGAGG GTACCTGCTCGACATGTTCGTGATTCAC Bph Terminator

CCACTAAGTGCCTGTGAAACGC

GCTCGCTCTACGATTCGAAT

Figure 1. Strategy for generating the plasmid vector pVBG containing the PC-bph knock-out cassette.

43 B. Antibiotic selection plasmids. The second plasmid set (pVH and pVP plasmids containing

hygromycin and phleomycin resistance gene, respectively) were generated as follows. Briefly, a

2000 bp GPD promoter starting from -2000 bp (upstream of ATG) was amplified from the

genomic DNA using the primers GPD-PstI-F and GPD-SphI-R (Table 1), such that PstI and SphI

restriction sites were introduced at the 5’ and 3’ ends, respectively. The amplification conditions were similar to those for the EGFP sequence amplification (see earlier section).

Using the same amplification conditions, hygromycin gene was amplified using the primers HphI-SphI-F and HphI-SpeI-R (Table 1) and pAN7-1 plasmid (kindly provide by Dr.

Peter Punt, TNO Food and Nutrition Research, The Netherlands) that contained the hygromycin gene, as the template. The amplified product contained SphI and SpeI restriction sites at the 5’ and 3’ ends, respectively. A 1000 bp TrpC terminator sequence (Tryptophan synthase) was then amplified using the primers TrpCt-SpeI-F and TrpCt-BamHI-R (Table 1) such that SpeI and

BamHI sites were added at the 5’ and 3’ ends, respectively. Amplification conditions were same as that for EGFP amplication The amplified fragments were then cloned into the temporary vector (TOPO 2.1), restricted with the corresponding restriction enzymes (mentioned in their amplication primers), and ligated to a PstI and BamHI digested pUC19 vector backbone. The cloning strategy is diagrammatically shown in Fig. 2.

Another plasmid (pVP) containing phleomycin resistance gene was also constructed using the same strategy as for pVH construction, except that the phleomycin resistance gene was inserted at the SpeI and SphI sites instead of the hygromycin resistance gene. The complete plasmid construct is presented in the Appendix section.

44

GPD Promoter

ACTGCAG TGCTGGCACGCATCCG GTGGGGATGTGATGAACTCGTACG

Hph

AGCATGCCTGAACTCACCGC

GCTCCCGTTTCCTGATCAC

TrpC Terminator

GACTAGTGGTGATATCATAAAA GTGCGGTCTGTACGCCTAGGA

Figure 2. Strategy for generating the plasmid vector pVH containing the hygromycin knock-out cassette.

C. Generation of a combined knock-out plasmid. As an alternative to the above cotransformation

strategy, I designed another plasmid vector (pVBH) that contained the hygromycin resistance

gene in place of the EGFP reporter gene. The basic strategy remained the same, except that the

first 70 bp of the GPD gene was cloned as a SphI-SalI fragment followed by SalI–SacI fragment

of the hygromycin resistance gene. The plasmid map is presented in the Appendix section.

45 3.2.4. Transformation of P. chrysosporium protoplasts with the recombinant plasmids.

A. Protoplast preparation: Freshly harvested conidiospores were used for generating the

protoplasts for transformation. Conidiospores were inoculated into 200 ml of modified Vogel

medium (Vogel medium containing 3% malt extract, 0.15% yeast extract) at a concentration of

107 spores/ml and allowed to germinate for 12 h – 13 h at 370C in a rotary shaker. At this point, the germinated spores were centrifuged at 800 x g for 10 min and the pellets were resuspended in

1ml of 0.5M MgSO4-0.05M maleic acid, pH 5.9 (MgOsm).To this suspension, 3 ml of MgOSM containing 20 mg/ml Driselase, (InterSpex), 40 mg/ml beta-D-glucanase Driselase (InterSpex), and 81.25 U/ml lyticase (Sigma) were added. The resulting mixture was incubated at 380C for 4 h on a rotary shaker (100 rpm) to allow formation of protoplasts. Protoplasts were separated from the mycelial debris by passing through sterilized miracloth. The debris was washed repeatedly

with 1M sorbitol -20mM MOPS, pH 6.3 (SorbOsm) to extract the protoplasts that were trapped

in the debris. This protoplast suspension was centrifuged at 270 x g for 10 min and resuspended

in 0.5 ml of SorbOsm. Protoplasts were counted using a haemocytometer and again centrifuged at 270 x g for 10 min. The protoplasts were then suspended in SorbOsm containing 0.04M CaCl2 such that the final concentration was adjusted to 2 x 107 protoplasts per ml.

B. Transformation of protoplasts: Approximately 5 µg of the knock-out cassette-containing plasmid DNA and 0.625 µg of the selection plasmid in TE pH 8.0 were mixed together (Ratio 8

:1)and added to 100 µl of protoplasts (2 x 106 protoplasts) followed by incubation on ice for 10 min. Control protoplasts were treated with an equal amount of TE plus 0.04 M CaCl2. These samples were overlaid with 160 µl of 44% PEG 3350 in 10 mM MES, pH 6.75 and incubated on ice for 10 min with intermittent mixing. Protoplasts were then diluted to a concentration of 2.5 to

5 5.0 x 10 /ml in asparagine-glucose-salts minimal medium (MM) containing 0.5 M MgSO4, pH

46 4.8 and 0.1 ml was spread-plated on the 20 ml MM agar plates. Plates were incubated at room

temperature overnight to allow expression of the hygromycin gene. After overnight incubation,

10 ml of top agar (MM medium containing 1% agar) containing 160 µg/ml hygromycin [final

concentration in 30 ml medium (20 ml basal agar + 10 ml top agar)] was overlaid and the plates

were incubated at 370C. Colonies that showed growth in this medium were then transferred to

individual MM agar plates containing 160 µg/ml hygromycin again to confirm that the colonies are truly hygromycin resistant.

Only those transformants that showed hyromycin resistance in the second screen were selected for further analysis. Individual colonies were transferred to liquid medium and genomic DNA extracted using a standard protocol (Lee et al. 1988). Southern blot analysis was then performed to identify those transformants that did not show the presence of any signal on probing with the

PC-bph but showed signals when probed with EGFP probe. Two probes (1600 bp genomic PC-

bph fragment and a 750 bp EGFP fragment) were used in the Southern blot analyses.

3.2.5. Agrobacterium-mediated transformation of plasmids into P. chrysosporium.

A. Generation of plasmid vector containing the siRNA construct: Two different plasmids were

constructed, plasmid pCFNRc and pC-Bph-a. In order to construct both these plasmids, a plant

transformation vector pCAMBIA 1201 used as a backbone was obtained from CAMBIA

(Australia).

Construction of pCFNRc vector: An 874 bp PC-bph fragment (bp position from 115 to 978) was

PCR amplified using the cloned genomic DNA fragment as template. The primers used for this amplification were Bph-NcoI-F and Bph-Nsi-R1-Revised (Table 1). The amplification conditions included an initial denaturation step at 950C for 5 min, followed by 35 cycles each at

950C for 1 min, 550C for 1 min, and 720C for 1 min. This product spanned a region from 115 bp

47 to 978 bp downstream of the translational start codon and contained two introns of 231 bp and 50

bp size, respectively. Transcription of this genomic DNA after integration into the genome of P.

chrysosporium should result in a 603 bp mRNA after intron splicing. A second PC-bph fragment was amplified using the primers Bph-Nsi-F2 and Bph-BstEII-R2 (Table 1) using the same PCR conditions. Cloned PC-bph cDNA was used as a template in this PCR reaction. The product obtained was a 300 bp amplicon that spanned the region between 105 bp to 404 bp of the PC-bph cDNA. The two fragments were independently cloned into the temporary vector TOPO 2.1, enzyme restricted using the NcoI and NsiI for the 874 bp fragment and NsiI and BstEII for the

300 bp fragment, respectively, and ligated with NcoI – BstEII digested pCAMBIA 1201 vector.

Digestion of the pCAMBIA 1201 vector with NcoI and BstEII leads to the release of the gusA reporter gene. Thus the siRNA construct that is cloned is a replacement of the gusA reporter gene such that the cloned product is under the control of the CaMV35S promoter. The hairpin construct that will result from the ligation of the above two fragments will have a 300 bp stem

(after intron splicing), 300 bp loop followed by a 300 bp reverse stem. The formation of hairpin structure is diagrammatically shown in Fig. 3. The plasmid map is presented the Appendix section.

48

300 bp stem 300 bp loop 300 bp stem

Transcription

300 bp stem

300 base loop

Dicer-mediated cleavage

19-22 base siRNA

Figure 3. Formation of 19 -22 base siRNA from a 300 bp hairpin structure.

49 Construction of pC-Bph-a: This construct was generated using a similar strategy as above. The

vector pCAMBIA 1201 was enzyme restricted using the NcoI and BstEII restriction enzymes,

thereby releasing the gusA reporter gene. Two different oligonucleotides of 55 bp and 56 bp

were designed such that the second oligonucleotide (antisense oligo) had 51 nt sequence

complementary to the first oligonucleotide (sense oligo). In addition the sense oligo and the

antisense oligo after annealing will have a 5’ NcoI and a 3’ BstEII overhang, respectively. The

nucleotide sequence of the sense oligo was

CATGGCTAGATTTGAAGTCGTGGCTTCAAGAGAGCCACGACTTCAAATCTAGTTG and of the antisense oligo

was GTCACCAACTAGATTTGAAGTCGTGGCTCTCTTGAAGCCACGACTTCAAATCTAGC. Two µl aliquot of

each oligo was mixed in a 50 µl total reaction mixture, denatured at 950C for 2 min followed by

cooling immediately on ice for 5 min to allow annealing of the complementary sequences of the

two oligos. The annealed product will form a 51 bp double stranded complementary sequence as

shown in Fig. 4. A 5 µl aliquot of this reaction mixture was then ligated with the NcoI-BstEII

digested vector fragment followed by transformation into Top10 chemically competent E. coli

cells and plated on Luria Bertani (LB) medium containing chloramphenicol (25 µg/ml). Colonies

were then screened for the presence of the insert by PCR using the primers pCambia-For and

pCambia-Rev (Table 1).

NcoI overhang CATGGCT AGATTTGAAGTCGTGGCTTCAAGAGAGCCACGACTTCAAATCTAGTTG CGATCTAAACTTCAGCACCGAAGTTCTCTCGGTGCTGAAGTTTAGATCAACCACTG BstEII overhang

Figure 4. Double stranded DNA structure formed by complementary forward and reverse oligo nucleotides

50 B. Transformation of plasmids into Agrobacterium tumefaciens: A 2 ml aliquot of an overnight

grown Agrobacterium culture in LB containing 250 µg/ml spectinomycin was transferred to a

fresh 50 ml medium of LB containing spectinomycin and incubated at 280C under shaker conditions till the culture density reached an O.D600 of 0.5 -1.0. Culture was then chilled, centrifuged at 3000 x g for 5 min, and resuspended in 20 mM CaCl2. A 1 µg aliquot of each plasmid DNA (pCAMBIA 1201, pCFNRc, pC-Bph-a) was added to the 0.1 ml aliquot of this cell suspension and the resulting mixture was frozen in liquid nitrogen for 30 sec. Tubes were then transferred to 370C water bath to allow the cells to thaw. One ml of LB broth (no antibiotics) was then added and the cells were incubated for 3 h at 280C in a shaker. Cells were centrifuged and resuspended in 100 µl LB broth and plated on LB agar containing spectinomycin (250 µg/ml) and chloramphenicol (25 µg/ml). Colonies appeared after 2 days of incubation at 280C.

C. Agrobacterium-mediated transformation of plasmids into P. chrysosporium. There are three

steps involved in this transformation process.

Step 1: Preparation of Agrobacterium for co-cultivation. On day 1, a 5 ml culture of

Agrobacterium (containing the respective plasmids) was initiated in LC medium (1 % tryptone,

0.5 % yeast extract, and 0.8 % NaCl) containing 250 µg/ml spectinomycin and 25 µg/ml

0 chloramphenicol. This culture was incubated at 30 C for 48 h till the O.D600 reached 2.0. On day

3, 2 ml of this culture was centrifuged at 2000 rpm for 2 min followed by resuspension in 10 ml

LC medium containing the antibiotics and the inducer compound acetosyringone (AS) at a final concentration of 200 µM. The culture was then incubated for 5 h at room temperature till the culture density reached an O.D600 of 0.6.

51 Step 2: Preparation of P. chrysosporium pellets for co-cultivation. On day 1, 107 conidiospores were inoculated into two 250 ml flasks containing 50 ml of malt extract medium (ME) each and incubated at 370C for 48 h at 180 rpm. On day 3, the pellets were filtered by passing through a sterile filter cloth (Joanne Fabric) and transferred to a 50 ml sterile flask. The pellets were resuspended in 4 ml of MgOsm containing 10 mg/ml Driselase, 20 mg/ml β-D-glucanase, and

40.62 u/ml lyticase and incubated at 100 rpm for 1 h at 370C. Following enzyme treatment with the cell-wall lysing enzymes, the pellets were again filtered and resuspended in 5 ml of ME broth.

Step 3: Co-cultivation of Agrobacterium and P. chrysosporium cells. On day 3, 5 ml of the enzyme-treated P. chrysosporium pellets was mixed with 5 ml of the AS-induced Agrobacterium culture and incubated at room temperature for 6 h at 100 rpm. Individual pellets were transferred with sterile forceps to sterile Whatman paper laid on ME agar plates. Plates were incubated at room temperature for 2 days. On day 5, the individual colonies were transferred to MM agar plates containing 180 µg/ml hygromycin and incubated at 370C till hyphae started to appear.

Those colonies that produced hyphae were then transferred to 4 cm petriplates containing MM medium with 200 µg/ml hygromycin.

3.2.6. Northern Blotting. Total RNA was extracted from the P. chrysosporium transformants using TRI reagent protocol (MRC). A 20 µg aliquot of total RNA was loaded onto 1.0 % formaldehyde agarose gel and transferred onto Nytran membrane by gravity-based transfer using a Turbo blotter (Schleicher and Schuell). RNA was crosslinked using a UV crosslinker

(Stratagene). Membranes were pre-hybridized with PerfectHyb™ Plus Hybridization Buffer

(Sigma, Inc.) for 1 h at 600C. This was followed by addition of radioactively labeled (32P) DNA

52 probes (~ 700 bp for both GPD and PC-bph) and hybridization overnight at 600C. Membranes were washed and exposed to X-ray films for autoradiography.

3.2.7. Cultivation of P. chrysosporium transformants for phenotypic analysis. Individual colonies were allowed to sporulate on ME agar plates. Spores were harvested after 10 days of incubation at 370C with sterile distilled water. One ml of the individual spore suspensions was

inoculated in low N medium (LN) without veratryl alcohol in a Fernback flask and incubated at

370C for 48 h under stationary conditions. The mycelial mat was transferred to a wide-mouth 250 ml flask and homogenized using a waring blender. Fifty ml LN medium (without veratryl alcohol) was inoculated with the blended P. chrysosporium cultures in rubber stoppered (125 ml)

flasks such that the initial O.D600 of the culture remained the same in all the flasks. The cultures

were oxygenated for 1 min after every 24 h intervals and the incubation was carried out at 370C at 180 rpm for 4 days till the pellets started to show browning. Cultures were then harvested and analyzed for veratryl alcohol levels, LiP activity and mycelial mass.

3.2.8. Estimation of mycelial mass. P. chrysosporium cultures were filtered through sterile #40

Whatman ashless filter papers under vacuum, dried at 800C, and weighed repeatedly till a constant weight was obtained.

3.2.9. Estimation of veratryl alcohol by HPLC. Veratryl alcohol was extracted from P. chrysosporium cultures using methylene chloride. Briefly, 50 ml of MeCl2 was added to 50 ml cultures in a separating flask. This mixture was shaken vigorously and allowed to stand for separation of the solvent from the aqueous phase. The solvent phase was collected in a beaker,

53 whereas the aqueous phase was subjected to two more rounds of extraction with MeCl2. The

pooled MeCl2 extracts were dried under vacuum in the presence of sodium sulfate and resuspended in 3 ml of methanol. The methanolic extract was again dried under nitrogen atmosphere and resuspended in 1 ml methanol. Samples were filtered through 0.45 µM filters and were analyzed by HPLC in a Prostar 210/215 Varian HPLC system (Varian, Inc., USA) equipped with a UV detector. Veratryl alcohol was detected at 277 nm and quantified using a standard curve generated using known concentrations of the chemical.

3.2.10. LiP activity assay. Culture supernatants were used as the source of lignin peroxidases

(LiPs). Briefly, 900 µl of the supernatant (source of LiP) was mixed with 900 ml of 125 mM tartaric acid (pH 2.5) and 100 µl of 40 mM veratryl alcohol. This mixture was then split into two cuvettes and the baseline was recorded at 310 nm. Fifty µl aliquot of H2O2 (8 mM) was then

added to one of the tubes and the change in absorbance was recorded over a period of two

minutes. The increase in absorbance is directly proportional to the amount of veratraldehyde that

is generated by LiPs in the presence of veratryl alcohol. The LiP activity is then calculated using

a molar extinction coefficient of 9300 M-1cm-1 and expressed as units per liter.

3.3. Results

Treatment of the P. chrysosporium cultures with the P450 inhibitor resulted in 50%

reduction of VA levels as observed by HPLC analysis (Fig. 5A). The HPLC peak of VA is as

shown in Fig. 5B.

54

1200

) 1000 g u (

l 800

o h

co 600 l

A a yl

r 400 t a r e 200 V

0 w/o VA - Inh w/o VA + Inh

B

Figure 5. Effect of P450 inhibitor on levels of veratryl alcohol. Panel A, VA was extracted from P. chrysosporium cultures grown in LN media with and without the inhibitor and analyzed by HPLC; Panel B, Typical HPLC peak of VA.

55 Transformation of BKM-F-1767 protoplasts was successfully performed using a

modified transformation protocol. This protocol yielded 54 putative transformants after three

rounds of transformation, out of which, 19 transformants were confirmed based on their

resistance to hygromycin antibiotic (160 µg/ml). Southern blot analysis was performed using a

1600 bp PCR product of PC-bph and a 750 bp fragment of EGFP. Twelve representative transformants (based on their growth rates) were selected for Southern blot analysis. Whereas all the transformants showed hybridization signals when probed with PC-bph probe, none of the transformants showed any signal with the EGFP probe.

Agrobacterium-mediated transformation of P. chrysosporium yielded 29 pCFNRc

transformants and 24 pC-Bph-a transformants both based on hygromycin resistance (hygromycin

concentration upto 200 µg/ml). The transformants (219 and 280, respectively) were transferred

from nonselective plates (ME plates) to the selective plates (MM containing 180 µg/ml

hygromycin). In vector-only transformation, out of 140 transformants, 11 transformants

(pCAMBIA1201) turned out to be hygromycin resistant on selective plates (MM containing 180

µg/ml hygromycin). Six transformants from pCFNRc, 3 transformants from pC-Bph-a, and 4

transformants from pCAMBIA 1201 transformation were subsequently used for further

phenotypic studies.

All the 6 pCFNRc transformants (#9, #10, #16, #17, #19, #22) that were grown in LN-

VA medium showed decreased levels of VA as compared to the untransformed control (Fig. 6A).

Likewise, all 6 transformants also showed significantly lower levels of LiP activity as compared

to the untransformed control (Fig 6B). All the six transformants showed similar mycelial mass

when compared to the untransformed control (Fig. 6C), confirming that the

biochemical/enzymatic changes in the transformants are authentic.

56 Of the four control transformants (pCAMBIA 1201 vector-only), all transformants (#28,

#42, #43) except one (#26) similar levels of VA as determined by HPLC analysis (Fig. 7A). LiP activity was found to be similar or higher than the untransformed control for two transformants,

#42 and #43. Transformant #28 showed slightly reduced LiP activity as compared to the untransformed control. However, LiP activity was the lowest (or undetectable) in #26 (Fig. 7B).

As expected, there was no significant difference in the mycelial mass in all four transformants as compared to the untransformed control (Fig. 7C), showing that the activity changes were not due to growth phenotype.

Out of the three pC-Bph-a transformants (#4, #6, #7) that were analyzed for phenotypic

properties, two transformants, #4 and #6 showed significantly low levels of VA as compared to

the untransformed control (Fig. 8A). Similarly #4 and #6 transformant showed significantly

lower levels of LiP activity as compared to the untransformed control (Fig. 8B). Mycelial mass

of only one transformant (#6) was found to be slightly lower as compared to the untransformed

control. Transformants #4 and #7 showed similar mycelial masses when compared to the

untransformed control.

In order to study the effect of the hairpin constructs on transcription of PC-bph, Northern analysis was performed on the transformants. All six pCFNRc transformants showed low levels of PC-bph transcripts as compared to the untransformed control (Fig. 9A). The PC-bph transcript levels were normalized in relation to the house-keeping gene GPD. This observation was also

confirmed by densitometric analysis performed using LabWorks Image Acquisition and analysis

software (UVP Inc., CA). Results of the densitometric analysis are also presented in Fig. 9B.

57 120.00

100.00

) 80.00 % ( c

n 60.00 o

c A A 40.00 V.

20.00

0.00 BKMF #9 #10 #16 #17 #19 #22 pCFNRc transformants

50 45 40

) L 35 / 30 (U ty

i 25 v

ti 20

B c 15 A P

i 10 L 5 0 -5 BMKF #9 #10 #16 #17 #19 #22 PCFNRc transformants

0.09 0.08

0.07 )

g ( 0.06 ss a 0.05 m l 0.04 C a i l 0.03 ce y

M 0.02 0.01 0 BKMF #9 #10 #16 #17 #19 #22 PCFNRc transformants

Figure 6. Phenotypic analysis of pCFNRc transformants. Panel A, Veratryl alcohol (VA) levels as estimated by HPLC; Panel B, LiP Activity of the transformants; Panel C, Mycelial mass of the transformants.

58 200 180 160

) 140 %

( 120

c n 100 o

A c 80

VA 60 40 20 0 BKMF #26 #28 #42 #43 pCAMBIA 1201 transform ants

40

35 30 )

l m

/ 25 (U 20 ty i

B v 15 ti c

a 10 P i

L 5 0 -5 BMKF #26 #28 #42 #43 pCAMBIA 1201 transform ants

0.08

0.07

0.06 ) g ( 0.05 ass 0.04 m l

C a i 0.03

ycel 0.02 M 0.01 0 BKMF #26 #28 #42 #43 PCAMBIA 1201 transform ants

Figure 7. Phenotypic analysis of pCAMBIA 1201 transformants. Panel A, Veratryl alcohol levels as estimated by HPLC; Panel B, LiP Activity of the transformants; Panel C, Mycelial mass of the transformants.

59 140.00 120.00

100.00 ) % ( 80.00

c

A n o

c 60.00

A V. 40.00

20.00

0.00 BKMF #4 #6 #7 pC-Bph-a transformats

16 14

) 12 L /

(U 10

ty i

v 8 B ti c 6 A P i

L 4

2 0 BMKF #4 #6 #7 pC-Bph-a transformants

0.07 0.06

)

g 0.05 (

s s

a 0.04 m C l a

i 0.03

ycel 0.02

M 0.01

0 BKMF#4#6#7

pC-Bph-a transformants Figure 8. Phenotypic analysis of pC-Bph-a transformants. Panel A, Veratryl alcohol levels as estimated by HPLC; Panel B, LiP Activity of the transformants; Panel C, Mycelial mass of the transformants.

60 On the other hand, 2 of the 4 pCAMBIA 1201 transformants (#26 and #42) had lower

levels of PC-bph expression as compared to the untransformed control. The remaining two

transformants #28 and #43 had slightly higher levels of PC-bph transcripts (Fig. 10).

Densitometric analysis did not show any major differences in the level of PC-bph transcripts among the pC-Bph-a transformants (Fig. 11).

61

B #9 #10 #16 #17 #19 #22

PC-bph A

Gpd

1.6

1.4 1.2

pd) 1 B

ph/G 0.8 B o ( 0.6 i t a

R 0.4

0.2

0 BKMF #9 #10 #16 #17 #19 #22

pCFNRc transformants

Figure 9. Effect of pCFNRc transformation on PC-bph transcription levels. Panel A, Northern blot analysis of transformants using 20 µg of total RNA and probing with 700 bp PC-bph probe and 600 bp GPD probe. Panel B, Densitometric analysis of the Northern blots showing PC-bph expression levels after normalizing with that of GPD.

62

B #26 #28 #42 #43

PC-bph A

Gpd

2

1.8 1.6

)

D 1.4 P

G 1.2 /

h B p 1

(B 0.8 o

ti a 0.6 R 0.4 0.2 0 BKMF #26 #28 #42 #43 Transformant #

Figure 10. Effect of pCAMBIA 1201 transformation on PC-bph transcription levels. Panel A, Northern blot analysis of transformants using 20 µg of total RNA and probing with 700 bp PC-bph probe and 600 bp GPD probe. Panel B, Densitometric analysis of the Northern blots showing PC-bph expression levels after normalizing with that of GPD.

63

B #4 #6 #7

Bph A

Gpd

1.2

1

)

D 0.8 P G

ph/ 0.6 B B o (

i t

a 0.4 R

0.2

0 BKMF #4 #6 #7 Transformant #

Figure 11. Effect of pC-Bph-a transformation on PC-bph transcription levels. Panel A, Northern blot analysis of transformants using 20 µg of total RNA and probing with 700 bp PC-bph probe and 600 bp GPD probe. Panel B, Densitometric analysis of the Northern blots showing PC-bph expression levels after normalizing with that of GPD.

64 Discussion

HPLC analysis for VA confirmed that the reduction in LiP activity of the cultures treated

with a P450 inhibitor is due to the reduced levels of VA synthesis. Thus it can be stated with

some confidence that a P450 enzyme, possibly P450-benzoate para hydroxylase enzyme, plays a

direct role in VA synthesis in this organism. This partially confirms our hypothesis that a P450

regulates LiP activity via its role in synthesis of VA, a secondary metabolite required for

maintaining the LiP activity in this fungus. However, it is not clear whether P450-bph is

involved in this process.

Although protoplast transformation using the cotransformation technique yielded

transformants that were resistant to hygromycin, none of the transformants turned out to be

positive for the presence of EGFP gene. This observation suggested that the selection plasmid

was integrated into the genome, whereas the knock-out plasmid (containing the EGFP reporter

gene) either did not get transformed successfully or was not being detected by Southern blotting.

Our efforts on performing homologous transformation using two different plasmids (one containing the knock-out cassette, and the other containing the selection cassette) did not yield any success.

Our inability to generate a PC-bph knock-out mutant is not very surprising. In the past,

there have been several attempts made by researchers to generate homologous recombination-

based knock-out of genes in P. chrysosporium. Alic et (1991) used basidiospores in order to

generate protoplasts. In their study, they studied transformation of an adenine auxotrophic strain

with a homologous adenine biosynthetic gene (ade 1) from P. chrysosporium. Their study

indicated that the plasmids got successfully integrated into the genome though ectopically in

65 single or multiple copies. Other attempts made by Alic et al. (1993) also showed that the

plasmids integrated ectopically into the chromosome, and they concluded that homologous

integration occurs infrequently in this fungus. Subsequently, an attempt was made by Randall

and Reddy (1991) to disrupt the lignin peroxidase-encoding gene of the white-rot fungus. Their

efforts resulted in the generation of a plasmid that did not integrate into the chromosome. Instead

the plasmid was maintained as a circular element and could be recovered by E. coli

transformation.

The enhanced green fluorescent protein (egfp) has been successfully used as a reporter

gene in previous studies in P. chrysosporium. This was shown by Ma et al. (2001) where they

cloned the efgp gene under the control of the glyceraldehyde-p-dehydrogenase (gpd) promoter.

In this study they cloned the efgp gene such that it was in-frame with the first exon (6 bp)

followed by the first intron (55 bp) and part of the second exon (9 bp) of the gpd gene. They

found that this construct resulted in higher expression of the egfp as compared to the intronless

egfp. Subsequently, Ma et al. also reported (2004) using this reporter gene for studying promoter

analysis of the Mnp gene in order to identify the Mn-responsive region of the promoter. In our

study, I tried this intron-based expression strategy; the plasmid pVBG was constructed with the

efgp gene under the control of the PC-bph promoter followed by the first intron of the gpd gene.

In all the previous studies, basidiospores have been used for transformation of the

plasmids into the chromosomes. Basidiospore formation requires closely controlled

physiological conditions, which includes carbon source, nitrogen levels, and light (Gold et al.

1979). Generation of conidiospores is a relatively less cumbersome process that does not require special growth conditions. Moreover, since there has been only one study that has used conidiospores for transformation of DNA into P. chrysosporium (Zapanta et al. 1998), we used

66 this strategy with an intention of improving and simplifying the transformation process in this white rot fungus.

Considering that our above strategies have not yielded the expected recombination, we conclude that transformation of DNA based on homologous recombination for generation of knock-out strains of this white-rot fungus may require additional strategies in future efforts. For instance, firstly, transformation frequencies have to be increased for better chances of finding a knock-out and possibly basidiospores are still a better candidate for performing the transformations. However, the possibility that the transformed plasmids will still remain as circular unintegrated copies inside the cells cannot be ruled out.

Since homologous-recombination mediated knock-out generation seems to be a rare occurence in this basidiomycete fungus, we decided to use the Agrobacterium-mediated transformation as an alternative mode of transferring DNA into this fungus. This technique involves random integration into the genome, and it is known that most of the integrations in fungi resulted in single-copy T-DNA integrations (reviewed in Michelse et al. 2005). Primarily,

Agrobacterium-mediated transformation has been used in transferring genes from bacteria to plants as naturally occurs in crown gall disease. This protocol depends on infection of the plant with the bacterium, Agrobacterium tumefaciens; the infection being directed by the presence of a

Ti plasmid, resulting in the insertion of specific genes into the host DNA. Instead of the T-DNA

(containing the specific pathogenic genes), plant biotechnology has improved on this strategy by inserting specific genes of interest in place of the T-DNA. The recent improvements have resulted in the generation of Agrobacterium strains that contain the Ti-plasmid, which is considered an unaltered entity. The gene to be transferred into the host cells, are then cloned into

67 a separate shuttle vector and transformed into Agrobacterium cells, which in turn can infect plants.

Specific virulence genes play a role in Agrobacterium-mediated transformation of DNA

into the host. Briefly, VirA and VirG genes get activated in response to phenolic compounds like

acetosyringone. This results in the phosphorylation-mediated activation of VirA that in turn

transfers the phosporyl group to VirG. VirG is known to have DNA-binding properties and also

is known to activate itself as well as other virulence genes. Gene products of VirC and VirD are

then involved in generating the single stranded T-DNA, the form that is transported to the

recipient. VirE2 protein, a single-strand DNA binding protein, then binds to the T-strand and

thereby prevents the action of nucleases as well as keeps the strand in an unfolded state. With the

concerted action of several VirB and VirD proteins, the T-strand is then transported into the

recipient through the T-pilus and is targeted to the nucleus for final insertion into the genome.

CAMBIA, a plant biotechnology company, based in Australia is involved in developing

plant based binary vectors for Agrobacterium-mediated transformations. This vector system

basically is used for transferring specific genes into the plants by cloning the genes of interest in

between the left and right T-DNA borders of the so-called binary vectors. These vectors can

replicate both in E. coli and in Agrobacterium tumefaciens, which is a plant pathogen.

Recently, it was shown that Agrobacterium tumefaciens can also infect several fungal species.

Particularly, it has been extensively used in Ascomycetes, where as there are only few reports in

basidiomycetes, zygomycetes, and oomycetes (reviewed in Michelse et al. 2005). In 2006,

Sharma et al. published a study, where in P. chrysosporium mycelial pellets were transformed by

Agrobacterium cells and the transformation resulted in functional expression of egfp gene in this

basidiomycete fungus. Further, in the same year, de Jong et al. (2006) reported that an intact

68 RNAi system existed in another basidiomycete fungus, Schizophyllum commune, which resulted

in silencing the transcription of the SC15 gene that encoded a 17 kDa secretory protein.

In this report, they also mentioned the fact that orthologs of the Neurospora crassa genes dcl-2,

qde-2, and qde-3 were also found in the genome of P. chrysosporium. This prompted us to

investigate whether similar RNAi machinery exists in P. chrysosporium. Therefore, our first step

in this direction was to confirm if the genes required for RNAi silencing are indeed present in P.

chrysosporium. We confirmed the presence of the RNAi machinery by blasting similar

sequences of dcl-1/2, qde-2, qde-3, and argonaute proteins of N. crassa and Arabidopsis against the P. chrysosporium database (http://genome.jgi-psf.org/Phchr1/Phchr1.home.html). The corresponding gene identity of these sequences in the P. chrysosporium genome turned out to be

fgenesh1_pg.C_scaffold_2000363, fgenesh1_pg.C_scaffold_10000171, e_gwh2.1.523.1, and e_gww2.5.62.1, respectively.

The evidence that plasmid DNA could be successfully transferred into P. chrysosporium using

Agrobacterium tumefaciens combined with our confirmation of the existence of a possible RNAi

machinery in this whiter-rot fungus prompted us to use this strategy to specifically knock-down

the PC-bph gene in this fungus.

Unlike the difficulty encountered in transforming plasmid DNA into the fungus using the conventional protoplasting technique (poor transformation efficiency), the Agrobacterium-

mediated transformation readily generated hygromycin resistant colonies. The transformation

frequency (based on number of hygromycin resistant colonies as compared to the number of

pellets) was approximately 10%. The pCFNRc construct must have resulted in generation of a

300 bp hairpin structure with a 300 bp stem, 300 bp loop and a 300 bp reverse stem.

Theoretically, this construct should have generated 15 to 13 siRNA structures considering that

the RNA structures that are needed to be effective as interfering RNA should be at least 19 – 22

69 bp long. Thus this strategy should have generated at least 13 targets for silencing of the PC-bph gene. Both LiP activity and VA levels reduced drastically in all the transformants suggesting that the RNAi structure led to silencing of the PC-bph gene in this fungus. Although this effect was

more seen in the phenotypic observation, the reduction in the PC-bph transcripts (observed in

Northern blots) were not that pronounced. This observation was further confounded by the fact that even the pCAMBIA 1201 vector-only transformants, although did not show a significant difference (except for the one transformant) in VA levels, showed more pronounced effect on

LiP activity. Further, even the Northern blot showed mild reduction in PC-bph transcripts in at least two of the transformants. This observation suggested that the vector-only transformation probably could have resulted in insertions that have taken place in or near one of the LiP genes and ultimately resulted in reducing the LiP activity. This is a more likely possibility since

Agrobacterium-mediated transformation, is based on the fact the integrations occur in a random

fashion. Hence, VA levels remained unaffected while LiP activity was reduced due to reduced

synthesis of the LiP genes (one or more) in such unwanted insertions. Thus, it can be inferred

that even though the siRNA strategy is functional in the pCFNRc transformants, this effect is

also seen in the vector-only transformants as an indirect or a nonspecific effect. Interpretation

was further clouded by the observations on the pC-Bph-a transformants, where there was no

effect on PC-bph transcript numbers, although there was a significant effect on the LiP activity.

Hence at this point, we have to infer that the siRNA strategy in our experiments shows a random

effect. There are two factors that can also affect the functioning of this strategy in this fungus;

the type of strain used (homokaryon/heterokaryon) and the stability of the insertions. In this case,

we have used the heterokaryotic strain BKM-F-1767 that has two independent copies of each

gene. The possibility that siRNA-mediated silencing of the PC-bph gene showing a more

70 specific effect with a homokaryotic strain like RP78 is yet to be tested. Secondly, the nature of

insertions occurring into the genome and their characterization at the sequence-level are yet to be

done. These proposed studies are expected to shed light on the specific/nonspecific effects of

siRNA that we have observed in our analysis.

Nevertheless, this part of study delivered the following contributions: First, this strategy

used whole mycelial pellets for transformation thus making it an easier and less tedious method

as compared to the protoplasting technique. Secondly, this is a robust technique, since this

involves using the natural infection mechanism of a bacterium, rather than the in vitro PEG-

CaCl2- based transformation. Thus the frequency of the transformation was found to be definitely

higher than the protoplast based transformation in our study. Thirdly, since homologous

recombination seems to be a difficult aim to achieve in this organism, random insertion-based

technique in order to express hairpin structures might lead to an improved way of silencing specific genes in this fungus.

Our efforts to generate knock-down of PC-bph gene yielded only partial success. Future efforts may include studying other areas of this gene or trying other genes as targets, as well as trying homologous-recombination based integration using Agrobacterium tumefaciens as a tool for

DNA transformation.

71 Chapter IV

Regulation and heterologous expression of p450 enzyme system components of

the white rot fungus Phanerochaete chrysosporium

Venkataramanan Subramanian and Jagjit Yadav*

Department of Environmental Health, University of Cincinnati,

Cincinnati, OH 45267-0056, USA

*Corresponding author: Tel: +1-513-558-4806

E-mail: [email protected]

Running title: Cytochrome P450 enzyme system of white rot fungus

This chapter has been published as an article in the journal “Enzyme and Microbial technology” 2007;doi:10.1016/j.enzmictec.2007.09.001.

72 Abstract

Phanerochaete chrysosporium is widely used as a model organism to understand the physiology, enzymology, and genetics of lignin degradation by white rot fungi and is known for its ability to metabolize and detoxify a wide range of environmental chemicals. Our pre-genomic efforts and the recent whole genome sequencing by the Joint Genome Institute of the US-DOE have revealed that this fungus carries a well developed P450 enzyme system, consisting of multiple P450 monooxygenases and a common P450 oxidoreductase. The entire P450ome of this organism comprises of ~150 cytochrome P450 monooxygenases, mostly arranged in gene clusters and classifiable into multigene families. Except for the structurally and functionally conserved fungal P450 families such as CYP51, CYP61, and CYP53, other P450 enzymes in this organism have largely unknown function and will require functional characterization. These new

P450 enzymes may likely have roles in biodegradation activity and physiology of this ligninolytic fungus. Our pre- and post-genomic efforts to understand the functional role of P450 enzyme systems in P. chrysosporium have focused on the regulation of expression of the first identified family of P450 enzymes, the CYP63 family, and genome-wide regulation of the other

P450 families using a custom-designed P450 microarray. The genomically-linked CYP63 member P450s were found to be differentially regulated under varying physiological and/or biodegradation conditions. Results on the heterologous expression of this family of monooxygenases in different prokaryotic and eukaryotic expression systems are presented and the inherent problems associated with the expression of these membrane proteins are discussed.

Further, we report the expression and purification of the white rot fungal cytochrome P450 oxidoreductase (POR), the electron transfer component of its P450 enzyme system, required for

P450 catalysis. The reported studies have uncovered the hitherto unknown regulatory aspects of

73 the P450 enzyme system in P. chrysosporium and generated useful expression tools and knowledgebase to pursue further studies on functional analysis of the P450 contingent in this model white rot fungus.

Key words: Cytochrome P450 monooxygenase, P450 oxidoreductase, Phanerochaete chrysosporium, White rot fungus, Biodegradation

74 1. Introduction

The model white-rot fungus Phanerochaete chrysosporium is widely known for its inherent

capacity to completely breakdown the plant cell wall polymer lignin as a part of the nature’s

carbon cycle and its ability to biodegrade or mineralize a wide range of toxic chemical pollutants

such as petroleum hydrocarbons, polycyclic aromatic hydrocarbons (PAHs), herbicides,

pesticides, detergents, dyes, preservatives etc. [1, 2]. Originally, the biodegradation ability in this

organism was attributed to the presence of two classes of extracellular peroxidases, lignin

peroxidases (LiPs) and manganese peroxidases (MnPs), in conjunction with multiple H2O2- generating enzymes, all of which are expressed under nutrient starvation (ligninolytic) conditions during secondary metabolism in this organism. However, it has been consistently shown by us and others that oxidation/degradation of several organic pollutants such as PAHs, BTEX

compounds, alkyl benzene sulfonates etc. can occur even under peroxidase-suppressing (non-

ligninolytic) conditions [3, 4, 5], indicating the role of other oxidative systems including P450

monooxygenases in this organism. In this context, the recently completed whole genome

sequence [6] has now revealed that P. chrysosporium possesses an entire gamut of alternate or additional oxidation systems in its genome (http://genome.jgi-psf.org/whiterot), of which cytochrome P450 enzyme system is prominent, constituting about 1% of the coding genome.

These pre-genomic and whole genome-based observations imply the involvement of multiple

P450 monooxygenases in catalyzing the ligninolysis and the initial oxidation of various chemical compounds under low-nutrient (ligninolytic) and/or high-nutrient (non-ligninolytic) conditions.

The current working hypothesis on the role of P450 enzyme system in lignin biodegradation in this white rot fungus is that these intracellular monooxygenases catalyze the subsequent

75 oxidation of the peroxidase-depolymerized lignin derivatives leading to complete mineralization

of lignin to CO2.

Cytochrome P450 enzymes are heme-thiolate proteins that are known to catalyze the metabolism

of a variety of exogenous and endogenous compounds in prokaryotes and eukaryotes. The

typical eukaryotic P450 monoxygenase system contains a P450 monooxygenase and a P450

oxidoreductase (POR), both of which are normally membrane-associated. The whole genome

sequence has revealed that the P450 monooxygenase system of P. chrysosporium, a lower

eukaryotic organism, comprises of ~ 150 P450 monooxygenases and a P450 oxidoreductase. In

this report, we present our pre-genomic and post-genomic efforts to analyze and characterize this

elaborate intracellular monooxygenase system, both at the level of transcription and translation, with particular emphasis on the first identified CYP63 family of P450 monooxygenases in this fungus as well as purification of the P450 oxidoreductase. The information generated is expected to pave the way for future studies on catalytic analysis and role of the P450 monooxygenase system in ligninolysis and bioremediation in this white rot fungus.

2. Materials and Methods

2.1. Strains and culture conditions

Phanerochaete chrysosporium strain BKM-F-1767 (ATCC 24725) used in this study was maintained on malt extract (ME) agar (Difco Laboratories, USA). P. chrysosporium cultures

76 were grown as shaken cultures at 37 0C in defined low N medium (low N), high N medium (high

N), or Malt extract medium (ME), as described elsewhere [4].

2.2. Transcriptional analysis by Custom-designed P450 Microarray and quantitative reverse transcription-PCR

For regulation studies using microarray or quantitative real time reverse transcription-PCR (RT-

PCR) analysis, total RNA was extracted from the cultures harvested on day 4 [7, 8]. Total RNA for induction experiments using RT-PCR analysis was prepared from fungal cultures grown using a consecutive two day culturing protocol, with xenobiotic inducer added after 1 day of incubation, as described earlier [9, 10, 11]. Microarray slide printing (spotting), hybridizations, and scanning were performed at the Genomics and Microarray Laboratory of the University of

Cincinnati following their protocols (http://www.microarray.uc.edu), as described elsewhere.

Quantitative RT-PCR analysis was performed using gene-specific primers using the reaction conditions described elsewhere [10].

2.3. Heterologous expression in E. coli

The P. chrysosporium P450 system genes pc-1, pc-3, and POR were expressed in E. coli. The pc-1 cDNA was custom-synthesized for codon optimization (BIO S&T, Inc., Canada). The cDNA of interest was cloned into the vector pET30a(+) (EMD Biosciences, Inc., USA) such that it was in frame with the N-terminal histidine tag. This construct was transformed into E. coli

RosettaBlue(DE3) (EMD Biosciences, Inc., USA) cells. A transformed colony was then

77 inoculated into 5 ml Luria Bertani (LB) broth containing antibiotics and grown overnight at 370

C. This overnight grown culture was then transferred to 100 ml of LB broth and allowed to grow

to an O.D660 of 0.5. Cultures were then induced with Isopropyl β-D-1-thiogalactopyranoside

(IPTG) for an additional 4 h at 250 C, 300 C, and 370 C. Protein extraction was done using

CellLytic B bacterial cell lysis extraction reagent (Sigma, Inc., USA) per the manufacturer’s protocol. The expressed protein was detected by Western blot analysis using anti-his antibody

(PC-3 and POR) or protein-specific antibody (PC-1).

2.4. Heterologous expression in Saccharomyces cerevisiae

pc-1 cDNA was inserted into pYES2.1/V5-His-TOPO vector (Invitrogen Corp., USA) such that it was under the control of the GAL1 promoter and was in frame with the C-terminal histidine tag. This construct was then transformed into Y300 yeast strain (MATa ade2-1 trp1-1 ura3-1

leu2-3,112 his 3-11,15 can1-100), kindly provided by Dr. Yolanda Sanchez of the University of

Cincinnati. A single transformed colony was then inoculated into synthetic complete medium

lacking uracil (SCD-ura) containing 2% glucose and incubated overnight. This culture was

centrifuged and transferred into 600 ml SCD-ura medium containing 2% galactose so as to get an

O.D600 of 0.4. After incubation for 0, 4, 8, 12, 16, 20 and 24h, the cultures were harvested by centrifugation and snap frozen. Microsomes were extracted by centrifugation at 1,00,000 x g for

90 min and the expressed P450 was detected by Western Blot analysis using the PC-1-specific antibody.

2.5. Heterologous expression in insect cell system

78

Sf9 (Spodoptera frugiperda) insect cells grown in serum-free media (SFM) to a cell density of 2

x 106 cells/ml were infected with recombinant Baculovirus containing pc-1 cDNA at a multiplicity of infection of 3.0. The recombinant bacmid construct was generated as follows: the pc-1 cDNA was cloned such that it was under the transcriptional control of the polyhedrin promoter, in pFASTBAC HTa (Invitrogen Corp., USA) cloning vector. This was followed by

transformation into DH10Bac cells (Invitrogen Corp., USA). At 24 hrs post infection, hemin was

added to the cells at a concentration of 3 µg/ml and the cells were harvested at 24, 48, 72 and 96

hr post addition of hemin followed by isolation of cell extracts. Microsomes were extracted from

these cell extracts by centrifugation at 1,00,000 x g for 90 min. A total of 100 µg of microsomal

protein for each time point was run on 10% SDS-PAGE followed by blotting onto nitrocellulose

membrane, and detection of the expressed protein using Western blot analysis as described

above.

2.6. Purification of the expressed POR

Purification of the white rot P450 oxidoreductase protein expressed in E. coli was done by

passing the Triton X-100 detergent-solubilized total protein extract through Ni-NTA agarose

column. Washing and elutions were done using increasing concentration of imidazole (5 mM to

80 mM). The expressed and purified POR was detected using anti-POR antibody. Functional

activity was determined by performing a cytochrome C reductase assay [12].

79 3. Results and Discussion

3.1. P450ome of P. chrysosporium

The whole genome sequence of P. chrysosporium and the initial annotation revealed an initial estimated number of 148 P450 monooxygenase genes [6]. This turned out to be the highest number known till that date among the fungal genomes. The P450 Nomenclature group

(http://drnelson.utmem.edu/Genome.list.htm.) predicted a total of 163 P450 sequences of which

126 were full-length or near full length. Using these predictions, we reported the occurrences of gene clustering of the P450 genes into 26 clusters based on overall homology [7]. Our phylogenetic analysis showed that the 126 full-length/near full-length genes could be grouped under 12 families and 23 subfamilies [13, 14]. The grouping was based on the amino acid sequence similarity using the existing criteria of less than 40% similarity defining a family and less than 55% similarity defining a sub-family. The 12 families under which these P450 genes could be classified are: CYP64, CYP67, CYP503, CYP58/53, CYP63, CYP505, CYP614/534,

CYP617/547, CYP5031/CYP547, CYP51, CYP61, and CYP62. Among these, the CYP64 family consists of the highest number of P450 genes (54 genes). Due to the ever expanding superfamily of P450 genes, it has been getting increasingly difficult to classify P450 proteins at the family level based on evolutionary and functional relationships. This has led to the introduction of the term “clan”, which is based on relationships that are beyond family level classifications. Typically, a clan represents a cluster of P450 families across species. Clan-level comparison revealed that the 12 P. chrysosporium P450 families had resemblances to 11 fungal

P450 clans. This suggested that progenitors of the P450 genes in P. chrysosporium were

80 probably acquired from a common ancestor [13]. In addition to the family- and clan-based

classification, genome-wide structural analysis also revealed that the P450 genes are present as

clusters on the genome. As high as 16 P450 gene clusters were identified with the highest

number belonging to the CYP64 family [13].

3.2. CYP63 gene family

CYP63 gene family, the first identified P450 family in white rot fungus, has been the focus of

research since the cloning of the first two members of this family in our laboratory [9]. This

multigene P450 family consists of seven members designated as pc-1 through pc-7. These seven genes are structurally related to each other to different extents at the amino acid levels based on their percentage of similarity or divergence as shown in table 1. The coding sequence in these genes varies from a minimum of 1713 bp in pc-6 to a maximum of 1809 bp in pc-3 [13, 14], and is interrupted by multiple small introns in a conserved manner. The typical sequence motifs, namely I-helix, K-helix, and HR2 region were also quite conserved. In our pre-genomic cloning

efforts, the first three genes pc-1 (CYP63A1), pc-2 (CYP63A2), and pc-3 (CYP63A3) of this family were shown to be tandemly linked [9] and were subsequently localized on the same scaffold in the genome [6]. pc-1 was found to be alternatively spliced, based on the two splice variants detected in cultures grown under nutrient-rich conditions. Sequencing of the 5’ proximal part of the cDNA sequence revealed five introns in variant 1 as compared to four introns in variant 2 [9]. Two other genes of this family, pc-5 (CYP63B1) and pc-6 (CYP63B2) were subsequently found to be tandemly linked but on a different scaffold in the genome. The other

81 two genes in this family, pc-4 (CYP63A4) and pc-7 (CYP63C1) are localized on different scaffolds in the genome.

3.3. Native (transcriptional) expression of P450 enzymes of P. chrysosporium under varied physiological and biodegradation conditions

3.3.1. Physiological regulation of expression of P450 monooxygenases

3.3.1.1. Global P450 gene regulation: We developed the first custom-designed 70 mer oligonucleotide chip [7, 8] based on the predicted P450 genes. Our microarray analysis using this chip revealed that all the P450 genes are constitutively expressed, both under ligninolytic (low

N) and non-ligninolytic (high N) conditions. However, 27 of the P450 genes were found to be differentially regulated between the two nutrient conditions. Of the 27 genes, 23 genes were upregulated under high N conditions, where as 4 genes showed upregulation under low N conditions [7, 8]. Our phylogenetic analysis of the whole P450ome had revealed that P450 genes could be clustered into 16 genomic clusters. Of these, 10 clusters showed non-assortative regulation of expression of its member genes suggesting divergence of function associated with the encoding P450 enzymes [8]. Specifically, the microarray analysis also revealed that pc-1 expression was downregulated to an extent of 0.48 fold in high N medium as compared to low N medium. On the other hand, expression of pc-2 was 2.26 fold upregulated in high N condition as compared to low N condition [8, Table 2]. Expression of pc-3 remained at a steady state under both the nutrient conditions.

82 3.3.1.2. CYP63 specific gene regulation: Our initial transcriptional analysis (pre-genomic) using

quantitative real time RT-PCR had revealed that pc-1 expression was highest in the defined low nitrogen (low N) medium as compared to high N (high nitrogen) or malt extract (ME) medium

[9]. In contrast, pc-2 was found to be expressed at an overall higher level under high N conditions. These differential expression patterns in response to nutrient levels were found consistent with our subsequent global analysis using the first custom-designed P450 microarray described above [8]. Time course transcriptional analysis of the CYP63 genes by quantitative real time RT-PCR revealed peak expression on day 4 for both pc-1 and pc-2 under defined low N

and high N conditions, respectively [10]. Like pc-1, pc-3 expression was found to be higher in

the defined low N medium as compared to the high N and ME medium [11].

Effect of temperature was studied for the three tandemly linked genes (pc-1, pc-2, and pc-

3) in low N medium. pc-1 expression was found to be higher at 370 C than at 220 C, where as pc-

2 and pc-3 showed no significant difference between these temperatures [10, 11, Table 2].

Oxygenation seemed to have an overall positive impact on expression of all three genes [10, 11,

Table 2]. Low N cultures using different carbon sources showed varied levels of expression of

pc-1. Highest level of expression was found in glucose, followed by sucrose or raffinose, starch,

and carboxy methyl cellulose (CMC). Growth on sucrose and raffinose as sole carbon sources

showed similar levels of pc-1 expression [10, Table 2]. Expression of pc-1 under high N

conditions was found to be dramatically high as observed in 4 day-old cultures grown on glucose

as sole carbon source. pc-2 expression was found to be relatively higher when grown on sucrose or raffinose as sole carbon source under low N conditions as compared to glucose, starch, or

CMC [10]. pc-3 expression was found to be higher when grown with starch as the sole source of carbon in low N cultures [11, Table 2]. These observations led to the conclusion that although

83 belonging to the same family of cytochrome P450 proteins, and despite being structurally

conserved and tandemly arranged on the same scaffold, the three genes pc-1, pc-2, and pc-3 are independently regulated by nutrients (nitrogen and carbon) and other physiological conditions

(temperature).

3.3.2. Xenobiotic induction of P450 monooxygenases

3.3.2.1. Induction by industrial/environmental chemicals: It is well known that several inducers for eukaryotic P450 monooxygenases can also be the substrates that these enzymes can oxidize

[15]. This prompted us to study the induction pattern of the three CYP63 member genes (pc-1, pc-2, pc-3) in response to several xenobiotic inducers, with an aim to identify their corresponding substrates. P. chrysosporium cultures grown in ME medium (high N and high C) were induced with 42 different xenobiotic compounds that represented a wide range of chemical

structures, including aliphatics, aromatics, polyaromatics, alkyl-substituted aromatics, alicyclics,

and lignin derivatives. Classical eukaryotic P450 inducers (phenobarbital, estradiol) were also

used for reference purposes. We selected the ME medium for studying the induction pattern

firstly, because peroxidase expression (LiP and MnP) is known to be suppressed under these

conditions, and secondly, P450-mediated oxidation of xenobiotics has been reported under these

culture conditions earlier [3, 4, 5]. Majority of the compounds tested in this study were included

because of their known degradability by P. chrysosporium in laboratory studies [2]. While pc-1

was shown to be highly induced by monocyclic aromatics (alkyl-substituted aromatics,

hydroxylated aromatics) and lower molecular weight PAHs (2-4 rings), pc-2 was induced by

high molecular weight PAHs (4-5 rings), and environmentally recalcitrant chemicals DDT, and

84 long-chain alkylphenols [10, Table 2]. Our observation that both pc-1 and pc-2 are induced by

alkyl-substituted aromatics could be attributed to the fact that a conserved motif (RDTTAG) in

the I-helix of these genes was similar to that present in other alkane-hydroxylating P450 proteins

[9]. This further supported our hypothesis that inducers for at least some of the P450 enzymes could likely be their substrates as well. PC-3, which also falls under the same family of P450 monooxygenases was also expected to show similar induction pattern in response to xenobiotic substances, since it shared a close overall aa homology of 85.2% with PC-2 and 58.9% with PC-

1 (Table 1), and also shared the conserved putative substrate-binding domain in the helix-I. In fact, pc-3 was also found to be induced in response to linear alkanes similar to pc-2, and by simple aromatics similar to pc-1 in our subsequent analysis. Polycyclic aromatic compounds were however shown to induce all the three P450 genes, albeit to varying extents [10, 11, Table

2].

3.3.2.2. Induction by lignin derivatives: In addition to the individual xenobiotic chemicals, we also tested the induction of CYP63 genes with the following commercially available lignin derivatives: lignin alkali, lignin alkali carboxylated, lignin alkali 2-hydroxy propyl ether, and lignosulfonic acid. Interestingly, both pc-1 and pc-2 were induced several folds with lignosulfonic acid [10, Table 2]. pc-3, however, responded only to lignin alkali [11, Table 2].

These compounds are used as dispersing agents in industrial applications. These observations added further credibility to the current working hypothesis that lignin after depolymerization by the non-specific peroxidase enzyme system can be internalized by the fungal hyphae and the lignin derivatives can then induce the P450 enzymes for subsequent breakdown of the lignin during its mineralization to CO2.

85

3.4. Heterologous expression of the cytochrome P450 monooxygenases of P. chrysosporium

The observed differential regulation pattern of the CYP63 family of proteins in response to physiological and biodegradation conditions, and their responses to specific chemical compounds provided an impetus for us to study their role in degradation of the identified likely xenobiotic substrates. An innate problem associated with studying the role of cytochrome P450 enzymes in the native host (P. chrysosporium) is their redundancy coupled with the difficulty in purifying the P450 monooxygenase of interest from the pool of ~ 150 P450 proteins that this fungus expresses. Hence, in order to pursue this goal, we undertook heterologous expression studies on selected P450 system genes in our laboratory. As has been the case with peroxidase genes, heterologous expression of P450 monooxygenases revealed inherent problems, presumably because of the high GC composition and divergent codon usage in this organism.

This necessitated codon optimization and/or use of different expression systems to achieve translation. A brief account of the different attempts made and their outcomes in the different expression systems is discussed in the following sections.

3.4.1. Expression in E. coli

Our initial efforts to heterologously express PC-1 (CYP63A1) enzyme in E. coli strain

BL21(DE3) did not yield the translation product. The plasmid vector system used in this effort was the E. coli-yeast shuttle vector lambda YES. Our subsequent efforts to express other proteins from this CYP family namely PC-2 and PC-3 in this vector system also did not yield the desired

86 product. Differences in codon usage could be one possible answer to the general inability of E. coli to express proteins from eukaryotic systems like P. chrysosporium efficiently. It is well known that differences in codon usage can result in reduced translation due to the lack of specific tRNAs required by the translation machinery in such systems [16, 17]. We therefore codon optimized one of the CYP63 genes (pc-1) and got its cDNA custom-synthesized (Bio S&T Inc.,

Canada) in a way that it would be recognized both in the yeast Saccharomyces cerevisiae and in

E. coli. We followed the common rules for codon optimization; all alanines were replaced by

GCT, arginines by AGA, asparagines by AAT, aspartic acid by GAT, cysteine by TGT, glutamine by CAA, glutamic acid by GAA, glycine by GGT and GGA, histidine by CAT, isoleucine by ATT and ATC, leucine by TTA, CTA, and TTG, lysine by AAG, phenylalanine by

TTC and TTT, proline by CCA and CCT, serine by TCT, threonine by ACT, tyrosine by TAT, and valine by GTC and GTT. Sequence variation introduced in the “synthesized pc-1 gene” as compared to the “native pc-1 gene” is shown in fig. 1. Among the incubation temperatures tested, 370 C supported the highest levels of expression (Fig 2A). We therefore used these conditions for our further expression studies. While the expression levels were high, our analysis revealed that most of the protein remained as inclusion bodies, which are aggregates of misfolded protein (Fig. 2B). Formation of such inclusion bodies is a common phenomenon that has been observed during expression of several eukaryotic proteins, especially membrane proteins in E. coli [18, 19].

In contrast, PC-3 was successfully expressed in E. coli in soluble form using a similar expression system [11]. However, the amount of protein expressed was not as abundant as that of the PC-1.

This could be explained by the codon optimization effect in pc-1 as compared to pc-3 that had the original gene sequence. Expression of these two genes demonstrated that P450 expression in

87 BL21-derived strains like RosetteBlue(DE3) was superior to that in the original strain. Although,

protein expression was observed for both PC-1 and PC-3, the expressed proteins did not yield a

typical P450 spectrum. Low expression levels of these proteins could be the likely reason for

undetectable spectrum. Our initial efforts to refold the otherwise abundant misfolded PC-1

protein also did not yield the desired results.

3.4.2 Expression in Yeast

Considering the constraints in E. coli system, we decided to attempt expression of the

synthesized pc-1 gene in a eukaryote using Saccharomyces cerevisiae expression system (see

Methods section). Western blot analysis revealed that microsomal extracts prepared from the cells of a transformant showed PC-1 expression after 12 h of induction with galactose (Fig. 3a).

However, the microsomal fraction did not yield the detectable P450 spectrum possibly because of the low level of expression.

3.4.3 Expression in Baculoviral expression system

Baculoviral expression systems are increasingly being used for heterologous expression of cytochrome P450 enzymes from plants and animals. This expression host has proven to be a useful system especially for proteins which need post-translational modifications eg. glycosylation. Several P450 enzymes from higher eukaryotes (humans, mouse, bovine, and plants) have been shown to be functionally produced in this heterologous expression system. We therefore attempted to express PC-1 in a commercially obtained insect cell expression system

88 (Invitrogen Corp., USA), as described under Methods section. Western blot analysis using anti-

PC1 polyclonal antibody raised against a PC-1-specific peptide detected PC-1 expression in this system starting from 24 h post addition of hemin (Fig. 3B). However, the problem associated with observation of a typical soret peak at 450 nm still remained indicating that the expressed protein concentration may not adequate for such analysis.

Based on previous studies, it is apparent that P. chrysosporium proteins are not so easy to express in common heterologous hosts. Especially, attempts to express lignin peroxidases in hosts such as E. coli, yeasts, and insect cells have met with similar difficulties and variable success [20, 21, 22, 23, 24]. Nevertheless, our attempts to express white rot P450s have led to the following conclusions. First, there is an extreme codon bias as shown by increased expression of

PC-1 in the bacterial system after codon optimization. This problem could also be solved in part by using improved recipient derivative strains that possess additional plasmids encoding the rare tRNAs required for expression of eukaryotic proteins. Second, although these fungal P450 proteins show expression to a certain extent in eukaryotic systems like Saccharomyces cerevisiae

(although by not all strains) and baculoviral systems, they do not show typical P450 spectrum possibly because they do not undergo the correct folding pattern either due to the native environment of these heterologous systems or due to the lack of incorporation of heme into the protein. Alternately, the level of expression of these proteins in the eukaryotic systems was probably not high enough to allow detection of the typical P450 soret peak. This problem has been commonly observed in the past with baculoviral system [24]. These issues point to the need for more intensive efforts towards protein refolding or towards strategies for increasing the levels of expression in these heterologous systems.

89

3.5. Heterologous expression of white rot fungal P450 oxidoreductase in E. coli

In contrast to the cytochrome P450 monooxygenases, the P450 oxidoreductase gene (POR) was successfully expressed in the bacterial expression system (E. coli). Oxidoreductases are electron transferring proteins that transfer electrons from NADPH to P450 monooxygenases, which in turn catalyze the oxidation of chemical compounds. The POR protein expressed in E. coli was detected both by Western blot analysis using anti-POR antibody as well as by performing cytochrome C reductase assay [12]. Purification of the expressed POR protein was done by passing the extract through Ni-NTA agarose column (Fig. 4). We were able to purify the POR protein up to 18 fold in comparison to the crude extract. The purification led to an increase in the specific activity of the protein from 40.7 U/mg to 732.95 U/mg (Table 3).

4. Conclusions

Our studies reported herein on the P450 enzyme system in P. chrysosporium have led to an understanding of the regulation of expression of the P450 enzymes in general and CYP63 enzymes in particular in this model white rot fungus. Global expression analysis showing constitutive expression of all P450 enzymes in a broad nutrient range (low to high) implies their wider involvement in the catalytic activity of this organism. Differential upregulation of certain

P450 enzymes under nutrient-limited and nutrient-sufficient conditions points to their likely specific role under ligninolytic and non-ligninolytic conditions, respectively. The transcriptional expression patterns of the individual members of CYP63 family showed that these P450 genes

90 are independently regulated despite being structurally conserved and tandemly linked in the genome. A substrate-specificity among the CYP63 enzymes is indicated based on their differential pattern of induction by different xenobiotic chemicals/substrates and lignin derivatives. A more comprehensive understanding of the transcriptional expression of these important biocatalysts in response to individual classes of xenobiotics and lignin-derived compounds could help in designing better conditions for bioremediation of diverse toxic chemicals found in the environment and ligninolysis/bioconversion processes. The heterologous enzyme expression studies on components of the P450 enzyme system of P. chrysosporium have yielded a functionally active purified P450 oxidoreductase for use in future catalytic analysis.

Efforts on CYP63 P450 monooxygenases, that yielded low levels of expressed proteins or inactive proteins, have brought out the key problems encountered in expressing these membrane proteins in non-native systems. Future efforts will focus on using other species and strains of yeast and filamentous fungal hosts as well as toward refolding of the bacterially expressed proteins to obtain sufficient active white rot fungal P450 proteins for catalytic analysis and applications. Considering the unlimited oxidizing potential of P. chrysosporium, it is conceivable that its large P450 contingent may represent an unusually high number of potentially important industrial enzyme biocatalysts. This catalytic versatility may justify the time and effort expected to delineate the function of these enzymes from this organism.

Acknowledgements

This work was supported by the NIH’s National Institute of Environmental Health Sciences

(NIEHS) grant R01-ES10210 (J.S.Y.). We thank Harshavardhan Doddapaneni for insightful discussions during the course of this study.

91 References

[1] Bumpus JS, Aust SD. Biodegradation of environmental pollutants by the white rot fungus Phanerochaete chrysosporium: involvement of the lignin degrading system. Bioessays 1987;6:166-70.

[2] Pszczynski A, Crawford RL. Potential for bioremediation of xenobiotic compounds by the white rot fungus Phanerochaete chrysosporium. Biotechnol Prog 1995;11:368-79.

[3] Yadav JS, Lawrence DL, Nuck BA, Federle TW, Reddy CA. Biotransformation of linear alkylbenzene sulfonate (LAS) by Phanerochaete chrysosporium: oxidation of alkyl side- chain. Biodegradation 2001;12:443-53.

[4] Yadav JS, Reddy CA. Degradation of benzene, toluene, ethylbenzene, and xylenes (BTEX) by the lignin-degrading basidiomycete Phanerochaete chrysosporium. Appl Environ Microbiol 1993;59:756-62.

[5] Sutherland JB, Selby AL, Freeman JP, Evans FE, Cerniglia CE. Metabolism of phenanthrene by Phanerochaete chrysosporium. Appl Environ Microbiol 1991;57:3310- 16.

[6] Martinez D, Larrondo LF, Putnam N, Gelpke MD, Huang K, Chapman J, et al. . Genome sequence of the lignocellulose degrading fungus Phanerochaete chrysosporium strain RP78. Nat Biotechnol 2004;22:695-700.

[7] Yadav JS, Doddapanani, H. Genome-wide expression profiling and xenobiotic inducibility of P450 monooxygenase genes in the white rot fungus Phanerochaete chrysosporium. In: Anzenbacher P, Hudecek J, editors. Cytochrome P450 biochemistry, biophysics and drug metabolism. Bologna: Monduzzi Editore; 2004, p. 333-40.

[8] Doddapaneni H, Yadav JS. Microarray-based global differential expression profiling of P450 monooxygenases and regulatory proteins for signal transduction pathways in the white rot fungus Phanerochaete chrysosporium. Mol Genet Genomics 2005;274:454-66.

[9] Yadav JS, Soellner MB, Loper JC, Mishra PK. Tandem cytochrome P450 monooxygenase genes and splice variants in the white rot fungus Phanerochaete chrysosporium: cloning, sequence analysis, and regulation of differential expression. Fungal Genet Biol 2003;38:10-21.

[10] Doddapaneni H, Yadav JS. Differential regulation and xenobiotic induction of tandem P450 monooxygenase genes pc-1 (CYP63A1) and pc-2 (CYP63A2) in the white-rot fungus Phanerochaete chrysosporium. Appl Microbiol Biotechnol 2004;65:559-65.

[11] Doddapaneni H, Subramanian V, Yadav JS. Physiological regulation, xenobiotic induction, and heterologous expression of P450 monooxygenase gene pc-3 (CYP63A3), a

92 new member of the CYP63 gene cluster in the white-rot fungus Phanerochaete chrysosporium. Curr Microbiol 2005;50:292-98.

[12] Guengerich FP. Analysis and characterization of Enzymes. In: Hayes AW, editor. Principles and methods of toxicology. New York: Raven Press Ltd; 1989, p. 777-813.

[13] Doddapaneni H, Chakraborty R, Yadav JS. Genome-wide structural and evolutionary analysis of the P450 monooxygenase genes (P450ome) in the white rot fungus Phanerochaete chrysosporium: evidence for gene duplications and extensive gene clustering. BMC Genomics 2005;6:92.

[14] Yadav JS, Doddapaneni H, Subramanian V. P450ome of the white rot fungus Phanerochaete chrysosporium: structure, evolution and regulation of expression of genomic P450 clusters. Biochem Soc Trans 2006; 34:1165-69.

[15] Anzenbacher P, Anzenbacherova E. Cytochrome P450 and metabolism of xenobiotics. Cell Mol Life Sci 2001;58:737-747.

[16] Kane JF. Effects of rare codon clusters on high-level expression of heterologous proteins in Escherichia coli. Curr Opin Biotechnol 1995;6:494-500.

[17] Goldman E, Rosenberg AH, Zubay G, Studier FW. Consecutive low-usage leucine codons block translation only when near the 5' end of a message in Escherichia coli. J Mol Biol 1995;245:467-73.

[18] Lambalot RH, Cane DE, Aparicio JJ, Katz L. Overproduction and characterization of the erythromycin C-12 hydroxylase, EryK. Biochemistry 1995;34:1858-66.

[19] Brandt ME, Vickery LE. Expression and characterization of human mitochondrial ferredoxin reductase in Escherichia coli. Arch Biochem Biophys 1992;294:735-40.

[20] Conesa A, Punt PJ, van den Hondel CAMJJ. Fungal peroxidases: molecular aspects and applications. J Biotechnol 2002;93:143–58.

[21] Doyle WA, Smith AT. Expression of lignin peroxidase H8 in Escherichia coli: folding and activation of the recombinant enzyme with Ca2+ and haem. Biochem. J. 1996;315:15–19.

[22] Whitwam R, Tien M. Heterologous expression and reconstitution of fungal Mn peroxidase. Arch. Biochem. Biophys. 1996;333: 439–46.

[23] Whitwam RE, Gazarian IG, Tien M. Expression of fungal Mn peroxidase in E. coli and refolding to yield active enzyme. Biochem Biophys Res Commun 1995; 216:1013–17.

[24] Pease EA, Aust SD, Tien M. Heterologous expression of active manganese peroxidase from Phanerochaete chrysosporium using the baculovirus expression system. Biochem Biophys Res Commun 1991;179:897–903.

93 Figure legends

Fig. 1. Sequence alignment of the native sequence (pc-1) and the codon-optimized sequence (pc-

1-syn) of CYP63A1 cDNA of P. chrysosporium. MegAlign 5.05 and GeneDoc Version 2.6.002 softwares were used for the alignment. Altered bases are not highlighted.

Fig. 2. Heterologous expression of the white rot fungal P450 monooxygenases PC-1 and PC-3 in

E. coli.

A: Left panel, Effect of temperature on PC-1 expression. Right panel, Expression of PC-1 in E. coli at 370 C. 1 – uninduced inclusion bodies, 2 – induced inclusion bodies, 3 – vector control, 4

– induced soluble fraction, 5 - uninduced soluble fraction.

B: Left panel, Effect of temperature on PC-3 expression. Right panel, Expression of PC-3 in E. coli at 370C. 1 – uninduced soluble fraction, 2 – induced soluble fraction, 3 – vector control.

Fig. 3. Heterologous expression of the white rot fungal P450 monooxygenase PC-1 in eukaryotic expression systems.

A. PC-1 expression in Saccharomyces cerevisiae. Yeast cultures grown in SCD-ura and induced with 2% galactose for varying incubation times (0h, 4h, 8h, 12h, 16h, 20h, and 24h) were harvested and the expressed protein was detected using anti-his antibody.

B. PC-1 expression in Baculoviral cell line. Sf9 cells expressing PC-1 protein were harvested after 24h, 48h, 72h, and 96h post addition of hemin and the expressed protein was detected using anti-PC-1 antibody.

94 Fig. 4. Heterologous expression of the white rot fungal P450 oxidoreductase (POR) in E. coli and its purification.

A. Total protein extract was passed through Ni-NTA column followed by washing and elution with increasing concentrations of imidazole. An equal volume was loaded on a 10% SDS-PAGE gel followed by silver staining of the gel.

B. Western blot analysis using anti-POR antibody.

M, Marker; F, Flowthrough; W, Washing; E, Elutions.

95

Figure 1

96

250C 300C 370C 1 2 3 4 5 A

250C 300C 370C 1 2 3 B

Adapted from reference 11

Figure 2

97

A B C 24h 48h 72h 96h 4h 8h 12h 16h 20h 24h

Figure 3

98

A M F1 W1 W2 W3 W4 B E1 E2 M

B M F1 W1 W2 W3 W4 B E1 E2 M

Figure 4

99 Table 1. Deduced protein sequence distances among the members of CYP63 family as determined using MegAlign 5.05

Percent Similarity

PC-1 PC-2 PC-3 PC-4 PC-5 PC-6 PC-7

PC-1 *** 58.9 58.9 49.5 35.2 34.7 32 PC-1 D i PC-2 57.5 *** 85.2 47.6 34.4 33.5 33.5 PC-2 v e PC-3 57.5 16 *** 48.6 34.9 33.3 34 PC-3 r PC-4 80.5 82.2 79.2 *** 37.4 36.4 33.3 PC-4 g e PC-5 128.3 128 129.9 125.1 *** 76.9 42.3 PC-5 n c PC-6 125.6 127.7 129.9 118.5 27 *** 42.4 PC-6 e PC-7 143 135.9 133.9 140.9 93 97.4 *** PC-7

PC-1 PC-2 PC-3 PC-4 PC-5 PC-6 PC-7

Values shown in horizontal axis represent percent similarity. Values shown in vertical axis represent divergence in terms of phylogenetic distance.

100 Table 2. Effect of different physiological conditions and xenobiotic treatments on induction of the tandemly-linked P450 members of the CYP63 family

Fold expression Variable pc-1 pc-2 pc-3 Growth condition

High N vs Low N 0.48 ± 0.18 * 2.26 ± 0.23 * 1.12 ± 0.07 * 37 0C vs 22 0C (Low 2.13 ± 0.04 0.84 ± 0.04 0.95 ± 0.06 N)

O2 vs Air (Low N) 3.67 ± 0.10 17.69 ± 2.80 2.17 ± 0.48

Carbon source

Sucrose vs Glucose 0.77 ± 0.03 2.01 ± 0.02 0.80 ± 0.00

Raffinose vs Glucose 0.71 ± 0.01 2.43 ± 0.15 0.77 ± 0.19

Starch vs Glucose 0.37 ± 0.04 1.35 ± 0.19 2.00 ± 0.05

CMC vs Glucose 0.27 ± 0.07 1.63 ± 0.00 0.78 ± 0.02

Xenobiotics 0.78 ± 0.20 – 5.11 ± 0.31 ± 0.03 - 31.48 0.07 ± 0.00 – 4.85 ± Aliphatics 0.16 ±0.32 0.15 0.64 ± 0.13 – 1.62 ± 1.36 ± 0.19 – 6.24 ± 1.50 ± 0.13 – 2.73 ± Aromatics 0.06 0.24 0.00

1.38 ± 0.07 – 6.27 ± 1.02 ± 0.12 – 6.02 ± 0.93 ± 0.44 – 2.87 ± Poly aromatics 0.48 1.39 0.09 Alkyl-substituted 0.34 ± 0.21 – 6.18 ± 0.76 ± 0.08 – 23.63 ± 0.01 ± 0.00 – 2.21 ± aromatics 1.14 7.5 0.11 Alicyclics 0.27 ± 0.32 0.24 ± 0.06 0.39 ± 0.02 0.64 ± 0.41 – 4.97 ± 3.69 ± 0.31 – 3.81 ± 1.00 ± 0.22 – 1.19 ± P450 inducers 0.65 0.68 0.04 0.89 ± 0.46 – 8.61 ± 0.72 ± 0.45 – 4.56 ± 1.69 ± 0.02 – 2.77 ± Lignin derivatives 1.35 2.31 0.09 Values given are means ± standard deviations obtained from quantitative real time RT-PCR data. * indicates values obtained from custom P450 microarray experiment. Data compiled from references 4, 7, 8, 9, 10.

101

Table 3. Purification of the recombinant white rot fungal POR heterologously expressed in E. coli, monitored in terms of specific activity, yield, and fold purification

Total Total Total Specific Protein Activity Yield Purification Volume Protein Activity Activity (mg/ml) (U/ml) (%) (X) (ml) (mg) (U) (U/mg) Crude 50 1.2 60 48.85 2442.5 40.7 100 1 extract Purified 3 0.22 0.66 161.25 483.75 732.95 19.8 18 protein

102 Chapter V

P450 redox enzymes in the white rot fungus Phanerochaete chrysosporium: gene transcription, heterologous expression, and purification of the expressed proteins

V. Subramanian, H. Doddapaneni, J. S. Yadav*

Environmental Genetics and Molecular Toxicology Division, Department of Environmental Health, University of Cincinnati College of Medicine, Cincinnati, OH 45267-0056, USA

Running title: P450 redox proteins in P. chrysosporium

Keywords: Phanerochaete chrysosporium; cytochrome P450 oxidoreductase; cytochrome b5; cytochrome b5 reductase; heterologous expression

*Corresponding author. Tel.: +1 513 558 4806; Fax: +1 513 558 4397; E-mail address: [email protected]

This chapter is written as a manuscript ready for submission.

103 Abstract

In continuation of our pre-genomic efforts that led to the first cloning and molecular

characterization of the POR of this organism, here we report functional characterization of this

and the other two P450 redox proteins, cytochrome b5 (cyt b5) and cytochrome b5 reductase (cyt

b5r) revealed by the whole genome sequencing. Their transcript abundance followed the order

POR > cyt b5r > cyt b5, and no clear differential transcription was observed for any of these genes during the primary and secondary phases of growth. Interestingly, the three genes showed an overall higher expression in the defined carbon-limited cultures with low N (LN) or high N

(HN) versus the carbon-rich malt extract (ME) cultures. cDNA cloning and analysis revealed the following deduced protein characteristics: cyt b5 (238 aa, 25.38 kDa) and cyt b5r (321 aa, 35.52 kDa). Phylogenetic analysis showed that the cloned cyt b5 belongs to the newly identified class of fungal cyt b5 proteins. Cyt b5 and cyt b5r were heterologously expressed in E. coli. The recombinant enzymes were purified using Ni-NTA agarose column. POR was heterologously expressed in Saccharomyces cerevisiae and was purified in active form as evidenced by its cytochrome c reduction activity.

104 1. Introduction

Phanerochaete chrysosporium, a model white rot basidiomycete fungus, has been most intensively studied for understanding the physiology, biochemistry, and genetics of biodegradation of lignin and toxic chemical pollutants by white rot fungi [1,2]. This fungus has been shown by us and others to degrade and mineralize a broad range of organic toxicants including substituted or unsubstituted monocyclic and polycyclic aromatics, aliphatics, and cycloalkanes [reviewed in 3, 4]. Both extracellular and intracellular enzymes are involved in these biodegradation processes. While previous studies have focused on the extracellular peroxidases, little is known about the intracellular oxygenases.

Alternate oxidizing systems including P450 monooxygenases have been shown to play important role as initial oxidizing systems in this fungus for biotransformation of different xenobiotics [5,6,7,8]. Recent whole genome sequencing [9] has revealed that this fungus carries a large P450 contingent comprising of ~ 150 P450 genes, arranged in 16 gene clusters that are groupable under existing 12 CYP families and 11 fungal CYP clans [10]. Our initial studies

[11,12] and subsequent whole genome analysis [10] showed that this fungus possesses a typical microsomal type P450 system as in higher eukaryotes, containing multiple monooxygenases and a common reductase component.

The NADPH-dependent cytochrome P450 oxidoreductase (E.C.1.6.2.4; POR), formerly abbreviated as CPR, is known to serve as a common electron donor to multiple monooxygenases in a typical microsomal P450 system, although multiple PORs have been recently reported in certain plants [13,14] and even fungi [15]. The electron transfer proceeds from NADPH to the

POR (via its FAD and FMN domains), to the P450 heme. This flavoprotein is also involved in

105 other physiological functions in eukaryotic systems, such as its role as electron donor to cytochrome b5 [16], heme oxygenase [17], squalene epoxidase [18], and the fatty acid elongation system [19]. POR has also been shown to initiate lipid peroxidation by one-electron reduction of molecular oxygen [20]. Interestingly, it has been shown that lipid peroxidation in intact P. chrysosporium cells is involved in the oxidation of polycyclic aromatic hydrocarbons that are not the substrates for lignin peroxidases due to their high (> 7.55 eV) ionization potential and in ligninolysis [21, 22, 23].

Cytochrome b5 reductase (E.C.1.6.2.2, cyt b5r), a membrane-bound flavoprotein containing a single FAD as a prosthetic group, catalyzes the reduction of cytochrome b5 (cyt b5) utilizing NADH as an electron donor. It belongs to the ferredoxin:NADP+ reductase (FNR) family of flavoproteins [24] that includes POR [25], assimilatory nitrate reductase [26], and nitric oxide synthase [27]. Cyt b5 is known to be involved in a number of oxidative reactions, which include metabolism of fatty acids [28], steroids and endogenous compounds. The role of cyt b5 as an obligate partner and modifier in xenobiotic biotransformation is well documented for higher eukaryotes [29].

Typical eukaryotic P450 monooxygenases primarily obtain both the electrons, needed for their monooxygenation reaction, from the POR, although involvement of an alternate electron transfer mechanism via the cyt b5 reductase-cyt b5 chain in providing one of the two electrons

(the second electron) from NADH to the P450 monooxygenase has been known [29]. Recent studies in plants also showed that cyt b5 stimulates the activity of a cytochrome P450 enzyme

(flavonoid 3’,5’-hydroxylase) that is involved in the synthesis of anthocyanins, which confer blue color to the flowers [30]. Presently, no information is available with respect to the functional expression or role of cyt b5 and cyt b5 reductase in P450 mediated reactions in P.

106 chrysosporium. Since an extraordinarily large P450 monooxygenase contingent (~ 150 P450s) is

present in P. chrysosporium, we hypothesize that the single POR enzyme present in this

organism would be insufficient to cater to the electron transfer needs of all the P450 enzymes.

Therefore it seems likely that the alternate redox proteins, cyt b5 and cyt b5 reductase, may be involved in sharing the electron supply during P450 monooxygenation reactions in this system.

As a first step towards this goal, functional characterization of the P450 redox partners is warranted to understand their relative role in the diverse P450 mediated monooxygenation reactions in P. chrysosporium.

A pre-requisite in the development of an efficient P450-based microbial biocatalyst for biotechnological applications is the expression of P450 enzymes along with its homologous

electron transfer proteins in a suitable microbial host that can internalize hydrophobic xenobiotic

chemicals. Here we report heterologous expression of the active P. chrysosporium POR, using our previously cloned cDNA [11], in the yeast Saccharomyces cerevisiae. Additionally, we

report for the first time isolation, structural analysis, and transcriptional regulation of cyt b5 and

cyt b5r in comparison with POR under varied physiological conditions. Furthermore,

heterologous expression of the P450 redox proteins, cyt b5 and cyt b5r, in E. coli followed by their purification is presented. Parts of this work were presented at the 103rd and 106th general meetings of the American Society for Microbiology [31,32].

2. Materials and methods

2.1 Fungal strain and culture conditions

107 Phanerochaete chrysosporium strain BKM-F 1767 (ATCC 24725) was maintained on

malt extract agar (Difco Laboratories, USA) as previously described [7]. It was grown under

nutrient-limited culture conditions using the defined low N (LN) medium (2.4 mM N, 1% glucose), and nutrient-rich culture conditions using the defined high N (HN) medium (24 mM N,

1% glucose) and the complex malt extract (ME) medium (8 mM N, 2 % glucose) as previously described [33]. The mycelial mass was harvested by vacuum filtration, washed with sterile water, and frozen at –800C for subsequent use in RNA isolation.

2.2. Analysis of gene transcription

Gene transcripts for POR, cyt b5 and cyt b5r were quantified by real-time quantitative

RT-PCR using Smart Cycler (Cepheid, Inc., USA) and GeneAmp rTth reverse transcriptase

RNA PCR kit per manufacturer’s specifications (Applied Biosystems, USA). Transcript quantitation was based on amplification of a ~ 350 bp segment of the transcript using gene- specific primers listed in Table 1. Time course of transcription was compared for the mycelia grown in low N-, high N-, and ME-medium, using 50 ng aliquots of total RNA for the RT-PCR analysis. The reverse transcription and amplification conditions were the same as described previously [12]. The number of gene transcripts was assessed as follows. Cycle threshold (Ct)

count for the RT-PCR amplification plot was determined for each sample and was normalized

against the control gene (GPD). The corresponding number of transcripts was deduced from a

standard curve prepared under identical conditions based on quantitation of a 323 bp amplicon

from increasing amounts (103, 104, 105, and 106 molecules) of a standard RNA (Promega Corp.,

USA).

108 2.3. Whole cell protein extracts from P. chrysosporium

Fungal cultures grown in low N-, high N-, and ME- medium were harvested on day 4 of

incubation. The mycelial mass were filtered, washed with 0.1 M sodium phosphate buffer (pH

7.4), and snap frozen (-800 C). During extraction of proteins, the frozen mycelium was thawed, macerated in liquid nitrogen, and vortexed with glass beads using seven pulses of 30 sec each.

The protein extract was clarified twice by centrifugation at 11,000 x g, and subjected to ultracentrifugation (100,000 x g) for 1 h to isolate microsomes, using established procedures

[34].

2.4. cDNA cloning for cyt b5 and cyt b5r

Full-length cDNAs of cyt b5 and cyt b5r were isolated using RT-PCR with gene-specific primers (Table 1). Briefly, the total RNA (1.5 µg) isolated from Day 4 ME culture was reverse

transcribed using the SuperScriptTM First-Strand Synthesis System for RT-PCR system

(Invitrogen Corp., USA), followed by the amplification step using Pfu ultra DNA polymerase

0 (Stratagene, USA). Amplification conditions for cyt b5r included an initial denaturation at 95 C for 120 sec, followed by 35 cycles of amplification, each at 950C for 30 sec, 580C for 30 sec and

720C for 120 sec and a final extension step of 7 min at 720C. Amplification conditions for cyt b5

included 35 cycles, each with denaturation at 950C for 60 sec, annealing at 580C for 60 sec, and extension at 720C for 2 min. The amplified cDNAs were purified using GENECLEAN Kit (BIO

101, USA) and cloned into TOPO 2.1 vector (Invitrogen Corp., USA) following the

manufacturer’s protocol, and subjected to DNA sequencing.

109

2.5. DNA sequencing and bioinformatic analysis of DNA sequence data

Gene Runner program (version 3.0, Hastings Software) was used to extract and analyze

DNA sequences from the whole genome sequence, design the primers for RT-PCR

amplification, and deduce the amino acid sequences for the cloned cDNAs. DNA sequencing

was performed at the University’s DNA core facility. DNA sequences and deduced amino acid

sequences were compared with the non-redundant nucleotide and protein sequence databases

(GenBank, EMBL, DDBJ) using BLASTN and BLASTP or SWISS PROT, respectively.

TMPred analysis helped predict hydrophobic transmembrane domains. Sequences were aligned

using the CLUSTALW program at EMBL-EBI website (http://www.ebi.ac.uk/clustalw/)

followed by editing and shading of the alignment using GeneDoc 2.0.1 Multiple Sequence and

Alignment Editor software. Minimal evolution trees were constructed using the MEGA 2.1

software (http://www.megasoftware.net/) as described previously [10]. A bootstrap value of

1000 was set for tree construction. The protein sequences used in constructing the phylogenetic

trees were obtained from the GenBank and are shown on the tree with accession numbers. The

cDNA sequences cloned in this study have been submitted to GenBank under the accession

numbers- AY862990, AY835609.

2.6. Heterologous expression of the white rot fungal POR in Saccharomyces cerevisiae

P. chrysosporium POR cDNA cloned in our laboratory [11] was used to reamplify the

coding region using the gene-specific primers (Table 1). The PCR amplified sequence,

110 confirmed by DNA sequencing, was cloned into the yeast expression vector pYES2.1/V5-His-

TOPO (Invitrogen Corp., USA) such that the terminal stop codon in the POR sequence was

deleted to allow expression of the downstream C-terminal histidine (His) tag present in the vector. The expression construct containing the POR cDNA in the correct orientation was transformed into S. cerevisiae Y300 (MATa ade2-1 trp1-1 ura3-1 leu2-3, 112 his 3-11, 15 can1-

100) strain using the transformation protocol of the Clontech Laboratories, Inc., USA, with some modifications. A single transformant was then inoculated into synthetic medium lacking uracil

(SCD-ura) containing 2 % glucose and grown overnight at 300 C. This pre-culture was centrifuged, and the cells were washed with sterile water and transferred into 600 ml of SCD-ura

0 medium (containing 2 % galactose) to a final O.D600 of 0.4 followed by incubation at 30 C under shaking conditions. In order to study the time course of POR expression, 100 ml aliquots of the culture, harvested at 4 h intervals, were centrifuged and the cells snap frozen (–800 C). For extraction of proteins, the cells were thawed and resuspended in buffer Y (50 mM Tris pH 7.4, 1 mM EDTA, 5% glycerol, 0.1 mM PMSF, 2 µg/ml Aprotinin, 1 µg/ml pepstatin). The cell suspensions were lysed using bead beating (ten cycles of 30 sec each) on ice and the lysate was centrifuged consecutively at 8000 x g to remove the cell debris and 11,000 x g for further clarification. Microsomes were isolated by centrifuging the clear lysate at 100,000 x g for 1 h followed by resuspension in Buffer Y containing 20% glycerol. The microsomal proteins were separated on a 10 % SDS-PAGE gel followed by Western blot analysis using the cross-reactive anti-POR antibody from S. cerevisiae [35,36].

2.7. Purification and activity analysis of the recombinant POR

111 A POR-expressing S. cerevisiae bulk culture (1-liter) was grown at 30oC for 16 h in the

presence of 2 % galactose in SCD-ura medium. Total microsomal extract was prepared as

described above. An aliquot of the microsomal extract (approximately 25 mg protein) was

diluted to 20 ml in Buffer Y and mixed with the solubilizing detergent CHAPS (3-[(3-

Cholamidopropyl)dimethylammonio]-1-propanesulfonate) to dissolve the membranes, by adding

the detergent slowly to a final concentration of 0.65 % using constant stirring for 1 h at 40 C.

After dissolution of the membranes, 300 mM NaCl and 5 mM Imidazole was added to the

protein extract. All solutions used in the subsequent purification protocol contained 300 mM

NaCl. The microsomal protein solution was mixed with 3 ml of Ni-NTA agarose pre-equilibrated

with Buffer Y containing 300 mM NaCl and 5 mM Imidazole, for 1 h at 40 C and loaded onto a

Nickel-Nitriloacetic acid (Ni-NTA) column (3 ml). The column was washed with the same buffer and the first wash was collected (W1). This was followed by three additional washes with

20 mM imidazole containing buffer Y (W2, W3 and W4). Elution of the purified protein was

done using buffer Y containing 80 mM imidazole and the protein fractions were collected as

eluates (E1, E2 and E3).

The protein fractions were separated on a 10 % SDS-PAGE gel and detected using silver stain or Western blot analysis using anti-His antibody (Santa Cruz Biotech. Inc., USA).

Fractions containing the POR enzyme were then pooled, concentrated using a YM-30 Centriprep centrifugal filter device (Millipore Corp., USA), and dialyzed against Buffer Y. Protein concentration was estimated by the Bradford method (Bio-Rad laboratories, Inc., USA) using bovine serum albumin (BSA) as the standard. Activity of the recombinant fungal POR was assayed by estimating the amount of cytochrome C reduced (CCR) by the enzyme in 1 min, following the established protocol [37].

112

2.8. Heterologous expression of the fungal cyt b5 and cyt b5r in E. coli

Expression of the P. chrysosporium redox proteins, cyt b5 and cyt b5r, was performed in

E. coli using pET30a(+) expression system (EMD Biosciences, Inc., USA). The expression

constructs were prepared as follows. Both cyt b5 and cyt b5r cDNAs, amplified using gene-

specific primers described in Table 1 and sequence confirmed, were directionally cloned into the

pET30a(+) expression vector at the EcoRI and Hind III sites. The cloning strategy was such that

cyt b5 expressed only the N-terminal His tag where as cyt b5r expressed both the N- and the C- terminal His tags. The constructs were confirmed by performing restriction digests and transformed into E. coli BL21 derivative strain RosettaBlue DE3 (EMD Biosciences, Inc., USA) for expression. A common protocol was followed for expression of the two proteins unless specified otherwise. Briefly, an overnight culture of a single colony of the E. coli transformant was inoculated into terrific broth (TB) containing 1 % glucose along with kanamycin (30 µg/ml), chloramphenicol (34 µg/ml) and tetracycline (10 µg/ml). One ml of the culture was transferred

0 into 100 ml of TB containing 1 % glucose and antibiotics and incubated at 37 C to an O.D660 of

0.5. Expression of the recombinant protein was induced by adding 0.5 mM IPTG and incubating for an additional 4 h. The cells were pelleted by centrifugation, washed with 0.1 M sodium phosphate buffer (pH 7.4), and stored at –800 C till further analysis to confirm expression or for further purification of the fungal proteins, as described below.

2.9. Purification of the expressed fungal cyt b5 and cyt b5r

113 The recombinant E. coli cells prepared as above from a 100 ml liquid culture were

thawed and resuspended in 15 ml of Buffer A (20 mM Tris pH 7.5, 20% glycerol, 0.2 mM

EDTA, 0.1 mM EDTA, 0.1 mM PMSF, 2 µg/ml Aprotinin, 1 µg/ml pepstatin) and disrupted by

sonication (20 pulses of 25 sec each). Lysozyme (0.5 mg/ml) and DNase (10 µg/ml) were added

and the suspension was stirred at 40C for 15 min. Ten ml of Buffer B (Buffer A plus 1% Triton

X-100) was then added and the suspension was incubated for additional 20 min with constant stirring. The solubilized protein extract was centrifuged (x 2) at 10,000 g for 15 min. The resulting supernatant containing the expressed recombinant soluble protein, was amended to 300 mM NaCl and 5 mM Imidazole. Forty ml of the amended extract was mixed with 3 ml of Ni-

NTA agarose (pre-equilibrated with Buffer A containing 300 mM NaCl and 5 mM Imidazole) for 1 h at 40 C and loaded onto a column. Subsequent wash and elution steps were similar to

those described above for POR purification, except that elution of cyt b5 was done using 80 mM

imidazole and that of cyt b5r was done using 150 mM imidazole.

Protein concentration was estimated using the procedure of Bradford (Bio-Rad laboratories, Inc.,

USA) as above. The expressed cyt b5 and cyt b5r proteins were detected by silver staining

protocol as well as by performing Western blot analysis using anti-His antibody (Santa Cruz

Biotech., Inc., USA).

3. Results

3.1. Nutritional and temporal regulation of transcription of the P450 redox proteins

114 Transcriptional expression of the POR was observed in both the primary and secondary metabolic phases of growth of P. chrysosporium in the three media conditions (LN, HN, and

ME) studied (Fig. 1A). In LN and HN cultures, the POR transcript number showed peaking on day 3 (HN) and day 4 (LN) coinciding with the transition to the secondary metabolic phase of growth. The ME cultures showed an overall lower expression as compared to LN and HN cultures, and the level of expression in ME decreased over the first 5 days followed by a transient increase on day 6. However, based on the Western blot analysis of the microsomes on day 4 LN,

HN and ME cultures, the POR protein was detectable only under HN conditions, despite almost the same transcript abundance in LN and HN conditions (see Fig. 2).

Cyt b5 showed similar expression pattern as POR, with peaking on day 3 in HN cultures and day 4 in LN cultures. However, its expression differed from that of POR in HN cultures in that a surge was observed from day 5 onwards (late secondary phase). Expression in ME cultures remained low and was nearly constant through the different phases of growth (Fig. 1B).

Cyt b5r expression in LN and HN cultures showed a biphasic peaking, with the first peak appearing at the transition to secondary metabolism (day 3 or 4) like in POR and Cyt b5 and the second peak in the late secondary metabolic phase (day 6). Expression in ME cultures remained almost unchanged with a low peak on day 5 (Fig. 1C).

3.2. Heterologous expression of the white rot fungal POR in yeast and partial purification of the recombinant POR

The P. chrysosporium POR was successfully expressed in the yeast S. cerevisiae.

Expression of the protein in the yeast gradually increased after induction with 2 % galactose

115 during the 8-16 h post-induction period (Fig 3A). Hence, the subsequent purification of the expressed POR was carried out using protein produced after incubation of the yeast transformant for 16 h in the presence of the inducer (galactose). The recombinant POR protein migrated as a single band on the SDS-PAGE gel, appearing between 82 kDa and 115 kDa size protein standards (being closer to the 115 kDa band) in Western blot analysis (Fig. 3B2). The apparent molecular weight of the expressed protein was higher than the calculated molecular weight of the

His-tagged protein (87.14 kDa); the tag contributed an additional 5.74 kDa to the native protein.

Purification of the expressed POR using Ni-NTA agarose (Qiagen Inc., USA) column at varying concentrations of imidazole in the elution buffer showed that the protein selectively elutes at 80 mM imidazole concentration in two different fractions (Fig. 3B1). The purified recombinant fungal POR was found to be functionally active, as evidenced by cytochrome c reduction.

Specific activity of the purified POR protein was found to be 91.66 U/mg with an overall 7.5- fold purification (Table 2).

3.3. cDNA cloning and analysis for cyt b5 and cyt b5r

Use of gene-specific primers (Table 1) allowed isolation of full-length cDNAs of the two electron transfer proteins, cyt b5 and cyt b5r. The isolated cDNAs of cyt b5 (717 bp) and cyt b5r

(966 bp) encode 238 aa and 321 aa long deduced proteins, respectively. Sequence alignment of the cDNAs with their corresponding genomic sequences obtained from the US-DOE’s Joint

Genome Institute website, revealed that cyt b5 and cyt b5r genes contain 2 introns (one each of type 0 and type I) and 3 introns (one each of type 0, type I and type II), respectively. The intron sizes (bp) were 51 bp and 60 bp for cyt b5 and 56 bp, 61 bp, and 470 bp for cyt b5r. The cloned

116 cyt b5 cDNA has a GC content of 60.5 % and a Tm of 83.80 C. On the other hand, the cloned cyt b5r cDNA has a GC content of 58.8 % and a Tm of 83.30 C. The predicted molecular weights of these proteins were 25.38 kDa (cyt b5) and 35.52 kDa (cyt b5r).

Comparison of the two proteins with known eukaryotic cyt b5 and cyt b5r proteins, respectively revealed several conserved regions (Fig. 4A, 4B). Alignment of the deduced amino acid sequence of the cloned cyt b5 with cyt b5 protein sequences from other organisms

(including experimentally characterized and deduced proteins) and two additional putative cyt b5

(“cyt b5-like”) sequences predicted by JGI from the P. chrysosporium genome revealed the presence of the conserved residues particularly the HPGG motif that corresponded to amino acids H194 to G197 in the cloned protein (Fig. 4A). Interestingly, while the HPGG is located in the sub C-terminus region of the cloned cyt b5 of P. chrysosporium and the hypothetical proteins

from other organisms, this domain was found in the N-terminus region of the conventional

(experimentally characterized) cyt b5 proteins from other organisms (Fig 4A). The two “cyt b5-

like” proteins in the P. chrysosporium genome predicted by the JGI, however, did not contain the

above conserved motif at either location. The phylogenetic tree clustering agreed with that based

on the multiple alignments and showed three distinct clusters (Fig 4C). The conventional cyt b5

and the hypothetical proteins from other organisms formed two separate groups and the two JGI-

predicted proteins of P. chrysosporium formed the third group with a high bootstrap value of 99.

The cloned protein clustered with the hypothetical cyt b5 proteins from Yarrowia lipolytica,

Debaryomyces hansenii, and Ustilago maydis. TMPred analysis of the cloned cyt b5 protein

revealed the presence of no significant transmembrane region that is characteristic of cyt b5-like

proteins.

117 The P. chrysosporium cyt b5r protein showed the characteristic flavin-binding domain

RXY(T/S)XX(S/N) that corresponded to the amino acid stretch R154 to S160 in the expressed

mature protein (Fig. 4B). Phylogenetic tree constructed using other known cyt b5r proteins

suggested that the isolated P. chrysosporium cyt b5r protein was closest to the zygomycetous

fungus Mortierella alpine homolog with a bootstrap value of 61 (Fig. 4D) followed by the

ascomycete Schizosaccharomyces pombe homolog.

3.4. Heterologous expression and purification of the white rot fungal cyt b5 and cyt b5r proteins

Both cyt b5 and cyt b5r were expressed in E. coli using similar strategies, as described under section 2.8. Cyt b5 expressing cells appeared pinkish in color. Expression of both the proteins was confirmed by Western blot analysis on the crude protein extract, before attempting

Ni-NTA column-based scaled-up purification of these proteins (data not shown). Cyt b5 protein eluted in the third (E3) and the fourth (E4) fractions (Fig. 5), corresponding to 80 mM and 150 mM imidazole concentration respectively, where as the cyt b5r protein eluted in the second (E2), third (E3) and the fourth (E4) fractions (Fig. 6), corresponding to 80 mM imidazole concentration. The proteins were shown to separate at the approximate molecular weights of

31.16 kDa for cyt b5 (Fig 5) and 43.66 kDa (Fig. 6) for cyt b5r in silver stained gels as well as in

Western blots.

4. Discussion

118 Considering a large P450 contingent (nearly 150 P450 monooxygenase genes) in P.

chrysosporium, one approach to understand the possible physiological role of the individual

P450 enzymes is to study regulation of these proteins and their redox partners temporally and

under different nutrient conditions. This is because activity of the P450 enzymes directly depends on the kinetic efficiency as well as the expression level of electron transfer (redox) proteins that provide reducing equivalents in order to complete their catalytic cycle [38]. For instance, the activity of P450 benzoate para hydroxylase has been shown to be enhanced by increasing the copy number of POR in Aspergillus niger [39]. On the other hand, deletion of

POR led to an increased sensitivity to benzoate in Gibberella fujikuroi [40]. Furthermore, it has been suggested that regulated expression of reductases selectively controls the activity of P450 monooxygenases in Streptomyces coelicolor [41]. It is therefore likely that the activity of P450 proteins at the functional level could be modulated, at least in part, via transcriptional regulation of the redox proteins in P. chrysosporium.

4.1. Regulation and co-ordinated expression of the P450 redox proteins in P. chrysosporium

This study revealed that the three electron transfer proteins in P. chrysosporium, namely

NADPH-dependent POR, NADH-dependent cyt b5r, and cyt b5, are constitutively expressed during both phases of growth (primary and secondary) in nutrient-limited as well as nutrient-rich media conditions. For POR, the expression was also detected at the translational level. However, the POR protein levels were enough to be within the detection limit only in HN medium, unlike the transcript numbers which were comparable in LN and HN media (Fig. 2). This inconsistency under the two culture conditions could likely be due to the differences in terms of translation

119 efficiency or stability of the protein product. Nevertheless, modifications in POR protein structure occurring in response to changing nutrient conditions, thereby inhibiting recognition by its native antibodies under low N conditions cannot be ruled out

Comparison of the transcriptional pattern of the three redox proteins with our earlier observation on the transcription of the P450 monooxygenase genes (particularly CYP63 family) in this organism [33, 42, 43, 44] under the test nutrient conditions (LN, HN, ME), implies a co- ordinated expression of the P450 redox proteins and the P450 monooxygenases in this fungus.

Although, the transcription of the P450 system components (the monooxygenases and the redox proteins) varies with the nutrient levels, this is far from being a tight nutrient regulation of expression, a phenomenon reported as a hallmark for peroxidases in this organism [45].

Nevertheless, an overall reduced level of transcriptional expression in nutrient-rich ME medium

(high organic N, high C) versus the nitrogen-rich HN medium (high inorganic N, low C) suggests a possible carbon-mediated regulation and/or regulation by nitrogen type (organic versus inorganic), albeit to a limited extent, for the three P450 redox proteins.

This study provides evidence that the redox proteins (POR, cyt b5, cyt b5r) are expressed under the same experimental conditions (physical, nutritional, and temporal) as the P450 monooxygenase genes reported earlier [33, 42, 43, 44], thereby supporting the hypothesis that both the POR and the cyt b5/cyt b5r redox chain are probably involved in transferring electrons to the plethora of P450 monooxygenase enzymes in this fungus. Moreover, the observed constitutive basal expression of the P450 redox proteins during both phases of growth (primary and secondary) supports a broader role of P450 enzyme system in the physiology of this white rot fungus. The likely roles of these intracellular monooxygenase systems may include both the biosynthetic role, such as in the synthesis of growth regulators and signaling molecules [46], and

120 the biodegradation role, such as that in the breakdown of lignin and toxic chemicals. Neither of

these roles has been well characterized for individual new P450s in this fungus so far.

Redox carrier proteins have also been shown to be induced in the presence of typical

P450 inducers such as progesterone in Rhizopus nigricans [47], and dimethylbenzanthracene and

benzo(a)pyrene in Streptomyces coelicolor A3(2) [41]. The possibility of such induction of the electron transfer proteins by some if not all P450 inducers cannot be ruled out in P. chrysosporium.

4.2. Structural and phylogenetic aspects of the redox proteins cyt b5 and cyt b5r

The cDNA-deduced amino acid sequence of cyt b5 protein of P. chrysosporium is divergent from the other characterized eukaryotic cyt b5 proteins. First, the cloned protein (238 aa) was

longer by nearly 90 aa particularly on the N-terminus as compared to the cyt b5 proteins from

other sources. As a result of this sequence extension, the conserved residues of the ‘cytochrome

b5 fold’ that are usually located near the N-terminus (centering around 40 to 75 aa) were found

down stream toward the C-terminus (centering around 190 to 210 aa) of the cloned cyt b5.

Second, the TMpred analysis did not yield any transmembrane domain with significant score (the

predicted weak region around 218 and 236 aa positions had a score of 378) in contrast to a

transmembrane domain found in the other cyt b5 proteins. This might indicate that the cloned cyt

b5 either exists as a soluble protein in the cytosol or is loosely bound to the endoplasmic

reticulum membrane. These two startling differences in the isolated cyt b5 protein prompted us to look for similar cytochrome b5-like proteins with long N-terminal amino acid stretches in other sequenced fungi. Interestingly, the BLAST search on other fungal genomes showed the

121 presence of similar proteins (E-value ≥ 9e-28) suggesting that other fungi also carry cyt b5 proteins of this kind. However, all of them are currently entered in the GenBank as hypothetical proteins and are uncharacterized. Multiple alignment followed by phylogenetic analysis revealed that these alternate cyt b5 proteins form a separate cluster on the phylogenetic tree (Fig. 3C). The first 50-60 aa in the cloned P. chrysosporium cyt b5 have no match in any of these longer cyt b5- like proteins in other fungi suggesting a hitherto uncharacterized function for this N-terminal stretch of the protein.

The isolated cyt b5r protein showed high sequence similarity with the other cyt b5r proteins suggesting that this protein might possess functional characteristics similar to the cyt b5r proteins from other organisms.

4.3. Heterologous expression and purification of the P450 redox proteins of P. chrysosporium

The ultimate goal of expressing the cytochrome P450 monooxygenase and redox proteins is to exploit this enzyme system as a biocatalyst in biotechnologically or pharmaceutically meaningful biotransformations using xenobiotics and other chemical compounds. In order to achieve this using whole cell biocatalysts, P450 monooxygenase(s) and related redox protein(s) have to be co-expressed in organisms such that they can be directly applied in environmental and industrial biotechnological applications. Our successful heterologous expression of functional white rot fungal POR in S. cerevisiae could pave the way for developing such yeast biocatalysts for P450 catalysis in controlled biotransformations. On the other hand, the purified recombinant fungal POR could be directly used in similar applications requiring reconstituted P450 enzyme

122 system. The level of purification achieved (7.5 fold) should be practically sufficient to perform in vitro catalytic reactions.

While both forms of P450 biocatalyst (whole cell- versus enzyme- biocatalysts) are useful depending on the application, yeast-based whole cell biocatalysts are particularly desirable in xenobiotic biodegradation and biotransformations involving hydrophobic substrates such as polycyclic aromatic hydrocarbons, as the yeasts are capable of internalizing these substrates.

Moreover, the yeast system may allow co-expression of multiple (fungal) P450 monooxygenases along with the homologous fungal POR, for multiplex catalytic studies. Whole cells or the microsomes extracted from such co-expressing recombinants would contain all the components needed to drive the monooxygenation reaction and will not require addition of reaction co- factors as done in case of reconstituted enzyme system.

cyt b5 has primarily been implicated in lipid biosynthesis for serving as electron donor to microsomal desaturases that synthesize unsaturated fatty acids [48]. Also it has been found to be involved in plasmalogen and sterol biosynthesis. Cyt b5 is usually reduced by NADH-dependent cyt b5r. However, reduction of cyt b5 can also be mediated by NADPH-dependent POR [16]. In addition to the role in fatty acid synthesis, cyt b5 can provide the second electron required for the

P450-dependent monooxygenation reactions [49]. Sutter and Loper [36] also showed that disruption of P450 reductase in yeasts did not prove to be lethal indicating that alternate proteins such as cyt b5 can mediate transfer of electrons to support CYP51 activity, as was later observed in vitro [50]. With this enormous count (~ 150) of P450 genes in P. chrysosporium, it is highly unlikely that a sole electron donor (NADPH-dependent POR) would be sufficient to provide electrons to such a large pool of simultaneously-expressing monooxygenases for the possible array of P450 mediated reactions happening in this fungus. Thus a role of alternate source(s) of

123 electrons such as cyt b5 is highly likely to maintain the functionality of cytochrome P450s under

different nutritional and biodegradation conditions. In this context, based on the transcription data, it is evident that both POR and cyt b5/cyt b5r are constitutively expressed during the

different phases of growth thereby suggesting that the two redox enzyme may have roles to play

in the overall electron transfer reactions in the P450-mediated physiological and biodegradation

activities of this fungus.

In conclusion, this is the first report on the heterologous expression of P. chrysosporium

POR in a eukaryotic host S. cerevisiae. Further, this is also the first demonstration of the native

and heterologous expression of alternate P450 redox partners (cyt b5 and cyt b5r proteins) from a white rot fungus. Availability of the expressed P450 redox proteins would pave the way for understanding the function of the hitherto uncharacterized P450 monooxygenases of this model

white rot fungus. Moreover, understanding the transcriptional regulation of these redox proteins

would help in developing the white rot fungus as a biocatalyst for intended environmental and

industrial biotechnological applications. Studies on functional co-expression of individual P450

monooxygenases from P. chrysosporium in the generated homologous POR-expressing yeast

system are being pursued in our on-going work.

Acknowledgements

This work was supported by the NIH’s National Institute of Environmental Health

Sciences (NIEHS) grant R01-ES10210 (JSY). We thank Drs. Yolanda Sanchez and Jack Loper,

both of the University’s Department of Molecular Genetics for providing the S. cerevisiae strain

Y300 and the yeast anti-CPR antibody, respectively.

124 References

[1] Gold MH, Alic M. Molecular biology of the lignin-degrading basidiomycete Phanerochaete chrysosporium. Microbiol Rev 1993;57:605-22.

[2] Reddy CA. The potential of white rot fungi for the treatment of pollutants. Curr Opinion Biotechnol 1995;6:320-28.

[3] Bumpus JA, Aust SD. Biodegradation of environmental pollutants by the white rot fungus Phanerochaete chrysosporium: involvement of the lignin degrading system. Bioessays 1987;6:166-70.

[4] Paszczynski A, Crawford RL. Potential for bioremediation of xenobiotic compounds by the white rot fungus Phanerochaete chrysosporium. Biotechnol Prog 1995;11:368-79.

[5] Sutherland JB, Selby AL, Freeman JP, Evans FE, Cerniglia CE. Metabolism of phenanthrene by Phanerochaete chrysosporium. Appl Environ Microbiol 1991;57:3310- 16.

[6] Yadav JS, Reddy CA. Non-involvement of lignin peroxidases and manganese peroxidases in 2,4,5-trichlorophenoxyacetic acid degradation by Phanerochaete chrysosporium. Biotechnol Lett 1992;14:1089-92.

[7] Yadav JS, Reddy CA. Degradation of benzene, toluene, ethylbenzene, and xylenes (BTEX) by the lignin-degrading basidiomycete Phanerochaete chrysosporium. Appl Environ Microbiol 1993;59:756-62.

[8] Kullman SW, Matsumura F. Metabolic pathways utilized by Phanerochaete chrysosporium for degradation of the cyclodiene pesticide endosulfan. Appl Environ Microbiol 1996;62:593-600.

[9] Martinez D, Larrondo LF, Putnam N, Gelpke MD, Huang K, Chapman J, et al. Genome sequence of the lignocellulose degrading fungus Phanerochaete chrysosporium strain RP78. Nat Biotechnol 2004;22:695-700.

[10] Doddapaneni H, Chakraborty R, Yadav JS. Genome-wide structural and evolutionary analysis of the P450 monooxygenase genes (P450ome) in the white rot fungus Phanerochaete chrysosporium: evidence for gene duplications and extensive gene clustering. BMC Genomics 2005;6:92.

[11] Yadav JS, Loper JC. Cytochrome P450 oxidoreductase gene and its differentially terminated cDNAs from the white rot fungus Phanerochaete chrysosporium. Curr Genetics 2000;37:65-73.

[12] Yadav JS, Soellner MB, Loper JC, Mishra PK. Tandem cytochrome P450 monooxygenase genes and splice variants in the white rot fungus Phanerochaete

125 chrysosporium: cloning, sequence analysis, and regulation of differential expression. Fungal Genet Biol 2003;38:10-21.

[13] Lesot A, Hasenfratz MP, Batard Y, Durst F, Benveniste I. Two messenger RNAs are encoding for NADPH cytochrome-cytochrome P450 reductases in Helianthus tuberosus tuber tissues. Plant Physiol Biochem 1995;33:751-57.

[14] Urban P, Mignotte C, Kazmaier M, Delorme F, Pompon D. Cloning, yeast expression, and characterization of the coupling of two distantly related Arabidopsis thaliana NADPH-cytochrome P450 reductases with P450 CYP73A5. J Biol Chem 1997;272:19176-86.

[15] Kunic B, Truan G, Breskvar K, Pompon D. Functional cloning, based on azole resistance in Saccharomyces cerevisiae, and characterization of Rhizopus nigricans redox carriers that are differentially involved in the P450-dependent response to progesterone stress. Mol Genet Genomics 2001;265:930-40.

[16] Enoch HG, Strittmatter P. Cytochrome b5 reduction by NADPH-cytochrome P450 reductase. J Biol Chem 1979;254:8976-81.

[17] Schacter BA, Nelson EB, Marver HS, Masters BSS. Immunochemical evidence for an association of heme oxygenase with the microsomal electron transport system. J Biol Chem 1972;247:3601-07.

[18] Ono T, Ozasa S, Hasegawa F, Imai Y. Involvement of NADPH-cytochrome c reductase in the rat liver squalene epoxidase system. Biochem Biophys Acta 1977;486:401-07.

[19] Ilan Z, Ilan R, Cinti DL. Evidence for a new physiological role of hepatic NADPH:Ferricytochrome (P-450) oxidoreductase. J Biol Chem 1981;256:10066-72.

[20] Sevanian A, Nordenbrand K, Kim E, Ernster L, Hochstein P Microsomal lipid peroxidation: the role of NADPH-cytochrome P450 reductase and cytochrome P450. Free Radical Biol Med 1990;8:145-52.

[21] Moen MA, Hammel KE. Lipid peroxidation by the manganese peroxidase of Phanerochaete chrysosporium is the basis for phenanthrene oxidation by the intact fungus. Appl Environ Microbiol 1994;60:1956-61.

[22] Bogan BW, Lamar RT. One electron oxidation in the degradation of creosote polycyclic aromatic hydrocarbons by Phanerochaete chrysosporium. Appl Environ Microbiol 1995;61:2631-35.

[23] Have RT, Teunissen P. Oxidative mechanisms involved in lignin degradation by white rot fungi. Chem Rev 2001;101:3397-3413.

[24] Correl CC, Ludwig ML, Bruns CM, Karplus PA. Structural prototypes for an extended family of flavoprotein reductases: comparison of phthalate dioxygenase reductase with ferredoxin reductase and ferredoxin. Protein Sci 1993;12:2112-33.

126 [25] Yabusaki Y, Murakami H, Ohkawa H. Primary structure of Saccharomyces cerevisiae NADPH-cytochrome P450 reductase deduced from nucleotide sequence of its cloned gene. J Biochem 1988;103:1004-10.

[26] Prosser IM, Lazarus CM. Nucleotide sequence of a spinach nitrate reductase cDNA. Plant Mol Biol 199015:187-90.

[27] Geller DA, Lowenstein CJ, Shapiro RA, Nussler AK, Di Silvio M, Wang SC et al. Molecular cloning and expression of inducible nitric oxide synthase from human hepatocytes. Proc Natl Acad Sci 1993;90:3491-95.

[28] Hultquist DE, Passon PG. Catalysis of methaemoglobin reduction by erythrocyte cytochrome B5 and cytochrome B5 reductase. Nat New Biol 1971;229:252-54.

[29] Hildebrandt A, Estabrook RW. Evidence for the participation of cytochrome b5 in hepatic microsomal mixed-function oxidation reaction. Arch Biochem Biophys 1971;143:66-79.

[30] Vetten ND, Horst JT, Schaik HPV, Boer AD, Mol J, Koes R. A cytochrome b5 is required for full activity of flavonoid 3’,5’-hydroxylase, a cytochrome P450 involved in the formation of blue flower colors. Proc Natl Acad. Sci 1999;96: 778-83.

[31] Yadav JS, Subramanian V, Safaie M. Cytochrome P450 oxidoreductase gene of the white rot fungus Phanerochaete chrysosporium: Gene transcription and heterologous expression in E. coli and Saccharomyces cerevisiae. In: Proc. 103rd General Meeting of the American Society for Microbiology, Washington DC:2003 (Abstract No. Q-032, p 63).

[32] Subramanian V, Doddapaneni H, Yadav JS. Gene transcription, heterologous expression, and purification of P450 redox proteins of the white rot fungus Phanerochaete chrysosporium. In: Proc. 106th General meeting of the American Society for Microbiology, Orlando, Florida:2006 (Abstract No. Q-448, p 207).

[33] Doddapaneni H, Yadav JS. Differential regulation and xenobiotic induction of tandem P450 monooxygenase genes pc-1 (CYP63A1) and pc-2 (CYP63A2) in the white-rot fungus Phanerochaete chrysosporium. Appl Microbiol Biotechnol 2004;65:559-65.

[34] Guengerich FP, Brian WR, Sari M-A, Ross JT. Expression of mammalian cytochrome P450 enzymes using yeast-based vectors. Methods Enzymol 1991;206:130-45.

[35] Loper JC, Chen C, Dey CR. Gene Engineering in yeast for biodegradation: Immunological cross-reactivity among cytochrome P-450 system proteins of Saccharomyces cerevisiae and Candida tropicalis. Hazardous Waste and Hazardous Mat 1985;2:131-41.

[36] Sutter TR, Loper JC. Disruption of the Saccharomyces cerevisiae gene for NADPH- cytochrome P450 reductase causes increased sensitivity to ketoconazole. Biochem Biophys Res Commun 1989;160:1257-66.

127 [37] Guengerich FP. Analysis and Characterization of Enzymes. In: Hayes AW, editor Principles and Methods of Toxicology, 2nd edn. Ravan press, Ltd;1989. p. 777-813.

[38] Warrilow AGS, Lamb DC, Kelly DE, Kelly SL. Phanerochaete chrysosporium NADPH- cytochrome P450 reductase kinetic mechanism. Biochem Biophys Res Commun 2002;299:189-95.

[39] Van den Brink HJM, van den Hondel CAMJJ, van Gorcom RFM. Optimization of the benzoate-inducible benzoate p-hydroxylase cytochrome P450 enzyme system in Aspergillus niger. Appl Microbiol Biotechnol 1996;46:360-64.

[40] Malonek S, Rojas MC, Hedden P, Gaskin P, Hopkins P, Tudzynski B. The NADPH- cytochrome P450 reductase gene from Gibberella fujikuroi is essential for gibberellin biosynthesis. J Biol Chem 2004;279:25075-84.

[41] Lei L, Waterman MR, Fulco AJ, Kelly SL, Lamb DC. Availability of specific reductases controls the temporal activity of the cytochrome P450 complement of Streptomyces coelicolor A3(2). Proc Natl Acad Sci 2004;101:494-99.

[42] Doddapaneni H, Yadav JS. Microarray-based global differential expression profiling of P450 monooxygenases and regulatory proteins for signal transduction pathways in the white rot fungus Phanerochaete chrysosporium. Mol Genet Genomics 2005;274:454-66.

[43] Doddapaneni H, Subramanian V, Yadav JS. Physiological regulation, xenobiotic induction, and heterologous expression of P450 monooxygenase gene pc-3 (CYP63A3), a new member of the CYP63 gene cluster in the white-rot fungus Phanerochaete chrysosporium. Curr Microbiol 2005;50:292-98.

[44] Subramanian V, Yadav JS. Regulation and heterologous expression of P450 enzyme system components of the white rot fungus Phanerochaete chrysosorium, Enzyme Microb Technol 2007;doi:10.1016/j.enzmictec.2007.09.001.

[45] Boominathan K, D'Souza TM, Naidu PS, Dosoretz C, Reddy CA. Temporal expression of the major lignin peroxidase genes of Phanerochaete chrysosporium. Appl Environ Microbiol 1993;59:3946-50.

[46] Hedden P, Kamiya Y. Gibberellin biosysnthesis: Enzymes, genes and their regulation. Annu Rev. Plant Physiol Plant Mol Biol 1997; 48:431-60.

[47] Kunic B, Truan G, Breskvar K, Pompon D. Functional cloning, based on azole resistance in Saccharomyces cerevisiae, and characterization of Rhizopus nigricans redox carriers that are differentially involved in the P450-dependent response to progesterone stress. Mol Genet Genomics 2001;265:930-40.

[48] Vergeres G, Waskell L. Cytochrome b5, its functions, structure and membrane topology. Biochimie 1995;77:604-20.

128 [49] Yamazaki H, Nakano M, Gillam EM, Bell LC, Guengerich FP, Shimada T. Requirements for cytochrome b5 in the oxidation of 7-ethoxycoumarin, chlorzoxazone, aniline, and N-nitrosodimethylamine by recombinant cytochrome P450 2E1 and by human liver microsomes. Biochem Pharmacol 1996;26:301-09.

[50] Lamb DC, Kelly DE, Manning NJ, Kaderbhai MA, Kelly SL. Biodiversity of the P450 catalytic cycle: yeast cytochrome b5/NADH cytochrome b5 reductase complex efficiently drives the entire sterol 14-demethylation (CYP51) reaction. FEBS Lett 1999;462:283-88.

129 Figure Legends

Fig. 1. Time course of transcription of POR, cyt b5 and cyt b5r under different nutrient conditions in P. chrysosporium: Total RNA extracted from fungal mycelia harvested from cultures grown for days 1 through 8 was subjected to Real-time quantitative RT-PCR using gene- specific primers. Transcript numbers were calculated from a standard curve as described under

Materials and Methods. Average log value of the transcripts was plotted against time.

Abbreviations: LN (defined low N medium), HN (defined high N medium), ME (malt extract medium).

Fig. 2. Transcriptional and translational levels of the P. chrysosporium POR under different nutrient conditions. The transcript numbers were determined based on the real time quantitative

RT-PCR analysis under low N, high N and ME conditions. The values obtained (in duplicates) were normalized against those of the control gene (GPD). Translational levels were analyzed by

Western blot analysis, involving separation of the corresponding microsomal extracts (100 µg) on a 10 % SDS-PAGE gel followed by hybridization using the cross-reactive yeast anti-CPR antibody.

Fig. 3. Partial purification of heterologously expressed P. chrysosporium POR from the yeast S. cerevisiae. (A) Western blot analysis using anti-His antibody on microsomes extracted from S. cerevisiae expressing fungal POR after growing the cells in the presence of 2% galactose for 4,

8, 12, 16 and 20 h. (B) Total microsomal proteins extracted from the fungal POR-expressing S. cerevisiae were solubilized using 0.65% CHAPS and passed through Ni-NTA column followed by elution with different concentrations of imidazole. (B1) Equal volumes of the protein were

130 loaded on to the 10 % SDS-PAGE gel and the bands were observed by silver staining. (B2)

Western blot analysis on the same extracts using anti-His antibody. Abbreviations: M (Bench-

Mark Protein ladder), F1 (flow-through), W1- W4 (Serial washes), E1, E2 and E3 (Eluates using

80 mM imidazole).

Fig. 4. Amino acid sequence alignment and phylogenetic analysis of the cloned cyt b5 and cyt b5r proteins of P. chrysosporium against their homologs from other organisms. (A) Amino acid sequence alignment of the HPGG motif context sequence of cyt b5 with corresponding sequence of the homologs from other organisms. (B) Amino acid sequence alignment of the isolated full- length cyt b5r with those from other organisms. (C) Minimum evolution tree of the cyt b5 proteins (D) Minimum evolution tree of the cyt b5r proteins. Conserved residues are marked with a line over the amino acid sequence. Arrows indicate the location of introns in the corresponding genomic DNA sequence.

Fig. 5. Heterologous expression and purification of the fungal cyt b5 in E. coli. (A) 20 µl each of flowthrough (F) and washes (W1, W2, W3 and W4) and 30 µl each of eluates (E1 through E3) were loaded on to a 10% SDS-PAGE gel and stained by using silver stain protocol. (B) Western blot analysis for detection of the expressed cyt b5 using anti-His antibody.

Fig. 6. Heterologous expression and purification of the fungal cyt b5r in E. coli. (A) 20 µl each of the flowthrough (F) and washes (W1, W2, W3 and W4) and 30 µl each of the eluates (E1 through E3) were loaded on to a 10% SDS-PAGE gel and stained by using silver stain protocol.

(B) Western blot analysis for detection of the expressed cyt b5r using anti-His antibody.

131

6.1

5.8

s pt i 5.5 r c

s LN

n 5.2 POR a HN tr

f 4.9 o

ME 4.6

4.3 Log no. 4 12345678 Days

4.70 4.40 s

t 4.10 p i r 3.80

c LN s

n 3.50

a HN tr F Cyt b5 3.20 ME of . 2.90

g no 2.60

Lo 2.30 2.00 12345678 Days

5.40

5.10 s 4.80 pt i r

c LN s 4.50 n

a HN r 4.20

t

of ME 3.90 Cyt b5r 3.60 og no.

L 3.30 3.00 12345678 Days

Figure 1

132

Low N High N ME

682870 504715 103181 Transcript Levels

Translation levels

Figure 2

133

4h 8h 12h 16 h 20h 24h

A

M F W1 W2 W3 W4 E1 E2 E3

190 kDa 120 kDa 87 kDa 85 kDa 60 kDa 50 kDa 40 kDa

B 25 kDa 20 kDa

15 kDa

F W1 W2 W3 W4 E1 E2 E3

87 kDa

Figure 3

134 A

B

FAD

33 P.chrysosporium cloned D C 34 C.neoformans EAL17281 D.hansenii XP 458715 36 60 Y.lipolytica XP 501731

G.zeae EAA76697 M.grisea EAA55430 55 51 100 A.thaliana NP197279 21 A.nidulans EAA60006 30 Z.mays AAD17694 32 N.crassa EAA30578 N.crassa XP322302 U.maydis EAK85477 94 C.tropicalis AAO73962 S.pombe NP 587852

A.thaliana NP 199692 31 P.chrysosporium Cloned 67 S.cerevisiae CAA93396 61 M.alpina BAA85586 32 R.stolonifer AAG23835 G.zeae BAC66099 32 100 43 H.sapiens BAA23735 F.sporotrichioides AAO27755 55 R.norvegicus NP 071581 H.sapiens AAF17227 P.chrysosporium pc.131.18.1 100 C.elegans NP 504638 99 P.chrysosporium pc.4.163.1 0.2 0.2 Figure 4 135

M C F W1 W2 W3 E1 E2 E3 E4

A

~ 31 kDa

M C F W1 W2 W3 E1 E2 E3 E4

B ~ 31 kDa

Figure 5

136

M F W1 W2 W3 W4 E1 E2 E3 E4

A ~ 41 kDa

M F W1 W2 W3 W4 E1 E2 E3 E4

B ~ 41 kDa

Figure 6

137

Table 1. Primers used for isolation of cDNAs, real time RT-PCR analyses and cloning in the expression vector

Primer name Sequence (5’ – 3’) Purpose

CPR-Up1 GAGCACTACCAGAACATCGTC Real time RT-PCR

CPR-Dn1 CAGCGTAGCTGCCTTGTCATG Real time RT-PCR

B5-red-F1 ATCCGCGTGAAAGGACCAAAG Real time RT-PCR

B5-red-R CTCCTGAATCTGCTCCTTCGTG Real time RT-PCR

B5-Up1 CTCAGCGACTCACAGCGGAT Real time RT-PCR

B5-Dn1 GGGATGGTACGGAAGATAGTGC Real time RT-PCR

B5F1 AGATTACCACAGTCTCCAATCC cDNA isolation

B5R1 GTGAGCTGTATGGAGTGCAGC cDNA isolation

B5-RT-SP-F2 CGTCGCATGCCCAACCGC cDNA isolation

B5-red-R1 ATAGCGTTCATCATTGGCGGCG cDNA isolation

Cyt-B5-EcoR1-F TCCGAATTCGCGATGGCATCATATC pET30a(+) cloning

Cyt-B5-HindIII-R GCGAAGCTTCTATGGCTCGGGTAC pET30a(+) cloning B5-red-EcoRI-F TCCGAATTCCTGATGCCCAACCG pET30a(+) cloning

B5-red-HindIII-R GCGAAGCTTCATAGCGTTCATCATTGGC pET30a(+) cloning pYES2topocprF1 GCGCCATGGCCGTCTCTTC pYES2.1His TOPO cloning Yes2topocprR CGACCAGACATCCAACAATAGG pYES2.1His TOPO

cloning

138 Table 2. The specific activity, yield, and fold purification of the recombinant fungal POR heterologously expressed in S. cerevisiae.

Total Total Total Specific Protein Activity Yield Purification Volume Protein Activity Activity (mg/ml) (U/ml) (%) (X) (ml) (mg) (U) (U/mg)

Crude 2.6 9.66 25.11 119.04 309.50 12.32 100 1 extract

Purified 6 0.09 0.54 8.25 49.5 91.66 15.9 7.43 protein

139 Chapter VI

Role of P450 monooxygenases in degradation of the endocrine disrupting chemical nonylphenol by the white rot fungus Phanerochaete chrysosporium: biochemical and functional genomic evidences

Running title: Role of Fungal cytochrome P450 in nonylphenol biodegradation

VENKATARAMANAN SUBRAMANIAN AND JAGJIT S.YADAV*

Environmental Genetics and Molecular Toxicology Division, Department of Environmental

Health, University of Cincinnati College of Medicine, Cincinnati, OH 45267-0056.

* Corresponding author: Mailing address: Environmental Genetics and Molecular Toxicology Division, Department of Environmental Health, University of Cincinnati College of Medicine, Cincinnati, OH 45267-0056. USA. Tel.: 513-558-4806, Email: [email protected].

This chapter is written as a manuscript ready for submission.

140 Summary

The white rot fungus Phanerochaete chrysosporium extensively degraded (100% of 100 ppm) the endocrine disruptor chemical nonylphenol (NP) in both nutrient-limited and nutrient- sufficient cultures. The P450 enzyme inhibitor piperonyl butoxide caused significant inhibition

(~ 75%) of the degradation activity in the malt extract (ME) cultures, as compared to no inhibition in defined low N (LN) cultures, indicating an essential role of P450 monooxygenase(s) in NP degradation under nutrient-rich conditions. A genome-wide analysis using custom- designed P450 microarray revealed significant induction of multiple P450 monooxygenase genes by NP: 19 genes induced (2 to 195 fold) in ME and 18 genes (2 to 6 fold) in LN cultures (with 4 genes commonly induced). Particularly, the P450 genes PFF 311BM and PFF 4aM showed extraordinarily high levels of induction (195 and 167 fold, respectively) in ME cultures. In addition, the P450 oxidoreductase (POR), glutathione S-transferase (gst), and the cellulose- metabolism genes were also induced in ME cultures. However, certain metabolic genes, such as five of the peroxidase genes showed partial inhibition by NP. This study provides first evidence on the involvement of P450 enzyme(s) of this fungus in NP degradation and first genome-wide identification of the putative P450 genes responsive to an environmentally-significant chemical.

141 Introduction

Owing to the increased industrialization, several toxic xenobiotic chemicals that are released into

the environment are known to have endocrine disrupting activities and thus are designated as

endocrine-disrupting contaminants (EDCs). One of the most commonly found EDC groups is the

surfactants, which are used in various applications ranging from industrial chemicals to the

common consumer products. The major uses of surfactants in the USA, Japan, and western

Europe include detergents, textiles and fibers, cosmetics, and pharmaceuticals. This is closely

followed by mining, flotation and petroleum industries, paints, lacquers, and plastic

manufacturing industries, food, pulp and paper industries, agrochemical industries, and leather

and fur manufacturing industries (21).

Alkyl phenol ethoxylates (APE) form an important and a significant class of surfactant

compounds. Biodegradation of APE results in shortening of the ethoxylate chains that ultimately

leads to the generation of the relatively recalcitrant alkyl phenols, particularly nonyl phenols

(NP) and octyl phenols (OP). As nearly 85% of the total alkyl phenol market is represented by

NP, it is the commercially predominant member of the two alkylphenols. Nonyl phenol is a

hydrophobic organic compound that is primarily used in the chemical manufacturing industry

(11) and is found in the form of multiple congeners. The congeners are more resistant to

biodegradation as compared to their parent compound and are therefore found extensively in

waste water treatment plant effluents and rivers. (15, 20, 24, 30, 48). 4-n-nonylphenol (4-n-NP)

that has a linear nonyl chain is often used as a model compound in risk assessment and biodegradation studies (16, 22, 38). However, the industrially generated technical grade NP that consists of more than 30 different isomers (14) is less biodegradable, due to the fact that more

142 than 85 % of the isomers possess a quaternary carbon atom of the branched alkyl chain (39) and is therefore of greater environmental significance (27, 37).

The endocrine disrupting characteristics of NP are increasingly becoming evident. NP is known to bind to estrogen receptor thereby mimicking the effects of endogenous hormones (32,

35, 40) and has been shown to induce synthesis of vitellogenin and inhibit testicular growth in rainbow trout (18, 36). This has led to an increased interest in the biodegradation and elimination of this class of xenobiotic surfactants from the environment.

A few microorganisms have been shown to be able to degrade NPs (4, 5, 19, 31, 37, 38).

Recent studies have shown the ability of selected white rot fungi to degrade these chemicals (2,

31), albeit to varying extents. Extracellular oxidases (laccases) have been implicated in the oxidation of NP in these reports.

The model white rot fungus, Phanerochaete chrysosporium is known for its ability to oxidize a wide variety of environmental toxicants. This unique characteristic has been largely attributed to its extracellular peroxidase system. However, past studies by us and others have provided ample evidence that environmental toxicants can be oxidized/biodegraded even in absence of the peroxidases, as observed under nutrient-sufficient (non-ligninolytic) conditions

(25, 43, 45), suggesting a primary role of other oxidative enzyme systems, including P450 monooxygenases.

P. chrysosporium has been lately shown to possess an elaborate P450 enzyme system comprising of ~150 P450 monoxygenases in its genome (8). Although there have been isolated reports indicating the involvement of P450 monooxygenation in the oxidation of xenobiotic chemicals, limited information is available on the identification of specific P450 genes/enzymes important in such oxidations in this system. In this context, it is well known in other biological

143 systems that inducers for P450 monooxygenases can also be the substrates that these enzymes

can oxidize (1). These considerations led us to study P450 genes inducible in response to

nonylphenol with an aim to identify the putative P450 catalyst(s) involved in its degradation.

The results led to the first direct evidence to show the involvement of P450 enzymes in the

degradation of the endocrine disrupting chemical nonylphenol, and functional genomic

identification of multiple P450 monooxygenases responsive to this environmentally significant

toxicant.

Results

Effect of P450 enzyme inhibitor on degradation of NP by P. chrysosporium

HPLC analysis showed that nonylphenol, when used at a concentration of 100 ppm, was

degraded completely (100%) by P. chrysosporium in ME cultures (Fig. 1A). Addition of the

P450 enzyme inhibitor piperonyl butoxide (PB), abrogated the degradation activity, albeit in a

concentration-dependent manner. As shown in figure 1A, lower concentration (100µM) of PB

showed no inhibition of degradation, whereas the higher concentrations (500 µM and 1000 µM)

had a significant effect (~ 75% inhibition). Considering that there was no effect of the 100 µM concentration of the inhibitor, this concentration was omitted in subsequent inhibition experiments. Under the defined low N (LN) conditions, the results obtained were quite different.

Although P. chrysosporium showed complete (100 %) degradation of NP under these conditions as well, there was no abrogation of degradation activity in presence of the P450 inhibitor PB

144 (Fig. 1B). Furthermore, unlike ME and LN, there was no clearly detectable degradation of NP under the defined high N (HN) culture conditions (Fig. 1C).

Induction of P450 genes by NP

Microarray results showed induction of 19 P450 genes when grown in the presence of NP under

ME conditions (Fig. 2A). The levels of induction varied, ranging from 2.20 ± 0.07 fold (p =

0.0001, FDR = 0.0011) for Pff_78 gene to 194.94 ± 0.092 fold (p = 0.0000, FDR = 0.0000) for

Pff_311b gene. On the other hand, 18 P450 genes were induced during NP degradation under LN conditions, albeit in a relatively much lower range as compared to the ME conditions (Fig. 2B); the levels of induction in LN cultures ranged from 2.01 ± 0.24 fold (p = 0.016, FDR = 0.07) in

Pff_51M to 6.12 ± 0.31 fold (p = 0.00002, FDR = 0.0009) in Pff_137a. Of the induced P450 gene sets under the two culture conditions (ME and LN), 4 genes are common (Fig. 3). However, based on microarray data, their induction level was higher in ME as compared to LN cultures.

Effect of NP on peroxidase genes

The lignin peroxidase (LiP) genes showed variable hybridization signal in NP-treated LN cultures as compared to the untreated cultures (Fig. 4). Four LiP genes (LipA, LipD, LipJ, and

LpoB) showed downregulation in the presence of NP, out of which 3 were statistically significant

(LipD, -25.68 ± 0.49, p = 0.00006, FDR = 0.0016; LipJ, -2.47 ± 0.24, p = 0.0043, FDR = 0.033;

LpoB, -7.20 ± 0.20, p = 0.000003, FDR = 0.0004). LiP-specific common oligonucleotide spot also showed lowered signal intensity (-7.20 ± 0.20 fold, p = 0.005, FDR = 0.03), indicating

145 downregulation of Lip genes in the presence of NP. The expression changes in LipC, LipF, and

LipH genes remained within the cut-off limit. In NP-treated ME cultures, none of the LiP genes were detectable, except Lip J that showed marginal levels.

Of the manganese-dependent peroxidase (MnP) genes, Mnp1 and Mnp3 that showed

considerable hybridization signals in LN cultures, Mnp3 showed no significant change in

expression, whereas Mnp1 showed a 5.51 ± 0.31 fold (p = 0.0004, FDR = 0.0064)

downregulation in presence of NP (Fig. 4). On the other hand, none of the MnP genes spotted

showed considerable hybridization signal in ME cultures; Mnp3 showed low hybridization signal

within the cut-off limit (data not shown).

Effect of NP on other genes

None of the three phase I and phase II metabolism genes (m_eh, s_eh, and gst) that were spotted

showed differential regulation under LN degradation conditions. However, interestingly, gst

showed a significant upregulation [21.33 ± 0.092 (p < 0.00000, FDR < 0.00000) fold] under ME

degradation conditions (Fig. 5A). Of the two electron transfer proteins, (POR and cyt b5r), POR

also showed an upregulation [3.82 ± 0.02 fold (p = 0.00001, FDR = 0.0015)] in response to NP

under ME conditions (Fig. 5A).

Expression of both the spotted house-keeping genes (gpd and upq), remained within the

cut-off limit of ± 2.00 fold under the ME and LN degradation conditions (Table 2). Of the

spotted genes for the nitrogen assimilation pathway, creA was somewhat downregulated (-2.90

fold, p = 0.00019, FDR = 0.0014) under ME degradation conditions (Fig. 5A).

146 Of the 35 other genes comprising of the metabolism genes and transcription factors, four genes namely, alpha-galactosidase (agalA), endo-1,4-B-xylanase B (xynB-A), homolog of AP-1- like stress-induced transcriptional activator (YAP2), and homolog of the gene involved in Ty1 and Ty1-mediated gene expression (tec1), showed several-fold upregulation in response to NP under ME conditions, to an extent of 2.58 ± 0.081 fold (p = 0.0007, FDR = 0.0007), 22.55 ±

0.137 fold (p = 0.0000, FDR = 0.00005), 3.01 ± 0.096 fold (p = 0.0000, FDR = 0.00005), and

4.52 ± 0.32 fold (p = 0.0047, FDR = 0.0142), respectively (Fig. 5A). In addition, two genes involved in cellobiose utilization, CBHI.2 and CDH, were highly upregulated to an extent of

29.94 ± 0.181 fold (p = 0.00001, FDR = 0.00015) and 16.74 ± 0.163 (p = 0.0001, FDR = 0.0002) fold, respectively, under these conditions (Fig. 5A). Of the four cellulose-utilization genes, the cellulose A gene showed induction [7.89 ± 0.137 fold (p = 0.0000, FDR = 0.0001)] in response to NP (Fig. 5A) in these cultures. On the other hand, under LN treatment conditions, three genes namely, uric acid xanthine permease (uap), ligninase precursor (ckg4), and glyoxal oxidase

(glx1) showed significantly lower expression (Fig. 5B) in the presence of NP, as follows: uap (-

2.74 ± 0.48 fold, p = 0.0665, FDR = 0.1748), ckg4 (-27.96 ± 0.47 fold, p = 0.000035, FDR =

0.0011), and glx1 (-10.44 ± 0.48 fold, p = 0.0006, FDR = 0.0083). Of the two cellobiose- hydrolysis genes, CBHI.1 showed a 2.76 ± 0.35 fold (p = 0.1140, FDR = 0.185) downregulation

(Fig. 5B), whereas none of the cellulose-hydrolysis genes seemed to be affected. Two of the four cellulose-hydrolysis genes, however, showed non-detectable hybridization signals under these test conditions.

Real time RT-PCR confirmation of gene induction

147 Twelve genes were selected for confirmation of the microarray data using quantitative RT-PCR.

Except for pc-2, these genes were either induced or repressed under one of the two nutrient conditions. Overall, the induction patterns in the microarray analysis corroborated those observed in RT-PCR analysis (Table 2).

Discussion

Involvement of P450 monooxygenase(s) in nonylphenol degradation

The results showed almost complete degradation of NP in both nutrient-limited (LN) and nutrient-rich (ME) cultures. The degradation in ME cultures indicated that this activity is mediated by enzymes other than the ligninolytic peroxidases. This is because the expression of peroxidases (which occurs under nutrient-limited LN conditions), is known to be suppressed under high nutrient conditions such as in ME cultures (28, 42). The observed significant abrogation of the degradation activity by the added eukaryotic P450 enzyme inhibitor piperonyl butoxide (Fig 1A) suggests that cytochrome P450 enzyme(s) play a key oxidizing role in NP degradation process. The abrogation activity of PB was concentration dependent, further suggesting that P450 enzyme activity is the underlying basis of NP degradation (Fig 1A).

Unlike in nutrient-rich ME cultures, there was no effect of piperonyl butoxide (at even the highest concentration of 1000 µM) on the overall degradation of NP in LN cultures. This suggested that either the P450 enzymes are not involved in the NP oxidation process under LN conditions, or the P450 enzymes are readily replaceable by the predominant co-expressing peroxidases, which are the primary oxidizing enzymes involved in various degradation reactions

148 under these nutrient-limited conditions. Furthermore, the possibility that other P450 enzymes not inhibitable by PB are involved under these conditions cannot be excluded.

No observed degradation of NP in HN cultures lends credence to the assumption that extracellular peroxidases are involved in NP degradation

NP-inducible P450 monooxygenase genes and related phase I and phase II metabolic genes

Our recent studies have shown that P450 genes in this organism are differentially regulated under the two biodegradation-relevant nutrient conditions (nutrient-limited and nutrient-sufficient) (7, 44, 46) and in response to several xenobiotic chemicals (6, 9). However, genome-wide analysis to identify all P450 monooxygenases responsive to a given xenobiotic toxicant has not been reported yet in this system.

Results on differential effect of the P450 enzyme inhibitor on degradation of NP under different nutrient conditions (ME versus LN) suggested that induction of NP-oxidizing P450 enzymes is tightly regulated by the nutrient status. We therefore embarked on the microarray approach to identify the specific P450 genes involved in NP oxidation process using the two nutrient conditions, one under which the P450 enzymes seemed to play a clear role (ME), and the other under which P450 enzymes seemed to be unimportant or dispensable (replaceable by peroxidases) in the NP oxidation process (LN).

Interestingly, the microarray data showed that NP differentially induced P450s (cut off limit = 2 fold) under the two nutrient conditions; 19 genes under ME conditions and 18 genes under LN conditions. Of these, 15 P450 genes were specifically induced (2.16 fold to 194.94 fold) under ME conditions, and 14 genes were specifically induced, albeit to a much lower extent

149 (2.01 fold to 6.12 fold) under LN conditions in response to NP. This suggests that these two sets

of P450 genes in P. chrysosporium are induced by NP in a nutrient-specific manner. Four of the

NP-induced genes were common to the two culture conditions, although their induction levels

differed significantly between the two conditions (Fig. 3). The common induction of these genes

(pc-2, Pff_169f, Pff_293b, and Pff_7) implies that their induction is NP-specific and that they

may be involved in NP degradation under either nutrient condition. However, considering that

the P450 enzyme inhibitor did not abrogate the degradation activity in LN cultures, their

involvement under these conditions is not essential; in this context it is arguable that their

enzyme product levels may be low enough and are readily replaceable by the predominant

peroxidases. However, the possibility that their enzyme products are not inhibitable by PB, the

enzyme inhibitor used in this study, can not be excluded.

An important aspect that stood out in this comparison was that two ME-specific genes namely Pff_311b, and Pff_4a showed extraordinarily high levels of induction to the magnitude of about 195 fold and 167 fold, respectively. Both these genes belong to the CYP617/547 clan of the P450ome (8). In order to delineate the functional and evolutionary relationship of these two

ME-specific P450 enzymes, we blasted their protein sequence against the NCBI protein database. It was found that these proteins are related to CYP4F family of cytochrome P450

monooxygenases that are known to catalyze hydroxylation of fatty acids in higher eukaryotic

systems (3, 33). This observation suggested that these P450s could primarily be involved in the

degradation of nonylphenol, which has a chemical substructure (long alkyl side-chain) that

resembles the aliphatic backbone of the fatty acids, and other related aliphatic compounds. The

dramatic differences between the levels of these P450s in the two culture types (ME vs LN) is

150 consistent with the differential effect of the P450 enzyme inhibitor on the NP degradation

activity under ME versus LN condition.

Evidenced role of P450 enzyme system in degradation of nonylphenol under ME

condition was further supported by the observation that the genes encoding P450 electron

transfer protein (POR) and the phase II metabolic enzyme glutathione S-transferase (gst) were both co-induced (3.82 ± 0.073 and 21.33 ± 0.092 fold, respectively), in the presence of NP under these conditions. POR is required for the transfer of electrons from NADPH to cytochrome P450 monoxygenases during the P450 catalytic cycle, leading to hydroxylation of the substrate. GST on the other hand is a phase II xenobiotic metabolizing enzyme involved in further modification of the hydroxylated products generated by the P450 monooxygenase activity.

On the other hand, 8 genes were downregulated under ME condition (-2.15 to -13.36 fold) and 6 genes were downregulated under LN condition (-2.02 to -4.15 fold) in response to NP

(data not shown). The observed downregulation may be partly due to the general toxicity of NP to the fungus as reported earlier by Kollmann et al. (23) or due to the rerouting of the fungal

protein synthesis machinery for de novo synthesis of the induced P450s.

Effect of NP on other metabolic and regulatory genes

Under ME degradation conditions, several of the genes encoding the breakdown of polysaccharides and other sugars, including those encoding hydrolysis of xylan (xynB), cellulose

(cellulose binding protein ac2), cellobiose (CBHI.2, CDH), and galactose (agalA), were significantly upregulated, indicating co-regulation of the alternate carbon source-utilizing enzymes during NP degradation. This observation is consistent with the statistically significant

151 reduction in the expression of the catabolite repressor protein, creA in the presence of nonylphenol under these growth conditions; creA is a known suppressor of xylanases and cellulases in T. reesei (17, 29). While the physiological relevance of induction of these hydrolytic enzymes is not clear, it may be assumed that NP exposure prepares the fungal system for assimilating alternate carbon sources to sustain the nutrient environment required for its

P450-mediated biodegradation.

Further, two of the transcription factors, tec1 that is known to be involved in psuedohyphal development in S. cerevisiae (12), and YAP2 that is known to be involved in oxidative-stress response (34), were upregulated by NP under ME conditions indicating their role in providing a possible survival mechanism to the fungus under the biodegradation conditions by enhancing the hyphal length thereby giving it more access to the nutrients and combating the increased oxidative-stress environment in the medium in the presence of NP, respectively. However, the following stress-responsive genes were downregulated during NP degradation: osm1 and Pbs2a. Homolog of the fungal stress responsive gene uric acid xanthine permease (uap) was also under-expressed. This is in contrast to the observed upregulation of uap in response to other forms of chemical stress in Aspergillus nidulans (13) and Phanerochaete chrysosporium (26) This could be a consequence of the general toxicity/chemical stress or inhibition effect of NP on the metabolism of the fungus and/or due to metabolic rerouting of the fungal enzyme synthesis machinery to attain the induced levels of P450 enzymes and other inducible proteins.

As expected, the peroxidases LiPs and MnPs were found to be expressed only in LN cultures. However, 4 out of the 8 LiP genes and one MnP gene (mnp1) were expressed at higher levels in untreated (regular) as compared to the NP-treated LN cultures. This indicated that the

152 treatment with NP (100 ppm), directly or indirectly inhibits the expression of some of the peroxidase genes at this concentration. Furthermore, another ligninolytic condition-specific gene glyoxal oxidase (glx1) was found to be severely under expressed in the NP-treated LN cultures; this is consistent with the repression of the major ligninolytic condition-specific genes, the LiPs and MnPs. Overall, lower expression of peroxidases and other genes specific to ligninolytic conditions in NP-treated as compared to the untreated LN cultures could possibly be due to the suppressing effect of NP on their common transcription network. Nevertheless, the prevalent peroxidase levels in these NP-treated LN cultures seemed to be enough to catalyze NP oxidation without the need for the involvement of P450 monooxygenases. Despite a detectable inhibitory effect on some of the components of the metabolic machinery, NP addition did not seem to affect the degradative potential of the fungus as indicated by comparable percent degradation of NP in

LN versus ME cultures. This reinforces the idea of a contributory but replaceable/dispensable role of P450s under LN conditions.

In conclusion, this study has demonstrated a role of P450 monooxygenase(s) during biodegradation of nonylphenol in P. chrysosporium and has led to the identification of multiple

P450 monooxygenase genes that were specifically induced under nonylphenol-biodegradation conditions. However, the NP-inducible P450 monoxygenases of P. chrysosporium are differentially regulated by nutrient conditions. Identification of the specific NP-responsive genes in this study would allow their heterologous expression and thus could provide tools to elucidate the catalytic activity and substrate specificity of these P450 biocatalysts for NP degradation.

Furthermore, the study constitutes the first report on genome-wide induction of the P450 monooxygenase genes in response to a specific xenobiotic toxicant class. Such xenobiotic class-

153 specific information would help in target designing of the improved versions of the whole fungus

for degrading specific environmental pollutants in the long-term.

Experimental Procedures

Strain and culture conditions

Phanerochaete chrysosporium strain BKM-F-1767 (ATCC 24725) used in this study was

maintained on malt extract agar. Unless otherwise stated, the fungus was grown at 37 0C using

malt extract broth (ME), defined low-N medium (LN, 2.4mM N, 100 g/L glucose) or defined

high-N medium (HN, 24 mM N, 100 g/L glucose) as described elsewhere (6).

Biodegradation experiments

P. chrysosporium was grown as 50 ml shaken cultures (180 rpm) at 370C in rubber-stoppered

125 ml conical flasks. At 24 h of incubation, technical grade nonylphenol (Sigma-Aldrich Corp.,

Cat. # 29085-8) was added to these flasks at a concentration of 100 ppm and the incubation continued for additional 72 h. The common P450 enzyme inhibitor, piperonyl butoxide (in methanol), was added simultaneously to a parallel set of cultures at different concentrations (100

µM, 500 µM and 1000 µM). Two different controls were used; a chemically-killed control prepared from pre-grown culture killed with 100 mM sodium azide for 2 h, meant to estimate the adsorbed amount of the added NP and an uninoculated control prepared from the same medium

(without inoculum), meant to determine the initial level of NP added to the cultures and any

154 abiotic degradation. Each condition was studied in triplicate. Following incubation, the fungal cultures were extracted thrice with methylene chloride, and the extract was dried in the presence of sodium sulfate and resuspended in acetonitrile. After filtering through 0.45 µM glass fiber filters, the samples were analyzed by HPLC in a Prostar 210/215 Varian HPLC system (Varian,

Inc., USA) equipped with a C18 reverse phase column and a UV detector. NP was detected at

277 nm and quantified using a standard curve generated increasing concentrations.

Gene induction conditions

Four independent cultures (100 ml each) were grown for either nutrient condition (LN and ME) in 250 ml flasks, as described above, using continuous shaking (180 rpm) and regular oxygenation (1 min each flask) at 24 h intervals. Briefly, the ME cultures were grown for 24 h prior to induction by addition of NP to a final concentration of 100 ppm followed by harvesting of the cultures 24 h post-induction. For LN cultures, fungus was grown for 96 h to secondary metabolic phase (as indicated by browning) followed by addition of NP and further incubation for additional 24 h, before harvesting. Thus, the induction time was 24 h in either condition. The harvested mycelia were snap-frozen and maintained at –80 0C prior to extraction of RNA.

RNA extraction

Total RNA was extracted from the harvested mycelia using TRI Reagent (Molecular Research

Center, USA) per the manufacturer’s protocol and our modifications as described previously

(44). Total RNA concentration was quantified using a NanoDrop® ND-1000 UV–visible

155 Spectrophotometer (NanoDrop Technologies, USA) and the quality of RNA was checked using

Agilent 2100 Bioanalyzer.

Microarray set up and data acquisition

A custom-designed oligonucleotide microarray chip developed in our laboratory (7, 44) was

used. The 70 mer gene-specific oligonucleotides were spotted on the microarray slides at the

Genomics and Microarray Laboratory of University of Cincinnati. This array consisted of a total

of 250 genes, representing 150 P450 genes, and 100 ‘other test genes’ (including control genes

and other metabolism-related genes) (7). The gene names used in this study are the same as used

in the earlier report (7). The ‘other test genes’ on the P450 custom microarrray included 9 lignin

peroxidase (lip) spots, including 8 LiP isozyme-specifc oligos and 1 common LiP-signature oligo, 3 manganese-dependent peroxidase (mnp) genes, 2 house-keeping genes namely, ubiquitin

(ubq) and glyceraldehyde-3-phosphate dehydrogenase (gpd), 25 MAP kinase genes, 9 cAMP pathway genes, 4 sulfur metabolism genes, 8 nitrogen metabolism genes, 2 P450 electron transfer protein genes [(cytochrome P450 oxidoreductase (POR) and cytochrome b5 reductase

(cytb5r)], 3 phase I and phase II xenobiotic metabolism genes [microsomal epoxide hydrolase

(m_eh), soluble epoxide hydrolase (s_eh), and glutathione-s-transferase (gst)], and 35 other cellular metabolism-related genes [including sugar utilization genes and metabolic transcription

factor homologs; a detailed list of these genes is reported elsewhere (7)]. Twenty-two of the

P450 genes were represented twice (using two separate oligos for each gene) in order to verify

the hybridization specificity of the oligo probes. Each test gene was spotted twice on the

microarray slide.

156 Four biological replicate sets (each set comprising of two samples, one from NP-treated

and one from untreated cultures) were used for either nutrient condition (ME or LN). Of these,

RNA from two replicate sets for each condition, were labeled with Cy3 (for NP-treated) and Cy5

(for untreated) monofunctional fluorescent dyes. The remaining two sets of samples from either

condition were labeled using dye flip. Following hybridization, the slides were scanned for both

635 nm (Cy5) and 532 nm (Cy3) channels using an Axon 4000B scanner (Molecular Devices

Corporation, Sunnyvale, CA, USA). The PMT settings for Cy3 and Cy5 were optimized to get

an overall ratio of 1. The raw spot intensities (2 spots x 4 slides = 8 spots per gene) were

obtained using GenePix Pro 5.4 software.

Microarray data analysis

Data analysis was performed as described in our earlier report (7). Briefly, the background was

subtracted for normalization, and array-specific local regression was performed using SAS

statistical software package (SAS Institute Inc., USA). This was followed by identification of the

differentially expressed genes by fitting gene-specific mixed linear models (41). P-values were

then calculated using the assumption that the array effect was random and the treatment and dye

effects were fixed. A multiple hypotheses testing adjustment was then performed on false

discovery rates (FDRs). An arbitrary cut-off limit of 2-fold change in transcript level was used to

identify the differentially expressed genes. Expression profiles were then clustered using the average-linkage-based hierarchical clustering (10).

Real time RT-PCR analysis

157

Total RNA (50 ng) was used for performing the real-time quantitative RT-PCR analysis. Twelve

genes that showed differential regulation under either or both of the conditions were selected for

this analysis. The four replicates each of NP-treated and untreated RNA were pooled independently followed by RT-PCR analysis on each pool in duplicate. The reaction set up was done using Brilliant SYBR Green QRT-PCR Master mix kit (Stratagene, USA) in an ABI Prism

9600 HT system (Applied Biosystems, USA). The RT reaction step was carried out at 50oC for

30 min followed by the PCR reaction step using the following conditions: activation of the

SureStart Taq DNA polymerase at 90o C for 10 min, followed by 40 cycles of amplification

(denaturation at 95oC for 30 sec, annealing at 55o C for 1 min, and extension at 72oC for 30 sec).

The gene-specific primers used in this study are presented in Table 1. The fold induction was

calculated as follows: Difference between the threshold cycle (Ct) value of the test gene and of

the house-keeping gene gpd was calculated and used as the normalized Ct value. The normalized

Ct value of the untreated control was then subtracted from the normalized Ct value of the NP-

treated sample to obtain the ∆Ct value. The fold change was then calculated using the following

formula: Fold change = 2 ∆Ct.

Acknowledgements

This work was supported by the NIH/NIEHS grant R01-ES10210 (JSY).

158 References

1. Anzenbacher, P., and E. Anzenbacherová. 2001. Cytochrome P450 and metabolism of xenobiotics. Cell. Mol. Life Sci. 58:737-747.

2. Cabana, H., J. L. Jiwan, R. Rozenberg, V. Elisashvili, M. Penninckx, S. N. Agathos, and J. P. Jones. 2007. Elimination of endocrine disrupting chemicals nonylphenol and bisphenol A and personal care product ingredient triclosan using enzyme preparation from the white rot fungus Coriolopsis polyzona. Chemosphere 67:770-778.

3. Christmas, P., K. Tolentino, V. Primo, K. Z. Berry, R. C. Murphy, M. Chen, D. M. Lee, and R. J. Soberman. 2006. Cytochrome P-450 4F18 is the leukotriene B4 omega- 1/omega-2 hydroxylase in mouse polymorphonuclear leukocytes: identification as the functional orthologue of human polymorphonuclear leukocyte CYP4F3A in the down- regulation of responses to LTB4. J. Biol. Chem. 281:7189-7196.

4. Corvini, P. F., R. J. Meesters, A. Schaffer, H. F. Schroder, R. Vinken, and J. Hollender. 2004. Degradation of a nonylphenol single isomer by Sphingomonas sp. strain TTNP3 leads to a hydroxylation-induced migration product. Appl. Environ. Microbiol. 70:6897- 6900.

5. de Vries, Y. P., Y. Takahara, Y. Ikunaga, Y. Ushiba, M. Hasegawa, Y. Kasahara, H. Shimomura, S. Hayashi, Y. Hirai, and H. Ohta. 2001. Organic Nutrient-dependent Degradation of Branched Nonylphenol by Sphingomonas sp. YT Isolated from a River Sediment Sample. Microbes Environ. 16:240-249.

6. Doddapaneni, H., and J. S. Yadav. 2004. Differential regulation and xenobiotic induction of tandem P450 monooxygenase genes pc-1 (CYP63A1) and pc-2 (CYP63A2) in the white-rot fungus Phanerochaete chrysosporium. Appl. Microbiol. Biotechnol. 65:559- 565.

7. Doddapaneni, H., and J. S. Yadav. 2005. Microarray-based global differential expression profiling of P450 monooxygenases and regulatory proteins for signal transduction pathways in the white rot fungus Phanerochaete chrysosporium. Mol. Genet. Genomics. 274:454-466.

8. Doddapaneni, H., R. Chakraborty, and J. S. Yadav. 2005. Genome-wide structural and evolutionary analysis of the P450 monooxygenase genes (P450ome) in the white rot fungus Phanerochaete chrysosporium: evidence for gene duplications and extensive gene clustering. BMC Genomics 14:6:92.

9. Doddapaneni, H., V. Subramanian, and J. S. Yadav. 2005. Physiological regulation, xenobiotic induction, and heterologous expression of P450 monooxygenase gene pc-3 (CYP63A3), a new member of the CYP63 gene cluster in the white-rot fungus Phanerochaete chrysosporium. Curr. Microbiol. 50:292-298.

159 10. Eisen, M. B., P. T. Spellman, P. O. Brown, and D. Botstein. 1998. Cluster analysis and display of genome-wide expression patterns. Proc. Natl. Acad. Sci. 95:14863-14868.

11. European Union. 2001. 4-Nonylphenol (branched) and nonylphenol. European Union Risk Assessment Report, p. 4-5, Oxfordshire.

12. Gavrias, V., A. Andrianopoulos, C. J. Gimeno, and W. W. Timberlake. 1996. Saccharomyces cerevisiae TEC1 is required for pseudohyphal growth. Mol. Microbiol. 19:1255-1263.

13. Gorfinkiel, L., G. Diallinas, and C. Scazzocchio. 1993. Sequence and regulation of the uapA gene encoding a uric acid-xanthine permease in the fungus Aspergillus nidulans. J. Biol. Chem. 268:23376-23381.

14. He, Y., and H. K. Lee. 1996. Separation of structural homologues of alkylphenols and isomers of 4-nonylphenol by cyclodextrein-modified micellar electrokinetic chromatography. J. chromatogr. A 749:227-236.

15. Heemken, O. P., H. Reincke, B. Stachel, and N. Theobald. 2001. The occurrence of xenoestrogens in the Elbe river and the North Sea. Chemosphere 45:245-259.

16. Hu, J. Y., G. H. Xie, and T. Aizawa. 2002. Products of aqueous chlorination of 4- nonylphenol and their estrogenic activity. Environ. Toxicol. Chem. 21:2034-2039.

17. Ilmen, M., M. L. Onnela, S. Klemsdal, S. Keranen, and M. Penttila. 1996. Functional analysis of the cellobiohydrolase I promoter of the filamentous fungus Trichoderma reesei. Mol. Gen. Genet. 253:303-314.

18. Jobling, S., D. Sheahan, J. A. Osborne, P. Matthiessen, and P. Sumpter. 1996. Inhibition of testicular growth in rainbow trout (Oncorhynchus mykiss) exposed to estrogenic alkylphenolic chemicals. Environ. Toxicol. Chem. 15:194-202.

19. Junghanns, C., M. Moeder, G. Krauss, C. Martin, and D. Schlosser. 2005. Degradation of the xenoestrogen nonylphenol by aquatic fungi and their laccases. Microbiology.

20. Kannan, K., T. L. Keith, C. G. Naylor, C. A. Staples, S. A. Snyder, and J. P. Giesy. 2003. Nonylphenol and nonylphenol ethoxylates in fish, sediment, and water from the Kalamazoo River, Michigan. Arch. Environ. Contam. Toxicol. 44:77-82.

21. Karsa, D. R. 1987. Industrial applications of surfactants. The Royal Society of Chemistry, London.

22. Kim, Y. S., T. Katase, S. Sekine, T. Inoue, M. Makino, T. Uchiyama, Y. Fujimoto, and N. Yamashita. 2004. Variation in estrogenic activity among fractions of a commercial nonylphenol by high performance liquid chromatography. Chemosphere 54:1127-1134.

160 23. Kollmann, A., A. Brault, I. Touton, J. Dubroca, V. Chaplain, and C. Mougin. 2003. Effect of nonylphenol surfactants on fungi following the application of sewage sludge on agricultural soils. J. Environ. Qual. 32:1269-1276.

24. Kolpin, D. W., E. T. Furlong, M. T. Meyer, E. M. Thurman, S. D. Zaugg, L. B. Barber, and H. T. Buxton. 2002. Pharmaceuticals, hormones, and other organic wastewater contaminants in U.S. streams, 1999-2000: a national reconnaissance. Environ. Sci. Technol. 36:1202-1211.

25. Kullman, S. W., and F. Matsumura. 1996. Metabolic pathways utilized by Phanerochaete chrysosporium for degradation of the cyclodiene pesticide endosulfan. Appl. Environ. Microbiol. 62:593-600.

26. Kurihara, H., H. Wariishi, and H. Tanaka. 2002. Chemical stress-responsive genes from the lignin-degrading fungus Phanerochaete chrysosporium exposed to dibenzo-p-dioxin. FEMS Microbiol. Lett. 212:217-220.

27. Lalah, J. O., K. W. Schramm, B. Henkelmann, D. Lenoir, A. Behechti, K. Gunther, and A. Kettrup. 2003. The dissipation, distribution and fate of a branched 14C-nonylphenol isomer in lake water/sediment systems. Environ. Pollut. 122:195-203.

28. Li, D., M. Alic, and M. H. Gold. 1994. Nitrogen regulation of lignin peroxidase gene transcription. Appl. Environ. Microbiol. 60:3447-3449.

29. Mach, R. L., J. Strauss, S. Zeilinger, M. Schindler, and C. P. Kubicek. 1996. Carbon catabolite repression of xylanase I (xyn1) gene expression in Trichoderma reesei. Mol. Microbiol. 6:1273-1281.

30. Rice, C. P., I. Schmitz-Afonso, J. E. Loyo-Rosales, E. Link, R. Thoma, L. Fay, D. Altfater, and M. J. Camp. 2003. Alkylphenol and alkylphenol-ethoxylates in carp, water, and sediment from the Cuyahoga River. Ohio Environ. Sci. Technol. 37:3747-3754.

31. Soares, A., K. Jonasson, E. Terrazas, B. Guieysse, and B. Mattiasson. 2005. The ability of white-rot fungi to degrade the endocrine-disrupting compound nonylphenol. Appl. Microbiol. Biotechnol. 66:719-725.

32. Soto, A. M., H. Justicia, J. W. Wray, and C. Sonnenschein. 1991. p-Nonyl-phenol: an estrogenic xenobiotic released from "modified" polystyrene. Environ. Health Perspect. 92:167-173.

33. Stark, K., B. Wongsud, R. Burman, and E. H. Oliw. 2005. Oxygenation of polyunsaturated long chain fatty acids by recombinant CYP4F8 and CYP4F12 and catalytic importance of Tyr-125 and Gly-328 of CYP4F8. Arch. Biochem. Biophys. 441:174-181.

34. Stephen, D. W., S. L. Rivers, and D. J. Jamieson. 1995. The role of the YAP1 and YAP2 genes in the regulation of the adaptive oxidative stress responses of Saccharomyces cerevisiae. Mol. Microbiol. 3:415-423.

161 35. Sumpter, J. P., and S. Jobling. 1993. Male sexual development in "a sea of oestrogen". Lancet 342:124-125.

36. Sumpter, J. P., and S. Jobling. 1995. Vitellogenesis as a biomarker for estrogenic contamination of the aquatic environment. Environ. Health Perspect. 103:173-178.

37. Tanghe, T., W. Dhooge, and W. Verstraete. 1999. Isolation of a bacterial strain able to degrade branched nonylphenol. Appl. Environ. Microbiol. 65:746-751.

38. Vallini, G., S. Frassinetti, F. D'Andrea, G. Catelani, and M. Agnolucci. 2001. Biodegradation of 4-(1-nonyl)phenol by axenic cultures of the yeast Candida aquaetextoris: identification of microbial breakdown products and proposal of a possible metabolic pathway. Int. Biodeterior. Biodegradation 47:133-140.

39. Wheeler. T. F., J. R. H., M. R. LaTorre, and B. Janes. 1997. Mass spectral characterization of p-nonylphenol isomers using high-resolution capillary GC-MS. Chromatogr. Sci. 35:19-30.

40. White, R., S. Jobling, S. A. Hoare, J. P. Sumpter, and M. G. Parker. 1994. Environmentally persistent alkylphenolic compounds are estrogenic. Endocrinology 135:175-182.

41. Wolfinger, R. D., G. Gibson, E. D. Wolfinger, L. Bennett, H. Hamadeh, P. Bushel, C. Afshari, and R. S. Paules. 2001. Assessing gene significance from cDNA microarray expression data via mixed models. J. Comput. Biol. 8:625-637.

42. Yadav, J. S., and C. A. Reddy. 1993. Degradation of benzene, toluene, ethylbenzene, and xylenes (BTEX) by the lignin-degrading basidiomycete Phanerochaete chrysosporium. Appl. Environ. Microbiol.:756-762.

43. Yadav, J. S., and C. A. Reddy. 1992. Non-involvement of lignin peroxidases and manganese peroxidases in 2,4,5-trichlorophenoxyacetic acid degradation by Phanerochaete chrysosporium. Biotech. lett. 14:1089-1092.

44. Yadav, J. S., and H. Doddapanani. 2003. Genome-wide expression profiling and xenobiotic inducibility of P450 monooxygenase genes in the white rot fungus Phanerochaete chrysosporium. Monduzzi Editore, Bologna.

45. Yadav, J. S., D. L. Lawrence, B. A. Nuck, T. W. Federle, and C. A. Reddy. 2001. Biotransformation of linear alkylbenzene sulfonate (LAS) by Phanerochaete chrysosporium: oxidation of alkyl side-chain. Biodegradation 12: 443-453.

46. Yadav, J. S., H. Doddapaneni, and V. Subramanian. 2006. P450ome of the white rot fungus Phanerochaete chrysosporium: structure, evolution and regulation of expression of genomic P450 clusters. Biochem. Soc. Trans. 34:1165-1169.

47. Yadav, J. S., J. F. Quensen 3rd, J. M. Tiedje, and C. A. Reddy. 1995. Degradation of polychlorinated biphenyl mixtures (Aroclors 1242, 1254, and 1260) by the white rot

162 fungus Phanerochaete chrysosporium as evidenced by congener-specific analysis. Appl. Environ. Microbiol. 61:2560-2565.

48. Ying, G. G., B. Williams, and R. Kookana. 2002. Environmental fate of alkylphenols and alkylphenol ethoxylates-a review. Environ. Int. 28:215-226.

163 Figure Legends:

Fig. 1. Effect of P450 enzyme inhibitor on degradation of nonylphenol by P. chrysosporium under different nutrient conditions. Varying final concentration of the P450 enzyme inhibitor piperonyl butoxide (100, 500, 1000 µM) was used. Panel A: ME cultures; Panel B: LN cultures;

Panel C: HN cultures. Asterix indicates the values that are statistically significant (P ≤ 0.05).

Fig. 2. Induction of P450 genes in response to nonylphenol in P. chrysosporium cultures grown under ME and LN conditions, as determined by the custom-P450 microarray analysis. Bars represent average fold-induction of individual P450 genes. Asterix indicates the statistically significant values (P ≤ 0.05, FDR < 0.1).

Fig. 3. Comparative profiling of the P450 genes inducible by nonylphenol under different nutrient conditions. Only those P450 genes that showed greater than two-fold induction under either nutrient condition (LN or ME) were included. Genes represented in the center are the overlapping genes that showed induction under both the nutrient conditions.

Fig. 4. Regulation of the peroxidase genes in response to nonylphenol under Low N (LN) condition as revealed by microarray analysis. Bars represent average fold-change. Asterix indicates the statistically significant values (p ≤ 0.05, FDR < 0.1).

Fig. 5. Transcription factors and other signal transduction genes responsive to nonylphenol under different nutrient conditions as revealed by microarray analysis. Bars represent average fold-

164 change of only those genes that showed changes greater than the cut-off limit of ± 2.0 fold in the microarray analysis. Asterix indicates the statistically significant values (p ≤ 0.05, FDR < 0.1).

165 ME

120

g n i 100 * n i

a *

m 80 A e

r l 60 no

he 40 p l

ny 20

no 0 % Uninoc - NP - inh NP + 100uM NP + 500uM NP + control inh inh 1000uM inh Treatment conditions

LN

140 g 120 inin a 100 m e

B r 80

nol 60

he

lp 40

ny 20

no

% 0

Uninoc -control NP - inh NP + 500uM inh NP + 1000uM inh Treatment conditions

HN

140

g n i 120

n i a 100 m e r 80

C nol 60 phe l 40

nony 20 % 0 Uninoc -control NP - inh NP + 500uM inh NP + 1000uM inh Treatment conditions

Figure 1

166

00 2 * ME condition 0 19 0 8 1 0 7 1 * ange 160 A h 10 * Fold c * * * 5 * * * * * * * * * * * * * 0 1 b 5 7 M M -2 8a 2 * 5h 2d 3b 9M MP MP 9f 4aM 4cM 1cM 8 F 78 pc 1B 4aM aI 3I 38 20 25 29 PFF PFF 16 FF 14 PF 16 16 31 F 12 31 10 17 F P PFF F PFF F PFF PFF PFF PFF PF F P PFF PFF PFF P PFF PFF

P450 gene

12 LN condition

10

8

ge * * B 6 * * Fold chan * * 4 * * * * * * * * * * 2 * *

0 2 1 P R R R R M - fM 57 1 aM F 7 F 9 O O O O MP M xy 49a 93b 6 9fM pc fo PF PF PFF PFF 15c PFF 5 252aI 205dI FF 16 PFF 2 PFF 8 PFF 2 FF 137 361aF 242cF P P PFF PFF PFF PFF PFF 361bF PFF 242bF

P450 gene

Figure 2

167

ME LN PFF 10aIMP foxy1 PFF 129M PFF 15c PFF 141 PFF 205dIMP PFF 164a PFF 242cFOR PFF 164cM Pc 2 PFF 249a PFF 173IMP PFF 361aFOR PFF 252d PFF169fM PFF 361bFOR PFF 311BM PFF293b PFF 51M PFF 311cM PFF 57 PFF 388a PFF 7 PFF 86fM PFF 4aM PFF 9 PFF 5 PFF 137 aM PFF 78 PFF 242 bFOR PFF 82b PFF 252aIMP PFF 205h

Figure 3

168

2

3 - e g * -8 n * a

h *

3 *

1 c - ld 8 o F -1 3 2

-

8 -2 D A ily 13

pJ P pC pH p np1 np3 Li poB m Li LI Li Li L a m m f 802 _ M p i _

L 1 F

p Gene name Li

Figure 4

169

ME condition

32.00 28.00 *

24.00 * * 20.00 e

g * 16.00 an A 12.00 ch d l 8.00 * o * F 4.00 * * * 0.00

-4.00 * * * -8.00 1 2 2 1 1 H A R * A l tA P eA C B a e_A A n CP CD cr BHI Pbs Gs 2 TE ag OSM C P xy los llu YA e c Gene name

LN condition

0 0 . 5

0 0 .

5 * -

B 00 * 5. change 1

- d l Fo 0

0 . 5 2

-

*

00 35. 1 1 2 - 1 G4 uap glx CK CBHI STE Gene name

Figure 5

170 Table 1. List of primers used in this study

Gene Forward Primer (5’ – 3’) Reverse Primer (5’ – 3’) Pff_252a Pff252a-RT-SP-F1 - CCGTCCACAGAACTTACCCAAGGC Pff252a-RT-SP-R1 – GTAAGGTCGTGCGCTCAGTCCG Pff_205h Pff205h-RT-SP-F2 - GCGGGCACTGTAATTGTCGGC 205h-RT-SP-R1 - CTGACCGAACCAGGGCTTCCGC LpoB LpoB-F- CCCAAGTTCCAAGTCAAACG LpoB-R-Rev – GCTCGATGTCGTCGAAGATC Pc-2 A2-RT-SP-F3 - AGCCCGAACCCGTTCATCTTCCTC A2-RT-SP-R10 – GCAGCAGGGCACATCCACTAGG Glx1 Glx1-Up1 - GCTCAGCAATGGCACTATG Glx1-Dn1 - CGAGCGTTCCAAGAAGGC Pff_10a Pff-10a-Up1 - CACACGGTCTCGCAGAGC Pff-10a-Dn1 - GGATACACTTCGTCGTCCAG Pff_137a Pff-137a-Up1 - CGAGTACTCAGACTCTCGC Pff-137a-Dn1 - GATCCACTGAAGCATGTCG LipD LipD-F – TCCATCGCTATCTCGCCC LipD-R - ATGCGAGCGAGAACCTGA agalA agalA-Up1 - CATCACGAACAAGGCCATCATCG agalA-Dn1 - GGTGTACGCCGATAGTGAC xynB xynB-A-Up1 - CGGATCCGTCACCTACAAC xynB-A-Dn1 - GATCGACGGCTCGTTCAC GPD PC-GPD-UP2 - GGCATTGTGCAGGGTCTCATG PC-GPD-DN2 - GAGTAGCCCCACTCGTTGTC CPR CPR-UP1-SV - GAGCACTACCAGAACATCGTC CPR-DN1-SV - CAGCGTAGCTGCCTTGTCATG Pff_141 PFF_141-Up1 - AACACGAACGGGATCAAGGAG PFF_141-Dn1 - GTAGAACAGGTTGCTGAGGAC PC-3 A3- SP-RT-R5 - CCAAGGAGGAGATAGACGAGGAC A3- SP-RT-R4 -CGAACGTTCCATGGGACAGCG Pff_4a Pff_4a-Up1-GGACGCAACCTTGCATACA Pff_4a-Dn1-GATTTCGGCACGCTTAGCC Pff_311b Pff_311b-Up1- CGCTCTGGATAACACGGAGAAC Pff_311b-Dn1- CAGAGCATCCAGGTGACC

171

Table 2. Verification of the microarray-based induction patterns of selected genes by quantitative RT-PCR analysis

Fold changes under ME condition Fold changes under LN condition Gene Name Microarray QRT-PCR Microarray QRT-PCR Pff_4a 166.96 ± 0.091* 537.36 ± 153.38 1.1 2.05 ± 0.64 xynBA 22.55 ± 0.098* 10.62 ± 3.47 1.41 ± 0.20 0.15 ± 2.02 gpd -1.51 ± 0.051* 1.01 ± 0.01 -1.08 ± 0.26 -1.96 ± 0.15 PC-2 8.49 ± 0.065* 8.27 ± 3.42 3.93 ± 0.19 * 16.77 ± 3.18 Pff_311b 194.94 ± 0.055* 506.95 ± 22.32 -1.5 ± 0.22 2.82 ± 0.80 Pff_141 5.12 ± 0.092* 17.57 ± 0.77 1.52 ± 0.16 3.08 ± 0.33 agalA 2.58 ± 0.081* 2.33 ± 1.50 1.4 ± 0.20 3.41 ± 0.33 PC-3 1.97 ± 0.081* 4.59 ± 1.07 -1.31 ± 0.19 1.76 ± 0.81 POR 3.82 ± 0.073* 3.60 ± 0.24 -1.1 ± 0.20 -1.27 ± 0.03 Pff_10a 2.64 ± 0.135* 1.19 ± 0.14 1.87 ± 0.18* 5.62 ± 1.52 Pff_205h 3.04 ± 0.208* 1.64 ± 0.52 6.6 10.02 ± 3.51 Pff_252a -2.39 ± 0.138* -1.46 ± 0.41 5.11 ± 0.3* 4.26 ± 1.88 glx -1.21 ± 0.119 0.03 ± 2.61 -10.44 ± 0.48* -5.43 ± 0.31 LipD 1.33 ± 0.23 -0.08 ± 1.58 -25.68 ± 0.49* -6.09 ± 0.47 LpoB -1.16 ± 0.076 -0.03 ± 1.67 -7.2 ± 0.20* -14.88 ± 0.80 Pff_137a -13.36 ± 0.136* -3.28 ± 1.81 6.12 ± 0.31* 9.10 ± 0.53

The values presented in “Microarray” columns represent average fold-change obtained by averaging eight independent spots for each gene. The values presented in QRT-PCR columns represent average fold-change obtained from duplicate samples.

* Values that are statistically significant (P ≤ 0.05) and have < 0.1 false discovery rate (FDR)

172 Chapter VII

Heterologous expression and purification of white rot fungal cytochrome P450 monooxygenase PC-2, a PAH-inducible P450

7.1. Introduction

Cytochrome P450 monooxygenases are a super family of heme-containing proteins that are

known to catalyze the oxidation of a wide variety of endogenous compounds and xenobiotic

chemicals (Aznenbacher and Anzenbacherova 2001). These oxidizing enzymes are thought to

form an important component of the biodegradative enzyme machinery of the white rot fungus

Phanerochaete chrysosporium. Our working hypothesis is that P450s along with the other

intracellular enzymes are involved in the complete degradation of the internalized lignin-

degradation products, as well as in direct metabolism of internalized lipophilic xenobiotic

compounds such as PAHs. A minimum of 148 P450 genes were reported in the Phanerochaete genome (Martinez et al. 2005). In on our phylogenetic analysis, 163 predicted P450 sequences were initially clustered into 26 clusters (Yadav and Doddapaneni 2003). Subsequent analysis of the 126 full-length or near full-length (>300 amino acids) P450 genes coupled with the standard homology criteria showed that these P450 genes fall into 12 families and 23 subfamilies

(Doddapaneni et al. 2005). The gene numbers varied between families, from one gene in CYP51,

CYP61, and CYP62 to as high as 54 gene members in CYP64.

The P450 family, CYP63, has been the focus of study in our laboratory. This family consists of seven genes, arbitrarily named as pc-1 through pc-7. Of these, pc-1 (CYP63A1) and pc-2 (CYP63A2) were the first to be isolated from this organism (Yadav et al. 2003).

Subsequently the third protein in this family, pc-3 (CYP63A3) was isolated and heterologously

173 expressed in our laboratory (Doddapaneni et al. 2005). Based on our gene regulation studies, it is known that all CYP63 family of proteins are regulated at the level of transcription by several of the xenobiotic compounds, including aliphatic compounds, alicyclic compounds, aromatic compounds, and polycyclic aromatic compounds (Doddapaneni and Yadav, 2004, Doddapaneni et al. 2005, Yadav et al. 2006). Despite reasonable information now available on these proteins practically nothing is known with respect to their function in this organism. Our initial efforts related to the heterologous expression of two of the CYP63 proteins, PC-1 and PC-3 using multiple heterologous systems like E. coli, S. cerevisiae, Y. lipolytica, A. niger and baculoviral

systems earlier (Subramanian and Yadav 2007, Doddapaneni et al. 2005). Here we report

heterologous expression and purification of the third protein of the CYP63 family, PC-2 using

the yeast Pichia pastoris. Recombinant expression and purification of this P450 is significant

considering its inducibility by a wide range of xenobiotic chemicals, including polycyclic

aromatic hydrocarbons.

7.2. Materials and Methods

7.2.1. Strains and culture conditions. Pichia pastoris strain GS115 used in this study was kindly

provided by Dr. George Smulian of the University of Cincinnati. The yeast cultures were

routinely maintained in YEPD (yeast extract peptone dextrose) medium at 300C.

7.2.3. Construction of expression plasmid. The cloned pc-2 gene was amplified using the

forward primer 5’-AGAATTCGCTATGTTGGTCTCCGTG-3’ and reverse primer 5’-

AGCGGCCGCAACGACGGCCTCCGAG-3’ such that the translational start codon ATG was a

174 part of the forward primer, which was preceded by the G/ANN nucleotide sequence that forms a

part of the Kozak sequence (G/ANNAUGG). The reverse primer did not contain the translational

stop codon, hence the expressed protein would contain a histidine tag in the C-terminus. The

forward and the reverse primer had built-in EcoRI and a NotI restriction site, respectively, so as to facilitate cloning into the pPICZb vector. The amplified product was cloned into the TOPO

2.1 vector followed by restriction digestion with EcoRI and NotI to release the insert. This fragment was then gel eluted and ligated with the EcoRI-NotI digested pPICZb vector.

Transformants were selected on low salt Luria-Bertani medium (LB) containing 25 µg/ml zeocin. Colonies were screened for the presence of the insert in the correct orientation by using restriction analysis.

7.2.3. Transformation into Pichia pastoris. The pc-2 containing plasmid was linearized using

BstXI enzyme and transformed into GS115 cells using the lithium chloride transformation method (Invitrogen Corp.). Transformants were selected on YPD containing 100 µg/ml zeocin plates. Colonies were further confirmed to be true transformants by restreaking on YPD containing zeocin plates (100 µg/ml). Genomic DNA was extracted from these transformants.

Insertion of pc-2 gene into the yeast genome was confirmed by PCR using the cloning primers mentioned in the earlier section. The pPICZb vector was also transformed into GS115 cells in order to serve as a negative control.

7.2.4. Heterologous expression of PC-2 in Pichia pastoris. A single transformant colony was transferred into 100 ml of BMGY (Buffered minimal glycerol medium) containing 1% glycerol

0 as the source of carbon and incubated at 30 C at 180 rpm to an O.D600 of 7.0. Cells were pelleted

175 by centrifugation at 6000 rpm for 5 min and resuspended in 300 ml of BMMY (Buffered

minimal methanol medium) induction medium containing 0.5 % methanol such that the O.D600

of the culture was adjusted to 1.0. Cultures were incubated at 280C at 200 rpm for 96 h post induction. Methanol was added to a final concentration of 0.5 % after every 24 h. A 50 ml

aliquot of the induced culture was harvested every 12 h by centrifugation at 6000 rpm for 5 min,

washed with 0.1 M sodium phosphate buffer and snap-frozen (-800 C). For extraction of proteins,

the cells were thawed and resuspended in buffer Y (50 mM Tris pH 7.4, 1 mM EDTA, 5%

glycerol, 0.1 mM PMSF, 2 µg/ml aprotinin, 1 µg/ml pepstatin). The cells were lysed with glass

beads (ten cycles of 30 sec each) and the lysate was centrifuged consecutively at 8000 x g to

remove the cell debris and 11,000 x g for further clarification of the extract. Microsomes were

isolated by centrifuging the clear lysate at 100,000 x g for 1 h followed by resuspending the

pellet in Buffer Y containing 20% glycerol. Protein estimation was done using Bradford reagent

protocol (Bio-Rad). The microsomal proteins were separated on two separate 10 % SDS-PAGE

gels; one gel was used for SYPRO Ruby staining and the other for Western blot analysis using

anti-His antibody (Bio-Rad).

7.2.5. Purification of the heterologously expressed PC-2 protein. A single transformed colony of

PC-2 expressing Pichia pastoris culture was grown in 500 ml of BMMY medium in two liter

flasks at 280C for 36 h post induction. Total microsomal extract was prepared as described above.

An aliquot (7 mg) of the microsomal protein was diluted to 7 ml in Buffer A (0.1 M tricine/NaOH pH 7.5) containing 15 mM thioglycolic acid. To this mixture 0.2 % CHAPS (3-[(3-

Cholamidopropyl)dimethylammonio]-1-propanesulfonate) was added and stirred for few min.

176 Emulgen 913 (2%) solution (140 µl) of was then added to this 7 ml mixture and allowed to stir

for 1 h at 40 C. Following stirring, this solubilized fraction was centrifuged at 100,000 x g for 1 h

to remove unsolubilized membrane fractions. The pellet was stored in 0.1 M KPO4 buffer (pH

7.4) containing 20 % glycerol. The supernatant was stored as the membrane solubilized fraction.

An aliquot (50 µl) of each extract was then loaded on a 10 % SDS-PAGE gel followed by

SYPRO Ruby staining and Western blot analysis.

A defined amount (7 ml) of the solubilized membrane protein was diluted (to 20 ml) with

tricine/NaOH buffer (pH 7.5) containing the same final concentrations of CHAPS and Emulgen

913 followed by addition of 300 mM NaCl and 5 mM Imidazole to this protein extract. All

solutions used in the subsequent purification protocol contained 300 mM NaCl. The solubilized-

microsomal protein solution was mixed with 3 ml of Ni-NTA agarose pre-equilibrated with

Buffer A containing 300 mM NaCl and 5 mM Imidazole for 1 h at 40C and loaded onto a column

(3 ml). The column was washed with the same buffer and the first wash was collected (W1). This was followed by two washes with 20 mM imidazole containing buffer A (W2 and W3). Elution of the purified protein was done using buffer A containing 80 mM imidazole (E1, E2, E3), 150 mM imidazole (E4, E5, E6), and 300 mM imidazole (E7).

The protein fractions (40 µl) were separated on a 10 % SDS-PAGE gel and detected using SYPRO Ruby stain or Western blot analysis using anti-His antibody (Santa Cruz Biotech.

Inc., USA). Following purification, the four fractions that showed a single band on the SYPRO

Ruby stained gel namely E2, E3, E4, and E5 were pooled together. Twelve ml of the pooled extracts were subjected to concentration using YM-10 Centriprep centrifugal filter device

(Millipore Corp., USA) to a final volume of 1 ml. The concentrated protein was then dialyzed against 0.1 M KPO4 buffer (pH 7.4) containing 3 % glycerol using spectrapor membrane with a

177 molecular weight cut off limit of 6000-8000 daltons. Sterile glycerol was then added to the

dialyzed protein preparation to make the final glycerol concentration of 20 %. The protein concentration was then estimated using Bradford reagent (Bio-rad). Approximately 2 µg of this purified protein was then separated on 10 % SDS-PAGE and stained with SYPRO Ruby to check the purity.

7.2.6. Whole cell-based bio-degradation studies using PC-2 expressing cells. GS115 cells expressing PC-2 were induced in the presence of 0.5 % methanol in BMMY medium for 36 h. A parallel culture containing the vector-only transformant was also induced as a control. Five ml of this culture was mixed with 5 ml of BMMY medium containing the test chemicals at a final concentration of 100 µM (dodecene, phenyldodecane, linoleic acid, β-estradiol, DDT, pyrene, phenanthrene, and benzo(a)pyrene). The treated cultures were incubated for 1 h at 300C under

shaker conditions. An aliquot (3 ml) of the culture was removed aseptically and extracted with an

equal volume of methylene chloride. The remaining culture was allowed to incubate overnight.

Similar aliquot (3 ml) of the culture was removed and extracted with methylene chloride.

Following extractions, the solvent fraction was dried under nitrogen and resuspended in 500 µl

acetonitrile for GC-MS analysis. GC analysis was done using a Varian 3800 GC equipped with

an 8200 autosampler. Separation of metabolites was achieved using the Heliflex AT column

(length, 30 m; inner diameter, 0.25 mm; film thickness, 0.25 mm; nonpolar). Mass spectrometry

was done using a Saturn 2000 system. The GC column temperature program varied for

individual compounds.

178 7.3. Results

7.3.1. Heterologus expression of PC-2 in Pichia. The cloned full length pc-2 gene showed heterologous expression of the gene product in Pichia pastoris, the molecular weight of which was found to be ~ 70 kDa. Western blot analysis using anti-His antibody showed that the protein expressed maximally after 36 h followed by decline in expression at 48 h and 72 h post- induction with 0.5 % methanol (Fig. 1). In order to exclude the possibility of non-specific binding of the anti-his antibody, proteins extracted from control cultures were run in parallel to the protein extracts from PC-2 expressing cultures. SYPRO Ruby staining clearly showed the presence of a band that was unique for the PC-2 expressing lane and which migrated at the same distance as the PC-2 expressing band on the Western blot (Fig. 2). The expressed PC-2 microsomal protein showed a typical reduced CO-spectrum (Fig. 3).

7.3.2. Purification of PC-2 from yeast microsomal extracts. Since PC-2 expression was found to be highest after 36 h of induction, 500 ml cultures were grown and harvested at this time point for microsomal protein extraction. The microsomal extract was solubilized using 0.1 M tricine/NaOH buffer in the presence of the detergents, CHAPS and Emulgen 913. As observed from Western blotting, significant amount of the protein was found to be in the soluble fraction, as opposed to a minor amount that was also observed in the insoluble fraction (Fig. 4).

Purification of the PC-2 protein using Ni-NTA column showed that the protein started eluting

from the column starting from the third wash fraction (20 mM imidazole). Mild elution of the

protein was observed in the first eluate with 80 mM imidazole (E1 fraction), followed by

maximal elution in subsequent 80 mM fractions (E2, E3). The protein continued to be eluted in

179 the first 150 mM fraction (E4) followed by reduction in the levels of the purified protein in the second 150 mM fraction (E5). No further protein elution was observed in the third 150mM imidazole fraction (E6) or 300 mM imidazole fraction (E7) (Fig. 5A). The protein that eluted on

E2, E3, E4, and E5 lanes showed bands that migrated at molecular weights between 64kDa and

85 kDa. Parallel gels that were subjected to Western blotting (using anti-his antibody) showed single bands of the same molecular sizes as that seen on the SYPRO Ruby stained gels (Fig. 5B).

In order to use the purified protein for further analysis, the fractions were pooled, concentrated, dialyzed, and analyzed on an SDS-PAGE gel. SYPRO Ruby staining showed a single band that migrated at an approximate molecular weight of > 66 kDa, the expected size of the PC-2 protein

(Fig. 6).

7.3.3. Whole cell degradation of xenobiotic compounds. PC-2 expressing cultures of Pichia pastoris were grown in the presence of individual compounds and solvent extracted for GC-MS analysis. The following compounds tested for the biotransformation reactions were selected based on their induction potential: dodecene, phenyldodecane, linoleic acid, β-estradiol, DDT, pyrene, phenanthrene, and benzo(a)pyrene. The compounds were detected both using the scanning mode as well as ion extraction mode for selective detection of the compound. None of the compounds tested showed any traces of bioconversion when compared with the vector-only control based on GC analysis (Figs. 7-14). Both the 1 h-treated and the 24 h-treated cultures showed similar profiles when compared with the vector-only control cultures.

180 7.4. Discussion

Owing to the unique catalytic activity of the cytochrome P450 monooxygenases, these enzymes are gaining increased acceptance in the drug manufacturing industries. A primary hurdle in using these enzymes in industrial applications is the amount of functional enzymes produced, since sufficient quantitities of enzymes are required for carrying out large-scale enzymatic reactions. Pichia pastoris is one such heterologous expression system that is known to produce enzymes in huge quantities.

Several problems have been associated with expression of the P450 enzymes from the white rot fungus Phanerochaete chrysosporium. The primary problem deals with high GC content combined with the difficulty in reading codons of this organism (codon usage). We have in the past faced extreme difficulties expressing proteins in bacterial systems like E. coli

(Subramanian and Yadav 2007). Secondly, even white rot P450 proteins that were expressed using codon-optimized cDNAs failed to show proper folding and incorporation of heme

(Subramanian and Yadav 2007). Our attempts to express white rot P450 in other eukaryotic systems have also yielded only partial success. For instance, white rot P450s showed little expression, if any, in eukaryotic hosts like S. cerevisiae, Y. lipolytica, A.niger or the baculoviral systems (Subramanian and Yadav 2007).

Pichia pastoris has been used previously for expression of membrane proteins and specifically P450 monooxygenases from other organisms (Kolar et al. 2007, Trant 1996, Dietrich et al. 2005). This prompted us to use the Pichia system for heterologous expression of the P450 enzyme PC-2. In order to select a suitable candidate for the expression studies, we used the previously known and well accepted fact that chemical inducers of P450 genes could also be the substrates for these enzymes. PC-2, which belongs to the CYP63 family of proteins, is known to

181 be induced by several chemicals, belonging to aliphatic compounds, aromatic compounds, PAH compounds, and alicyclic aromatic compounds (Doddapaneni and Yadav 2004). We have also seen in our microarray experiments that pc-2 is specifically induced by the endocrine-disrupting chemical, nonylphenol, under both nitrogen-limited and nitrogen-sufficient conditions (chapter

VI). These induction data encouraged us to select pc-2 for further heterologous expression studies.

The deduced PC-2 protein contains all the motifs that are typical of a P450 enzyme namely a transmembrane domain in the N-terminus and I –helix and the K-helix preceding the

HR2 motifs. It is a 600 aa protein with a predicted molecular weight of 68.45 kDa. As shown by

Western blotting, PC-2 was successfully expressed in the host Pichia pastoris (Fig. 1). The expressed protein was a full length protein based on the fact that the histidine residues were tagged to the C-terminus of the protein. The protein was seen to selectively elute in fractions of

80 mM and 150 mM imidazole. Purity of the protein as observed on SDS-PAGE gels seemed to be extremely high indicating that the protein could be directly used for in vitro catalytic studies.

The level of expression varied with the time of induction. As seen in Fig. 1, maximal expression of the protein was found at 36 h of induction, a characteristic that varies with individual protein in this expression system. PC-2 protein was expressed in membrane fractions based on the observation that they were exclusively detected in the microsomal fractions.

Absolutely no protein was detected in soluble fractions (data not shown). The expressed protein was found to be practically insoluble in detergents like CHAPS and Emulgen 913 in phosphate and tris buffers. We therefore used an alternate protocol (Rosco et al. 1997) that incorporated both CHAPS and Emulgen 913 at a concentration of 0.2 % and 2 %, respectively, in 0.1 M tricine/NaOH buffer (pH 7.5) in combination with the disulfide bond-breaking compound

182 thioglycolic acid. This procedure enhanced the solubilization of the enzymes drastically. A major

portion (~ 70 %) of the PC-2 protein was found in the soluble fraction. An important aspect that

stood out from our attempts was that neither thioglycolic acid nor tricine/NaOH buffer showed any interfering effect in the subsequent Ni-NTA purification protocol. This buffer is traditionally not used in protein purification techniques. As far as we know, this is the first report using tricine/NaOH buffer for Ni-NTA based purification of a P450 enzyme. However, P450 enzymes are known to be extremely unstable in the membrane-unbound form. This was also the case in our experiment, where the purified soluble form was not found to be spectrally active. The effect of thioglycolic acid on PC-2 is an important factor that needs to be considered. Due to its characteristic of breaking disulfide bonds it is not certain if some of the important chemical bonds especially the one that involves the cysteine residue, which forms an important component of the heme-binding HR2 domain, is altered. Hence, even though a complete protein product is observed on the Western blot, the stability and conformation of the protein is still questionable due to lack of co-binding spectrum. The amount of protein that we purified from the initial 7 mg of microsomal protein was 1 mg, which amounts to nearly 14 % of the total microsomal protein from this expression system.

Whole Pichia cells expressing P450 (cyp) enzymes have been used successfully in the past for biotransformations (Trant 1996, Kolar et al. 2007). One advantage of using Pichia cells

is that being a eukaryotic host, it can carry out the post translational modifications (e.g.

glycosylation) that are needed to maintain the native confirmation of the protein, thereby

eliminating the problems associated with optimizing in vitro catalytic conditions. Secondly,

Pichia is known to contain a native cytochrome P450 reductase component that is likely capable

of transferring electrons needed to complete the catalytic cycle of the P450 monooxygenases.

183 Thirdly, yeast cells are known to allow diffusion of several lipophilic compounds through their cell walls. Even large hydrophobic compounds like the PAH could be transported into these cells, thus making yeast cells a suitable candidate for in situ bioremediation of toxic xenobiotics in nature.

In order to study the functionality of the P450 proteins, there are two approaches that can be followed; either using the purified CYP enzyme or using whole cells as a biocatalyst. The purified enzyme did not show the typical P450 spectrum. Our attempts to incorporate the heme into the protein also did not yield any spectrally active protein (data not shown). We therefore decided to use the whole cells in order to study biotransformation of xenobiotic compounds.

Based on GC-MS analysis there were no new products that were observed in the GC spectrum.

One possible reason for the observed lack of biotranformation could be the use of insufficient enzyme or the fact the incompatibility of the P450 with the endogenous oxidoreductase enzyme of the Pichia host. Thus the electrons are not transferred to the P450 enzyme thereby resulting in the overall biotransformation activity. The advantage of using GC-MS as opposed to using

HPLC was that specific mass ions can be selectively detected thereby making GC-MS more sensitive to smaller amounts of chemicals as compared to HPLC. Thus the probability of identifying the biotransformed product was much higher and easier as compared to HPLC. To our disappointment, none of the compounds that we tested showed biotransformation with the whole cells. Scaling-up of the PC-2 expression/purification and use of the homologous P450 oxidoreductase from P. chrysosporium are the possible future strategies in this direction.

Alternately, further optimization needs to be carried out in Pichia, or other expression systems have to be explored to identify “the perfect” system that can achieve a fully functional spectrally- active P450 enzyme from this fungus.

184 Figure Legends

Figure 1. Time course of induction of PC-2 expression in Pichia pastoris. PC-2 transformed

cultures were induced in Buffered minimal methanol medium containing 0.5 % methanol

followed by harvesting at 0 12, 24, 36, 48h, 72, and 96 h post induction. Microsomes (100 µg)

extracted from these cultures were then subjected to SDS-PAGE and transferred to nitrocellulose

membrane. Western blot analysis was performed using anti-His antibody.

Figure 2. Heterologous expression of PC-2 in Pichia pastoris. Cultures transformed with pc-2

containing plasmid and vector-only plasmids were grown for 36 h in the presence of methanol

(0.5 %) followed by extraction of microsomes. Panel A, 12.5 µg microsomal protein was separated on 10 % SDS-PAGE for SYPRO Ruby staining; Panel B, 150 µg microsomal proteins

were separated on 10 % SDS-PAGE and analyzed by Western blotting. Lane 1, untransformed

GS115; Lane 2, GS115 transformed with vector-only; Lane 3, GS115 transformed with PC-2.

Figure 3. P450 spectrum of the expressed white rot P450 PC-2. Reduced CO spectrum of the

microsomes expressing PC-2.

Figure 4. Solubilization of Pichia microsomes extract expressing PC-2. Microsomal extract was

solubilized with 0.1 M tricine/NaOH (pH 7.5) containing 0.2 % CHAPS, 2 % Emulgen 913, and

15 mM thioglycolic acid. Panel A, SYPRO Ruby stained PAGE gel; Panel B, Western blot for

the solubilized fractions using anti-his antibody. M, prestained protein marker, Lane 1, 50 µl

solubilized protein fraction, lane 2, pellet after centrifugation at 100,000 x g.

185

Figure 5. Purification of the heterologously expressed white rot P450 PC-2 from the yeast P.

pastoris. Total microsomal proteins extracted from the PC-2-expressing P. pastoris were solubilized and passed through Ni-NTA column followed by elution with different concentrations of imidazole. (A) Equal volumes of the protein were loaded on to 10 % SDS-

PAGE gel and the bands were observed by SYPRO Ruby staining. (B) Western blot analysis on

the same extracts using anti-His antibody. Abbreviations: M (Bench-Mark Protein ladder), F1

(flow-through), W1 - W3 (Serial washes), E1 - E3 (Eluates using 80 mM imidazole), E4 – E7

(Elutates using 150 mM imidazole).

Figure 6. Electrophoretic analysis of the purified PC-2 protein. Purified protein eluates were

pooled, concentrated and dialyzed followed by running on 10% SDS-PAGE and stained with

SYPRO Ruby. 2 µg of purified PC-2 loaded. M, unstained protein ladder; Lane 1, 2 µg of

purified PC-2 protein.

Figure 7. Biotransformation of dodecene using whole cells of Pichia GS115 expressing PC-2.

Panel A: Gas chromatographic analysis for possible dodecene metabolites from methanol-

induced PC-2 expressing GS115 cells (top) and vector-only control (bottom) treated with

dodecene for 1h. Panel B: Typical mass spectrum showing the m/z peaks of dodecene.

Figure 8. Biotransformation of phenyldodecane using whole cells of Pichia GS115 expressing

PC-2. Panel A: Gas chromatographic analysis for possible phenyldodecane metabolites from

methanol-induced GS115 cells transformed with PC-2 (top) or pPICZb vector (bottom) treated

186 with phenyldodecane for 1h. Panel B: Typical mass spectrum showing the m/z peaks of

phenyldodecane.

Figure 9. Biotransformation of β-estradiol using whole cells of Pichia GS115 expressing PC-2.

Panel A: Gas chromatographic analysis for possible TMS derivatized β-estradiol metabolites

from methanol-induced GS115 cells transformed with PC-2 (top) or pPICZb vector (bottom)

treated with β-estradiol for 1h. Panel B: Typical mass spectrum showing the m/z peaks of TMS

derivatized β-estradiol.

Figure 10. Biotransformation of linoleic acid using whole cells of Pichia GS115 expressing PC-

2. Panel A: Gas chromatographic analysis for possible linoleic acid metabolites from methanol- induced GS115 cells transformed with PC-2 (top) or pPICZb vector (bottom) treated with linoleic acid for 1h. Panel B: Typical mass spectrum showing the m/z peaks of linoleic acid.

Figure 11. Biotransformation of DDT using whole cells of Pichia GS115 expressing PC-2. Panel

A: Gas chromatographic analysis for possible DDT metabolites from methanol-induced GS115 cells transformed with PC-2 (top) or pPICZb vector (bottom) treated with DDT for 1h. Panel B:

Typical mass spectrum showing the m/z peaks of DDT.

Figure 12. Biotransformation of phenanthene using whole cells of Pichia GS115 expressing PC-

2. Panel A: Gas chromatographic analysis of possible phenanthrene metabolites from methanol- induced GS115 cells transformed with PC-2 (top) or pPICZb vector (bottom) treated with phenanthrene for 1h. Panel B: Typical mass spectrum showing the m/z peaks of phenanthrene.

187

Figure 13. Biotransformation of pyrene using whole cells of Pichia GS115 expressing PC-2.

Panel A: Gas chromatographic analysis for detection of possible pyrene metabolites from

methanol-induced GS115 cells transformed with PC-2 (top) or pPICZb vector (bottom) treated

with pyrene for 1h. Panel B: Typical mass spectrum showing the m/z peaks of pyrene.

Figure 14. Biotransformation of BaP using whole cells of Pichia GS115 expressing PC-2. Panel

A: Gas chromatographic analysis for detection of possible BaP metabolites from methanol- induced GS115 cells transformed with PC-2 (top) or pPICZb vector (bottom) treated with BaP for 1h. Panel B: Typical mass spectrum showing the m/z peaks of BaP.

188

0h 12h 24h 36h 48h 72h 96h

~70 kDa

Figure 1

189

M 1 2 3

~ 70 kDa

1 2 3

B A

Figure 2

190

Figure 3

191

M 1 2

M 1 2

A B

Figure 4

192

M F W1 W2 W3 E1 E2 E3 E4 E5 E6 E7

~ 190 kDa ~ 120 kDa

~ 85 kDa ~ 70 kDa ~ 60 kDa ~ 50 kDa ~ 40 kDa

~ 25 kDa ~ 20 kDa

~ 15 kDa

F W1 W2 W3 E1 E2 E3 E4 E5 E6 E7

~ 70 kDa

Figure 5

193

M 1

~ 200 kDa ~ 116.3 kDa ~ 97.4 kDa ~ 66.3 kDa ~ 70 kDa ~ 55.4 kDa

~ 36.5 kDa

~ 21.5 kDa

~ 3.5 kDa

Figure 6

194

A

B

Figure 7

195

A

B

Figure 8

196

A

B

Figure 9

197

A

B

Figure 10

198

A

B

Figure 11

199

A

B

Figure 12

200

A

B

Figure 13

201

A

B

Figure 14

202 Chapter VIII

Conclusions

This study led to the following conclusions towards understanding the role of P450s in physiological regulation (indirect role in oxidation of xenobiotics) and direct metabolism of xenobiotics in the white rot fungus Phanerochaete chrysosporium.

1) The study demonstrated the role of P. chrysosporium P450 monooxygenase(s) in the

oxidation/biodegradation of higher ring PAHs namely anthracene and benzo(a)pyrene,

based on P450 inhibition experiment using chemical inhibitors and peroxidase-

suppressing (P450 expressing) culture conditions. Although pyrene was also

oxidized/degraded under these conditions, involvement of P450(s) could not be

confirmed based on the P450 inhibitors tested.

2) The transformation studies led to the generation of specific plasmid vector constructs that

can be used either singly (pVBH) or in combination (pVBG and pVH/pVP) (Refer to

Appendix for plasmid constructs) to knock-out a specific gene (e.g. PC-bph gene) in this

basidiomycete fungus for homologous recombination-based transformation. These

plasmid vectors are based on dominant selection containing antibiotic selection markers

namely hygromycin phosphotransferase (hph) for hygromycin resistance or bleomycin

resistance gene (Sh ble) for phleomycin resistance.

3) An Agrobacterium-based transformation protocol showing considerably higher

transformation frequency (10 %) was optimized for the white rot fungus P.

chrysosporium.

203 4) The developed Agrobacterium-mediated transformation protocol can be used for either of

the following objectives: one, for over expression of specific genes of interest and two,

for use in siRNA-mediated knock-down of specific genes.

5) This study is the first report on the presence of a functional RNA interference (siRNA-

based) machinery in the white rot basidiomycete P. chrysosporium. This gene knock-

down strategy was tested for the P450 gene PC-bph using either 300 nt or the

recommended 19 nt hairpin structures. Expected reduction in the encoded activity led to

the conclusion that either of these strategies (larger RNAi construct or shorter RNAi

construct) is effective in knock-down of the targeted gene. e.g. PC-bph in this case.

6) An RNAi (siRNA) strategy based on Agrobacterium-mediated transformation

demonstrated that the P450 monooxygenase PC-bph regulates the lignin peroxidase

activity via veratryl alcohol synthesis. This implies that PC-bph plays an indirect role in

LiP-mediated oxidation of xenobiotics via synthesis of veratryl alcohol; although this

conclusion warrants further analysis.

7) Several strategies were tested (with variable success) for the heterologous expression of

white rot fungal P450 monooxygenases of the CYP63 family (PC-1 and PC-3) in

commercial expression hosts, including E. coli, Saccharomyces, and baculovirus. While

PC-3 was expressed in its native form, PC-1 showed considerable expression only after

codon optimization.

8) Two altenate P450 redox proteins that are also capable of transferring electrons to the

P450 monooxygenases, namely cytochrome b5 (cyt b5) and cytochrome b5 reductase (cyt

b5r) were cloned and characterized. Where as cyt b5r was a homolog of known cyt b5r

204 proteins from other species, cyt b5 did not match the known cyt b5 homologs and was

found to belong to a newly identified class of cyt b5-like proteins.

9) All the P450 redox proteins, including the primary redox enzyme P450 oxidoreductase

(POR) and the two alternate redox proteins cyt b5 reductase and cyt b5, were

transcriptionally expressed under all the three nutrient media conditions, indicating that

cyt b5-cyt b5r chain may likely provide the alternate electron transfer mechanism in the

P450 enzyme system in this white rot fungus.

10) The P450 redox proteins namely POR, cyt b5r, and cyt b5 were functionally expressed in

E. coli and purified to homogeneity.

11) As a part of our efforts to understand the role of white rot fungal P450 monooxygenases

in direct oxidation of xenobiotic chemicals, P. chrysosporium was shown to oxidize the

endocrine disrupting chemical nonylphenol via P450 reaction under peroxidase-

suppressing nutrient-rich culture conditions.

12) Global gene induction analysis using custom-designed P450 gene array allowed us to

identify multiple nonylphenol-responsive P450 monooxygenase genes in P.

chrysosporium. Among the 19 genes induced under nutrient-rich (ME) conditions and 18

induced under nutrient-limited (LN) condition, four P450 genes were commonly induced.

Interestingly, two of the P450s, PFF 311BM and PFF 4aM, were specifically induced in

nutrient-rich (ME) cultures at very high levels (195 and 167 fold, respectively), implying

their role in oxidation of nonylphenol.

13) The PAH-inducible P450 gene PC-2 (CYP63A2) was heterologously expressed in

spectrally active form in the yeast Pichia pastoris. The expressed protein was detected in

the microsomal fraction and could be solubilized under optimized buffer conditions:

205 tricine/NaOH buffer containing CHAPS, Emulgen 913, and the disulfide bond-breaking

compound thioglycolic acid. The expressed PC-2 was purified close to homogeneity

using affinity purification (Ni-NTA). This effort demonstrated that Pichia pastoris could

prove to be a suitable expression system for heterologous expression of P450

monooxygenases of the white rot fungus Phanerochaete chrysosporium. However,

generation of a spectrally active purified P450 protein from this fungus will require

incorporation of the heme moiety.

14) For catalytic characteriziation of the recombinantly expressed white rot fungal P450

monooxygenase(s) GC-MS conditions were optimized for a range of individual

xenobiotic toxicants, including PAHs (phenanthrene, pyrene, benzo(a)pyrene) and other

chemicals shown to induce P450s in this organism.

206 Chapter IX

Scope of the Study

With the increase in the number of xenobiotic pollutant compounds that are generated in our daily life, there is an increasing demand for novel mechanisms for the breakdown of these toxic compounds into nontoxic and environmentally safe products. The preferred ways for remediation include the use of natural and environmentally safe mechanisms like the use of microorganisms and plants, or their enzyme biocatalysts. Cytochrome P450 monooxygenases are one such group of enzyme biocatalysts that is capable of detoxifying a variety of xenobiotic compounds and is being recognized as an option for carrying out these enzymatic reactions in bioremediation

(Guengerich 1995).

Phanerochaete chrysosporium, the most well-studied white rot fungus, is known to possess nearly 150 P450 genes in its genome. This extensive repertoire of P450s is a unique feature in this organism, particularly in light of the fact that this system already possesses a non- specific peroxidase enzyme system, in its enzyme repertoire. The question arises as to what is the role of these P450s in this organism. We hypothesized that there are two possible roles, one, the involvement of these P450s in regulation of several biosynthetic pathways as in plants, and two, a direct involvement in biodegradation of lignin/toxic chemicals that this fungus encounters in nature. Some of the major roles of P450s in plants include synthesis of lignin components, UV protectants, pigments, defense compounds, hormones, and oxygenated fatty acids (Schuler and

Werck-Reichhart 2003). The role of P450s in metabolism of xenobiotic compounds has been reviewed in Anzenbacher and Anzenbacherova (2001). Since neither of these roles is yet

207 characterized in the white rot fungus P. chrysosporium, our study has attempted to address these questions in this system.

Our goal in this study was to identify white rot P450s with a potential as biocatalysts to perform industrially/environmentally useful chemical reactions. Biocatalyst refers to either the whole organism or its enzymes useful for carrying out specific chemical reactions. Traditionally biocatalysts have been used to perform those chemical reactions that are not practicable by synthetic organic chemistry. Enzymes are the most commonly used biocatalysts, however it is more practical to use the whole organisms as biocatalysts in the bioreactors. This approach solves the problem especially if providing specific cofactors or cosubstrates is too expensive, or to eliminate the problems associated with isolation and immobilization of the enzymes.

Our functional genomic study on the P450 enzyme system has attempted to address several important issues in this white rot fungus. P. chrysosporium has been primarily recognized as an organism that has a versatile xenobiotic-degrading machinery. Thus the primary goal is to use this fungus or its enzymes in in situ bioremediation studies involving the recalcitrant PAH compounds. Brodkorb and Legge (1992) had shown that under aerobic conditions, addition of P. chrysosporium to the soil enhanced the mineralization of oil tar from

20 % to 38 % in 21 days. In situ biodegradation of soils contaminated with pentachlorophenol has been attempted in the past by Lamar and Dietrich (1990). Their study showed approximately

90 % degradation of PCP in nearly seven weeks of incubation under suboptimal temperatures for fungal growth and activity. The study suggested a potential role of white rot fungus in in situ bioremediation techniques. Fournier et al (2004) showed that P. chrysosporium in combination with Rhodococcus sp. is capable of degrading 4-nitro-2,4-diazabutanal (NDAB), a dead end metabolite, completely under liquid cultures as well as in soil conditions. Their study brought

208 about an important aspect that dead-end metabolites such as NDAB that are produced by microbial degradation are also degraded by this organism thereby raising the interest in P. chrysosporium to be developed as a biocatalyst. Further, aromatic compounds like napthalene, tetrachlorobenzene, and dichloroaniline isomers, diphenylether and N-phenyl-1-naphtalenamine were also found to be completely degraded in 30 days by P. chrysosporium in a historically contaminated soil (D’Annibale et al. 2005).

There are several factors that influence the use of microorganisms in bioremediation.

These range from physical and chemical properties of the chemicals to the environmental factors affecting the availability of the chemicals to the organisms as well as the factors/conditions affecting the growth of organisms. Physical properties of the compounds include state of the compound, its solubility, its hydrophobicity, adsorbability, size and shape, charge, toxicity, and its concentration. Environmental factors include biotic and abiotic factors. Biotic factors include the availability of organisms capable of degrading pollutant chemicals. Abiotic factors include temperature, presence of nutrients, presence of oxygen, presence of alternative electron acceptors, pH, presence of inhibitory chemicals, soil type, and moisture content.

White rot fungi have several characteristics that make them a potential bioremediating agent (reviewed in Reddy 1995). They are known to degrade a wide range of xenobiotic compounds (explained in earlier chapters), they are found ubiquitously in nature, and even substrates with low solubility can be degraded due to the presence of extracellular enzymatic machinery in these organisms. In addition, the enzymes are constitutively produced thereby eliminating the need to acclimatize the organism to these chemicals. Further, the substrates required for growth of these organisms are naturally available and are inexpensive such as corn cobs, straw, sawdust etc. Also the key enzymes that are involved in this degradation process are

209 produced under nutrient-limited conditions i.e. conditions found in soil. And finally, the hyphae can penetrate the soil and can reach the pollutants more effectively than what unicellular bacteria can. Moreover, white-rot fungi offer a wider diversity of compounds that they can degrade in comparison to bacteria.

With such a great potential of white rot fungus for bioremediation, Phanerochaete chrysosporium is still not widely used in on-field applications. In spite of degrading a plethora of compounds under laboratory conditions, this fungus has not proven to be a great success outside so far. Extensive research has been undertaken to understand the molecular biology of the fungus; a lot is known about the non-specific peroxidase system, the genes involved, its production, nutritional regulation and so on (Reddy 1995, Gold and Alic 1993). Despite this knowledge, further research dollars need to be invested towards optimizing the use of this fungus to bioremediate soils contaminated with several compounds especially the PAHs. Over expression of genes is a strategy that can help increase the production of specific enzymes, either directly or indirectly, that are involved in the peroxidase enzyme system in this fungus; P450s possibly being one of them. Since peroxidase system is already well known for its degradation potential, this could serve as the model for such overexpression studies. A primary stumbling block associated with this approach is a lack of an easy transformation system and genetic engineering techniques in this fungus. Transformation protocols in this fungus have been achieved in the past, albeit cumbersome, and often do not yield the success rate observed with other lower eukaryotes like S. cerevisiae. This problem has been further worsened by the fact that there is a lack of selective markers/auxotrophic strains that have been developed in this organism. Further, gene knock-out using homologous recombination has been hardly found to be successful in this organism. Thus novel techniques need to be developed to enhance and

210 accelerate the genetic studies in this organism that can yield better strains with improved

capabilities. In this study, we have attempted to develop a novel technique of generating a

knock-down strain (of a P450 gene pc-bph) using the plant-pathogen Agrobacterium tumefaciens as a tool to insert the genetic material into the host fungus. The reason for using this gene as a candidate is that PC-bph is a single-copy gene, its in vitro catalytic function is known, and we have predicted its in vivo function (i.e. involvement in VA synthesis, thereby increasing LiP activity) in this fungus. Our efforts have resulted in some but not the ultimate success in achieving directed knock-down event. Nevertheless, it has introduced a novel approach towards solving the problem associated with generating directed or random knock-down strains of

Phanerochaete chrysosporium. Further optimization and improvement in this technique would lead to the development of a robust way towards understanding the physiology of this fungus and indirectly lead to delineating the various pathways involved in the peroxidase-mediated degradation by this organism. As already shown by Sharma and coworkers (2006), expression of foreign genes (egfp) can also be attained, and thus over expression of genes using this transformation technique would be an alternative strategy towards improving the production of specific degradative enzymes (peroxidases) in this fungus. The whole fungus producing higher levels of peroxidases could provide improved biocatalyst for environmental biodegradation/bioremediation applications.

With the present need for alternate sources of energy, P. chrysosporium can play a

pivotal role in this application. Biotechnology companies are investing a huge amount of their

resource in developing bio-based energy like bioethanol. These products use natural biological

sources as raw materials. Particularly, plant sources like corn, maize and wheat crops, waste

straw, willow and poplar trees, sawdust, reed canary grass, cord grasses, jerusalem artichoke,

211 miscanthus and sorghum plants are being suggested and are being researched upon. The first key step towards achieving this objective is to breakdown the lignin that surrounds the cellulose.

Cellulose is the carbohydrate that needs to be accessed for fermentation into ethanol. Peroxidase overexpressing strains of P. chrysosporium can provide the desired enzymatic capability, either in the form of the whole fungus or as isolated peroxidase enzymes to unlock the lignin containing cell-wall matrix and thereby provide easier access to this fermentable polymer for bioethanol production.

The second important application of this organism relates to its P450 enzymes that could be optimally expressed to metabolize xenobiotic pollutants as well as developed as biocatalysts for use in the production of novel chemicals/pharmaceuticals. With an unbelievable number of

P450 genes that are found in this organism and the diversity, it is logical to assume that these

P450s have diverse functions. In fact, our P450-microarray and quantitative RT-PCR studies show that these enzymes are inducible by a range of xenobiotic chemicals. Going by the existing knowledge on P450 enzymes, these inducers could also be their substrates. These functional genomic observations imply that P450s from this organism have diverse metabolizing potential.

Genetic engineering of P450s either by directed evolution or by site-directed mutagenesis is being undertaken by several laboratories in order to improve the substrate specificity of these enzymes (Peters et al. 2003, Wiseman 2003, Kumar et al. 2006). Since the white rot fungus already contains such a large P450 diversity, this can be considered as a naturally available untapped source of diverse P450s that would have unique catalytic potential. Individual white rot

P450s can be isolated and heterologously expressed for identification of the substrate xenobiotic compounds that it can oxidize in nature. These P450s can then be over expressed in the whole fungus either individually or in combination, to generate strains that have improved potential of

212 metabolizing one/more chemicals either singly or in combination in nature. The advantage of using P. chrysosporium in these processes is that it can grow on naturally available biomass substrates like wood chips, sawdust, etc. Thus the need for providing expensive/chemically pure sources of carbon for growth of this organism is eliminated, making Phanerochaete chrysosporium an economically feasible option for bioremediation purposes. The expressed

P450s can also be screened for other useful industrial biotransformation reactions for synthesis of novel pharmaceutical drug candidates. In our efforts to heterologously express the P450 enzyme system of this versatile organism, we have been successful in expressing and purifying the redox protein namely cytochrome P450 oxidoreductase (POR) that is the primary electron- transferring enzyme to the P450 enzyme system. At least two P450 monooxygenases, PC-2 and

PC-3, of the CYP63 family have been expressed in commercial expression hosts, albeit with problems in obtaining functional purified proteins. This study has nevertheless identified the problems associated with expressing P450s genes of this organism. While a robust system for optimal functional expression of white rot fungal P450s is yet to be identified, P. pastoris currently seems to be the expression system of choice based on our observation that detectable amounts of the expressed PC-2 enzyme was expressed in this organism. A major advantage of expression of P450s in this commercial expression system would be that, being a eukaryotic yeast system, it contains the other required P450 redox proteins (like the P450 oxidoreductase and cytochrome b5) that form an integral part of the reconstituted cytochrome P450 enzyme system. Thus individual P450 over expressing Pichia strains can also be used in whole-cell biotransformation reactions.

213 Future Directions

The novel Agrobacterium-mediated transformation system has a great potential to be used for effective transformation of genes into Phanerochaete chrysosporium. Our studies provided the first evidence on the presence of an RNA-interference mechanism in this fungus.

Although the siRNA-mediated knock-down of genes in this fungus was partially achieved, this shows that the system could be further optimized. For instance, determination of the optimal size of the RNA construct that would give the highest silencing of genes, would help in understanding the optimal gene silencing in this organism. Additionally, this

Agrobacterium-based system could also be developed for specific homologous recombination- based gene knock-out strategies as in case of other fungi (Michielse et al. 2005, Bundock et al.

1999). Availability of this technique would allow an easy way of teasing out the different metabolic pathways and signal transduction pathways that are directly or indirectly involved in the overall biodegradative activities of this fungus. Further, development of overexpressing strains of peroxidases could also be pursued using the same transformation strategy, for much- needed applications in the upcoming field of bioenergy production.

This study has led to the identification of several xenobiotic-responsive P450 monooxygenase genes that are proposed to have to oxidative potential towards environmental toxic chemicals especially the PAHs. Our microarray-based study has resulted in the development of an easy method of screening the induction response of P450 genes to xenbiotic chemicals. Considering our observations on xenobiotic-specific perturbations in P450 expression this approach has provided the probable way to investigate substrate range for these P450 enzymes.

214 Optimal functional expression of these P450 enzymes needs further focused efforts such

as those targeting refolding of the proteins for introduction of the heme iron in order to achieve a spectrally active protein. Alternatively, genetically manipulated P. chrysosporium over expressing individual P450 enzymes could be generated (biocatalyst) to segregate the catalytic activity of individual P450s under laboratory conditions. Once conditions required for optimal functioning of these biocatalysts is achieved, these customized-P. chrysosporium strains could

then be pursued for field bioremediation applications. Development of such an improved

xenobiotic-degrading, nontoxic, environmentally friendly organism would prove to be an

invaluable tool towards eliminating the ever increasing demand for a pollution-free environment

suitable for a more safe existence of living beings on this planet.

215 References for chapters I, II, III, VII, VIII, and IX

1. Alexander M. 1981. Biodegradation of chemicals of environmental concern. Science. 211:132-138.

2. Alic, M., L. Akileswaran, and M.H. Gold. 1993. Gene replacement in the lignin-degrading basidiomycete Phanerochaete chrysosporium. Gene. 136:307-311.

3. Alic, M., M.B. Mayfield, L. Akileswaran, and M.H. Gold. 1991. Homologous transformation of the lignin-degrading basidiomycete Phanerochaete chrysosporium. Curr. Genet. 19:491-494.

4. Bhatnagar, D., K.C. Ehrlich, T.E. Cleveland. 2003. Molecular genetic analysis and regulation of aflatoxin biosynthesis. Appl. Microbiol. Biotechnol. 61:83-93.

5. Bogan, B.W, and R.T. Lamar. 1995 One-electron oxidation in the degradation of creosote polycyclic aromatic hydrocarbons by Phanerochaete chrysosporium. Appl. Environ. Microbiol. 61:2631-2635.

6. Bogan, B.W, and R.T. Lamar. 1995. One-electron oxidation in the degradation of creosote polycyclic aromatic hydrocarbons by Phanerochaete chrysosporium. Appl. Environ. Microbiol. 61:2631-2635.

7. Boominathan, K., and A.C. Reddy. 1992. Fungal degradation of lignin: Biotechnological applications. In. Handbook of applied Mycology vol 4: Fungal Biotechnology. D.K. Arora, R.P. Elander, K.G. Mukerji (ed), Marcel Dekker, Inc. NewYork.

8. Brodkorb, T.S., and R.L. Legge. 1992. Enhanced biodegradation of phenanthrene in oil tar- contaminated soils supplemented with Phanerochaete chrysosporium. Appl. Environ. Microbiol. 58:3117-3121.

9. Brown, J.A., J.K. Glenn, and M.H. Gold. 1990. Manganese regulates the expression of manganese peroxidase by Phanerochaete chrysosporium. J. Bacteriol. 172:3125-3130.

10. Brown, J.A., M. Alic, and M.H. Gold. 1991. Manganese peroxidase gene transcription in Phanerochaete chrysosporium: activation by manganese. J. Bacteriol. 173:4101-4106.

11. Bumpus, J.A. 1989. Biodegradation of polycyclic hydrocarbons by Phanerochaete chrysosporium. Appl. Environ. Microbiol. 55:154-158.

12. Bumpus, J.A., and B.J. Brock. 1988. Biodegradation of crystal violet by the white rot fungus Phanerochaete chrysosporium. Appl. Environ. Microbiol. 54:1143-1150.

13. Bumpus, J.A., and S.D. Aust. 1987. Biodegradation of DDT [1,1,1-trichloro-2,2-bis(4- chlorophenyl)ethane] by the white rot fungus Phanerochaete chrysosporium. Appl. Environ. Microbiol. 53:2001-2008.

216 14. Bumpus, J.A., S.N. Kakar, and R.D. Coleman. 1993. Fungal degradation of organophosphorus insecticides. Appl. Biochem. Biotechnol. 39-40:715-726.

15. Bundock, P., K. Mróczek, A.A. Winkler, H.Y. Steensma, and P.J. Hooykaas. 1999. T-DNA from Agrobacterium tumefaciens as an efficient tool for gene targeting in Kluyveromyces lactis. Mol. Gen. Genet. 261:115-121.

16. Cancel, A.M., A.B. Orth, and M. Tien. 1993. Lignin and veratryl alcohol are not inducers of the ligninolytic system of Phanerochaete chrysosporium. Appl. Environ. Microbiol. 59:2909-2913.

17. Chang, C.W, and J.A. Bumpus. 1993. Oligomers of 4-chloroaniline are intermediates formed during its biodegradation by Phanerochaete chrysosporium. FEMS Microbiol. Lett. 107:337-342.

18. Conneely, A., W.F. Smyth, and G.McMullan. 1999. Metabolism of the phthalocyanine textile dye remazol turquoise blue by Phanerochaete chrysosporium. FEMS Microbiol Lett. 179:333-337.

19. Cripps, C., J.A. Bumpus, and S.D. Aust. 1990. Biodegradation of azo and heterocyclic dyes by Phanerochaete chrysosporium. Appl. Environ. Microbiol. 56:1114-1118.

20. D'Annibale, A., M. Ricci, V. Leonardi, D. Quaratino, E. Mincione, and M. Petruccioli. 2005. Degradation of aromatic hydrocarbons by white-rot fungi in a historically contaminated soil. Biotechnol. Bioeng. 90:723-731.

21. Davin, L.B., and N.G. Lewis. 2005. Lignin primary structures and dirigent sites. Curr Opin Biotechnol. 16:407-415.

22. Denison, M.S., and J. P. Whitlock Jr. 1995. Xenobiotic-inducible transcription of cytochrome P450 genes. J. Biol. Chem. 270:18175-18178.

23. Dietrich, D., W.J. Hickey, and R. Lamar. 1995 Degradation of 4,4'-dichlorobiphenyl, 3,3',4,4'-tetrachlorobiphenyl, and 2,2',4,4',5,5'-hexachlorobiphenyl by the white rot fungus Phanerochaete chrysosporium. Appl. Environ. Microbiol. 61:3904-3909.

24. Dietrich, M,, L. Grundmann, K. Kurr, L. Valinotto, T. Saussele, R.D. Schmid, and S. Lange. 2005. Recombinant production of human microsomal cytochrome P450 2D6 in the methylotrophic yeast Pichia pastoris. Chembiochem. 6:2014-2022.

25. Doddapaneni, H., R. Chakraborty, and J.S. Yadav. 2005. Genome-wide structural and evolutionary analysis of the P450 monooxygenase genes (P450ome) in the white rot fungus Phanerochaete chrysosporium: evidence for gene duplications and extensive gene clustering. BMC Genomics. 14;6:92.

26. Doddapaneni, H., V. Subramanian, and J.S. Yadav. 2005. Physiological regulation, xenobiotic induction, and heterologous expression of P450 monooxygenase gene pc-3

217 (CYP63A3), a new member of the CYP63 gene cluster in the white-rot fungus Phanerochaete chrysosporium. 50:292-298.

27. Eriksson, K.-E., B. Pettersson, J. Volc, and V. Musilek. 2004. Formation and partial characterization of glucose-2-oxidase, a H2O2 producing enzyme in Phanerochaete chrysosporium. Appl. Microbiol. Biotechnol. 23:257-262.

28. Farrell, R.L., K.E. Murtaghj, M. Tien, M.D. Mozuch, and T.K. Kirk. 1989. Physical and enzymatic properties of lignin peroxidase isoenzymes from Phanerochaete chrysosporium. Enzyme Microb. Technol. 11:322-328.

29. Ferrey, M.L., W.C. Koskinen, R.A. Blanchette, and T.A. Burnes. 1994. Mineralization of alachlor by lignin-degrading fungi. Can. J. Microbiol. 40:795-798.

30. Fournier, D., A. Halasz, J. Spain, R.J. Spanggord, J.C. Bottaro, and J. Hawari. 2004b. Biodegradation of the hexahydro-1,3,5-trinitro-1,3,5-triazine ring cleavage product 4-nitro- 2,4-diazabutanal by Phanerochaete chrysosporium. Appl. Environ. Microbiol. 70:1123- 1128.

31. Fournier, D., A. Halasz, J. Spain, R.J. Spanggord, J.C. Bottaro, and J. Hawari. 2004. Biodegradation of the hexahydro-1,3,5-trinitro-1,3,5-triazine ring cleavage product 4-nitro- 2,4-diazabutanal by Phanerochaete chrysosporium. Appl. Environ. Microbiol. 70:1123- 1128.

32. Fournier, D., A. Halasz, S. Thiboutot, G. Ampleman, D. Manno, and J. Hawari. 2004. Biodegradation of octahydro-1,3,5,7-tetranitro-1,3,5,7-tetrazocine (HMX) by Phanerochaete chrysosporium: new insight into the degradation pathway. Environ. Sci. Technol. 38:4130-4133.

33. Fournier, D., F. Monteil-Rivera, A. Halasz, M. Bhatt, and J. Hawari. 2006. Degradation of CL-20 by white-rot fungi. Chemosphere. 63:175-181.

34. Fruedenberg, K. 1968. The constitution and biosynthesis of lignin, p. 47-122. In A.C. Neish and K. Freudenberg (ed.) Constitution and biosynthesis of lignin. Springer-Verlag, New York.

35. Gadd G.M. 2001. In. Fungi in bioremediation. G.M. Gadd (ed) Cambridge University Press Cambridge, U.K.

36. Glenn, J.K, and M.H. Gold. 1983. Decolorization of Several Polymeric Dyes by the Lignin-degrading Basidiomycete Phanerochaete chrysosporium. Appl. Environ. Microbiol. 45:1741-1747.

37. Glenn, J.K., and M.H. Gold. 1985. Purification and characterization of an extracellular Mn(II)-dependent peroxidase from the lignin-degrading basidiomycete, Phanerochaete chrysosporium. Arch. Biochem. Biophys. 242:329-341.

218 38. Gold, M.H., and T.M. Cheng. 1979. Conditions for fruit body formation in the white rot basidiomycete Phanerochaete chrysosporium. Arch. Microbiol. 121:37-41.

39. Goodwin, D.C., S.D. Aust, and T.A. Grover. 1995. Evidence for veratryl alcohol as a redox mediator in lignin peroxidase-catalyzed oxidation. Biochemistry 34:5060-5065.

40. Grifoll, M., and K.E. Hammel. 1997. Initial Steps in the Degradation of Methoxychlor by the White Rot Fungus Phanerochaete chrysosporium. Appl. Environ. Microbiol. 63:1175- 1177.

41. Guengerich, F.P. 1995. Cytochrome P450 proteins and potential utilization in biodegradation. Environ. Health Perspect. 103 Suppl 5:25-8.

42. Guengerich, F.P. 2001. Common and uncommon cytochrome P450 reactions related to metabolism and chemical toxicity. Chem. Res. Toxicol. 14:611-650.

43. Gusse, A.C., P.D. Miller, and T.J. Volk. 2006. White-rot fungi demonstrate first biodegradation of phenolic resin. Environ. Sci. Technol. 40:4196-4199.

44. Hammel, K.E., W.Z. Gai, B. Green, and M.A. Moen. 1992. Oxidative degradation of phenanthrene by the ligninolytic fungus Phanerochaete chrysosporium. Appl. Environ. Microbiol. 58:1832-1838.

45. Hattori, T., A. Nishiyama, and M. Shimada. 1999. Induction of L-phenylalanine ammonia- lyase and suppression of veratryl alcohol biosynthesis by exogenously added L- phenylalanine in a white-rot fungus Phanerochaete chrysosporium. FEMS Microbiol. Lett. 179:305-309.

46. Hawksworth, D.L., P.M. Kirk, B.C. Sutton, and D.N. Pegler. 1995. In. Ainsworth and Bisby’s Dictionary of the Fungi, 8th ed. Oxon, U.K

47. Hildebrandt, A., and R.W. Estabrook. 1971. Evidence for the participation of cytochrome b 5 in hepatic microsomal mixed-function oxidation reactions. Arch. Biochem. Biophys. 143:66-79.

48. Jackson, M.M., L. Hou, H.N. Banerjee, R. Sridhar, and S.K. Dutta. 1999. Disappearance of 2,4-dinitrotoluene and 2-Amino,4,6-dinitrotoluene by Phanerochaete chrysosporium under non-ligninolytic conditions. Bull Environ. Contam. Toxicol. 62:390-396.

49. Jauregui, J., B. Valderrama, A. Albores, and R. Vazquez-Duhalt. 2003. Microsomal transformation of organophosphorus pesticides by white rot fungi. Biodegradation. 14:397- 406.

50. Jeffries T.W. 1990.Biodegradation of lignin-carbohydrate complexes. Biodegradation. Vol. 1, Numbers 2-3.

219 51. Jensen Jr, K.A., K.M.C. Evans, T.K. Kirk, and K.E. Hammel. 1994. Biosynthetic pathway for veratryl alcohol in the ligninolytic fungus Phanerochaete chrysosporium. Appl. Environ. Microbiol. 60:709-714.

52. Kelley, R.L., and C.A. Reddy. 1988. Glucose oxidase of Phanerochaete chrysosporium. Methods Enzymol. 161:307-316.

53. Kennedy, D.W., S.D. Aust, and I.A. Bumpus. 1990. Comparative biodegradation of alkyl halide insecticides by the white rot fungus, Phanerochaete chrysosporium (BKM-F-1767). Appl. Environ. Microbiol. 56:2347-2353.

54. Kennes, C., and J.M. Lema. 1994. Simultaneous biodegradation of p-cresol and phenol by the basidiomycete Phanerochaete chrysosporium. J. Ind. Microbiol. 13:311-314.

55. Kersten, P.J., and D. Cullen. Cloning and characterization of cDNA encoding glyoxal oxidase, a H2O2-producing enzyme from the lignin-degrading basidiomycete Phanerochaete chrysosporium. Proc. Natl. Acad. Sci. 90:7411-7413.

56. Kersten, P.J., and T.K. Kirk. 1987. Involvement of a new enzyme, glyoxal oxidase, in extracellular H2O2 production by Phanerochaete chrysosporium. J. Bacteriol. 169:2195- 2201.

57. Kirk, T.K., and R.L. Farrell. 1987. Enzymatic "combustion": the microbial degradation of lignin. Annu Rev Microbiol. 41:465-505.

58. Kirk, T.K., T. Higuchi, and H.–M. Chang. (eds). 1978. Lignin biodegradation: Microbiology, Chemistry, and Potential applications, Vols. 1 and 2. CRC Press, Boca Raton, Fl.

59. Koduri, R.S, and M. Tien. 1994. Kinetic analysis of lignin peroxidase: explanation for the mediation phenomenon by veratryl alcohol. Biochemistry. 33:4225-4230.

60. Koduri, R.S., and M. Tien. 1995. Oxidation of guaiacol by lignin peroxidase. Role of veratryl alcohol. J. Biol. Chem. 270:22254-22258.

61. Kolar, N.W., A.C. Swart, J.I. Mason, and P. Swart. 2007. Functional expression and characterisation of human cytochrome P45017alpha in Pichia pastoris. J. Biotechnol. 129:635-644.

62. Kullman, S.W., and F. Matsumura. 1996. Metabolic pathways utilized by Phanerochaete chrysosporium for degradation of the cyclodiene pesticide endosulfan. Appl. Environ. Microbiol. 62:593-600.

63. Kumar, S., H. Liu, and J.R. Halpert. 2006. Engineering of cytochrome P450 3A4 for enhanced peroxide-mediated substrate oxidation using directed evolution and site-directed mutagenesis. Drug Metab. Dispos. 34:1958-1965.

220 64. Lamar, R.T., and D.M. Dietrich. 1990. In Situ Depletion of Pentachlorophenol from contaminated Soil by Phanerochaete spp. Appl. Environ. Microbiol. 56:3093-3100.

65. Lee, J.W., S.M. Lee, E.J. Hong, E.B. Jeung, H.Y. Kang, M.K, Kim, and I.G. Choi. 2006. Estrogenic reduction of styrene monomer degraded by Phanerochaete chrysosporium KFRI 20742. J. Microbiol. 44:177-184.

66. Lee, B., A.L. Pometto, A. Fratzke, and T.B. Bailey. 1991. Biodegradation of Degradable Plastic Polyethylene by Phanerochaete and Streptomyces Species. Appl. Environ. Microbiol. 57:678-685.

67. Lee, S.B., M.G. Milgroom, and J.W. Taylor. 1988. A rapid, high yield mini-prep method for isolation of total genomic DNA from fungi. Fungal Genet. Newsletter 35:23-24.

68. Ma, B, M.B. Mayfield, B.J. Godfrey, M.H. Gold. 2004. Novel promoter sequence required for manganese regulation of manganese peroxidase isozyme 1 gene expression in Phanerochaete chrysosporium. Eukaryot. Cell. 3:579-588.

69. Ma, B., M.B. Mayfield, and M.H. Gold. 2001. The green fluorescent protein gene functions as a reporter of gene expression in Phanerochaete chrysosporium. Appl Environ Microbiol. 67:948-955.

70. Mai, C., W. Schormann, A. Majcherczyk, and A. Hüttermann. 2004. Degradation of acrylic copolymers by white-rot fungi. Appl. Microbiol. Biotechnol. 65:479-487.

71. Martinez, D., L.F., Larrondo, N. Putnam, M.D. Gelpke, K. Huang, J. Chapman, K.G. Helfenbein, P. Ramaiya, J.C. Detter, F. Larimer, P.M. Coutinho, B. Henrissat, R. Berka, D. Cullen, and D. Rokhsar. 2004. Genome sequence of the lignocellulose degrading fungus Phanerochaete chrysosporium strain RP78. Nat. Biotechnol. 22:695-700.

72. Masaphy, S., D. Levanon, Y. Henis, K. Venkateswarlu, and S.L. Kelly. 1996. Evidence for cytochrome P-450 and P-450-mediated benzo(a)pyrene hydroxylation in the white rot fungus Phanerochaete chrysosporium. FEMS Microbiol Lett. 135:51-55.

73. Matsuzaki, F., and H. Wariishi. 2005. Functional diversity of cytochrome P450s of the white-rot fungus Phanerochaete chrysosporium. Biochem. Biophys. Res. Commun. 324:387-393.

74. Matsuzaki, F., and H. Wariishi. 2005. Molecular characterization of cytochrome P450 catalyzing hydroxylation of benzoates from the white-rot fungus Phanerochaete chrysosporium. Biochem. Biophys. Res. Commun. 334:1184-1190.

75. McLean, K.J., D. Clift, D.G. Lewis, M. Sabri, P.R. Balding, M.J. Sutcliffe, D. Leys, and A.W. Munro. 2006. The preponderance of P450s in the Mycobacterium tuberculosis genome. Trends Microbiol. 14:220-228.

221 76. Michel, F.C. Jr., S.B. Dass, E.A. Grulke, and C.A. Reddy. 1991. Role of manganese peroxidases and lignin peroxidases of Phanerochaete chrysosporium in the decolorization of kraft bleach plant effluent. Appl. Environ. Microbiol. 57:2368-2375.

77. Michielse, C.B, P.J. Hooykaas, C.A. van den Hondel, and A.F. Ram. 2005. Agrobacterium- mediated transformation as a tool for functional genomics in fungi. Curr Genet. 48:1-17.

78. Michielse, C.B., M. Arentshorst, A.F. Ram, C.A. van den Hondel. 2005. Agrobacterium- mediated transformation leads to improved gene replacement efficiency in Aspergillus awamori. Fungal Genet. Biol. 42:9-19

79. Mileski, G.J., J.A. Bumpus, M.A. Jurek, and S.D. Aust. 1988. Biodegradation of pentachlorophenol by the white rot fungus Phanerochaete chrysosporium. Appl. Environ. Microbiol. 54:2885-2889.

80. Milstein, O., R. Gersonde, A. Huttermann, M.J. Chen, and J.J. Meister. 1992. Fungal biodegradation of lignopolystyrene graft copolymers. Appl. Environ. Microbiol. 58:3225- 3232.

81. Morant, M., S. Bak, B.L. Møller, and D. Werck-Reichhart. 2003. Plant cytochromes P450: tools for pharmacology, plant protection and phytoremediation. Curr. Opin. Biotechnol. 14:151-162.

82. Mori, T., and R. Kondo. 2002. Degradation of 2,7-dichlorodibenzo-p-dioxin by wood- rotting fungi, screened by dioxin degrading ability. FEMS Microbiol. Lett. 213:127-131.

83. Mougin, C., C. Laugero, M. Asther, J. Dubroca, P. Frasse, M. Asther. 1994. Biotransformation of the Herbicide Atrazine by the White Rot Fungus Phanerochaete chrysosporium. Appl. Environ. Microbiol. 60:705-708.

84. Nelson, D.R. 2004. Cytochrome P450 nomenclature, p 1-10. In. Methods in Molecular Biology 320, P450 Protocols, I.R. Phillips, E.A. Shephard. (ed) 2nd ed., Human Press, Inc., Totowa, NJ.

85. Nishida, A., and K.-E. Eriksson. 1987. Formation, purification, and partial characterization of methanol oxidase, a H2O2-producing enzyme in Phanerochaete chrysosporium. Biotechnol. Appl. Biochem. 9:325,-338.

86. Noshiro, M., Ullrich, V., and T. Omura. 1981. Cytochrome b5 as electron donor for oxy- cytochrome P-450. Eur. J. Biochem. 116:521-526.

87. Ogawa, N., H. Okamura, H. Hirai, and T. Nishida. 2004. Degradation of the antifouling compound Irgarol 1051 by manganese peroxidase from the white rot fungus Phanerochaete chrysosporium. Chemosphere. 55:487-491.

88. Orth, A.B., M. Tien. 1995. Biotechnology of lignin degradation. p 287-302. In: K. Esser, P.A. Lemke (ed) The Mycota. II. Genetics and biotechnology. Springer, Berlin Heidelberg, New York.

222 89. Peters, M.W., P. Meinhold, A. Glieder, and F.H. Arnold. 2003. Regio- and enantioselective alkane hydroxylation with engineered cytochromes P450 BM-3. J. Am. Chem. Soc. 125:13442-13450.

90. Pointing, S.B. 2001. Feasibility of bioremediation by white-rot fungi. Appl. Microbiol. Biotechnol. 57:20-33.

91. Potentini, M.F, and A.J. Rodriguez-Malaver. 2006. Vinasse biodegradation by Phanerochaete chrysosporium. J. Environ. Biol. 27:661-665.

92. Randall, T., and C.A. Reddy. 1991. An improved transformation vector for the lignin- degrading white rot basidiomycete Phanerochaete chrysosporium. Gene. 103:125-130.

93. Reddy, C.A. 1995. The potential for white-rot fungi in the treatment of pollutants. Curr. Biol. 6:320-328.

94. Reddy, G.V., M.D. Gelpke, and M.H. Gold. 1998. Degradation of 2,4,6-trichlorophenol by Phanerochaete chrysosporium: involvement of reductive dechlorination. J. Bacteriol. 180:5159-5164.

95. Rosco, A., H.H. Pauli, W. Priesner, and T.M. Kutchan. 1997. Cloning and heterologous expression of NADPH-cytochrome P450 reductases from the Papaveraceae. Arch. Biochem. Biophys. 348:369-377.

96. Rothmel, R.R., and A.M. Chakrabarty. 1990. Microbial degradation of Synthetic recalcitrant Compounds. Pure & appl. Chem. 62: 769-779.

97. Saikia, N., and M. Gopal. 2004. Biodegradation of beta-cyfluthrin by fungi. J. Agric. Food Chem. 52:1220-1223.

98. Sandermann, H. Jr., W. Heller, N. Hertkorn, E. Hoque, D. Pieper, and R. Winkler. 1998. A new intermediate in the mineralization of 3,4-dichloroaniline by the white rot fungus Phanerochaete chrysosporium. Appl. Environ. Microbiol. 64:3305-3312.

99. Sarkanen, K.V., and C.H. Ludwig. 1971. Lignins. Occurrence, formation, structure and reactions. Wiley-interscience, New York.

100. Schardl, C.L., D.G. Panaccione, and P. Tudzynski. 2006. Ergot alkaloids--biology and molecular biology. Alkaloids Chem. Biol. 63:45-86.

101. Schuler, M.A., and R. Werck-Reichhart. 2003. Functional genomics of P450s. Annu. Rev. Plant Biol. 54:629-667.

102. Servent, D., C. Ducrocq, Y. Henry, A. Guissani, and M. Lenfant. 1991. Nitroglycerin metabolism by Phanerochaete chrysosporium: evidence for nitric oxide and nitrite formation. Biochim. Biophys. Acta. 1074:320-325.

223 103. Sharma, K.K., S. Gupta, and R.C. Kuhad. 2006. Agrobacterium-mediated delivery of marker genes to Phanerochaete chrysosporium mycelial pellets: a model transformation system for white-rot fungi. Biotechnol. Appl. Biochem. 43:181-186.

104. Shet, M.S. 2007. Relevance of cytochrome P450s in plants: also one of Ron Estabrook's research interests. Drug Metab Rev. 39:273-280.

105. Soares, A., K. Jonasson, E. Terrazas, B. Guieysse, and B. Mattiasson. 2005. The ability of white-rot fungi to degrade the endocrine-disrupting compound nonylphenol. Appl. Microbiol. Biotechnol. 66:719-725.

106. Spadaro, J.T., M.H. Gold, and V. Renganathan. 1992. Degradation of azo dyes by the lignin-degrading fungus Phanerochaete chrysosporium. Appl. Environ. Microbiol. 58:2397-2401.

107. Sutherland, J.B. 1992. Detoxification of polycyclic aromatic hydrocarbons by fungi. J. Ind. Microbiol. 9:53-61.

108. Sutherland, J.B., A.L. Selby, J.P. Freeman, F.D. Evans, and C.E. Cerniglia. 1991. Metabolism of phenanthrene by Phanerochaete chrysosporium. Appl. Environ. Microbiol. 57:3310-3316.

109. Tamagawa, Y., H. Hirai, S. Kawai, and T. Nishida. 2007. Removal of estrogenic activity of 4-tert-octylphenol by ligninolytic enzymes from white rot fungi. Environ. Toxicol. 22:281- 286.

110. Tekere, M., J.S. Read, and B. Mattiasson. 2005. Polycyclic aromatic hydrocarbon biodegradation in extracellular fluids and static batch cultures of selected sub-tropical white rot fungi. J. Biotechnol. 115:367-377.

111. ten Have, R., I.M. Rietjens, S. Hartmans, H.J. Swarts, and J.A. Field. 1998. Calculated ionization potentials determine the oxidation of vanillin precursors by lignin peroxidase. FEBS Lett. 430:390-392.

112. Teramoto, H., H. Tanaka, and H. Wariishi. 2004. Degradation of 4-nitrophenol by the lignin-degrading basidiomycete Phanerochaete chrysosporium. Appl .Microbiol. Biotechnol. 66:312-317.

113. Thurston, C.F. 1994. The structure and function of fungal laccases. Microbiology 140: 19- 26.

114. Tien M. 1987. Properties of ligninase from Phanerochaete chrysosporium and their possible applications. Crit. Rev. Microbiol. 15:141-168.

115. Tien, M., and D. Ma. 1997. Oxidation of 4-Methoxymandelic Acid by Lignin Peroxidase. Mediation by veratryl alcohol. J. Biol. Chem. 272: 8912-8917.

224 116. Tonon, F., and E. Odier. 1988. Influence of veratryl alcohol and hydrogen peroxide on ligninase activity and ligninase production by Phanerochaete chrysosporium. Appl. Environ. Microbiol. 54:466-472.

117. Trant, J.M. 1996. Functional expression of recombinant spiny dogfish shark (Squalus acanthias) cytochrome P450c17 (17 alpha-hydroxylase/C17,20-lyase) in yeast (Pichia pastoris). Arch. Biochem. Biophys. 326:8-14.

118. Urlacher, V.B, S. Lutz-Wahl, R.D. Schmid. 2004. Microbial P450 enzymes in biotechnology. Appl. Microbiol. Biotechnol. 64:317-325.

119. Valli, K., and M.H. Gold. 1991. Degradation of 2,4-dichlorophenol by the lignin-degrading fungus Phanerochaete chrysosporium. J. Bacteriol. 173:345-352.

120. Valli, K., H. Wariishi, and M.H. Gold. 1988. Oxidation of monomethoxylated aromatic compounds by lignin peroxidase: role of veratryl alcohol in lignin biodegradation. Biochemistry 29:8535-8539.

121. van den Brink, H.M., R.F. van Gorcom, C.A. van den Hondel, and P.J. Punt. 1998. Cytochrome P450 enzyme systems in fungi. Fungal Genet. Biol. 23:1-17.

122. Van Hamme, J.D., E.T. Wong, H. Dettman, M.R. Gray, M.A. Pickard. 2003. Dibenzyl sulfide metabolism by white rot fungi. Appl. Environ. Microbiol. 69:1320-1324.

123. Wariishi, H., H.B. Dunford, I.D. MacDonald, and M.H. Gold. 1989. Manganese peroxidase from the lignin-degrading basidiomycete Phanerochaete chysosporium: transient-state kinetics and reaction mechanism. J. Biol. Chem. 264:3335-3340.

124. Wariishi, H., K. Valli, and M.H. Gold. 1992. Mangenese(II) oxidation by manganese peroxidase from the basidiomycete Phanerochaete chrysosporium: kinetic mechanism and role of chelators. J. Biol. Chem. 267:23688-23695.

125. Wariishi, H., L. Akileswaran, and M.H. Gold. 1988. Manganese peroxidase from the basidiomycete Phanerochaete chrysosporium: spectral characterization of the oxidized states and the catalytic cycle. Biochemistry 27:5365-5370.

126. Warshawsky, D. and J. R. Landolph Jr. (eds). 2006. In. Molecular carcinogenesis and molecular biology of human cancer. CRC Press, Boca Raton, Fl.

127. Wiseman, A. 2003. Novel cytochromes P450 applications arising from the directed- evolution of recombinant micro-organisms. Lett. Appl. Microbiol. 37:264-267.

128. Yadav, J.S., and C.A. Reddy. 1993. Degradation of benzene, toluene, ethylbenzene, and xylenes (BTEX) by the lignin-degrading basidiomycete Phanerochaete chrysosporium. Appl Environ Microbiol. 59:756-762.

225 129. Yadav, J.S., and C.A. Reddy. 1993. Mineralization of 2,4-Dichlorophenoxyacetic Acid (2,4-D) and Mixtures of 2,4-D and 2,4,5-Trichlorophenoxyacetic Acid by Phanerochaete chrysosporium. Appl. Environ. Microbiol. 59:2904-2908.

130. Yadav, J.S., C. Bethea, and C.A. Reddy. 2000. Mineralization of trichloroethylene (TCE) by the white rot fungus Phanerochaete chrysosporium. Bull. Environ. Contam. Toxicol. 65:28-34.

131. Yadav, J.S., D.L. Lawrence, B.A. Nuck, T.W. Federle, C.A. Reddy. 2001. Biotransformation of linear alkylbenzene sulfonate (LAS) by Phanerochaete chrysosporium: oxidation of alkyl side-chain. Biodegradation. 12:443-453.

132. Yadav, J.S., H. Doddapaneni, and V. Subramanian. 2006. P450ome of the white rot fungus Phanerochaete chrysosporium: structure, evolution and regulation of expression of genomic P450 clusters. Biochem. Soc. Trans. 34:1165-1169.

133. Yadav, J.S., J.F. Quensen 3rd, J.M. Tiedje, and C.A. Reddy. 1995. Degradation of polychlorinated biphenyl mixtures (Aroclors 1242, 1254, and 1260) by the white rot fungus Phanerochaete chrysosporium as evidenced by congener-specific analysis. Appl. Environ. Microbiol. 61:2560-2565.

134. Yadav, J.S., M.B. Soellner, J.C. Loper, and P.K. Mishra. 2003. Tandem cytochrome P450 monooxygenase genes and splice variants in the white rot fungus Phanerochaete chrysosporium: cloning, sequence analysis, and regulation of differential expression. Fungal Genet. Biol. 38:10-21.

135. Yadav, J.S., R.E. Wallace, and C.A. Reddy. 1995. Mineralization of mono- and dichlorobenzenes and simultaneous degradation of chloro- and methyl-substituted benzenes by the white rot fungus Phanerochaete chrysosporium. Appl. Environ. Microbiol. 61:677- 680.

136. Zapanta, L.S., T. Hattori, M. Rzetskaya, and M. Tien. 1998. Cloning of Phanerochaete chrysosporium leu2 by complementation of bacterial auxotrophs and transformation of fungal auxotrophs. Appl. Environ. Microbiol. 64:2624-2629.

137. Zouari, H., M. Labat, and S. Sayadi. 2002. Degradation of 4-chlorophenol by the white rot fungus Phanerochaete chrysosporium in free and immobilized cultures. Bioresour. Technol. 84:145-150.

226 Appendix

pVBG vector construct

XbaI - 423 - T'CTAG_A PstI - 466 - C_TGCA'G PstI - 645 - C_TGCA'G

or ct e v B 9 1 p h C P

U

p pVBG (pUC19-BphP-GFP-BphT) 5908 bp

I - D P G Sph P I - 1881 - G_CATG'C F PstI - 1948 - C_TGCA'G B EG phT HindIII - 3669 - A'AGCT_T

DraIII - 2668 - CAC_nnn'GTG

pVBG construct: 5908 nucleotides

Bph promoter: 429-1878 GPD (including first intron):1879-1948 EGFP:1949-2668 Bph terminator: 2669-3668 pUC19 vector sequence: 3669-428

227 pVH vector contruct

BamHI - 417 - G'GATC_C

r T to rp ec C v t 9 e 1 r m C SpeI - 1422 - A'CTAG_T U

p pVH(pUC19-GpdP-Hph-TrpCT) 6694 bp h p H PstI - 2114 - C_TGCA'G SphI - 4453 - G_CATG'C G PstI - 4447 - C_TGCA'G P D p ter romo SphI - 2443 - G_CATG'C BamHI - 4099 - G'GATC_C

BamHI - 3294 - G'GATC_C

pVH construct: 6694 nucleotides

GPD promoter: 2443-4442 bases (complementary strand) Hygromycin resistance gene (hph): 1423-2442 bases (complementary strand) TrpC terminator: 403-1422 bases (complementary strand) pUC19 vector: 4443-417 bases

228 pVP vector construct

BamHI - 417 - G'GATC_C

T rp C t e r m

SpeI - 1422 - A'CTAG_T pVP(pUC19-GpdP-Phl-TrpCt)

l 6049 bp h P SphI - 1798 - G_CATG'C

r te G o SphI - 3808 - G_CATG'C PD prom PstI - 3802 - C_TGCA'G

BamHI - 3454 - G'GATC_C BamHI - 2649 - G'GATC_C

pVP construct: 6049 nucleotides

GPD promoter: 1798-3797 bases (complementary strand) Phleomycin resistance gene (ble): 1423-1797 bases (complementary strand) TrpC terminator: 403-1422 bases (complementary strand) pUC19 vector: 3798-416 bases

229

pCFNRc vector construct

NsiI - 11093 - A_TGCA'T BstEII - 10951 - G'GTnAC_C NcoI - 10945 - C'CATG_G NsiI - 10418 - A_TGCA'T

OSt RB in) N irp p NcoI - 9540 - C'CATG_G ha V ( S h -S p T B A p V M C

a

Z

c

S

C a

M

L

p

Z

c

a

L pCFNRc(pCAMBIA 1201-Hairpin) P

C E 11351 bp R M

- V S p V p H p

h ri -o 22 R3 pB CM Vt LB CAT

NsiI - 4945 - A_TGCA'T

C _ C G G

_ _ nA G G T CA'T GT A G C

' C C'CAT A_T -

- II - G' - I I I E o o i t

c Nc Ns N Bs

Bph 600 with int Bph 300 rev w/o int

FR t t

pCFNRc construct: 11351 nucleotides

Bph (Forward stem and loop): 9540-10418 bases Bph (Reverse stem): 10419-10951 bases pCAMBIA 1201: 10952-9539 bases

230

pCAMBIA 1201 Bph-a (siRNA)

BstEII - 9595 - G'GTnAC_C NcoI - 9540 - C'CATG_G

RB

A t N S siR NO Vp CM p Za S c C M a V L Zp a c L S -S p T V A M C pCAMBIA 1201-Bph-a (siRNA) H 9995 bp P p

E h R - S C M V V t

L p B

C -ori 322 A pBR T

NcoI overhang CATGGCT AGATTTGAAGTCGTGGCTTCAAGAGAGCCACGACTTCAAATCTAGTTG CGATCTAAACTTCAGCACCGAAGTTCTCTCGGTGCTGAAGTTTAGATCAACCACTG BstEII overhang

pCAMBIA 1201-Bph (19nt siRNA) construct: 9995 nucleotides

siRNA insert: 9540-9595 pCAMBIA 1201 vector: 9596-9539

231

pPICZb-PC2 vector construct

ori AO C X1 U p p r o EcoRI - 943 - G'AATT_C

n

i

c pPICZb-PC2 o

e

Z 5088 bp

2 C P

NotI - 2753 - GC'GGCC_GC

pPICZb-PC2 construct: 4902 nucleotides

PC2 insert: 952-2751 bases pPICZb vector: 2568-942 bases

232