Controversy: Blocking Fas Ligand Expression Suppresses Tumor Immune Evasion of Colon Cancer in Vivo

Research Article

Addressing the ‘‘Fas Counterattack’’ Controversy: Blocking Fas Ligand Expression Suppresses Tumor Immune Evasion of Colon Cancer In vivo

Aideen E. Ryan,1 Fergus Shanahan,1,2 Joe O’Connell,1,2 and Aileen M. Houston1,2

1Department of Medicine, Cork University Hospital, and 2Alimentary Pharmabiotic Centre, National University of Ireland Cork, Cork, Ireland

Abstract factor (TNF) family (2). FasL interacts with its receptor, Fas Fas ligand (FasL/CD95L) is a transmembrane protein (CD95/APO-1), and can trigger a cascade of subcellular events belonging to the tumor necrosis factor superfamily that culminating in the apoptotic cell death of sensitive cells (3). This can trigger apoptotic cell death following ligation to its interaction plays an important role in immune homeostasis (4) receptor, Fas (CD95/APO-1). Expression of FasL may help to and in the maintenance of immune privilege in sites such as the maintain tumor cells in a state of immune privilege by eye (5) and testis (6). In these sites, constitutive expression of inducing apoptosis of antitumor immune effector cells—the FasL may limit inflammatory responses and maintain relative ‘‘Fas counterattack.’’ However, the ability of FasL to mediate immunosuppression by inducing apoptosis in infiltrating proinflammatory lymphocytes. tumor immune privilege is controversial due to studies that indicate FasL has both pro- and anti-inflammatory activities. The discovery that FasL is also expressed by a variety of tumor To resolve this controversy and functionally define the role of cells raised the possibility that FasL may mediate immune privilege FasL in tumor immune evasion, we investigated if suppres- in human tumors (7–9). Activated T cells express Fas and are sion of endogenously expressed FasL in colon tumor cells sensitive to Fas-mediated apoptosis (10). Thus, up-regulation of resulted in reduced tumor development and improved FasL expression by tumor cells may enable the tumor cells to kill antitumor immune challenge in vivo. Specifically, FasL infiltrating antitumor lymphocytes. Numerous studies have shown expression in CMT93 colon carcinoma cells was down- that tumor-expressed FasL is capable of killing Fas-bearing, regulated following stable transfection with a plasmid sensitive cells in vitro (7, 9), whereas expression of FasL by human encoding antisense FasL cDNA. Down-regulation of FasL tumors is associated with apoptosis and loss of tumor-infiltrating expression had no effect on tumor growth in vitro but lymphocytes (TIL) in vivo (11, 12). significantly reduced tumor development in syngeneic im- However, the role of FasL in tumor-mediated immunosuppres- munocompetent mice in vivo. Tumor size was also signifi- sion is controversial. In addition to its well-defined role in cantly decreased. Reduced FasL expression by tumor cells led apoptosis, Fas/FasL interactions may mediate other responses to increased lymphocyte infiltration. The overall level of such as cytokine secretion and inflammation. In fact, genetically neutrophils present in all of the tumors examined was low, engineered overexpression of FasL in allografts of tissues and with no difference between the tumors, irrespective of FasL tumor cells in many instances targeted these cells for rapid expression. Thus, down-regulation of FasL expression by rejection in vivo (13–15). Rejection was mediated primarily by colon tumor cells results in an improved antitumor immune neutrophils. These findings contrast with others showing an challenge in vivo, providing functional evidence in favor of immunoprotective effect of FasL (16–18). Reasons proposed to the ‘‘Fas counterattack’’ as a mechanism of tumor immune account for these discrepancies include differences in the level of evasion. (Cancer Res 2005; 65(21): 9817-23) FasL expressed by the allografts (17, 19), sensitivity of the transduced cells to apoptosis (20), overexpression of membrane- bound FasL (21), and/or the moderating effects of the local Introduction microenvironment (22). These studies indicate that FasL can be Tumor escape is a major obstacle to successful immunotherapy either immunoprotective or immunodestructive, and question the (1). Despite compelling evidence that immunogenic tumors can ability of FasL to mediate tumor immune privilege in vivo. be rejected by the immune system under optimum conditions, a Overexpression of some proteins can lead to atypical con- large number of tumors continue to grow and evade immune- sequences. In addition, significant neutrophil recruitment and mediated elimination. During carcinogenesis, tumors develop inflammation has not been observed in tumors endogenously multiple mechanisms to evade the host immune response. Up- expressing FasL in vivo. Thus, to functionally investigate the role of regulation of Fas ligand (FasL/CD95L) expression may represent FasL in tumor immune escape and to avoid any potential artifacts one such mechanism. FasL was first identified in 1993 as a 40 kDa of overexpression systems, we investigated whether inhibition of type II transmembrane protein belonging to the tumor necrosis native FasL expression resulted in reduced tumor development and improved antitumor immune challenge in vivo. In the present study, we specifically inhibited FasL expression in murine colon tumor cells using antisense RNA. Relative to controls, we found Requests for reprints: Aileen M. Houston, Department of Medicine, Clinical that tumor formation by FasL antisense–transfected cells was Science Building, Cork University Hospital, Wilton, Cork, Ireland. Phone: 353-21-490- significantly reduced following s.c. injection into syngeneic C57BL/ 1226; Fax: 353-21-434-5300; E-mail: [email protected]. I2005 American Association for Cancer Research. 6 mice. In those tumors that did develop, leukocyte infiltration was doi:10.1158/0008-5472.CAN-05-1462 significantly increased. Interestingly, despite strong expression of www.aacrjournals.org 9817 Cancer Res 2005; 65: (21). November 1, 2005

Downloaded from cancerres.aacrjournals.org on September 28, 2021. © 2005 American Association for Cancer Research. Cancer Research constitutive FasL in the control tumors, neutrophil recruitment did incorporates into the plasma membrane, allowing the identification of not occur. Taken together, our results provide for the first time target cells (23). Aliquots of the target cells (500 AL) were incubated in definitive, functional evidence in favor of a role for FasL in tumor triplicate for 16 hours with the effector cells at the indicated effector-to- immune evasion. target cell ratios. To block the Fas pathway, neutralizing anti-FasL monoclonal antibody (MFL3, 10 Ag/mL; PharMingen, San Diego, CA) was preincubated on the monolayer for 1 hour at 37jC, followed by the addition Materials and Methods of the labeled Jurkat T cells. Cells were harvested, washed in PBS, and Mice. Four- to six-week-old female C57BL/6 mice were obtained from stained with Annexin V-FITC (BD PharMingen). The percentage of PKH-26/ Harlan UK Ltd., (Oxon, United Kingdom) and maintained in the animal Annexin V dual positive cells was determined by flow cytometry using a facility of University College Cork. Animal experiments were carried out in FACSCalibur flow cytometer and Cell Quest software (Becton Dickinson, accordance with institutional guidelines, using an Animal Research San Jose, CA). Committee–approved protocol. The mice were maintained in standard Detection of soluble Fas ligand. Soluble FasL was detected in the environmental conditions with free access to food and water and were culture supernatant of CMT93 cells (transfected and nontransfected) by allowed to adapt to their environment for 2 weeks before commencement ELISA. Briefly, after 72 hours, the culture supernatant was removed, of the experiment. centrifuged to remove particulate matter, and analyzed by ELISA according Cells and culture conditions. CMT93, a mouse colon cancer cell line, to the instructions of the manufacturer (R&D Systems, Minneapolis, MN). was kindly provided by Dr. Stephen Todryk (Oxford University, United Proliferation assays—[3H]thymidine incorporation and 3-(4,5- Kingdom). Cells were maintained in DMEM supplemented with 2 mmol/L dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay. Cells glutamine, 100 Ag/mL streptomycin, 100 units/mL penicillin, and 10% FCS were seeded at 2 Â 104 cells/mL in quadruplicate in 24-well plates 3 in a humidified 5% CO2 atmosphere. and grown for 48 hours. Fresh medium containing [ H]thymidine (1 ACi/mL; Generation of stable CMT93 FasLLow/À cell line. A cDNA fragment Amersham, Buckinghamshire, United Kingdom) was then added to each complementary, when transcribed, to nucleotides 35 to 371 of the mouse well. After 6 hours, the cells were washed with ice-cold PBS and FasL mRNA sequence (GeneBank accession no. U06948) was amplified by harvested for liquid scintillation counting. Alternatively, after 48 hours PCR using the following set of primers: forward, 5V-TGGAGCAGTCAGCGT- culture, 20 AL of 5 mg/mL 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetra- CAGAGTT-3V, and reverse, 5V-CCACCGGTAGCCACAGATTTG-3V. The frag- zolium bromide (MTT; Sigma) in PBS were added to each well. After ment spans the translational start site of the mouse FasL gene and was 4 hours at 37jC, the medium was carefully removed from the wells and cloned into the StuI site of pBlast expression vector (Invivogen, San Diego, the remaining formazan crystals were dissolved in DMSO. The CA). Ligation products were transformed into chemically competent XL2- absorbance at 570 nm was read on a microplate reader. MRF E. coli cells (Stratagene, La Jolla, CA) and analyzed by restriction PCR. PCR was done on genomic DNA isolated from individual clones digestion and automated sequence analysis to determine fragment using a DNA isolation kit (Machery-Nagel, Du¨ren, Germany) according to the orientation. instructions of the manufacturer. PCR primers were designed using the CMT93 cells were seeded in 24-well plates and transfected the following DNASTAR Lasergene Primerselect programme (DNASTAR, Inc., Madison, day using Lipofectamine 2000 reagent (Life Technologies, Inc., Baltimore, WI). Primers were selected which showed no significant homology to any MD) according to the instructions of the manufacturer. Briefly, cells were other genes in the European Molecular Biology Laboratory DNA sequence transfected with 1 Ag of DNA using 1.5 AL of Lipofectamine 2000 reagent. database. Primers were used at a final concentration of 0.1 Amol/L each, The medium was replaced 24 hours later with fresh growth media. deoxynucleotide triphosphates at 50 Amol/L, and MgCl2 at 1.5 Amol/L. Blasticidin-supplemented medium (8 Ag/mL) was used to select for stable One unit of Taq DNA polymerase was used per 50 AL reaction. The following transfectants. Suppression of FasL expression in stably transfected clones forward and reverse primers were used, respectively: FasL, CGGTGGTA- was determined by immunoblotting for FasL protein and the clone with TTTTTCATGGTTCTGG and CTTGTGGTTTAGGGGCTGGTTGTT; b-actin, the lowest level of FasL was isolated by limiting dilution. CCTTCCTGGGCATGGAGTCCTG and GGAGCAATGATCTTGATCTTC. Immunoblotting. For immunoblotting, cells were lysed for 1 hour on ice Thermal cycling was as follows: denaturation at 96jC for 15 seconds, an- in 20 mmol/L Tris-HCl (pH 7.4), containing 150 mmol/L NaCl and 1% Triton nealing at 55jC for 30 seconds, and extension at 72jC for 2 minutes. The X-100, supplemented with the complete-TM mixture of protease inhibitors products were resolved on 2% agarose gels and viewed under UV light (Roche Molecular Biochemicals, Indianapolis, IN). Protein concentrations following ethidium bromide staining. A 100-bp DNA ladder size marker were measured using the bicinchoninic acid protein assay (Pierce, Rockford, (Promega, Madison, WI) was used. IL) according to the instructions of the manufacturers. After removing In vivo tumor growth. C57BL/6 mice were injected s.c. into the right insoluble material, equivalent amounts of protein (10-50 Ag) were loaded flank with 3 Â 106 tumor cells suspended in 200 ALPBS(n = 25 per group). onto a 10% polyacrylamide gel, separated by electrophoresis, and Five mice from each group were sacrificed each week. Tumor growth was transferred onto nitrocellulose membranes. Loading between lanes was monitored by measuring the width (W) and length (L) of the tumors. The assessed by Ponceau-S staining. Membranes were blocked in Blotto (5% mean tumor diameter was then calculated as W + L / 2. After sacrificing, skim milk in TBS-0.5% Tween 20) for 1 hour at room temperature. The tumors were excised, snap frozen in liquid nitrogen, and fixed in buffered membrane was then incubated with one of the following primary formalin (pH 7.2). antibodies: anti-FasL (Ab-1; Oncogene Research Products, Cambridge, Immunohistochemistry. Tumors were excised, fixed with 10% neutral MA), anti-Fas (M-20; Santa Cruz Biotechnology, Santa Cruz, CA), anti–TNF buffered formalin, and embedded in paraffin. Sections were deparaffinized receptor 1 (H-5; Santa Cruz Biotechnology), anti–TNF-related apoptosis- in xylene and rehydrated before analysis. Antigen retrieval was done by inducing ligand (H-257; Santa Cruz Biotechnology), and anti–h-actin (AC- microwave irradiation in 0.01 mol/L citrate buffer (pH 6.0). Slides were 74; Sigma, St. Louis, MO). Primary antibodies were detected with washed with TBS containing 0.001% saponin and endogenous peroxidase horseradish peroxidase (HRP)–conjugated immunoglobulin G (Dako Corp., was quenched with 3.0% hydrogen peroxide in methanol for 5 minutes. Carpinteria, CA) raised against the corresponding species (1:1,000). Nonspecific binding was blocked with 5% normal rabbit serum (or normal Peroxidase activity was detected with the enhanced chemiluminescence goat serum for FasL detection) in wash buffer for 1 hour. To detect FasL system (Pierce) and analyzed using Scion Image analysis software (Scion, expression, sections were incubated overnight at 4jC with anti-FasL specific Inc., Frederick, MD). Changes in FasL protein expression were determined polyclonal antibody (N-20; Santa Cruz Biotechnology) at 0.066 Ag/mL. after normalizing the band intensity of each lane to that of h-actin. CD45+ cells were detected in consecutive sections using a polyclonal anti- Flow cytometric cytotoxicity assay. Cells were plated in triplicate in CD45 specific antibody (M-20; Santa Cruz Biotechnology) at 0.8 Ag/mL, six-well tissue culture dishes and allowed to reach f75% confluency as a whereas the presence of tumor cells was confirmed by staining for cripto monolayer. Jurkat T cells were labeled with the red fluorescent dye PKH-26 (D-19; Santa Cruz Biotechnology) at 0.26 Ag/mL. Cripto is an epidermal (Sigma) according to the instructions of the manufacturer. PKH-26 stably growth factor-Cripto-FRL1-Cryptic protein that is overexpressed in several

Cancer Res 2005; 65: (21). November 1, 2005 9818 www.aacrjournals.org

Downloaded from cancerres.aacrjournals.org on September 28, 2021. © 2005 American Association for Cancer Research. Fas Ligand Mediates Immune Privilege in Cancer types of cancer, including colon cancer. Neutrophils were identified by (Fig. 1B). Moreover, FasL antisense RNA significantly decreased immunohistochemical staining for the neutrophil-specific marker lactofer- the expression of soluble FasL in antisense-transfected cells rin (N-20; Santa Cruz Biotechnology) at 0.4 Ag/mL. Antibody binding was (CMT93/AS), as determined by ELISA. After 72 hours in culture, localized using a biotinylated secondary antibody, avidin-conjugated HRP, there was an almost 2-fold decrease in the amount of soluble and 3,3V-diaminobenzidine substrate, contained within the Vectastain FasL present in the supernatant of CMT93/AS cells relative to avidin-biotin complex detection kit (Vector Laboratories, Burlingame, CA). Slides were counterstained with hematoxylin. When viewed under control cells (P < 0.001; data not shown). light microscopy, positive cells stained brown. Down-regulation of FasL protein expression on CMT93 cells also To quantify CD45+ TIL infiltration within each tumor, stained tumor substantially inhibited their effector function against Fas-sensitive sections were observed under light microscopy at Â620. The number of target cells. There was a marked decrease in the number of CD45+ cells per 10 high-power fields per section was counted. Results were apoptotic Jurkat T cells following coculture with CMT93/AS cells, then expressed as the mean number of CD45+ cells per high-power field. relative to coculture with FasL-expressing mock-transfected Neutrophil infiltration was assessed in a similar fashion. (CMT93/C) and untransfected parental cells (Fig. 1C). Cell death F Statistical analysis. Data are expressed as the mean SE. Student’s t induced by CMT93 and CMT93/C cells was confirmed to be FasL- test or one-way ANOVA was used to compare the mean differences between mediated as killing could be blocked by the addition of a groups. P < 0.05 was considered significant. neutralizing anti-FasL antibody. In addition, all transfectants, as well as the parental cell line, were found to be resistant to Fas- Results mediated apoptosis, as assessed by Annexin V staining and flow Stable transfection of CMT93 cells with antisense FasL RNA cytometry following incubation of the tumor cells with 250 ng/mL down-regulates Fas ligand. To examine the role of FasL in tumor anti-Fas agonistic antibody (CH-11; Upstate Biotechnology, Char- immune escape, a 340-bp fragment spanning the translational lottesville, VA; data not shown). start site of the mouse FasL gene was generated by reverse Recent studies have shown that Fas can transduce activation transcription-PCR (RT-PCR) and cloned into pBlast vector in the and proliferation signals although the mechanism by which this antisense direction. The positive plasmid was verified by NdeI and occurs is poorly understood (24, 25). Because CMT93 cells AgeI digestion and DNA sequence. CMT93 cells were stably coexpress Fas and FasL, tumor-expressed FasL may act in an transfected with either this antisense construct (CMT93/AS) or a autocrine or juxtacrine manner to promote tumor growth. construct containing nonspecific sequence (CMT93/C). CMT93 is However, down-regulation of FasL expression did not affect the a mouse colon tumor cell line which constitutively expresses FasL viability and proliferation rate of the tumor cells in vitro,as (Fig. 1A). After antibiotic selection, genomic DNA was isolated assessed by both MTT assay and tritiated thymidine incorporation from the stable clones and analyzed by PCR. PCR analysis (Fig. 1D). Two days after transfection, there was no significant revealed that the recombinant plasmids had integrated into the difference in the proliferation rate of the antisense-transfected genomic DNA of the CMT93 cells (data not shown). The efficacy cells, relative to that of the control cells. However, CMT93/AS of FasL antisense RNA in inhibiting FasL protein production was tumor cells did retain a low level of expression of the ligand and then examined by Western blotting and ELISA, respectively. this low level may be sufficient to transduce any potential Western blot analysis revealed a f90% inhibition in FasL protein proliferation signals. expression in clone A3 compared with mock-transfected and Down-regulation of Fas ligand expression results in reduced untransfected parental cells (Fig. 1B; P < 0.001). This clone was tumorigenicity of colon tumor cells. To investigate whether selected for all subsequent experiments. Inhibition of FasL protein reduced FasL expression by colon tumor cells leads to impaired expression was specific as the antisense construct did not affect tumor development in vivo, antisense-transfected, parental, or expression of other members of the TNF family, including Fas, mock-transfected CMT93 cells were injected s.c. into the flanks of TNF-related apoptosis-inducing ligand, and TNF receptor 1 syngeneic immunocompetent C57BL/6 mice (3 Â 106 cells/mouse).

Figure 1. FasL antisense RNA suppresses FasL expression by CMT93 cells. A, FasL expression was detected in CMT93 cells at both the mRNA level and protein level by RT-PCR and Western blotting, respectively. Expression of the housekeeping gene b-actin was used as an internal control. B, immunoblot analysis of FasL protein expression revealed a reduction in FasL protein levels in FasL antisense–treated CMT93 cells (CMT93/AS), relative to parental (CMT93) and mock-transfected (CMT93/C) cells. C, CMT93, CMT93/C, or CMT93/AS cells were incubated in triplicate at the indicated effector-to-target cell ratios with fluorescently labeled Jurkat cells in the presence or absence of a neutralizing anti-FasL antibody (MFL3). CMT93/AS cells displayed reduced cytotoxicity against Fas+ Jurkat target cells. D, growth rates of CMT93, CMT93/AS, and CMT93/C cells were analyzed by both tritiated thymidine incorporation and MTT assay 48 hours after seeding. Proliferation is expressed relative to untransfected control cells. Columns, mean of three independent experiments; bars, SE. www.aacrjournals.org 9819 Cancer Res 2005; 65: (21). November 1, 2005

FasLLow/À CMT93/AS cells developed tumors, whereas three of those injected with FasL-positive (FasL+) CMT93/C cells and four injected with parental cells developed tumors. In fact, overall, there was a 2.3-fold decrease in the number of tumors derived from FasLLow/À CMT93/AS cells compared with CMT93/C cells (P = 0.0165)—in total, 6 tumors developed in mice inoculated with CMT93/AS cells compared with 14 in those inoculated with CMT93/C tumor cells. Moreover, the size of the tumors derived from FasLLow/À CMT93/AS cells was significantly reduced relative to FasL+ CMT93/C and parental CMT93 cells (P = 0.0033). Analysis revealed that tumors derived from CMT93/AS cells were smaller than those derived from CMT93/C and CMT93 parental cells (Fig. 2B). Overall, tumors derived from CMT93/AS cells had an average diameter of just 1.5 mm, compared with those derived from CMT93/C and CMT93 cells which yielded tumors of 2.95 and 3.84 mm, respectively. Thus, suppression of FasL expression by tumor cells resulted in at least a 50% reduction in the average diameter of the tumors which did develop. Together, these findings clearly show that reduction in FasL expression by tumor cells significantly reduces tumor development in mice and favors a role for FasL in tumorigenesis. Both Western blotting and immunohistochemical analysis confirmed that the levels of FasL protein remained reduced in the CMT93/AS cells in vivo. Tumors were excised from all mice and FasL protein levels assessed by both Western blotting and immunohistochemistry. Immunoreactivity for FasL was detected Figure 2. Effect of reduced FasL expression by CMT93 cells on tumor in all excised tumors, but was substantially reduced in the CMT93/ development. A total of 3 Â 106 parental, antisense-transfected, and mock-transfected CMT93 colon tumor cells were injected s.c. into C57BL/6 mice. AS tumors relative to the parental CMT93 and mock-transfected Five mice were sacrificed per group each week and the number of tumors tumors (Fig. 3). present determined (A). B, tumor diameter was also measured and used to Reduction in Fas ligand expression by colon tumor cells assess tumor growth. The values shown exclude the zero values for those cases where tumors did not develop. results in increased infiltration of tumor-infiltrating lymphocytes. To elucidate the mechanism whereby down-regulation of FasL expression by tumor cells results in reduced tumor To follow the course of tumor development, five mice from each development in vivo, we assessed the level of lymphocyte infiltration group were randomly selected and sacrificed every 7 days for a in the excised tumors. Activated lymphocytes express Fas and total of 5 weeks and any tumors present excised. Tumors were become sensitive to Fas-mediated apoptosis (10). Leukocytes were found in a total of 30 mice. However, the rate of tumor formation identified within tumors by immunohistochemical staining for the was significantly reduced in mice injected with FasL-low/negative leukocyte common antigen (CD45) and the number of CD45+ cells (FasLLow/À) CMT93/AS cells (Fig. 2A). Examination of mice per 10 high-power fields per tumor was determined. As shown in sacrificed at week 5 revealed that none of the mice injected with Fig. 4, there was a significant increase in the overall number of

Figure 3. Analysis of tumors derived from CMT93/AS, CMT93/C and parental cells inoculated s.c. in C57BL/6 mice. A, tumors that developed following injection of parental (P), mock-transfected (C), or antisense-transfected (AS) CMT93 cells into C57BL/6 mice were excised and FasL protein expression analyzed by immunoblotting. B, the intensity of the immunoblotting signals was analyzed using a digital imaging analysis system. Values are expressed relative to control h-actin protein levels. C, FasL protein expression was also assessed by immunohistochemistry. FasL protein was down-regulated in the CMT93/AS tumors relative to the tumors derived from CMT93 and CMT93/C cells. Results from a representative series of tumors. Original magnification, Â400.

Cancer Res 2005; 65: (21). November 1, 2005 9820 www.aacrjournals.org

Figure 4. Down-regulation of FasL expression leads to increased infiltration of TILs. A, tumors that developed following injection of parental (a), antisense-transfected (b), or mock-transfected (c) CMT93 cells into C57BL/6 mice were excised and FasL expression detected by immunohistochemistry. TILs were detected on consecutive sections by immunohistochemistry for CD45 (d-f; brown, arrows). B, TILs were quantified as the number of CD45+ cells per high-power field. There were 3.7-fold fewer TIL detectable in FasL+ tumors compared with FasLLow/À antisense-transfected tumors (P = 0.0072). Original magnifications: Â400; inset, Â1,000. Results from a representative series of tumors.

CD45+ TILs present in FasLLow/À tumors. Analysis revealed a mean and neutrophil recruitment in response to tumor-expressed FasL 3.7-fold increase in the number of TILs in FasLLow/À CMT93/AS (Fig. 5). Moreover, there was no difference in the level of neutrophil tumors relative to FasL+ CMT93/C tumors (P = 0.0072). These infiltration between tumors that expressed FasL and FasLLow/À results indicate that tumor-expressed FasL has an inhibitory effect tumors. These findings are consistent with a role for tumor- on infiltration of TILs and are consistent with other studies expressed FasL in inducing apoptosis rather than activation or demonstrating that FasL contributes to immune privilege in human recruitment of neutrophils. Indeed, activated neutrophils have tumors (26, 27). previously been shown to be sensitive to Fas-mediated apoptosis Constitutively expressed Fas ligand does not trigger the in vitro (28). recruitment of neutrophils. Given the studies showing that overexpression of recombinant FasL in allografts and tumor cells can trigger an inflammatory response and rejection of the grafts, Discussion we determined whether constitutively expressed native FasL The role of FasL in tumor immune evasion and immune privilege triggers neutrophil infiltration in vivo. Neutrophils were identified is controversial (29, 30). Despite compelling evidence that tumor- based on their characteristic multi-lobed nuclei, together with expressed FasL is associated with immune evasion, attempts to immunohistochemical staining for lactoferrin. Both parental and enhance allograft survival by overexpressing FasL revealed a mock-transfected CMT93 cells constitutively express FasL; potential proinflammatory activity for this death ligand, and however, histologic analysis revealed a lack of inflammation suggested a more complex biology than previously suspected. However, overexpression of some proteins can lead to atypical consequences. Thus, in an effort to functionally investigate the role of FasL in tumor immune evasion and to avoid any potential artifacts associated with overexpression of FasL, we decreased FasL protein expression in mouse colon tumor cells that constitutively express FasL. If FasL expression promotes tumor immune privilege, then lack of FasL would be expected to result in decreased tumor immune evasion. This, in turn, should lead to reduced tumor formation and growth due to an improved antitumor immune Figure 5. Constitutively expressed FasL does not trigger neutrophil recruitment challenge in vivo. in vivo. FasL expression by tumors was detected by immunohistochemical In the present study, we found that expression of FasL antisense staining with an anti-FasL specific antibody (A). On a consecutive section, f neutrophils were identified by immunohistochemistry for lactoferrin (B), together RNA resulted in a 90% reduction in FasL protein in CMT93 colon with their multi-lobed nucleus (inset). Consecutive sections were also stained tumor cells. Soluble FasL production was also decreased. with anti-cripto antibody (C) which served as a tumor marker. FasL expression S.c. injection of these FasLLow/À tumor cells into immunocompe- by the tumor cells did not trigger the recruitment of neutrophils. Original + magnifications: Â400; inset, Â1,000. Results from a representative series of tent mice resulted in impaired tumor formation relative to FasL tumors. nonspecific transfected control cells (P = 0.0165). Tumor size was www.aacrjournals.org 9821 Cancer Res 2005; 65: (21). November 1, 2005

Downloaded from cancerres.aacrjournals.org on September 28, 2021. © 2005 American Association for Cancer Research. Cancer Research also significantly reduced (P = 0.0033). An enhanced antitumor transplantation biology to control rejection. Indeed, prolonged immune response may be responsible for the impaired tumor survival of allografts was reported in some studies following FasL development because the number of lymphocytes in the FasLLow/À gene transfer to organs such as thyroid (19) and kidney (41). In tumors was significantly higher than in FasL+ tumors (P = 0.0072). contrast, many other studies reported rigorous inflammation and The increased infiltration of TILs seen in FasLLow/À tumors is likely accelerated rejection following transplantation of FasL-over- due to decreased apoptosis of the TILs. TILs express Fas (31) and expressing allografts (14, 15, 42). However, examination of our activated T cells are sensitive to Fas-mediated apoptosis (10). tumor specimens revealed that constitutively expressed FasL is Numerous studies have shown killing of Fas-sensitive lymphoid not proinflammatory. Not only was there a lack of neutrophil target cells following coculture with FasL+ tumor cell lines (7, 8). infiltration in response to native FasL but there was also no Furthermore, we have previously shown that tumor-expressed FasL difference between the tumors, regardless of FasL expression. is associated with the apoptotic depletion of TILs in human cancer Whereas several studies have shown that Fas/FasL ligation may in vivo (11, 26). Together, these findings provide functional stimulate the secretion of proinflammatory cytokines and chemo- evidence in favor of an immune-evasive role for tumor-expressed kines including interleukin (IL)-6, MCP-1, and IL-8 in various cell FasL in vivo. The ability of the tumor cells to ‘‘counterattack’’ the types (43, 44), results from the current study suggest that antitumor immune response was significantly impaired following excessive inflammation and neutrophil recruitment are directly a the reduction of tumor-expressed FasL and resulted in decreased result of enforced, ectopic, expression of FasL in cells which do tumor formation. This shows that functional FasL expression, not endogenously express the ligand. Endogenous expression of combined with loss of sensitivity to Fas-mediated apoptosis, FasL in vivo is regulated by a variety of processes. Although provides malignant cells with a potent mechanism with which to synthesized as a transmembrane protein, FasL can be cleaved by evade the immune system, promoting the development and a specific metalloproteinase, matrix metalloproteinase-7, to form survival of the tumor. soluble FasL (45). Recent findings suggest that the membrane- Additional evidence supporting a role for FasL in tumor bound form of FasL is the major proinflammatory form of FasL, immune evasion and immune privilege includes the extensive whereas soluble FasL is noninflammatory and in fact opposes the number of tumors and tumor cell lines of varying histologic proinflammatory activity of membrane-bound FasL (21). Thus, the origins reported to express FasL (8, 32–34). Functional studies membrane-to-soluble FasL ratio may be of vital importance in done in vitro, as well as evidence from in situ studies, indicate that determining the effect of FasL in vivo. Enforced expression of FasL expressed by tumors is functional and able to induce FasL may bypass the normal regulatory controls for expression of apoptosis of lymphocytes present in the tumor microenvironment. this molecule, tipping the balance in favor of inflammation. Too Studies have also shown that disease progression and metastasis little soluble FasL would ensure that any proinflammatory effects is associated with progressively increased expression of FasL of membrane-bound FasL would dominate. Indeed, CMT93 cells (35, 36). Numerous animal studies provide further evidence express both forms of FasL and are not subject to neutrophil- demonstrating the ability of tumor-expressed FasL to down- mediated rejection in vivo. regulate antitumor immune responses. S.c. injection of FasL- In addition, studies have revealed that resident tissue macro- expressing murine melanoma cells into Fas-deficient lpr mutant phages are highly susceptible to FasL-induced apoptosis and the mice resulted in delayed tumor growth compared with wild-type apoptotic demise of these cells preceded neutrophil infiltration mice (37). In addition, FasL-transfected tumor cells triggered the (46). Thus, the sudden introduction of large numbers of FasL- depletion of natural killer cells (38) and an impaired antibody overexpressing cells in mice may trigger excessive apoptosis of response (39) following injection into mice. Moreover, transgenic macrophages present in the allograft microenvironment and the expression of FasL on thyroid follicular cells or stable transfection production of proinflammatory cytokines or chemokines. In of colon tumor cells with FasL resulted in a strong inhibition of contrast, selective pressure during the gradual evolution of a the allospecific cytotoxic response and either a reduction or a spontaneous tumor would ensure that FasL up-regulation would shifting of the alloantibody response toward a Th2 antibody only occur where it would be advantageous to the tumor. Indeed, response (16, 39). The ability of FasL to promote tumor immune our study shows that the physiologic level of FasL found in tumor escape in the face of an active, specific immune response was also cells which endogenously express FasL does not induce shown recently using mice transgenic for the rat HER-2/neu neutrophil infiltration but is still sufficient to delete antitumor oncogene (NEU-TG; refs. 18, 40). These mice develop spontaneous lymphocytes. breast tumors after a first pregnancy. Following immunotherapy, Furthermore, in sites of immune privilege, FasL does not act in some rNEU-TG mice were found to develop late ‘‘escape’’ tumors isolation (47). In the eye, FasL represents only one of at least despite the presence of an rNEU-specific immune response. eight independent mechanisms that function to preclude any Characterization of these escape tumors revealed that they potentially destructive inflammatory responses (48). In addition, continued to express rNEU but had acquired constitutive FasL the tumor microenvironment is an immunosuppressive one. expression, which was associated with apoptosis of infiltrating Tumors can produce a variety of immunoinhibitory cytokines, T lymphocytes in situ. Thus, together, these results provide including transforming growth factor h, IL-10, prostaglandins, and compelling evidence in favor of a role for tumor-expressed FasL in gangliosides, which down-regulate the activity of antitumor immune evasion. immune cells. In such an environment, the anti-inflammatory Much of the controversy surrounding the ‘‘Fas counterattack’’ as and immune down-regulatory activities of tumor-expressed FasL a mechanism of tumor immune evasion stems from transplan- may be favored. tation studies demonstrating that forced overexpression of FasL In conclusion, our results provide for the first time direct in transplants induced accelerated destruction or rejection of the in vivo evidence that tumor-expressed FasL contributes to transplanted organs via recruitment of neutrophils. As a mediator tumor immune evasion. Low levels of FasL led to increased of immune privilege, it was thought that FasL could be used in infiltration of TILs and reduced tumor formation and growth.

Cancer Res 2005; 65: (21). November 1, 2005 9822 www.aacrjournals.org

We have also shown that FasL expression by tumor cells is not Acknowledgments proinflammatory. On the contrary, native FasL expression by Received 4/28/2005; revised 7/26/2005; accepted 8/23/2005. tumor cells is advantageous to tumor development. Because Grant support: Enterprise Ireland, the Wellcome Trust, the Irish Higher FasL is a major inhibitor of antitumor responses, disarming the Educational Authority, the Irish Health Research Board, and Science Foundation ‘‘Fas counterattack’’ may tip the tumor-immune balance in favor Ireland. The costs of publication of this article were defrayed in part by the payment of page of the immune system and ultimately result in improved charges. This article must therefore be hereby marked advertisement in accordance anticancer therapies. with 18 U.S.C. Section 1734 solely to indicate this fact.

References 17. Li XK, Okuyama T, Tamura A, et al. Prolonged mechanism of immune evasion in human colon cancer. survival of rat liver allografts transfected with Fas J Pathol 1998;186:240–6. 1. Ahmad M, Rees RC, Ali SA. Escape from immuno- ligand-expressing plasmid. Transplantation 1998;66: 33. Gastman BR, Atarshi Y, Reichert TE, et al. Fas ligand is therapy: possible mechanisms that influence tumor 1416–23. expressed on human squamous cell carcinomas of the regression/progression. Cancer Immunol Immunother 18. Cefai D, Favre L, Wattendorf E, Marti A, Jaggi R, head and neck, and it promotes apoptosis of T lympho- 2004;53:844–54. Epub 2004 Jun 10. Gimmi CD. Role of Fas ligand expression in promoting cytes. Cancer Res 1999;59:5356–64. 2. Suda T, Takahashi T, Golstein P, Nagata S. Molecular escape from immune rejection in a spontaneous tumor 34. Abrahams VM, Straszewski SL, Kamsteeg M, et al. cloning and expression of the Fas ligand, a novel model. Int J Cancer 2001;91:529–37. Epithelial ovarian cancer cells secrete functional Fas member of the tumor necrosis factor family. Cell 1993; 19. Batteux F, Lores P, Bucchini D, Chiocchia G. ligand. Cancer Res 2003;63:5573–81. 75:1169–78. Transgenic expression of Fas ligand on thyroid follicular 35. Belluco C, Esposito G, Bertorelle R, et al. Fas ligand is 3. Nagata S, Golstein P. The Fas death factor. Science cells prevents autoimmune thyroiditis. J Immunol 2000; up-regulated during the colorectal adenoma-carcinoma 1995;267:1449–56. 164:1681–8. sequence. Eur J Surg Oncol 2002;28:120–5. 4. Brunner T, Wasem C, Torgler R, Cima I, Jakob S, 20. Chervonsky AV, Wang Y, Wong FS, et al. The role of 36. Kase H, Aoki Y, Tanaka K. Fas ligand expression in Corazza N. Fas (CD95/Apo-1) ligand regulation in T cell Fas in autoimmune diabetes. Cell 1997;89:17–24. cervical adenocarcinoma. Relevance to lymph node homeostasis, cell-mediated cytotoxicity and immune 21. Hohlbaum AM, Moe S, Marshak-Rothstein A. Oppos- metastasis and tumor progression. Gynecol Oncol 2003; pathology. Semin Immunol 2003;15:167–76. ing effects of transmembrane and soluble Fas ligand 90:70–4. 5. Griffith TS, Brunner T, Fletcher SM, Green DR, expression on inflammation and tumor cell survival. 37. Hahne M, Rimoldi D, Schroter M, et al. Melanoma Ferguson TA. Fas ligand-induced apoptosis as a J Exp Med 2000;191:1209–20. cell expression of Fas(Apo-1/CD95) ligand: implications mechanism of immune privilege. Science 1995;270: 22. Chen JJ, Sun Y, Nabel GJ. Regulation of the for tumor immune escape. Science 1996;274:1363–6. 1189–92. 6. Bellgrau D, Gold D, Selawry H, Moore J, Franzusoff A, proinflammatory effects of Fas ligand (CD95L). Science 38. Khar A, Varalakshmi C, Pardhasaradhi BV, Mubarak Duke RC. A role for CD95 ligand in preventing graft 1998;282:1714–7. Ali A, Kumari AL. Depletion of the natural killer cell rejection. Nature 1995;377:630–2. 23. Aubry JP, Blaecke A, Lecoanet-Henchoz S, et al. population in the peritoneum by AK-5 tumor cells 7. O’Connell J, O’Sullivan GC, Collins JK, Shanahan F. The Annexin V used for measuring apoptosis in the early overexpressing fas-ligand: a mechanism of immune Fas counterattack: Fas-mediated T cell killing by colon events of cellular cytotoxicity. Cytometry 1999;37: evasion. Cell Immunol 1998;189:85–91. cancer cells expressing Fas ligand. J Exp Med 1996;184: 197–204. 39. Arai H, Chan SY, Bishop DK, Nabel GJ. Inhibition of 1075–82. 24. Freiberg RA, Spencer DM, Choate KA, et al. Fas the alloantibody response by CD95 ligand. Nat Med 8. Niehans GA, Brunner T, Frizelle SP, et al. Human lung signal transduction triggers either proliferation or apop- 1997;3:843–8. carcinomas express Fas ligand. Cancer Res 1997;57: tosis in human fibroblasts. J Invest Dermatol 1997;108: 40. Cefai D, Schwaninger R, Balli M, Brunner T, Gimmi 1007–12. 215–9. CD. Functional characterization of Fas ligand on tumor 9. Song E, Chen J, Ouyang N, Su F, Wang M, Heemann U. 25. Desbarats J, Newell MK. Fas engagement accelerates cells escaping active specific immunotherapy. Cell Soluble Fas ligand released by colon adenocarcinoma liver regeneration after partial hepatectomy. Nat Med Death Differ 2001;8:687–95. cells induces host lymphocyte apoptosis: an active mode 2000;6:920–3. 41. Ke B, Coito AJ, Kato H, et al. Fas ligand gene transfer of immune evasion in colon cancer. Br J Cancer 2001; 26. Houston A, Bennett MW, O’Sullivan GC, Shanahan F, prolongs rat renal allograft survival and down-regulates 85:1047–54. O’Connell J. Fas ligand mediates immune privilege anti-apoptotic Bag-1 in parallel with enhanced Th2- 10. Krammer PH. CD95’s deadly mission in the immune and not inflammation in human colon cancer, type cytokine expression. Transplantation 2000;69: system. Nature 2000;407:789–95. irrespective of TGF-h expression. Br J Cancer 2003;89: 1690–4. 11. Bennett MW, O’Connell J, O’Sullivan GC, et al. The 1345–51. 42. Seino K, Kayagaki N, Okumura K, Yagita H. Fas counterattack in vivo: apoptotic depletion of tumor- 27. Reichert TE, Strauss L, Wagner EM, Gooding W, Antitumor effect of locally produced CD95 ligand. Nat infiltrating lymphocytes associated with Fas ligand Whiteside TL. Signaling abnormalities, apoptosis, and Med 1997;3:165–70. expression by human esophageal carcinoma. J Immunol reduced proliferation of circulating and tumor-infiltrat- 43. Abreu-Martin MT, Vidrich A, Lynch DH, Targan SR. 1998;160:5669–75. ing lymphocytes in patients with oral carcinoma. Clin Divergent induction of apoptosis and IL-8 secretion in 12. Okada K, Komuta K, Hashimoto S, Matsuzaki S, Cancer Res 2002;8:3137–45. HT-29 cells in response to TNF-a and ligation of Fas Kanematsu T, Koji T. Frequency of apoptosis of tumor- 28. Liles WC, Kiener PA, Ledbetter JA, Aruffo A, Klebanoff antigen. J Immunol 1995;155:4147–54. infiltrating lymphocytes induced by fas counterattack in SJ. Differential expression of Fas (CD95) and Fas ligand 44. Shimada M, Andoh A, Araki Y, Fujiyama Y, Bamba T. human colorectal carcinoma and its correlation with on normal human phagocytes: implications for the Ligation of the Fas antigen stimulates chemokine prognosis. Clin Cancer Res 2000;6:3560–4. regulation of apoptosis in neutrophils. J Exp Med 1996; secretion in pancreatic cancer cell line PANC-1. J Gastro- 13. Chen CM, Song W, Kao JY, Zheng QD, Chen JJ. 184:429–40. enterol Hepatol 2001;16:1060–7. Expression of Fas ligand is not a main mechanism used 29. Restifo NP. Not so Fas: re-evaluating the mechanisms 45. Mariani SM, Matiba B, Baumler C, Krammer PH. by tumors to counteract antitumor immunity. Front of immune privilege and tumor escape. Nat Med 2000;6: Regulation of cell surface APO-1/Fas (CD95) ligand Biosci 2004;9:448–56. 493–5. expression by metalloproteases. Eur J Immunol 1995;25: 14. Kang SM, Schneider DB, Lin Z, et al. Fas ligand 30. O’Connell J, Houston A, Bennett MW, O’Sullivan GC, 2303–7. expression in islets of Langerhans does not confer Shanahan F. Immune privilege or inflammation? In- 46. Hohlbaum AM, Gregory MS, Ju ST, Marshak- immune privilege and instead targets them for rapid sights into the Fas ligand enigma. Nat Med 2001;7: Rothstein A. Fas ligand engagement of resident perito- destruction. Nat Med 1997;3:738–43. 271–4. neal macrophages in vivo induces apoptosis and the 15. Takeuchi T, Ueki T, Nishimatsu H, et al. Accelerated 31. CardiG,HeaneyJA,SchnedAR,ErnstoffMS. production of neutrophil chemotactic factors. J Immu- rejection of Fas ligand-expressing heart grafts. J Im- Expression of Fas(APO-1/CD95) in tumor-infiltrating nol 2001;167:6217–24. munol 1999;162:518–22. and peripheral blood lymphocytes in patients with renal 47. Niederkorn JY. Mechanisms of immune privilege in 16. Tourneur L, Malassagne B, Batteux F, et al. Trans- cell carcinoma. Cancer Res 1998;58:2078–80. the eye and hair follicle. J Investig Dermatol Symp Proc genic expression of CD95 ligand on thyroid follicular 32. O’Connell J, Bennett MW, O’Sullivan GC, et al. Fas 2003;8:168–72. cells confers immune privilege upon thyroid allografts. ligand expression in primary colon adenocarcinomas: 48. Ferguson TA, Green DR. Fas-ligand and immune J Immunol 2001;167:1338–46. evidence that the Fas counterattack is a prevalent privilege: the eyes have it. Cell Death Differ 2001;8:771–2.

www.aacrjournals.org 9823 Cancer Res 2005; 65: (21). November 1, 2005

Downloaded from cancerres.aacrjournals.org on September 28, 2021. © 2005 American Association for Cancer Research. Addressing the ''Fas Counterattack'' Controversy: Blocking Fas Ligand Expression Suppresses Tumor Immune Evasion of Colon Cancer In vivo

Aideen E. Ryan, Fergus Shanahan, Joe O'Connell, et al.

Cancer Res 2005;65:9817-9823.

Updated version Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/65/21/9817

Cited articles This article cites 48 articles, 19 of which you can access for free at: http://cancerres.aacrjournals.org/content/65/21/9817.full#ref-list-1

Citing articles This article has been cited by 7 HighWire-hosted articles. Access the articles at: http://cancerres.aacrjournals.org/content/65/21/9817.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/65/21/9817. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.