The American University in Cairo

School of Sciences and Engineering

Genetic Diversity Comparison among Invasive Fish Populations (Nemipterus randalli and Serranus cabrilla) from Mediterranean and Red Sea Coastal Wa-

ters using Cytochrome c Oxidase Subunit I (COI)

A Thesis Submitted to

The Department of Biology

in partial fulfilment of the requirements for the degree of a Master of Science in

Biotechnology

by Joel Ogwang

under the supervision of Dr. Arthur Bos Dec. /2018

DEDICATION This thesis is dedicated to my parents, my mother Lily Awor and my late father Vitorino Ocen, and my siblings. I also dedicate this work to Mr. Alfred A. Olwit and his family. I con- sider Alfred more of a father than guardian because of his unwavering effort to support my academic journey.

ACKNOWLEDGMENTS My supervisor, Dr. Arthur Bos was immensely supportive from the inception of this project and his effort never wavered at any point. Dr. M. Bariche (AUB) contributed samples from Lebanon. Dr. Ahmed Moustafa (AUC) provided invaluable support in the initial molecular analyses of this work. Mr. Amged Aouf (AUC) provided initial technical input to kick-start this project and handled most procurement related to this work. The laboratory attendants, Zain and Mohamed were immensely helpful. My friends offered a helping hand in the lab: Youssef, Mariam, Muziri, Eric Zadok, Yomna Moqidem, to mention a few. I am also grateful to the African Graduate Fellowship for the opportunity to conduct my graduate study in AUC. Finally, this work would have been impossible without the AUC Graduate Research Grant.

iii

Genetic Diversity Comparison among Invasive Fish Populations (Nemipterus randalli and Serranus cabrilla) from Mediterranean and Red Sea Coastal Wa- ters using Cytochrome c Oxidase Subunit I (COI)

Joel Ogwang1 | AR Bos2

ABSTRACT Since the Suez Canal connected the Red Sea with the Mediterranean, several fish species have migrated between the two seas. Nemipterus randalli has crossed from the Red Sea to the Mediterranean (Lessepsian migration) whereas Serranus cabrilla is considered to have crossed in the reverse direction (anti-Lessepsian migration). Genetic variation between populations of these fish species on either side of the Suez Canal might provide valuable information on their patterns of migration. In this study, 600 bp of cytochrome c oxidase subunit I (COI) sequences were used to compare genetic diversity of populations of N. randalli from the eastern Mediterranean with a population off the Red Sea coast near Hurghada, Egypt. For comparison, three other Nemipterus species were included. Similarly, genetic diversity of Serranus cabrilla from the Gulf of Suez was compared with populations in the eastern Medi- terranean Sea. A Maximum Likelihood (ML) tree was constructed using Molecular Evolu- tionary Genetics Analysis version 7 (MEGA7) software to visualize the evolutionary relationships of S. cabrilla and Nemipterus species of the two seas. Population structures of N. randalli and S. cabrilla were assessed by constructing haplotype networks using PopART. Results from COI sequence divergence analysis revealed possible existence of cryptic species of N. bipunctatus in the Red Sea. Although the ML tree resolved Nemipterus species into four clades representing the four species analyzed, all N. randalli sequences from both seas formed a single clade. Genetic diversity analysis revealed that Mediterranean populations of N. randalli share one haplotype from the Red Sea and supported unidirectional multiple invasion events from the Red Sea to the Mediterranean Sea. Meanwhile, S. cabrilla sequences formed two phylogenetic clades representing the Gulf of Suez and eastern Mediterranean Sea populations. S. cabrilla from the Gulf of Suez also had a significantly reduced sequence divergence compared to Mediterranean Sea populations. In addition, none of the 17 haplotypes in the Mediterranean Sea was found among the 12 haplotypes in the Gulf of Suez. Together, these results provided evidence that the S. cabrilla population in the Gulf of Suez did not come from the Mediterranean Sea through the Suez Canal as was previously thought. Ac- cording to these results, reported cases of invasion on either side of the Suez Canal should be followed by genetic investigations on a species-by-species basis.

Keywords – anti-Lessepsian migration, COI, haplotype diversity, invasive species, Les- sepsian migration, Nemipterus randalli, nucleotide diversity, Serranus cabrilla.

1Graduate student, Department of Biology, the American University in Cairo 2Supervisor and Chair, Department of Biology, the American University in Cairo

TABLE OF CONTENTS List of Figures………………………....………………....………………...…….…………...vi List of Tables...…………………………………..……………………………….………….vii Introduction……………………..……………………………….…………………………….1 1.0 Literature Review………..……………………..………….…………..……………….….3 1.1 Lessepsian versus anti-Lessepsian Migration ……………………….……..…….……….3 1.2 Nemipterus randalli as a Lessepsian Migrant...…………………..….…………..………..4 1.3 Serranus cabrilla as an anti-Lessepsian migrant……...…………………...…...... ….... 5 1.4 Hypotheses……………………………………...…..…………………..……………...….6 1.5 Study Aims and Objectives…………………………..…………...…………....…….……7 2.0 Experimental Design and Methods……………..…………………..……..………………8 2.1 Sample Collection and Handling………..………...…………...….……...…..…..……..…9 2.2 DNA extraction…..……………...…………...... ………..…………..……………..…...…9 2.3 Polymerase Chain Reaction (PCR) and Cycle Sequencing….…….….…...……....……..10 3.0 Data Analysis…………..………………………….……...…………………….………..11 3.1 Species Identification………………………………………………………...…...... ……11 3.2 DNA Barcoding…………………………………………………………………………..11 3.3 Metric Analysis……………………………………………………………….………….14 3.4 Molecular Evolutionary Analysis…………………….…...…………………………..….16 4.0 Results……..………….………………………...……………………………………..…19 4.1 Length-weight relationships……………………………………………….……………..19 4.2 Molecular Evolutionary Relationships………………………………………….………..22 5.0 Discussion …………………..………………………...…..……………….…………… 31 5.1 Evolutionary Relationships………………………………………………………………31 5.1.1 Phylogenetic Relationships: DNA Barcoding Perspective……………….……………31 5.1.2 Genetic Diversity………………………………………………………………………32 5.2 Length-weight relationships (LWRs)………………………………………...…………..35 6.0 Conclusion………………………... ………………..……………….………………….. 37 Declaration of Interest…………………………………………...…...………………………39 I References……………………………………………...………………...... I II Appendix…………………………………...…………………....…………….....……….XV

LIST OF FIGURES

Figure 1.0: Relationship between different players in the invasion process…………………..3

Figure 1.3: Geographical distribution of Serranus cabrilla……………………………….…..6

Figure 2.1: Map of the eastern Mediterranean and northern Red Sea………………………....9

Figure 3.1: Morphological Identities of Nemipterus spp. and Serranus cabrilla……….....…11

Figure 3.2: Schematic DNA Barcoding Pipeline…………………………………….………13

Figure 3.3.1: Metric Measurements of Fish………………………………………………….15

Figure 3.3.2: Length frequency distribution plots……………………………………………15

Figure 4.1.1: LWRs of four Nemipterus species……………………………………………..21

Figure 4.1.2: LWRs of Serranus cabrilla…………………………………...……………….22

Figure 4.2.1: Intraspecific COI sequence divergence within groups of Nemipterus spp. ...…23

Figure 4.2.2: Intraspecific COI sequence divergence within groups of Serranus cabrilla…..26

Figure 4.2.3: Maximum Likelihood tree for Nemipterus species…………………………….24

Figure 4.2.4: Maximum Likelihood tree for Serranus cabrilla…………………………...…27

Figure 4.2.5: Haplotype Network of Nemipterus species………………………………..…..29

Figure 4.2.6: Haplotype Network of Serranus cabrilla…………………………….………..30

LIST OF TABLES

Table I: LWR parameters of Nemipterus species and Serranus cabrilla………………….…19

Table II: Empirical LWR lengths of Nemipterus spp. and Serranus cabrilla………….….....20

Table III: Percentage COI sequence divergence between groups of Nemipterus species…....23

Table IV: Percentage COI sequence divergence between groups of Serranus cabrilla…..…26

Table V: Genetic Diversity of Nemipterus randalli…………………………………….……28

Table VI: Genetic Diversity of Serranus cabrilla…………………………………….……...30

vii

Introduction

Invasive species are nonnative species that are introduced from other geographical locations mainly through travel and trade. Their widespread occurrences demand international inter- vention (Funk, 2015). Economically, they have been reported to cause damages worth bil- lions of dollars (Pimentel et al., 2000). For instance, they are responsible for significant ecological shifts in the Mediterranean (Belmaker et al., 2013) including a decline in native species; for example, the lionfish Pterois volitans feeds on and thus reduces the density of her- bivorous fish resulting in algal bloom that consequently affects the functioning of coral reefs

(Hall-Spencer & Allen, 2015). Additionally, a recent analysis of freshwater fish catch data for the past three decades indicates that native fish species are on the decline whereas populations of some invasive species are expanding (Mueller, & Geist, 2018). Worse still, the harmful effects of invasive species are expected to dramatically increase in the wake of increasing oceanic carbon dioxide levels due to climate change, with more adapted yet harmful species likely to phase out the less adapted ones (Hall-Spencer & Allen, 2015). Moreover, these harmful effects could worsen given the recent finding of a likely positive feedback mechanism where by one invasion reinforces another like a ripple effect (DiGiacopo et al., 2018).

The ability of invasive species to evolve rapidly in response to environmental stress in their new environment makes them even more problematic. For instance, genome scans of the ‘Lessepsian sprinter’ Fistularia commersonii revealed that several outlier genes, which might be under positive selection, are related to disease and osmotic homeostasis (Bernardi et al., 2016). In addition, recent works have demonstrated epigenetic contribution to the rapid local adaptation of invasive species in their new habitats (Ardura et al., 2018; Hawes et al.,

2018). Furthermore, the process of invasion itself involves an array of factors (Fig. 1) (Parker et al., 2003) and thus invasive species are widely regarded as one of the major threats to the

conservation of biodiversity (Funk, 2015; Mack et al., 2000). Therefore, studies which em- ploy other genetic markers, epigenetic studies (e.g. (Ardura et al., 2018; Hawes et al., 2018)) and genomic studies (e.g. (Bernardi et al., 2016)) will be invaluable for unravelling the genetic basis of rapid adaptation of invasive species.

In order to understand patterns of invasion, recent studies have compared genetic variation of invasive species in their new environments with genetic variation of respective source populations. In some cases the invaders have reduced genetic variation (Daniel Golani et al.,

2007; Tsutsui et al., 2000), while some indicate an increase in genetic variation (e.g.(Kolbe et al., 2004)), whereas others show there is hardly any change in genetic variation (Azzurro et al., 2006). In this study, genetic variation within and between the Red Sea/Suez and Mediter- ranean populations of two invasive fish species – Nemipterus randalli and Serranus cabrilla; the former species entered the Mediterranean Sea from the Red Sea through the Suez Canal

(Lelli et al., 2008) whereas the latter is considered to have migrated in the reverse direction

(Por, 1978) – will be examined. The study will also include genetic variation of three other

Nemipterus species from the Egyptian southern Red Sea coast of Hurghada.

Figure 1.0: Relationship between elements that shape the invasion process. Outcrossing leads to increased genetic diversity within independent populations or foci; gene flow between independent introduced populations leads to rapid adaptation. Clonal breeding promotes inheritance of stress tolerance in the invasive populations (Parker et al., 2003).

1.0 Literature Review

1.1 Lessepsian versus anti-Lessepsian Migration

The opening of the Suez Canal, under the supervision of the French engineer Ferdinand de

Lesseps, connected the Red Sea to the Mediterranean Sea in 1869. This was immediately followed by an unprecedented movement of species northwards from the Red Sea into the Medi- terranean (Lessepsian migration) as well as southwards from the Mediterranean into the Red

Sea (anti-Lessepsian migration) (Golani, 1998; Por, 1978). The former type of migration involves invasion of the Mediterranean by Red Sea species, the majority of which are of Indo-

Pacific origin (Galil, 2009; Por, 1978), and represent organisms including jellyfish (Spanier

& Galil, 1991) and fish (Bariche & Fricke, 2018; Mavruk & Avsar, 2008). Anti-Lessepsian

migration meanwhile, is limited in scope and performed by fewer organisms, including fish species such as the recently reported variable-lined fusilier Caesio varilineata (Bos & Og- wang, 2018), although most acclaimed non-fish anti-Lessepsian migrants are thought to have hitchhiked on ships en route to Suez through the Suez Canal (Por, 1978).

The predominantly unidirectional migration of fish species through the Suez Canal has been attributed to hydrological factors – a gradient which facilitates water flow northwards from the Red Sea to the Mediterranean for most of the year – and a higher salinity of Red Sea that presents establishment challenges to species adapted to the less saline Mediterranean.

Additionally, the Red Sea has a high species richness and offers limited ecological niches for new migrants (Chanet et al., 2012). However, it has been found that success of Lessepsian migrants in the Mediterranean Sea is highly dependent on the ecological makeup of its native habitat (Red Sea) with higher Sea surface temperature, large range size and schooling tenden- cies argued as being major prerequisite factors for successful introduction (Belmaker et al.,

2013).

1.2 Nemipterus randalli as a Lessepsian Migrant

Among fishes, two species of the genus Nemipterus (family Nemipteridae) have been reported to have crossed from the Red Sea to the Mediterranean through the Suez Canal: N. japonicus (ElHaweet, 2013; Rizkalla et al., 2016) and N. randalli (Lelli et al., 2008). Nemipteridae is a family of demersal fishes that are brightly colored and feed on a variety of benthic fauna.

Commonly referred to as Breams, nemipterids have moderate sizes and have been categorized into at least 67 species belonging to five genera. They are endemic to the Indo-West

Pacific region (Froese & Pauly, 2018; Russel, 1990).

In Egypt, eleven species of the genus Nemipterus are known from the Red Sea (Froese

& Pauly, 2018; Russel, 1990). Nemipterus species are important food items in the Indo-West

Pacific and N. japonicus, particularly, is a famous component of surimi industrial products

(Sen et al., 2014). Due to the economic importance of these fishes, they are often exposed to overexploitation (Joshi, 2010; Murty et al., 2003). In the Gulf of Suez, most of the Nemipter- us spp. populations assessed were found to be overfished (El-Ganainy et al., 2018). Similarly, the N. japonicus population from Abu-Qir in Alexandria, Egypt, was reported to have slower growth and shorter longevity compared to the native Indian Ocean population, possibly a result of recent establishment or overfishing (ElHaweet, 2013).

Much is known about the biology and new occurrences of Nemipterus randalli populations in the Mediterranean Sea (Aydin et al., 2017; ElHaweet, 2013; Kalhoro et al., 2017;

Rizkalla et al., 2016; Stern N. et al., 2014) but how they vary genetically from the source population (Red Sea) has yet to be studied. Genetic studies of other Lessepsian species have revealed different patterns of genetic variation between populations of invaders and populations in the native habitat (Azzurro et al., 2006; Golani et al., 2007) signifying the need for a case by case study of other Lessepsian migrants.

1.3 Serranus cabrilla as an anti-Lessepsian Migrant

Another fish species, Serranus cabrilla, has been suggested to have migrated from the Medi- terranean Sea to the Red Sea (Ben-Tuvia, 1971; Golani, 1999). Serranus cabrilla (Family

Serranidae) is a relatively small grouper commonly found in rocky bottoms of the Mediterra- nean Sea at a depth range of 5 – 70 m. Also demersal by lifestyle, its biogeographical distribution ranges from the Cape of Good Hope through to Natal and Azores, Madeira, the Ca- nary Islands, the Mediterranean and western Black Sea (Heemstra, 2012; Tortonese, 1986) and a native population of this species in Egypt has also been documented (Hureau, 1991)

(Fig. 1.3). Unlike Lessepsian migration which has received considerable attention, genetic studies on anti-Lessepsian migrants on the contrary are few and rather limited in scope and thus requires further inquiries (Chanet et al., 2012). Studies of Mediterranean Sea populations of Serranus cabrilla have shown considerable levels of gene flow (Schunter et al., 2011; Vel- la & Vella, 2016) but the genetic connection between the Suez (Red Sea) and the Mediterra- nean populations has never been considered. Such a study might shed light on the contentious question of whether or not S. cabrilla is an actual anti-Lessepsian migrant (Por, 1978).

Figure 1.3: Geographical distribution of Serranus cabrilla. Source: https://www.gbif.org/species/2388710.

1.4 Hypotheses

Nemipterus species

H0: Genetic variability of N. randalli populations in the Red Sea and the Mediterranean is the same.

H1: Genetic variability of N. randalli populations in the Red Sea and the Mediterranean is different.

Serranus cabrilla

H0: Genetic variability of S. cabrilla populations in the Gulf of Suez and Mediterranean Sea is the same.

H1: Genetic variability of S. cabrilla populations is different between the Gulf of Suez and

Mediterranean Sea.

1.5 Study Aims and Objectives

The main aim of this study is to analyze the genetic diversity within and among Nemipterus species and Serranus cabrilla populations from the Mediterranean and Red Sea coasts of

Egypt and some neighboring countries.

The above aim will be achieved through the following specific objectives:

i. Conducting a metric analysis and traditional taxonomic identification of several whole

specimen representatives of Nemipterus species and Serranus cabrilla

ii. Constructing a phylogenetic tree to visualize evolutionary relationships of Nemipterus

species and Serranus cabrilla populations between the two seas iii. Assessing population structures of Nemipterus randalli and Serranus cabrilla by

comparing haplotype diversity and nucleotide diversity in the Red Sea/Suez and Med-

iterranean Sea iv. Comparing results with genetic data of populations from the wider Indo- West Pacific

and Mediterranean Sea

2.0 Experimental Design and Methods

2.1 Sample Collection and Handling

Twenty-three (23) Nemipterus randalli, twelve N. japonicus, twenty N. bipunctatus and two

(2) N. zysron were acquired from fishing sites in Hurghada from the Red Sea and twenty-two

(22) N. randalli were obtained from the Mediterranean Sea port of Abu Qir in Alexandria.

For comparison, ten (10) N. randalli samples (gill rakers only) were availed from the Leba- nese Mediterranean Sea coast.

Forty (40) Serranus cabrilla specimens were initially collected from Suez (Red Sea) and two (2) others were caught by fishing rods in Ain Sokhna (Red Sea) in 2014. Mediterra- nean S. cabrilla samples (gill rakers only) were availed from Cyprus (5 samples) and Leba- non (15 samples) for comparison. All samples were transported to the American University in

Cairo Department of Biology and stored in a freezer at -20°C.

Locations where specimens were collected are shown (Fig. 2.1). Of particular importance is the Gulf of Suez, a transitory habitat for Lessepsian migrants (Golani, 1971). Abu

Qir (a Mediterranean coastal port in Alexandria, Egypt) and Mediterranean Sea coasts of Cy- prus and Lebanon are representative of the recipients of Lessepsian migrants (Aydin et al.,

2017; ElHaweet, 2013; Golani, 1999) whereas Hurghada represents the mainstream Red Sea habitat, the native habitat of Red Sea fishes.

Figure 2.1: Map of the eastern Mediterranean and northern Red Sea showing five locations where study specimens were collected: Abu Qir in Alexandria, Egypt; Suez, Egypt, Hurgha- da, Egypt; Cyprus; Lebanon. Credit: Google Maps.

2.2 DNA extraction

Genetic material was collected from all specimens. DNA extraction was done following column adsorption protocol, a method that is faster than traditional alkaline or CTAB DNA extraction (Tan, 2009). Accordingly, QIAmp® DNA Mini Kit (Cat. No.: 51304) from Qiagen was used for DNA extraction following the manufacturer’s protocol. All centrifugation was done at 8000 rpm unless otherwise specified.

Briefly, 18 – 50 mg of gill raker or muscle tissue initially stored in 98% ethanol at -20

°C was incubated with intermittent vortexing in ATL and Proteinase K at 56°C until com- plete lysis. Buffer AL (~4M Guanidium Hydrochloride (GuHCl); Sodium Dodecyl Sulfate

(SDS)) was added and the lysate incubated at 70°C for 10 minutes. The lysate was then load- ed onto QIAmp® mini spin column and centrifuged; DNA bound to the silica column whereas cellular debris passed through the column matrix. Proteins and other contaminants from the column were washed with low GuHCl-containing buffer AW1 by centrifugation for 1 mi-

nute and residual GuHCl washed over with buffer AW2 (containing 70% ethanol) by centrifugation at full speed (13 200 rpm) for 3 minutes. The bound DNA was eluted in AE buffer

(10 mM Tris·Cl; 0.5 mM EDTA; pH 9.0) into a clean collecting tube. The optical density of each DNA sample was measured on a Nanodrop machine and its integrity checked on 1% agarose gel. The purified DNA was finally stored at -20 °C.

2.3 Polymerase Chain Reaction (PCR) and Cycle Sequencing

MyTaq™ DNA Polymerase (Cat No.: BIO-21105) was use to amplify COI sequences using the forward primer FishF1: TCAACCAACCACAAAGACATTGGCAC and the reverse primer

FishR1: TAGACTTCTGGGTGGCCAAAGAATCA primers (Ward et al., 2005). Each PCR reaction had a total volume of 25 µl and consisted of 5 µl MyTaq™ Red DNA Reaction Buffer,

1µl of 10µM concentration of forward and reverse primer, 0.5 µl of DNA polymerase, varying volumes of template DNA equivalent to 0.25 – 1 µg DNA and the rest of the volume was topped up with nuclease-free water. Cycling conditions were set as follows: 95°C for initial denaturation (5 minutes), and 35 cycles of 95°C (30 seconds), 45°C (45 seconds), 72°C (1 minute), a final extension at 72°C (7 minutes) and a final hold at 4°C, following Bos (2014).

Five microliters of each finished reaction was run of 1% agarose gel to visualize COI bands.

Samples with clear bands were cleaned using Qiagen’s MinElute™ PCR Purification

Kit (Cat. No.: 28004) and the pure products checked on 1% agarose gel (gel images in Ap- pendix Fig. S) before storage at -20°C. The purified PCR products were sent for cycle sequencing to Macrogen Inc., South Korea.

3.0 Data Analysis

3.1 Species Identification

Each Nemipterus fish was identified according to traditional taxonomy (Randall & Heemstra,

1991) (Fig. 3.1). Morphological identification of Nemipterus species is challenging, for instance, N. randalli has previously been misidentified as N. japonicus (Lelli et al., 2008). Con- sequently, Nemipterus spp. have been referred to by various common names (Tesfamichael &

Saeed, 2016). In Egypt for instance, they are generally referred to as ‘Morgan sari’ along the

Red Sea coast. Moreover, it is not surprising that new species have recently been discovered and described (Bineesh et al., 2018; Nakamura et al., 2018; Russell & Ho, 2017). According- ly, reliance on inconspicuous morphological features for accurate species identification is not only insufficient, often resulting in misidentification and far reaching implications on commercially traded fish and other sea foods (Changizi et al., 2013; Nagalakshmi et al., 2016;

Sultana et al., 2018).

3.2 DNA Barcoding

To counter the above challenges, traditional species identification was followed by the DNA- barcoding approach (Hebert et al., 2003). Besides being able to identify fragmented specimens and difficult-to-identify life stages, the barcoding approach offers further advantages including stability of DNA and ease of reproducibility of DNA-based experimental approaches unlike traditional taxonomy which relies on extensive expertise and experience

(Hanner et al., 2005; Ward et al., 2009).

Figure 3.1: Morphological identities of four Nemipterus species (A – D) and S. cabrilla (E). Pictures of Nemipterus species have accompanying pictures of dorsal fin (top right) and anal fin (bottom right); (A) N. randalli, (B) N. japonicus, (C) N. zysron, (D) N. bipunctatus.

Briefly, DNA barcoding relies on fairly standard sequences of genes or gene regions

(markers – also barcodes) to detect sequence divergence between specimens, leading to their identification or discovery at species level (Hebert et al., 2003). Generation of barcodes involves several partners starting with field collection of samples through to various end users

(Fig. 3.2). Recently, the use of DNA barcoding has expanded to, among other things, study species diversity and/or interspecific interactions (Al-Rshaidat et al., 2016; Roslin et al.,

2016) and to study invasive species (Xu et al., 2018).

The choice of the marker to use as for DNA barcoding is crucial. Ideally, barcoding markers should be short enough to be amenable to current DNA amplification and sequenc-

ing techniques, conserved enough to reveal species-level diagnostic characteristics and they should show homoplasy at minimum degrees (Kress & Erickson, 2008; Rach et al., 2017).

For animals, both vertebrates and invertebrates, 650 base pairs of cytochrome c oxidase subunit I (COI) gene has been widely employed (Waugh, 2007), as primers that amplify this region across phyla are available (da Silva et al., 2011; Vrijenhoek et al., 1994). COI is a mitochondrial gene that encodes the catalytic unit of cytochrome c oxidase, an enzyme which acts as the terminal electron receptor in aerobic respiratory chain (García-Horsman et al., 1994).

Other mitochondrial genes used in DNA barcoding include cytochrome b and 16S ribosomal

DNA sequences (Baharum & Nurdalila, 2012).

Figure 3.2: Schematic DNA barcoding pipeline

Generally, preference for mitochondrial DNA (mtDNA) for barcoding animals is based on several reasons. Firstly, mtDNA is maternally inherited as a haploid genotype; thus it does not undergo recombination, except in cases of paternal leakage and heteroplasmy (Gyllensten et al., 1991; Sutherland et al., 1998). Secondly, mtDNA is present as many copies per cell, guaranteeing sufficient DNA extract even with a very small tissue sample. Additionally, ani-

mal mtDNA evolves faster than nuclear DNA, arguably due to error prone replication exas- perated by strand switching, propensity to change in codon sequences and high turnover of transfer RNA (tRNA) in mitochondria (Xia, 2012).

3.3 Metric Analysis

Metric analysis in the form of length-weight relationships (LWRs) have been used for decades in commercial fisheries management. They are described by the equation 푊 = 푎퐿푏 where W is the weight of the fish, a is the coefficient of the arithmetic LWR and b is the exponent (Keys, 1928). The LWR equation relates the proportionate change in weight relative to length and is useful for biomass estimations of fish samples for which only length is known. In respect to growth, a value of parameter b = 3 indicates isometric growth whereas values different than 3 represents allometric growth. In addition, plotting log a against b for a species with many LWRs can be employed to identify outlier LWRs for the said species in a particular ecosystem; this could be a result of misidentification of a closely related species

(Froese, 2006).

In this study, metric analysis was done using GraphPad Prism (Swift, 1997) by applying a confidence limit of 0.05. For both Nemipterus species and S. cabrilla, three linear measurements (in cm) were done to the nearest tenth: standard length (SL), total length (TL) and fork length (FL) (Fig. 3.3.1) in addition to wet weight (g). These measurements excluded samples from Lebanon and Cyprus as they were gill rakers only. A scatter plot was used to test the regression of weight onto length (TL) according to the arithmetic length-weight equation: 푊 = 푎퐿푏. Lengths of Nemipterus spp. and S. cabrilla were grouped using frequency histograms.

Figure 3.3.1: Metric measurements of fish showing standard length (SL), fork length (FL) and total length (TL). Modified from Fishbase: https://www.fishbase.de/summary/FamilySummary.php?ID=324.

Several fish lengths, particularly length at first maturity (Lm), length at maximum possible yield per recruit (Lopt) and asymptotic length (Linf) are extremely useful for commercial stock management. Empirical formulas for calculating them have been derived. For example, the length-frequency distribution in Fig. 3.3.2 shows the difference between a sustainably exploited stock and an unfished stock (Froese & Binohlan, 2000).

Figure 3.3.2: Length frequency distribution plots. Left: sustainable fish harvesting; most of the catch samples to have lengths falling between Lm and Lopt. Right: unfished stock; a large proportion of the stock specimens have lengths below Lm (Froese & Binohlan, 2000).

Despite the usefulness of LWRs in fisheries management, few studies, only in Suez, have focused on Nemipterus spp. in the Egyptian Red Sea coastal waters (e.g. Amine, 2012;

El-Ganainy et al., 2018), and none on Nemipterus randalli or Serranus cabrilla (Family Ser- ranidae). The current study will supplement previous ones on the Japanese threadfin bream

(Nemipterus japonicus) and Nemipterus bipunctatus by providing LWRs from the coast of

Hurghada. In addition, the study will also provide new LWRs for Randall’s threadfin bream

(Nemipterus randalli) from the same location and for S. cabrilla from Suez.

Asymptotic length (L∞), length at first maturity (Lm) and length at maximum possible yield per recruit (Lopt) were calculated according to the following empirical equations (Froese

& Binohlan, 2000):

퐿∞ = 100.044+0.9841푙표푔퐿푚푎푥…………………...…………….....………..……...………….(1)

where Lmax is the length (TL) of the largest observed fish in the study area and L∞ is

asymptotic length, the length that the fish would reach if allowed to grow indefinitely.

퐿푚 = 100.8979푙표푔퐿∞−0.0782………………..…………………...…………………………….(2)

where Lm is the length at first maturity.

퐿표푝푡 = 101.0421 푙표푔퐿∞−0.2742………………………………..………………………………(3)

where Lopt is the length that gives the maximum yield of catch.

3.4 Molecular Evolutionary Analysis

The analysis involved 95 COI sequences (600 bp): 51 COI sequences of four species of the genus Nemipterus (family Nemipteridae) and a further 40 sequences of S. cabrilla (family

Serranidae). Forward and reverse sequences (ab1 format) of COI of each fish sample were merged into one sequence using Fragment Merger, an online platform, to complement any gaps in either sequence (Bell & Kramvis, 2013). The concatenated sequences were aligned online on MAFFT platform which also allows enhanced interaction with the input sequences

(Katoh et al., n.d.; Kuraku et al., 2013) and permits visualization of a guide phylogenetic tree

(Robinson et al., 2016). The aligned sequences were checked for redundancy and curated by eye (Li et al., 2001; Yachdav et al., 2016). For comparison, the 91 COI sequences analyzed included eleven sequences (Supplementary Table S) from Genbank were; N. japonicus (1) and N. bipunctatus (1) from Saudi Arabia, and S. cabrilla from Israel (5) and Turkey (3).

Alignment segments are shown in the appendix (Fig. S2 and Fig. S3).

Distance analysis was conducted in Molecular Evolutionary Genetics Analysis (MEGA version 7.0.26, hereafter referred to as MEGA7) (Kumar et al., 2016) by applying the appro- priate nucleotide substitution model (Collins et al., 2012). For both Nemipterus spp. and S. cabrilla, Kimura 2-parameter model (Kimura, 1980) was the most suitable. All positions containing gaps and missing information were deleted. Sequences were grouped according to geographical origin and evolutionary divergence, a measure of the number of base substitutions per site from between sequences, within and between groups calculated. When applica- ble, significance of sequence divergence between populations was computed by applying a single sample T-test in GraphPad Prism (Swift, 1997). To visualize evolutionary relationships, phylogenetic trees were constructed from the multiple alignment by Maximum Likeli- hood (ML) method through inferring initial trees using Maximum Parsimony method as applied in MEGA7 using MEGA7 software (Kumar et al., 2016).

Population structures of N. randalli and S. cabrilla were examined by analyzing their genetic diversity (haplotype and nucleotide diversity). Haplotype diversity measures the probability that two alleles picked at random are different while nucleotide diversity

measures the probability that a point in aligned DNA sequences is different between two ran- domly chosen sequences (as cited in (Jong et al., 2011)). These two parameters were deter- mined by single nucleotide polymorphism (SNP) analysis using DnaSP software (Rozas et al., 2017). To visualize haplotype distributions, minimum spanning networks (Bandelt et al.,

1999) were drawn using popART (Leigh & Bryant, 2015) software.

4.0 Results

4.1 Length-weight relationships

Nemipterus species

The number of Nemipterus specimens per length is shown on a frequency distribution histogram (Fig. 4.1.1 E). Length-weight relationships for all four Nemipterus species examined display negative allometric growth. The only exception was found for N. randalli from Abu

Qir which depicts near isometric growth (b = 2.894) (Fig. 4.1.1; Table I). This growth pattern is supported by high correlation coefficients except in the case of N. randalli from

Hurghada which has a low correlation coefficient (R2 = 0.522, SE = 0.594) (Fig. 4.1.1 B).

Table I: LWR parameters of Nemipterus spp. and S. cabrilla. Sample size, n, size range, total length (TL in cm), weight (g), coefficient of the arithmetic LWR, a, the exponent, b, the 95% confidence intervals of a and b in brackets, the standard error of b and the correlation coefficient, R2.

n TL range Weight a (CI) b (CI) SE(b) R2

range

N. japonicus+ 14 15.7-22.3 45.2-108.7 0.582 2.457 0.298 0.873

(-0.0547 – 0.171) (1.808 – 3.106)

N. bipunctatus+ 19 18.0-25.0 67.6-154.7 0.0466 2.522 0.163 0.939

(-0.00335 – 0.0965) (2.177 – 2.866)

N. randalli+ 19 18.4-21.0 70.9-108.5 0.0472 2.518 0.594 0.522

(-0.130 – 0.225) (1.265 – 3.770)

N. randalli* 23 15.4-22.7 42.6-141.8 0.0165 2.894 0.192 0.930

(-0.00330 – 0.0362) (2.494 – 3.294)

S. cabrilla^ 42 9.6-14.7 9.5-36.2 0.0151 2.855 0.285 0.752

(-0.00734 – 0.0375) (2.280 – 3.430)

+ Hurghada *port of Abu Qir ^Gulf of Suez

Asymptotic length (L∞), length at first maturity (Lm) and length at maximum possible yield per recruit (Lopt) are shown in Table II. These lengths were similar for N. bipunctatus,

N. randalli and N. zysron but they were higher for N. japonicus.

Table II: Empirical LWR lengths of Nemipterus spp. and Serranus cabrilla. Lengths calculated based on maximum observed length (Lmax): asymptotic length (L∞), length at first maturity (Lm) and length corresponding to maximum possible yield per recruit (Lopt).

Lmax L∞ Lm Lopt

N. japonicus (Hurghada) 29.0* 32.1 18.4 19.8

N. bipunctatus (Hurghada) 23.9* 25.1 15.1 15.3

N. zysron (Hurghada) 20.9* 22.0 13.4 13.3

N. randalli (Abu Qir) 22.7 23.8 13.8 13.8

N. randalli (Hurghada) 21.0 22.1 13.5 13.4

S. cabrilla (Suez) 14.7 15.6 9.8 9.3

*Values obtained from the largest size (TL) documented in Suez for N. japonicus (Amine, 2012) and the average total length (TL) of the oldest specimens of N. bipunctatus and N. zysron (El-Ganainy et al., 2018).

Serranus cabrilla

The length frequency distribution of S. cabrilla showed that most specimens were average in size (Fig. 4.1.2 a). Serranus cabrilla also display a negative allometric growth pattern

(b = 2.855) and few outliers (R2 = 0.752) (Fig. 4.1.2 b). Values of asymptotic length (L∞) and length corresponding to the maximum yield per recruit (Lopt) are low (Table II).

1 5 0 1 2 0

1 1 0

) 1 0 0

) g

( 1 0 0

(

h h

g 9 0 i

2 .8 9 4 g 2 .5 1 8 i e W = 0 .0 1 6 5 L W = 0 .0 4 7 2 L 5 0 e W 2 8 0 2 R = 0 .9 2 9 8 W R = 0 .5 2 1 5

7 0

0 6 0 (A ) 1 4 1 6 1 8 2 0 2 2 2 4 (B ) 1 7 1 8 1 9 2 0 2 1 2 2 2 3 T o ta l le n g th (c m ) T o ta l le n g th (c m )

1 5 0 2 0 0

1 5 0

) 1 0 0

)

(

t h

h 1 0 0

g 2 .4 5 7

g i

W = 0 .0 5 8 2 L i 2 .5 2 2 e e W = 0 .0 4 6 6 L

5 0 2 W W R = 0 .8 7 3 2 5 0 R 2 = 0 .9 3 9 1

0 0 (C ) 1 4 1 6 1 8 2 0 2 2 2 4 (D ) 1 6 1 8 2 0 2 2 2 4 2 6 2 8 T o ta l le n g th (c m ) T o ta l le n g th (c m )

2 5

y 2 0 N b ip H U R c

n N ja p H U R

e 1 5

u N ra n H U R

q N ra n A B Q

e 1 0

r F

0 (E ) 5 6 7 8 9 0 1 2 3 4 5 1 1 1 1 1 2 2 2 2 2 2

T o ta l le n g th (c m )

Figure 4.1.1: LWRs of four Nemipterus spp. Unless otherwise stated in brackets, graphs represent fish from Hurghada. Correlation coefficient, R2, is indicated for (A) N. randalli (Abu Qir), (B) N. randalli, (C) N. japonicus and (D) N. bipunctatus. (E) Length frequency distribution histogram.

1 5 4 0

y 3 0 c

1 0 )

(

t 2 .8 5 5 h

q 2 0 W = 0 .0 1 5 1 L

e i

r 2 5 e

F R = 0 .7 5 2 2 W 1 0

0 0 5 0 5 0 5 0 5 0 5 0 a) .5 ...... 0 9 0 0 1 1 2 2 3 3 4 4 5 1 1 1 1 1 1 1 1 1 1 1 b ) 8 1 0 1 2 1 4 1 6 T o ta l le n g th (c m ) T o ta l le n g th (c m )

Figure 4.1.2: LWR of Serranus cabrilla. a) Length frequency distribution and b) LWR graph; Correlation coefficient, R2, is indicated.

4.2 Molecular evolutionary relationships

A. Phylogenetic relationships

Nemipterus species

Including indels, there were a total of 623 positions in the final alignment of which 242

(39%) were conserved, 359 (58%) were variable, 233 (37%) were parsimony informative and

125 (20%) were singletons. The average COI sequence divergence of Nemipterus spp. over all sampled locations (intergeneric divergence) was 13.4% whereas the minimum and maximum intraspecific sequence divergence were 0.5% (N. randalli from Hurghada) and 7.6% (N. bipunctatus) (Fig. 4.2.1). All other Nemipterus spp. showed between 2% and 3.5% genetic divergence among conspecifics. However, there was no detectable genetic divergence within

N. randalli from Abu Qir.

Between groups of the same species, divergence was low and comparable to respective within group divergence (light gray shaded values, Table III). Remarkably, N. zysron from

Hurghada (NZ_HUR) and N. japonicus from Saudi Arabia (NJ_SAU) were only 1% divergent (red shade, Table III).

All Nemipterus spp. sequences clustered into four clades supported by >95% bootstrap values and represent the four species analyzed (Fig. 4.2.2). Nemipterus randalli from the Red

Sea (Hurghada) and Mediterranean coast (port of Abu Qir and Lebanese coast) formed a single clade. One of the two sequences used for comparison, KY675935_1_NJ_SAU, an N. japonicus sequence from Saudi Arabia clustered with N. zysron whereas the second one,

KY675462_1_NB_SAU clustered correctly with N. bipunctatus. One sequence, NB_RS05, which was correctly identified as N. bipunctatus however, clustered with N. japonicus.

c n

e 6

r e

v 4

% 2

0 R R Q R B R U U B U E U H H A H L H ______B J R R R Z N N N N N N

Figure 4.2.1: Intraspecific COI sequence divergence within groups of Nemipterus spp. NB_HUR, NJ_HUR, NR_HUR and NZ_HUR are N. bipunctatus, N. japonicus, N. randalli and N. zysron from Hurghada respectively. NR_ABQ and NR_LEB are N. randalli from Abu Qir and Lebanon respectively.

Table III: Percentage COI sequence divergence between groups of Nemipterus spp. The grey shaded values represent genetic divergence between groups of the same species. The red shade represents an abnormally low genetic divergence between groups of different species (refer to Fig. 4.2.1 for group details)

1 2 3 4 5 6 7 8 1 NB_HUR 2 NB_SAU 0.049 3 NJ_HUR 0.218 0.211 4 NJ_SAU 0.253 0.232 0.201 5 NR_ABQ 0.162 0.127 0.180 0.213 6 NR_HUR 0.164 0.129 0.179 0.213 0.007 7 NR_LEB 0.178 0.146 0.200 0.237 0.023 0.027 8 NZ_HUR 0.250 0.228 0.210 0.010 0.214 0.215 0.239

NR A59 NR_ABQ R NR L724 NR_LEB NR L731 NR_LEB R NR A09 NR_ABQ R NR L730 R NR L727 17 NR_LEB 84 R NR L729 29 98 R NR L728 R NR RS01 NR_HUR R NR A05 NR_ABQ NR A68 NR_ABQ R NR A04 NR_ABQ R NR A02 NR_ABQ R NR A03 NR_ABQ R NR A06 NR_ABQ

99 NR RS02 R NR RS19 R NR RS08 R NR RS10 R NR RS18 NR_HUR 43 R NR RS03 R NR RS17 96 R NR RS05 R NR RS16 R NR RS07 NR_HUR KY675462 1 NB SAU NB_SAU R NB RS17 R NB RS16 R NB RS18 99 R NB RS11

86 R NB RS13 NB RS04 NB-RS03 NB_HUR 68 R NB RS15 R NB RS20 R NB RS19 R NB RS06 R NB RS10 NB RS14 NJ RS02 NJ_HUR NJ RS09 NJ_HUR NJ RS01 99 R NJ RS13 NJ_HUR R NJ RS12 NJ_HUR 63 R NJ RS10 NJ_HUR NJ RS05 NJ_HUR NJ RS03 NJ_HUR 99 R NB RS05 NB_HUR NZ RS02 NZ_HUR

99 KY675935 1 NJ SAU NJ_SAU 66 NZ RS01 NZ_HUR

Figure 4.2.2: Maximum Likelihood tree for Nemipterus spp. The evolutionary history was inferred based on Kimura 2-parameter model. The analysis involved 51 nucleotide sequences. All positions containing gaps and missing data were eliminated. There were a total of 362 positions in the final dataset. The tree with the highest log likelihood = -1961.46 is shown.

Serranus cabrilla

Of 602 positions in the aligned sequence dataset, 552 (92%) were conserved, 48 (8%) were variable, 30 (5%) were parsimony informative whereas 18 (3%) were singletons. Average intraspecific genetic divergence of Serranus cabrilla over all locations was 1.8%. The population from Cyprus was the most divergent (1.4%) whereas that of the Suez Gulf was the least divergent (0.4%) (Fig. 4.2.3 A). Within-group (intraspecific) divergence of S. cabrilla from the Suez (Red Sea) and the average from four Mediterranean locations (Cyprus, Lebanon,

Israel and Turkey) were significantly different (T-test, t = 5.21, P = 0.014, DF = 3).

Divergence between groups was low and comparable to within-group divergence

(Tabe IV, gray shaded values). Nevertheless, the Red Sea group (RS_SUEZ) was more genetically distant from the more genetically more divergent Mediterranean groups (values in red shade, Table IV).

Forty-four (41) COI sequences of initially morphologically-identified Serranus cabrilla specimens from the Gulf of Suez clustered into two clades, one representing the Gulf of Suez and the other representing four Mediterranean populations (Cyprus, Lebanon, Turkey and

Israel) (Fig. 4.2.4). Although the Mediterranean clade did not cluster S. cabrilla sequences according to their respective Mediterranean subpopulation, it did reveal two major subclades; one of the subclades was dominated by sequences obtained from Lebanese specimens and the other contained at least two sequences from all Mediterranean subpopulations.

1 .5

c n

e 1 .0

i d

0 .5 %

0 .0 Z B K P R E E R Y S L U I T C _ _ S _ _ C C _ C C S S C S S S

Fig. 4.2.3: Intraspecific COI sequence divergence within groups of Serranus cabrilla. SC_SUEZ, SC_CYP, SC_ISR, SC_LEB and SC_TRK represent S. cabrilla samples from Suez (Egypt), Cyprus, Israel, Lebanon and Turkey respectively.

Table IV: Percentage COI sequece divergence between groups of S. cabrilla. Gray shaded values are comparisons of S. cabrilla genetic divergence from Suez with Mediterranean locations (refer to Fig. 4.2.2 for group details)

1 2 3 4 5

1 SC_CYP

2 SC_ISR 1.0

3 SC_LEB 1.2 1.1

4 SC_SUEZ 2.6 2.5 2.8

5 SC_TRK 1.1 0.9 1.4 2.4

R Sc Cy05 CYP R Sc L718 LEB R Sc L707 LEB R Sc L716 LEB

89 R Sc L720 LEB R Sc L712 LEB R Sc L715 LEB 91 R Sc L710 LEB KM538540 1 SC ISR ISR R Sc Cy03 CYP KM538541 1 SC ISR ISR KC501457 1 SC TRK TRK KM538543 1 SC ISR ISR R Sc L717 LEB FN689286 1 SC TRK TRK KM538539 1 SC ISR ISR 48 R Sc L713 LEB 61 R Sc Cy04 CYP R Sc L721 LEB KC501463 1 SC TRK TRK KM538538 1 SC ISR ISR R Sc Cy02 CYP 65 R Sc L719 LEB JQ623994 1 SC TRK TRK R Sc L709 LEB R Sc Cy01 R Sc S17 R Sc S29 R Sc S24 R Sc S40 R Sc-S39 99 R Sc S30 R Sc S37 R Sc S05

62 R Sc S22 SUEZ Sc S09 99 63 R Sc S10 R Sc S15

85 R Sc S21 R Sc S07 R Sc S32 R Sc S36 Sc S26 R Sc S02

Figure 4.2.4: Maximum Likelihood tree for Serranus cabrilla. The evolutionary history was based on Kimura 2-parameter model. The analysis involved 40 nucleotide sequences. All positions containing gaps and missing information were eliminated. There were a total of 455 positions in the final dataset. The tree with the highest log likelihood of -910.13 is shown.

B. Genetic diversity

Nemipterus species

Nemipterus bipunctatus from Hurghada had 9 haplotypes, a relatively high haplotype diversity (h = 0.872) and the highest nucleotide diversity (π = 0.0721). Both N. japonicus and N. zysron (H = 5 and H = 2 respectively) also had high genetic diversity (Table V).

Mediterranean Sea populations (Abu Qir and the Lebanese coast) of N. randalli had a higher number of haplotypes (H = 6) than the Red Sea (Hurghada) population (H = 5). How- ever, the haplotype diversity of the Red Sea population (h = 0.722) was higher than that of the Mediterranean population (h = 0.682) although the latter had a much higher haplotype diversity (π = 0.0161 versus π = 0.00533 for the Red Sea population) (Table V). A haplotype analysis showed that the Mediterranean (both Abu Qir and Lebanon) shares only one of the five haplotypes in the Red Sea; Abu Qir has the largest share of this haplotype (Fig. 4.2.5).

Table V: Genetic diversity of Nemipterus species. n = number of sequences, S = number of polymorphic sites, H = number of haplotypes, h = haplotype diversity and π = nucleotide diversity (See Fig. 4.2.1 for group name codes)

Group Place Date n S H h ± SD π

NR_HUR Red Sea Spring 2018* 9 12 5 0.722±0.159 0.00533

NR_MED^ 12 33 6 0.682±0.147 0.0161

NR_LEB Mediterranean - 6 33 6 1.000±0.0962 0.0275

NR_ABQ Mediterranean Spring 2018 6 0 1 0 0

NJ_HUR Red Sea Spring 2018 8 146 5 0.786±0.151 0.0712

NZ_HUR Red Sea Summer 2017 2 10 2 1.000±0.5 0.0178

NB_HUR Red Sea Spring 2018 13 230 9 0.872±0.913 0.0721

^ Mediterranean total for Nemipterus randalli *One specimen was collected in Summer (June) 2017

Figure 4.2.5: A haplotype network of Nemipterus randalli from the Mediterranean Sea (Leb- anon and Abu Qir) and Red seas (Hurghada). Each pie is a haplotype and its size is proportional to the frequency. The number of mutations between haplotypes is represented by hatch marks. The shared haplotype is denoted HS.

Serranus cabrilla

Mediterranean populations of Serranus cabrilla had a higher number of haplotypes (H = 17) than the Suez population (H = 12). Although the two ecosystems had a similar haplotype diversity (h = 0.960 for the Mediterranean and h = 0.942 for the Gulf of Suez), the former ecosystem had a much higher nucleotide diversity (π = 0.0118 verses π = 0.00436 for the Gulf of

Suez) (Table VI).

There were four shared haplotypes in the Mediterranean Sea. Despite extensive sharing of haplotypes between Mediterranean subpopulations, haplotypes from the Lebanese coast were predominant. No haplotypes, however, were shared between the Red Sea and Mediter- ranean seas (Fig. 4.2.6).

Table VI: Genetic diversity of Serranus cabrilla. n = number of sequences, S = number of polymorphic sites, H = number of haplotypes, h = haplotype diversity and π = nucleotide diversity (See Fig. 4.2.2 for group name codes)

Group Place Date n S H h ± SD π

SC_SUEZ Gulf of Suez Spring 2014 16 16 12 0.942±0.0482 0.00406

SC_MED^ EastMED - 24 28 17 0.960±0.0251 0.0118

SC_TRK Mediterranean (G)* - 3 5 3 1.000±0.272 0.00556

SC_LEB Mediterranean - 11 21 9 0.945±0.0659 0.0119

SC_ISR Mediterranean (G)* - 5 11 5 1.000±0.126 0.00952

SC_CYP Mediterranean - 5 19 5 1.000±0.126 0.0157

*(G) indicates sequences from Genbank ^ Mediterranean total

Figure 4.2.6: A haplotype network of Serranus cabrilla from the Gulf of Suez and the Medi- terranean Sea (Israel, Lebanon, Cyprus and Turkey). Each pie is a haplotype and its size is proportional to the frequency. Steps interspaced by black dots represent the number of mutations.

5.0 Discussion

5.1 Evolutionary relationships

5.1.1 Phylogenetic relationships: DNA barcoding perspective

Nemipterus species

Fifty-one (51) specimens belonging to Nemipterus species were initially identified into respective species using morphological parameters (Fig. 3.1). All four Nemipterus species formed monophyletic clades (Fig. 4.2.2). The monophyletic status of Nemipterus species was reported in recent studies (Farivar et al., 2017; Imtiaz, 2016; Kakioka et al., 2017; Liang et al., 2012; Miller & Cribb, 2007; Orrell et al., 2002). The latest such study, however, would not clearly establish the monophyly of Nemipterus randalli, and cited possible mislabeling of the species as N. mesoprion, and did not include N. bipunctatus (Hung et al., 2017).

Although all Nemipterus specimens in this work were correctly identified (Fig. 3.1 A –

D), one specimen of N. bipunctatus did cluster with N. japonicus in the phylogenetic tree

(Fig. 4.2.2) despite being confirmed as N. bipunctatus by a follow-up morphological exami- nation. Besides this, intraspecific sequence divergence (7.6%, Fig. 4.2.1) of N. bipunctatus was more than twice higher than the threshold (3.5%) suggested for teleost fishes (R. D.

Ward et al., 2009). This raises concerns about the possibility of N. bipunctatus consisting of cryptic species in its Red Sea habitat, although any attempt to resolve them should follow an integrated approach (Fišer et al., 2018).

Despite the use of DNA barcoding to aid traditional species identification, morphological identification of Nemipterus species remains particularly challenging, for instance, N. randalli has been previously misidentified as N. japonicus (Lelli et al., 2008). Therefore, it is not surprising that KY675935_1_NJ_SAU (Accession No. KY675935.1, supplementary Ta-

ble S), a N. japonicus sequence for comparison in this study clustered with N. zysron instead, suggesting it was likely obtained from N. zysron. A similar case of N. zysron misidentification as N. japonicus has been reported before (Hung et al., 2017).

Serranus cabrilla

Unlike some Nemipterus species which had relatively high sequence divergence, Serranus cabrilla specimens in this work had less than 2% sequence divergence (Fig. 4.2.3 and Fig.

4.2.4). Similarly, serranid fishes of the Mediterranean have recently been resolved into respective species clades by less than 1% sequence divergence (Vella & Vella, 2016). Nonethe- less, sequence divergence between the Gulf of Suez and Mediterranean populations was significantly different possibly reflecting genetic isolation of the two ecosystems. However, just like Nemipterus species, serranid fishes are equally confusing to identify, for instance, Ser- ranus knysnaensis has long been mistakenly referred to as Serranus cabrilla (Heemstra &

Heemstra, 2004).

5.1.2 Genetic diversity

Nemipterus randalli as a Lessepsian migrant

The poor phylogenetic clade differentiation between the Red Sea and other Mediterranean populations of N. randalli (Fig. 4.2.2) signals haplotype sharing between the two ecosystems.

Although Mediterranean subpopulations share just one haplotype from the Red Sea (Fig.

4.2.5), the latter sea most likely has more haplotypes that were not sampled in this study but are already present in the former sea and would require sampling other locations in the Red

Sea. In fact, the higher haplotype diversity of the native Red Sea (Table V) habitat means

that it harbors a more diverse genetic pool which may continue to flow into the Mediterrane- an in the future.

Therefore, the six haplotypes in the Mediterranean are most likely suggestive of multiple invasion events or continuous influx of genetically diverse N. randalli populations from the Red Sea into these Mediterranean locations; indeed, there are many reported encounters with N. randalli in the eastern Mediterranean (e.g. (Aydin et al., 2017; Lelli et al., 2008;

Stern N. et al., 2014)). This scenario of multiple introductions has recently been reported for the Lessepsian lionfish Pterois miles (Stern et al., 2018) and were suggested in previous findings on other Lessepsian fish species, where invading species populations moved continuous- ly into the Mediterranean without a bottleneck (Azzurro et al., 2006; Hassan et al., 2003).

Other Nemipterus species

Nemipterus japonicus, N. bipunctatus and N. zysron have high haplotype diversity and nucleotide diversity, a sign that their populations are stable (Grant & Bowen, 1998). This contrasts with findings on N. randalli and S. cabrilla of Hurghada and the Gulf of Suez respectively, whose populations appear to have recovered from historical population bottlenecks as im- plied by their high haplotype diversity but low nucleotide diversity (Grant & Bowen, 1998).

On the Mediterranean origin of Serranus cabrilla

Recently, a phylogenetic study on Serranus cabrilla indicated extensive haplotype sharing between Mediterranean subpopulations (Vella & Vella, 2016). Gene flow between western

Mediterranean subpopulations has also been examined using microsatellite DNA and was found to be highly associated with ocean currents which disperse planktonic larvae of S. cabrilla (Schunter et al., 2011). These findings agree with results of this study which found no

clear clade differentiation (Fig. 4.2.4) but revealed proportionate sharing of haplotypes between eastern Mediterranean subpopulations (Fig. 4.2.6).

The Mediterranean origin of S. cabrilla has been questioned before (Por, 1978). Rela- tive to Mediterranean subpopulations, the lower number of haplotypes and slightly lower haplotype diversity but far lower nucleotide diversity of the Suez population could initially be interpreted as representing a subset of the total haplotypes of the Mediterranean (Table VI).

In this case, there would be haplotype sharing between the two ecosystems, implying multiple invasion events without a bottleneck similar to what has been observed in some Les- sepsian migrants (Stern et al., 2018). Or, perhaps, the high haplotype diversity and significantly lowered nucleotide diversity could signal recovery from a previous population bottleneck (Grant & Bowen, 1998). However, none of the 17 haplotypes found in the eastern Medi- terranean Sea is represented in the Gulf of Suez (Fig. 4.2.6) as is reflected by the two ecosystems having clearly differentiated phylogenetic clades (Fig. 4.2.4).

According to these results, S. cabrilla populations of the Gulf of Suez and the Mediter- ranean have been isolated well before the opening of the Suez Canal, thus contrasting with previous claims that the species is an anti-Lessepsian migrant (Ben-Tuvia, 1971; Golani,

1999). In addition, ocean currents in the Gulf of Suez progress northwards towards the Medi- terranean Sea (Por, 1978), annulling their contribution to the spread of S. cabrilla southwards. Indeed, it has been argued that 1875, the date S. cabrilla was firstly reported in the

Red Sea, was too early for even the most adapted organism to have established themselves in a new environment (Por, 1978). This is consistent with the view that a native population of this fish species exists in Egypt (Hureau, 1991).

5.2 Length-weight relationships

The narrow length range can be attributed to the fishing gear which might have favored catching medium-sized fishes over smaller and larger ones, a phenomenon that is not un- common and has unintended impact on LWRs (Froese, 2006; Froese & Binohlan, 2000). The negative allometric growth pattern (Fig. 4.1.1 A – D and Fig. 4.1.2 b) more increase in length relative to weight (Froese, 2006).

Negative allometric growth pattern was presently reported in N. bipunctatus in south

India (b = 2.563) (Karuppasamy et al., n.d.). This value of b is slightly higher than that of the present study (b = 2.522, Fig. 4.1.1 D). The value of the exponent b = 2.457 for N. japonicus is also lower than that of a previous study (b = 2.733) in Suez (Amine, 2012). These discrep- ancies probably reflect geographical and sampling differences; for example, the length range in this study is much smaller (Table II). Similar to N. randalli from Abu Qir that display near isometric growth (b = 2.894) (Fig. 4.1.1 A), isometric growth has been reported in the north- and south-eastern Mediterranean (Edelist, 2014; Erguden, Turan, Gurlek, Yaglioglu, &

Gungor, 2010; Innal et al., n.d.). Whereas lower values of b for N. randalli exist in literature

(Erguden, Turan, & Gurlek, 2009; Kalhoro et al., 2017), the strong negative allometric growth from Hurghada (Fig. 4.1.1 B) could be attributed to the narrow length range analyzed in this study.

For N. japonicus, asymptotic length (L∞), and presumably other lengths (Table II), was similar to previous studies in the Gulf of Suez (Amine, 2012; El-Ganainy et al., 2018) and the

Mediterranean Sea (ElHaweet, 2013). However, L∞ was much lower in other Nemipterus species. In the case of N. bipunctatus and N. zysron for instance, L∞ was calculated from the average length of the oldest specimens whereas L∞ for N. japonicus was calculated using long- est individual observed for the area (i.e. Lmax from (Amine, 2012)). In the case of N. randalli,

the low value of L∞ should be attributed to lack of data on the largest individual since this is the first LWR report for Hurghada. Put together, these results underscore the usefulness and choice of the input Lmax for calculating other lengths using empirical formulas (Froese &

Binohlan, 2000).

The value of the LWR exponent b = 2.855 for S. cabrilla (Fig. 4.1.2 b) also signify negative allometric growth and is lower than that reported in Greece (b = 2.955) although both values are for autumn seasons. Nevertheless, it is similar to the overall value of b =

2.805 (Moutopoulos & Stergiou, 2002).

Overall, there were differences in values of the LWR exponent b in the species examined from different locations in this study. This variation is caused by such factors as feeding habit, availability of, and competition for food, maturity stage and/or other environmental factors (Rao, Ghosh, Sreeramulu, Mahesh, & Kumar, 2018). For instance, LWRs for juvenile fish are different than those of adult fish (Froese, 2006).

6.0 Conclusion

The present work used COI sequences to examine length-weight relationships, phylogenetic relationships and population structures of Red Sea/Suez and Mediterranean populations of two invasive fish species: Nemipterus randalli, a Lessepsian migrant and S. cabrilla, a sus- pect anti-Lessepsian migrant, in addition to three other Nemipterus species, namely, N. bipunctatus, N. japonicus and N. zysron.

Phylogenetic relationships

Although S. cabrilla and Nemipterus species were resolved into monophyletic clades (Fig.

4.2.2 and Fig. 4.2.4), misidentification and cryptic species are two problems that remain to be tackled. Particularly, N. bipunctatus had twice higher sequence divergence (7.6%) than the designated 3.5% threshold for teleost fishes; thus, the Red Sea population potentially quali- fies to be categorized as having cryptic species of N. bipunctatus. Therefore, a comprehensive and integrated approach to species identification should be applied (Fišer et al., 2018) before depositing any sequences to Genbank. This will ensure advancement of the goal of Fish Bar- code of Life (FISH-BOL) to barcode all fish species to aid their monitoring and conservation

(R. D. Ward et al., 2009).

Population structures

Results have revealed similarity in genetic diversity between Mediterranean populations of

Nemipterus randalli signifying genetic connectivity resulting from extensive gene flow between these populations. Also, genetic variability between the Red Sea (Hurghada) and the

Mediterranean is low, a result of continuous movement of these species from the Red Sea to the Mediterranean through the Suez Canal.

Results that Serranus cabrilla populations from the Mediterranean are highly connected genetically agree with previous studies (Schunter et al., 2011; Vella & Vella, 2016). Most importantly, the present study has shown that none of the 17 haplotypes in the Mediterranean were present in Gulf of Suez. This contrasts clearly with previously thought that S. cabrilla is an anti-Lessepsian migrant (Ben-Tuvia, 1971; Dk’lIEL Golani, 1999). Therefore, the relationship between the Red Sea and Mediterranean populations, which has been debatable (F.

D. Por, 1978), can now be put to rest.

Length-weight relationships

The study also provided the first length-weight relationships (LWRs) for S. cabrilla from Su- ez, N. randalli and N. bipunctatus from Hurghada, N. randalli from Abu Qir, as well as addi- tional LWR for N. japonicus from the Gulf of Suez. The resultant LWR parameters will be useful for future management considerations for these fish species in Egypt.

Declaration of Interest

There was no conflict of interest during this study.

I. References

Al-Rshaidat, M. M. D., Snider, A., Rosebraugh, S., Devine, A. M., Devine, T. D., Plaisance, L., … Leray,

M. (2016). Deep COI sequencing of standardized benthic samples unveils overlooked diversi-

ty of Jordanian coral reefs in the northern Red Sea. Genome, 59, 724–737.

https://doi.org/10.1139/gen-2015-0208

Amine, A. (2012). Biology and assessment of the thread fin bream Nemipterus japonicus in Gulf of

Suez, Egypt. Egyptian Journal of Aquatic Biology and Fisheries, 16(2), 47–57.

https://doi.org/10.21608/ejabf.2012.2124

Ardura, A., Clusa, L., Zaiko, A., Garcia-Vazquez, E., & Miralles, L. (2018). Stress related epigenetic

changes may explain opportunistic success in biological invasions in Antipode mussels. Scien-

tific Reports, 8(1), 10793. https://doi.org/10.1038/s41598-018-29181-4

Aydin, I., & Akyol, O. (2017). Occurrence of Nemipterus randalli Russell, 1986 (Nemipteridae) off Iz-

mir Bay, Turkey. Journal of Applied Ichthyology, 33(3), 533–534.

https://doi.org/10.1111/jai.13331

Azzurro, E., Golani, D., Bucciarelli, G., & Bernardi, G. (2006). Genetics of the early stages of invasion

of the Lessepsian rabbitfish Siganus luridus. Journal of Experimental Marine Biology and

Ecology, 333(2), 190–201. https://doi.org/10.1016/j.jembe.2005.12.002

Baharum, S. N., & Nurdalila, A. A. (2012). Application of 16s rDNA and cytochrome b ribosomal

markers in studies of lineage and fish populations structure of aquatic species. Molecular Bi-

ology Reports, 39(5), 5225–5232. https://doi.org/10.1007/s11033-011-1320-2

Bandelt, H. J., Forster, P., & Röhl, A. (1999). Median-joining networks for inferring intraspecific phy-

logenies. Molecular Biology and Evolution, 16(1), 37–48.

https://doi.org/10.1093/oxfordjournals.molbev.a026036

Bariche, M., & Fricke, R. (2018). Dipterygonotus balteatus (Valenciennes, 1830) (Teleostei: Cae-

sionidae), a new alien fish in the Mediterranean Sea. BioInvasions Records, 7(1), 79–82.

https://doi.org/10.3391/bir.2018.7.1.12

Bell, T. G., & Kramvis, A. (2013). Fragment Merger: An Online Tool to Merge Overlapping Long Se-

quence Fragments. Viruses, 5(3), 824–833. https://doi.org/10.3390/v5030824

Belmaker, J., Parravicini, V., & Kulbicki, M. (2013). Ecological traits and environmental affinity explain

Red Sea fish introduction into the Mediterranean. Global Change Biology, 19(5), 1373–1382.

https://doi.org/10.1111/gcb.12132

Ben-Tuvia, A. (1971). On the Occurrence of the Mediterranean Serranid Fish Dicentrarchus punctatus

(Bloch) in the Gulf of Suez. Copeia, 1971(4), 741–743. https://doi.org/10.2307/1442650

Bernardi, G., Azzurro, E., Golani, D., & Miller, M. R. (2016). Genomic signatures of rapid adaptive evo-

lution in the bluespotted cornetfish, a Mediterranean Lessepsian invader. Molecular Ecolo-

gy, 25(14), 3384–3396. https://doi.org/10.1111/mec.13682

Bineesh, K. K., Russell, B. C., & Chandra, K. (2018). Nemipterus andamanensis, a new nemipterid fish

(Perciformes: Nemipteridae) from the Andaman Islands. Zootaxa, 4500(1), 82.

https://doi.org/10.11646/zootaxa.4500.1.4

Bos, A. (2014). Upeneus nigromarginatus, a new species of goatfish (Perciformes: Mullidae) from the

Philippines. The Raffles Bulletin of Zoology, 62, 745–753.

Bos, A. R., & Ogwang, J. (2018). Caesio varilineata Carpenter, 1987 (Osteichthyes: Caesionidae) a

new alien fish in the southeastern Mediterranean Sea. Bioinvasions Records (in Press), 7, 5.

Chanet, B., Desoutter-Meniger, M., & Bogorodsky, S. V. (2012). Range extension of Egyptian sole

Solea aegyptiaca (Soleidae: Pleuronectiformes), in the Red Sea, 5.

Changizi, R., Farahmand, H., Soltani, M., Asareh, R., Ghiasvand, Z., & others. (2013). Species identifi-

cation reveals mislabeling of important fish products in Iran by DNA barcoding. Iranian Jour-

nal of Fisheries Sciences, 12(4), 758–768.

Collins, R. A., Boykin, L. M., Cruickshank, R. H., & Armstrong, K. F. (2012). Barcoding’s next top mod-

el: an evaluation of nucleotide substitution models for specimen identification: Model selec-

tion in DNA barcoding. Methods in Ecology and Evolution, 3(3), 457–465.

https://doi.org/10.1111/j.2041-210X.2011.00176.x da Silva, J. M., Creer, S., Dos Santos, A., Costa, A. C., Cunha, M. R., Costa, F. O., & Carvalho, G. R.

(2011). Systematic and evolutionary insights derived from mtDNA COI barcode diversity in

the Decapoda (Crustacea: Malacostraca). PLoS One, 6(5), e19449.

DiGiacopo, D. G., Meindl, G. A., Ryan, S., Jaeger, J., Wersebe, M., Martin, A., … Hua, J. (2018). Inter-

action between invasive plant leaf litter and NaCl on two model amphibians. Biological Inva-

sions. https://doi.org/10.1007/s10530-018-1836-7

Edelist, D. (2014). New length-weight relationships and L max values for fishes from the Southeastern

Mediterranean Sea. Journal of Applied Ichthyology, 30(3), 521–526.

https://doi.org/10.1111/j.1439-0426.2012.02060.x

El-Ganainy, A. A., Khalil, M. T., El-Bokhty, E. E. E., Saber, M. A., & Abd El-Rahman, F. A. A. (2018). As-

sessment of three nemipterid stocks based on trawl surveys in the Gulf of Suez, Red Sea. The

Egyptian Journal of Aquatic Research. https://doi.org/10.1016/j.ejar.2018.02.005

ElHaweet, A. E. A. (2013). Biological studies of the invasive species Nemipterus japonicus (Bloch,

1791) as a Red Sea immigrant into the Mediterranean. The Egyptian Journal of Aquatic Re-

search, 39(4), 267–274. https://doi.org/10.1016/j.ejar.2013.12.008

Erguden, D., Turan, C., & Gurlek, M. (2009). Weight–length relationships for 20 Lessepsian fish spe-

cies caught by bottom trawl on the coast of Iskenderun Bay (NE Mediterranean Sea, Turkey).

Journal of Applied Ichthyology, 25(1), 133–135. https://doi.org/10.1111/j.1439-

0426.2008.01198.x

Erguden, D., Turan, C., Gurlek, M., Yaglioglu, D., & Gungor, M. (2010). Age and growth of the Ran-

dall’s threadfin bream Nemipterus randalli (Russell, 1986), a recent Lessepsian migrant in Is-

III

kenderun Bay, northeastern Mediterranean: Age and growth of the Randall’s threadfin

bream. Journal of Applied Ichthyology, 26(3), 441–444. https://doi.org/10.1111/j.1439-

0426.2009.01387.x

Farivar, S., Jalil-Piran, Z., Zarei, F., & Hosseinzadeh Sahafi, H. (2017). Intraspecific phylogeography of

the Japanese threadfin bream, Nemipterus japonicus (Perciformes: Nemipteridae), from the

Persian Gulf and Indo-West Pacific: a preliminary study based on mitochondrial DNA se-

quence. Iranian Journal of Fisheries Sciences, 16(2), 587–604.

Fišer, C., Robinson, C. T., & Malard, F. (2018). Cryptic species as a window into the paradigm shift of

the species concept. Molecular Ecology, 27(3), 613–635. https://doi.org/10.1111/mec.14486

Froese, R. (2006). Cube law, condition factor and weight-length relationships: history, meta-analysis

and recommendations. Journal of Applied Ichthyology, 22(4), 241–253.

https://doi.org/10.1111/j.1439-0426.2006.00805.x

Froese, R., & Binohlan, C. (2000). Empirical relationships to estimate asymptotic length, length at

first maturity and length at maximum yield per recruit in fishes, with a simple method to

evaluate length frequency data. Journal of Fish Biology, 56(4), 758–773.

https://doi.org/10.1111/j.1095-8649.2000.tb00870.x

Froese, R., & Pauly, D. (2018). FishBase. World Wide Web Electronic Publications.

http://www.fishbase.org.

Funk, J. L. (2015). Invasive Species: A Global Problem in Need of a Global Solution. BioScience, 65(6),

623–624. https://doi.org/10.1093/biosci/biv053

Galil, B. S. (2009). Taking stock: inventory of alien species in the Mediterranean Sea. Biological Inva-

sions, 11(2), 359–372. https://doi.org/10.1007/s10530-008-9253-y

García-Horsman, J. A., Barquera, B., Rumbley, J., Ma, J., & Gennis, R. B. (1994). The superfamily of

heme-copper respiratory oxidases. Journal of Bacteriology, 176(18), 5587–5600.

https://doi.org/10.1128/jb.176.18.5587-5600.1994

Golani, Daniel. (1998). Impact of Red Sea Fish Migrants through the Suez Canal on the Aquatic Envi-

ronment of the Eastern Mediterranean, (103), 375–387.

Golani, Daniel, Azzurro, E., Corsini-Foka, M., Falautano, M., Andaloro, F., & Bernardi, G. (2007). Ge-

netic bottlenecks and successful biological invasions: the case of a recent Lessepsian mi-

grant. Biology Letters, 3(5), 541–545. https://doi.org/10.1098/rsbl.2007.0308

Golani, Dk’lIEL. (1999). THE GULF OF SUEZ ICHTHYOFAUNA-ASSEMBLAGE POOL FOR LESSEPSIAN

MIGRATION INTO THE MEDITERRANEAN, 45, 79–90.

Grant, W. a. S., & Bowen, B. W. (1998). Shallow population histories in deep evolutionary lineages of

marine fishes: insights from sardines and anchovies and lessons for conservation. Journal of

Heredity, 89(5), 415–426. https://doi.org/10.1093/jhered/89.5.415

Gyllensten, U., Wharton, D., Josefsson, A., & Wilson, A. C. (1991). Paternal inheritance of mitochon-

drial DNA from mice. Nature, 352, 255–257.

Hall-Spencer, J., & Allen, R. (2015). The impact of CO2 emissions on nuisance marine species. Re-

search and Reports in Biodiversity Studies, 33. https://doi.org/10.2147/RRBS.S70357

Hanner, R., Corthals, A., & Dessauer, H. C. (2005). Salvage of genetically valuable tissues following a

freezer failure. Molecular Phylogenetics and Evolution, 34(2), 452–455.

https://doi.org/10.1016/j.ympev.2004.10.008

Hassan, M., Harmelin-Vivien, M., & Bonhomme, F. (2003). Lessepsian invasion without bottleneck:

example of two rabbitfish species (Siganus rivulatus and Siganus luridus). Journal of Experi-

mental Marine Biology and Ecology, 291, 219–232. https://doi.org/10.1016/S0022-

0981(03)00139-4

Hawes, N. A., Fidler, A. E., Tremblay, L. A., Pochon, X., Dunphy, B. J., & Smith, K. F. (2018). Under-

standing the role of DNA methylation in successful biological invasions: a review. Biological

Invasions, 20(9), 2285–2300. https://doi.org/10.1007/s10530-018-1703-6

Hebert, P. D. N., Cywinska, A., Ball, S. L., & deWaard, J. R. (2003). Biological identifications through

DNA barcodes. Proceedings of the Royal Society B: Biological Sciences, 270(1512), 313–321.

https://doi.org/10.1098/rspb.2002.2218

Heemstra, P. C., & Heemstra, E. (2004). Coastal fishes of southern Africa. NISC (PTY) LTD.

Heemstra, Phillip C. (2012). Serranidae. In Smiths’ Sea Fishes (pp. 509–537). Springer Science & Busi-

ness Media.

Hung, K.-W., Russell, B. C., & Chen, W.-J. (2017). Molecular systematics of threadfin breams and rela-

tives (Teleostei, Nemipteridae). Zoologica Scripta, 46(5), 536–551.

https://doi.org/10.1111/zsc.12237

Hureau, J.-C. (1991). La base de données GICIM: Gestion informatisée des collections ichthy-

ologiques du Muséum. In Atlas Preliminaire des Poissons d’Eaux Douce de France (pp. 225–

227). Conseil Supérieur de la Pêche, Ministère de l’Environment, CEMAGREF et Muséum Na-

tional d’Histoire Naturelle, Paris.

Imtiaz, A. (2016). Molecular identification of commercially important species of Nemipterus (Perci-

formes: Nemipteridae) in surrounding seas of Malaysia. Biodiversitas, Journal of Biological

Diversity, 17(2), 571–577. https://doi.org/10.13057/biodiv/d170226

Innal, D., Aksu, M., Akdoganbulut, D., Kisin, B., Can, M., Oztop, M., … Pek, E. (n.d.). Age and growth

of Nemipterus randalli from Antalya Gulf-Turkey, 5.

Isari, S., Pearman, J. K., Casas, L., Michell, C. T., Curdia, J., Berumen, M. L., & Irigoien, X. (2017). Ex-

ploring the larval fish community of the central Red Sea with an integrated morphological

and molecular approach. PloS One, 12(8), e0182503.

https://doi.org/10.1371/journal.pone.0182503

Jong, M. A. de, Wahlberg, N., Eijk, M. van, Brakefield, P. M., & Zwaan, B. J. (2011). Mitochondrial

DNA Signature for Range-Wide Populations of Bicyclus anynana Suggests a Rapid Expansion

from Recent Refugia. PLOS ONE, 6(6), e21385.

https://doi.org/10.1371/journal.pone.0021385

Joshi, K. K. (2010). Population dynamics of Nemipterus japonicus (Bloch) in the trawling grounds off

Cochin. Indian Journal of Fisheries, 57(1), 7–12.

Kakioka, R., Muto, N., Takeshima, H., Gaje, A. C., Cruz, R. S., Alama, U. B., … Ishikawa, S. (2017). Cryp-

tic genetic divergence in Scolopsis taenioptera (Perciformes: Nemipteridae) in the western

Pacific Ocean. Ichthyological Research. https://doi.org/10.1007/s10228-017-0596-1

Kalhoro, M. A., Tang, D., Ye, H., Morozov, E., Liu, Q., Memon, K. H., & Kalhoro, M. T. (2017). Popula-

tion dynamics of Randall’s threadfin bream Nemipterus randalli from Pakistani waters,

Northern Arabian Sea. INDIAN J. MAR. SCI., 46(03), 11.

Karuppasamy, K., Kingston, S. D., Jawahar, P., Venkataramani, V. K., Vidhya, V., & Dattatreya, P. S.

(n.d.). Length-weight relationship of Lethrinus lentjan and Nemipterus bipunctatus (valenci-

ennes, 1830) from Wadge Bank, south India, 5.

Katoh, K., Rozewicki, J., & Yamada, K. D. (n.d.). MAFFT online service: multiple sequence alignment,

interactive sequence choice and visualization. Briefings in Bioinformatics.

https://doi.org/10.1093/bib/bbx108

Keskın, E., & Atar, H. H. (2013). DNA barcoding commercially important fish species of Turkey. Mo-

lecular Ecology Resources, 13(5), 788–797. https://doi.org/10.1111/1755-0998.12120

Keys, A. B. (1928). The Weight-Length Relation in Fishes. Proceedings of the National Academy of

Sciences of the United States of America, 14(12), 922–925.

Kimura, M. (1980). A simple method for estimating evolutionary rates of base substitutions through

comparative studies of nucleotide sequences. Journal of Molecular Evolution, 16(2), 111–

120.

VII

Kolbe, J. J., Glor, R. E., Rodríguez Schettino, L., Lara, A. C., Larson, A., & Losos, J. B. (2004). Genetic

variation increases during biological invasion by a Cuban lizard. Nature, 431(7005), 177–181.

https://doi.org/10.1038/nature02807

Kress, W. J., & Erickson, D. L. (2008). DNA barcodes: Genes, genomics, and bioinformatics. Proceed-

ings of the National Academy of Sciences of the United States of America, 105(8), 2761–

2762. https://doi.org/10.1073/pnas.0800476105

Kumar, S., Stecher, G., & Tamura, K. (2016). MEGA7: Molecular Evolutionary Genetics Analysis Ver-

sion 7.0 for Bigger Datasets. Molecular Biology and Evolution, 33(7), 1870–1874.

https://doi.org/10.1093/molbev/msw054

Kuraku, S., Zmasek, C. M., Nishimura, O., & Katoh, K. (2013). aLeaves facilitates on-demand explora-

tion of metazoan gene family trees on MAFFT sequence alignment server with enhanced in-

teractivity. Nucleic Acids Research, 41(W1), W22–W28. https://doi.org/10.1093/nar/gkt389

Leigh, J. W., & Bryant, D. (2015). popart: full-feature software for haplotype network construction.

Methods in Ecology and Evolution, 6(9), 1110–1116. https://doi.org/10.1111/2041-

210X.12410

Lelli, S., Colloca, F., Carpentieri, P., & Russell, B. C. (2008). The threadfin bream Nemipterus randalli

(Perciformes: Nemipteridae) in the eastern Mediterranean Sea. Journal of Fish Biology,

73(3), 740–745. https://doi.org/10.1111/j.1095-8649.2008.01962.x

Li, W., Jaroszewski, L., & Godzik, A. (2001). Clustering of highly homologous sequences to reduce the

size of large protein databases. Bioinformatics, 17(3), 282–283.

https://doi.org/10.1093/bioinformatics/17.3.282

Liang, R., Zhuo, X., Yang, G., Luo, D., Zhong, S., & Zou, J. (2012). Molecular phylogenetic relationships

of family Haemulidae (Perciformes: Percoidei) and the related species based on mitochon-

drial and nuclear genes. Mitochondrial DNA, 23(4), 264–277.

https://doi.org/10.3109/19401736.2012.690746

VIII

Mack, R. N., Simberloff, D., Lonsdale, W. M., Evans, H., Clout, M., & Bazzaz, F. A. (2000). Biotic Inva-

sions: Causes, Epidemiology, Global Consequences, and Control. Ecological Applications,

10(3), 689–710. https://doi.org/10.1890/1051-0761(2000)010[0689:BICEGC]2.0.CO;2

Mavruk, S., & Avsar, D. (2008). Non-native fishes in the Mediterranean from the Red Sea, by way of

the Suez Canal. Reviews in Fish Biology and Fisheries, 18(3), 251–262.

https://doi.org/10.1007/s11160-007-9073-7

Miller, T. L., & Cribb, T. H. (2007). Phylogenetic relationships of some common Indo-Pacific snappers

(Perciformes: Lutjanidae) based on mitochondrial DNA sequences, with comments on the

taxonomic position of the Caesioninae. Molecular Phylogenetics and Evolution, 44(1), 450–

460. https://doi.org/10.1016/j.ympev.2006.10.029

Moutopoulos, D. K., & Stergiou, K. I. (2002). Length-weight and length-length relationships of fish

species from the Aegean Sea (Greece). Journal of Applied Ichthyology, 18(3), 200–203.

https://doi.org/10.1046/j.1439-0426.2002.00281.x

Mueller, M., Pander, J., & Geist, J. (2018). Comprehensive analysis of >30 years of data on stream

fish population trends and conservation status in Bavaria, Germany. Biological Conservation,

226, 311–320. https://doi.org/10.1016/j.biocon.2018.08.006

Murty, V. S., Joshi, K. K., & Nair, R. J. (2003). Threadfin Breams. In M. Mohan Joseph & A. A. Jayapra-

kash (Eds.), Status of Exploited Marine Fishery Resources of India (pp. 120–126). Cochin:

CMFRI. Retrieved from http://www.cmfri.org.in

Nagalakshmi, K., Annam, P.-K., Venkateshwarlu, G., Pathakota, G.-B., & Lakra, W. S. (2016). Mislabel-

ing in Indian seafood: An investigation using DNA barcoding. Food Control, 59, 196–200.

https://doi.org/10.1016/j.foodcont.2015.05.018

Nakamura, J., Russell, B. C., Moore, G. I., & Motomura, H. (2018). Scolopsis meridiana, a new species

of monocle bream (Perciformes: Nemipteridae) from northern Australia. Zootaxa, 4500(2),

222. https://doi.org/10.11646/zootaxa.4500.2.4

Orrell, T. M., Carpenter, K. E., Musick, J. A., & Graves, J. E. (2002). Phylogenetic and biogeographic

analysis of the Sparidae (Perciformes: Percoidei) from cytochrome b sequences. Copeia,

2002(3), 618–631.

Parker, I. M., Rodriguez, J., & Loik, M. E. (2003). An Evolutionary Approach to Understanding the Bi-

ology of Invasions: Local Adaptation and General-Purpose Genotypes in the Weed Verbas-

cum thapsus. Conservation Biology, 17(1), 59–72. https://doi.org/10.1046/j.1523-

1739.2003.02019.x

Pimentel, D., Lach, L., Zuniga, R., & Morrison, D. (2000). Environmental and Economic Costs of Non-

indigenous Species in the United States. BioScience, 50(1), 53–65.

https://doi.org/10.1641/0006-3568(2000)050[0053:EAECON]2.3.CO;2

Por, F. D. (1978). The Migrant Biota. In Francis Dov Por (Ed.), Lessepsian Migration: The Influx of Red

Sea Biota into the Mediterranean by Way of the Suez Canal (pp. 87–170). Berlin, Heidelberg:

Springer Berlin Heidelberg. https://doi.org/10.1007/978-3-642-66728-2_4

Rach, J., Bergmann, T., Paknia, O., DeSalle, R., Schierwater, B., & Hadrys, H. (2017). The marker

choice: Unexpected resolving power of an unexplored CO1 region for layered DNA barcoding

approaches. PLOS ONE, 12(4), e0174842. https://doi.org/10.1371/journal.pone.0174842

Randall, J. E., & Heemstra, P. C. (1991). Revision of Indo-Pacific groupers: (Perciformes: Serranidae:

Epinephelinae) : with descriptions of five new species, (20), 332.

Rao, M. V. H., Ghosh, S., Sreeramulu, K., Mahesh, V. U., & Kumar, M. S. (2018). Dynamics of Nemip-

terus japonicus (Bloch) stocks along the north-east coast of India. INDIAN J. MAR. SCI.,

47(09), 8.

Rizkalla, S. I., Akel, E. S. H. K., & Ragheb, E. (2016). Biodiversity and fisheries of the non-target catch

from bottom trawl, off Alexandria, Mediterranean Sea, Egypt. Regional Studies in Marine

Science, 3, 194–204. https://doi.org/10.1016/j.rsma.2015.10.004

Robinson, O., Dylus, D., & Dessimoz, C. (2016). Phylo.io: interactive viewing and comparison of large

phylogenetic trees on the web. Molecular Biology and Evolution, 33(8), 2163–2166.

https://doi.org/10.1093/molbev/msw080

Roslin, T., Majaneva, S., & Clare, E. (2016). The use of DNA barcodes in food web construction—

terrestrial and aquatic ecologists unite! Genome, 59(9), 603–628.

https://doi.org/10.1139/gen-2015-0229

Rozas, J., Ferrer-Mata, A., Sánchez-DelBarrio, J. C., Guirao-Rico, S., Librado, P., Ramos-Onsins, S. E., &

Sánchez-Gracia, A. (2017). DnaSP 6: DNA Sequence Polymorphism Analysis of Large Data

Sets. Molecular Biology and Evolution, 34(12), 3299–3302.

https://doi.org/10.1093/molbev/msx248

Russel, B. C. (1990). Nemipterid fishes of the world: threadfin breams, whiptail breams, monocle

breams, dwarf monocle breams, and coral breams, family Nemipteridae: a annotated and il-

lustrated catalogue of nemipterid species known to date. Rome: Food and Agriculture Organ-

ization of the United Nations.

Russell, B. C., & Ho, H.-C. (2017). A new species of Nemipterus (Perciformes: Nemipteridae) and first

record of N. nematophorus (Bleeker) from Taiwan. Zootaxa, 4231(2), 281–288.

https://doi.org/10.11646/zootaxa.4231.2.10

Schunter, C., Carreras-Carbonell, J., Macpherson, E., Tintoré, J., Vidal-Vijande, E., Pascual, A., … Pas-

cual, M. (2011). Matching genetics with oceanography: directional gene flow in a Mediterra-

nean fish species. Molecular Ecology, 20(24), 5167–5181. https://doi.org/10.1111/j.1365-

294X.2011.05355.x

Sen, S., Dash, G. R., Mohammed, K. K., Sreenath, K. R., Mojjada, S. K., Fofandi, M. K., … Kumari, S.

(2014). Stock assessment of Japanese threadfin bream, Nemipterus japonicus (Bloch, 1791)

from Veraval water. IJMS Vol.43(4) [April 2014]. Retrieved from

http://nopr.niscair.res.in/handle/123456789/28641

Shirak, A., Dor, L., Seroussi, E., Ron, M., Hulata, G., & Golani, D. (2016). DNA barcoding of fish species

from the Mediterranean coast of Israel. Mediterranean Marine Science, 17(2), 459–466.

https://doi.org/10.12681/mms.1384

Spanier, E., & Galil, B. S. (1991). Lessepsian migration: a continuous biogeographical process. En-

deavour, 15(3), 102–106. https://doi.org/10.1016/0160-9327(91)90152-2

Stern, N., Jimenez, C., Huseyinoglu, M. F., Andreou, V., Hadjioannou, L., Petrou, A., … Rothman, S. B.

S. (2018). Constructing the genetic population demography of the invasive lionfish Pterois

miles in the Levant Basin, Eastern Mediterranean. Mitochondrial DNA Part A, 0(0), 1–7.

https://doi.org/10.1080/24701394.2018.1482284

Stern N., Levitt Y., Galil B. S., Diamant A., Yokeş M. B., & Goren M. (2014). Distribution and popula-

tion structure of the alien Indo-Pacific Randall’s threadfin bream Nemipterus randalli in the

eastern Mediterranean Sea. Journal of Fish Biology, 85(2), 394–406.

https://doi.org/10.1111/jfb.12421

Sultana, S., Ali, M. E., Hossain, M. A. M., Asing, Naquiah, N., & Zaidul, I. S. M. (2018). Universal mini

COI barcode for the identification of fish species in processed products. Food Research Inter-

national, 105, 19–28. https://doi.org/10.1016/j.foodres.2017.10.065

Sutherland, B., Stewart, D., Kenchington, E. R., & Zouros, E. (1998). The fate of paternal mitochondri-

al DNA in developing female mussels, Mytilus edulis: implications for the mechanism of dou-

bly uniparental inheritance of mitochondrial DNA. Genetics, 148(1), 341–347.

Swift, M. L. (1997). GraphPad Prism, Data Analysis, and Scientific Graphing. Journal of Chemical In-

formation and Computer Sciences, 37(2), 411–412. https://doi.org/10.1021/ci960402j

Tan, S. C., & Yiap, B. C. (2009). DNA, RNA, and Protein Extraction: The Past and The Present. Journal

of Biomedicine and Biotechnology, 2009, 1–10. https://doi.org/10.1155/2009/574398

XII

Tesfamichael, D., & Saeed, H. (2016). Common Names of Exploited Fish and Invertebrates of the Red

Sea. In D. Tesfamichael & D. Pauly (Eds.), The Red Sea Ecosystem and Fisheries (pp. 135–

190). Dordrecht: Springer Netherlands. https://doi.org/10.1007/978-94-017-7435-2_10

Tortonese, E. (1986). Serranidae. In P.J.P. Whitehead, M.-L. Bauchot, J.-C. Hureau, J. Nielsen and E.

Tortonese (eds.) Fishes of the north-eastern Atlantic and the Mediterranean (Vol. 2, pp. 780–

792). Paris: UNESCO.

Tsutsui, N. D., Suarez, A. V., Holway, D. A., & Case, T. J. (2000). Reduced genetic variation and the

success of an invasive species. Proceedings of the National Academy of Sciences, 97(11),

5948–5953. https://doi.org/10.1073/pnas.100110397

Vella, A., & Vella, N. (2016). Genetic barcoding and preliminary phylogenetic analysis of Serranidae

species from Maltese coastal waters, with a perspective on their Mediterranean phylogeog-

raphy. Natural and Engineering Sciences, 1(3), 66–77.

https://doi.org/10.28978/nesciences.286369

Vrijenhoek, R., & others. (1994). DNA primers for amplification of mitochondrial cytochrome c oxi-

dase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotech-

nology, 3(5), 294–299.

Ward, R. D., Hanner, R., & Hebert, P. D. N. (2009). The campaign to DNA barcode all fishes, FISH-BOL.

Journal of Fish Biology, 74(2), 329–356. https://doi.org/10.1111/j.1095-8649.2008.02080.x

Ward, Robert D, Zemlak, T. S., Innes, B. H., Last, P. R., & Hebert, P. D. . (2005). DNA barcoding Aus-

tralia’s fish species. Philosophical Transactions of the Royal Society B: Biological Sciences,

360(1462), 1847–1857. https://doi.org/10.1098/rstb.2005.1716

Waugh, J. (2007). DNA barcoding in animal species: progress, potential and pitfalls. BioEssays, 29(2),

188–197. https://doi.org/10.1002/bies.20529

Xia, X. (2012). Rapid evolution of animal mitochondrial DNA. In Rapidly Evolving Genes and Genetic

Systems (p. 73). OUP Oxford.

XIII

Xu, S.-Z., Li, Z.-Y., & Jin, X.-H. (2018). DNA barcoding of invasive plants in China: A resource for identi-

fying invasive plants. Molecular Ecology Resources, 18(1), 128–136.

https://doi.org/10.1111/1755-0998.12715

Yachdav, G., Wilzbach, S., Rauscher, B., Sheridan, R., Sillitoe, I., Procter, J., … Goldberg, T. (2016).

MSAViewer: interactive JavaScript visualization of multiple sequence alignments. Bioinfor-

matics (Oxford, England), 32(22), 3501–3503.

https://doi.org/10.1093/bioinformatics/btw474

XIV

II. Appendices

Figure S1: Gel image of COI amplcons from 99 fish specimens belonging to 60 Nemipterus spp. and 39 Serranus

cabrilla. Specimens are labelled with initials of the scientific names followed by reference to where they were ob-

tained from, for instance, the first specimen Sc S02 is Serranus cabrilla from Suez. Likewise, Sc Cy01 and Sc

L707 are S. cabrilla specimens from Cyprus and Lebanon, Nb RS01and NJ RS01are N. bipunctatus and N. japoni-

cus from the Red Sea, whereas NR L724 is N. randalli from Lebanon.

Table S: Details of Genbank sequences used in this study

Accession No. Species Sea Country Article

KY675462.1 Nemipterus bipunctatus Central Red Sea Saudi Arabia (Isari et al., 2017)

KY675935.1 Nemipterus japonicus Central Red Sea Saudi Arabia (Isari et al., 2017)

KC501463.1 Serranus cabrilla Eastern Mediterranean Turkey (Keskın & Atar, 2013)

KC501457.1 Serranus cabrilla Eastern Mediterranean Turkey (Keskın & Atar, 2013)

JQ623994.1 Serranus cabrilla Eastern Mediterranean Turkey

KM538543.1 Serranus cabrilla Eastern Mediterranean Israel (Shirak et al., 2016)

KM538538.1 Serranus cabrilla Eastern Mediterranean Israel (Shirak et al., 2016)

KM538539.1 Serranus cabrilla Eastern Mediterranean Israel (Shirak et al., 2016)

KM538541.1 Serranus cabrilla Eastern Mediterranean Israel (Shirak et al., 2016)

KM538540.1 Serranus cabrilla Eastern Mediterranean Israel (Shirak et al., 2016)

Figure S2: Segment of multiple alignment for Nemipterus species

XVI

Figure S3: Segment of multiple alignment for Serranus cabrilla

XVII