Systematics of Dyerophytum (Plumbaginaceae) with a focus on heterostyly and the evolution of endemic taxa from Socotra
Rachael Graham
20th August 2014
Thesis submitted in partial fulfilment for the MSc in the Biodiversity and Taxonomy of Plants
Abstract
Dyerophytum is shown to be a monophyletic genus consisting of four morphologically distinct species, and is placed in the Plumbaginoideae subfamily of Plumbaginaceae. Dyerophytum is placed as sister to a main clade of Plumbago, but this relationship is complicated by the unexpected sister relationship of Plumbago europaea to the monotypic genus Plumbagella micrantha. Within Dyerophytum, Dyerophytum africanum is placed as the earliest diverging lineage, while the two Socotran species form a clade sister to Dyerophytum indicum. Dating analysis estimates the origin of the Socotran clade to 1.82 MYA (0.71-3.10 MYA), which is much more recent than the current estimate for the separation of Socotra from the Arabian Peninsula, at approximately 18 MYA. This recent date strongly supports an origin of Dyerophytum on Socotra by long distance dispersal from Asia/Arabia, and adds to growing evidence supporting the role of both dispersal and vicariance in shaping the Socotran flora. Dyerophytum africanum and Dyerophytum indicum are confirmed to show dimorphic exine sculpturing which is characteristic of heterostyly. Pollen in the Socotran species appears to be monomorphic, indicating that heterostyly has been lost in this lineage, which is hypothesised to be the result of selective pressure on island colonisers to be self-compatible.
Acknowledgements
Firstly, I would like to thank Alan Forrest for his guidance and support throughout this project. Secondly, I would like to thank the many people who have assisted with the technical aspects of the project: Tiina Sarkinen for guidance and troubleshooting with the phylogenetic analyses, Frieda Christie for technical support and advice with scanning electron microscopy, Elspeth Haston for support with the herbarium work, and also Michelle Hollingsworth and Laura Forrest for the excellent training provided in molecular techniques. Thirdly, I wish to thank my fellow MSc students who have been so generous in sharing their valuable knowledge (and excellent cake). Lastly, I thank my family who have been so supportive of my academic ambitions, and always suspected that the girl with leaves and feathers in her pockets would grow up to be a scientist one day.
Table of Contents
Abstract
Acknowledgements
1. Introduction……………………………………………………………………….….1 1.1. General Introduction……………………………………………………………1 1.2. Introduction to Plumbaginaceae………………………………………………..1 1.3. Introduction to Dyerophytum…………………………………………………...3 1.4. Introduction to Heterostyly……………………………………………………..5 1.4.1. History and Definition………………………………………………...…5 1.4.2. Floral Polymorphisms…………………………………………………....7 1.4.3. Genetic Basis of Heterostyly……………………………………………..9 1.4.4. Origins of Heterostyly…………………………………………………..11 1.4.5. Evolution of Heterostyly…………………………………………….….11 1.4.6. Heterostyly in Plumbaginaceae………………………………………...13 1.5. Introduction to Socotra………………………………………………………...16 1.5.1. Geology and Climate……………………………………………………16 1.5.2. Endemism and Vegetation Types………………………………………18 1.5.3. Floristic Affinities……………………………………………………….19 1.5.4. Biogeographic Patterns……………………………………………..…..20 1.6. Hypotheses and Aims of Project…………………………………..…………..23 2. Materials and Methods……………………………………………………….…….26 2.1. Taxonomic Sampling…………………………………………………...………26 2.2. Molecular Techniques……………………………………….…………………26 2.3. Phylogenetic Analysis…………………………………………………………..28 2.4. Molecular Dating Analysis……………………………………...……………..29 2.5. Morphology……………………………………………………………………..30 2.5.1. Character Analysis………………………………………………...……30 2.5.2. Scanning Electron Microscopy………………………………...………33 3. Results……………………………………………………………………………….34 3.1. Phylogenetic Analysis…………………………………………………………..34 3.1.1. Combined Plastid Analysis…………………………………………..…36 3.1.2. ITS Analysis…………………………………………………………..…38
3.1.3. Combined Plastid and Nuclear Analysis………………………..……..40 3.2. Molecular Dating Analysis………………………………………………….....42 3.3. Morphometric Ordination Analysis…………………………………….…….44 3.4. Scanning Electron Microscopy………………………………………….…….48 4. Discussion……………………………………………………………………………57 4.1. Phylogenetic Position of Dyerophytum……………………………………...…57 4.2. Relationships in Dyerophytum……………………………………………...….58 4.3. Biogeography…………………………………………………………………...60 4.4. Morphological Characters……………………………………………………..66 4.5. Taxonomy……………………………………………………………………….69 4.6. Heterostyly……………………………………………………………………...73 5. Conclusions………………………………………………………………………….77 6. Taxonomic Revision………………………………………………………………...78 7. References…………………………………………………………………………...82 8. Appendix…………………………………………………………………………….96
List of Figures
Figure 1.4.1.a: Diagram showing difference in length of style and stamens in distylous flowers
Figure 1.4.1.b: Diagram showing difference in length of style and stamens in tristylous flowers
Figure 1.4.2.a: Diagram showing difference in morphology of stigmatic papillae between papillate and cob stigmas
Figure 1.5.1.a: Map showing location of the islands of the Socotra archipelago
Figure 2.5.1.a: Diagrams showing morphological characters measured
Figure 3.1.1.a: Bayesian consensus tree for combined plastid dataset.
Figure 3.1.2a: Bayesian consensus tree for ITS dataset
Figure 3.1.3a: Bayesian consensus tree for combined plastid and nuclear dataset
Figure 3.2.a: Dated maximum clade credibility tree for combined plastid and nuclear dataset
Figure 3.3.a: PCA analysis showing principal components 1 and 2
Figure 3.3.b: PCA analysis showing principal components 1 and 3
Figure 3.3.c: PCA analysis showing principal components 2 and 3
Figure 3.4.a: Electron micrographs of pollen grains in Dyerophytum africanum (collection no. 127)
Figure 3.4.b: Electron micrographs of pollen grains in Dyerophytum africanum (collection no. 6371)
Figure 3.4.c: Electron micrographs of pollen grains in Dyerophytum indicum (collection no. 729)
Figure 3.4.d: Electron micrographs of pollen grains in Dyerophytum indicum (collection no. 2251)
Figure 3.4.e: Electron micrographs of pollen grains in Dyerophytum pendulum (collection no. 217)
Figure 3.4.f: Electron micrographs of pollen grains in Dyerophytum pendulum (collection no. 14041)
Figure 3.4.g: Electron micrographs of pollen grains in Dyerophytum socotranum (collection no. 359)
Figure 3.4.h: Electron micrographs of pollen grains in Dyerophytum socotranum (collection no. 8684)
Figure 4.3.a: Distribution map of Dyerophytum pendulum on Socotra
Figure 4.3.b: Distribution map of Dyerophytum socotranum on Socotra
Figure 4.3.c: Geological map of Socotra
Figure 4.5.a: Photographs showing representative leaf shapes in herbarium specimens of Dyerophytum
Figure 4.5.b: Photographs showing representative floral morphology in herbarium specimens of Dyerophytum
List of Tables
Table 2.2.a: Primers used in this study
Table 2.5.1.a: List of characters measured for morphometric analysis
Table 3.1.a: Summary of alignment statistics
Table 3.3.a: Contributions of morphological characters to each principal component
Table 3.3.b: Eigenvalues and percentage variance accounted for by each principal component
Table 4.4.a: combinations of character states in Dyerophytum indicated by PCA analysis
List of Appendices
8.1: Provenance and voucher information for DNA samples extracted
8.2: Accession numbers of sequences downloaded from GenBank
8.3: List of herbarium specimens included in morphometric analysis and in taxonomic revision
8.4: Provenance and voucher information for samples studied using SEM
8.5: Morphometric data used in PCA analysis
8.6: Summary statistics for morphometric data
1. Introduction
1.1. General Introduction
This is a study of the evolution of Dyerophytum, concentrating on the evolution of insular endemic taxa from Socotra. This will include an analysis of species level systematics of Dyerophytum and its position within the wider Plumbaginaceae phylogeny. As part of this, a morphometric analysis and taxonomic revision will be carried out to delimit taxa and establish the correct names to be applied. In addition, the systematic analysis will provide a framework to allow an analysis of the biogeographic history of Dyerophytum. Investigation will also be carried out into pollen heteromorphism in Dyerophytum in an effort to understand the evolution of heterostyly in this genus.
1.2. Introduction to Plumbaginaceae Juss.
The Plumbaginaceae family consists of around 27 genera and 650 species (Kubitzki, 1993), although it has been suggested that there may be in excess of 1000 species (Lledo, et al., 1998). Most species are shrubs, climbers or herbs with simple, exstipulate, spirally arranged leaves which often have secretory glands on their surface (Heywood, 1993). Plumbaginaceae has a cosmopolitan distribution, with representatives in the temperate and tropical Old and New World as well as in the Southern Hemisphere, but appears to have its centre of diversity in the mountains of central Asia (Kubitzki, et al., 1993) The family primarily grows in cool alpine areas, and also in saline coastal areas where they are often a dominant component of the vegetation (Heywood, 1993). Plumbaginaceae is recognised as a highly stress tolerant and halophytic plant family (Hanson, et al., 1994) and many of its species are adapted to their saline habitat by the presence of excretory salt glands (Liphschitz & Waisel, 1982).
The family is generally considered monophyletic on the basis of a set of uniting floral characters (De Laet, et al., 1995) and is supported by molecular data (Lledo, et al., 1998). Plumbaginaceae flowers are characterised as being hermaphrodite, actinomorphic and pentamerous, with single whorls of persistent sepals, fused petals and stamens (Hickey & King, 1988). In addition, they possess a superior ovary with one locule containing a single bitegmic cracinucellate basal ovule (Hutchinson, 1973). On the basis of these placentation and ovule characters Plumbaginaceae was placed along with Polygonaceae as separate orders (Plumbaginales and Polygonales) within the Caryophyllidae (Cronquist, 1968). The remaining families in the Caryophyllidae made up the Caryophyllales order and generally
1 corresponded to Eichler’s Centrospermae (=central-seeded) (Eckardt, 1976). However, this placement within Caryophyllidae was uncertain as both Plumbaginaceae and Polygonaceae lack the betalain pigments (Mabry, 1977) and unique P3-type plastids (Behnke & Turner, 1971) that characterise most of the Caryophyllales (betalains absent in Caryophyllaceae and Molluginaceae).
Doubts about the relationship of Plumbaginaceae and Polygonaceae to Caryophyllales led to some authors placing them in more distant positions. Dahlgren placed each family in their own order, while other authors found evidence linking these families to other parts of the angiosperm tree (Giannasi, 1992). Unusually, the stamens in Plumbaginaceae are attached opposite the corolla lobes (Clinckemaillie & Smets, 1992). This character, along with the presence of anthocyanin pigments and S-type rather than P-type plastids in both Plumbaginaceae and Primulaceae (Nowicke & Skvarla, 1977) led some authors to place them together in the order Primulales (Hutchinson, 1973; Thorne, 1992). It is now understood that many of the similarities between Plumbaginaceae and Primulaceae are likely to be the result of homoplasy (Clinckemaillie & Smets, 1992) and some characters such as pollen do not support this relationship (Nowicke & Skvarla, 1977).
Early molecular work (Giannasi, 1992) began to clarify the position of Plumbaginaceae, confirming its sister relationship to Polygonaceae and refuting suggestions of a close relationship with Primulacae. The sister pair were placed close to the betalain-containing Caryophyllales sensu stricto. Later work on the angiosperm phylogeny has supported this placement of Plumbaginaceae (Savolainen, et al., 2000a; 2000b; Soltis, et al., 2000; Chase, et al., 1993; Downie & Plamer, 1994; Fay, et al., 1997; Ledo, et al., 1998; Meimberg, et al., 2000) and found additional families which fall within a clade containing Caryophyllales s.s., including: Droseracae, Drosophyllaceae, Nepenthaceae, Asteropeiaceae, Physenaceae, Ancistrocladaceae, Dioncophyllaceae, Frankeniaceae, Rhabdodendraceae, Simmondsiaceae, and Tamaricaceae (Albert, et al., 1992; Chase, et al., 1993; Fay, et al., 1997; Ledo, et al., 1998; Hoot, et al., 1999; Meimberg, et al., 2000; Savolainen, 2000a; 2000b; Williams, et al., 1994; Morton, et al., 1997). As a result of this phylogenetic evidence the Caryophyllales order has been expanded, retaining the betalain-containing Caryophyllales s.s as the “core” Caryophyllales, while the additional families (including Plumbaginaceae) now form the “non-core” Caryophyllales (APG, 1998), making a total of 26 families within Caryophyllales sensu lato (Cuénoud, et al., 2002).
2
Within Plumbaginaceae, two distinct subgroups have long been recognised (Ledo, et al., 2001), and variously treated as tribes, subfamilies or separate families. The two groups are supported by both morphological and biochemical characters, with the Plumbaginoideae subfamily characterised by having leafy stems, more or less connate styles, filaments free from petals, and pentavalvate capsular fruits; while members of the Staticoideae subfamily generally have rosulate leaves, styles more or less free, filaments adnate to petal base, and utriculate or pyxidiate fruits (Ledo, et al., 1998). Chemical analysis also strongly supports this grouping as the Plumbaginoideae all contain plumbagin in their roots, while this compound is absent in Staticoideae, and the two groups also differ in their flavonoid composition (Harborne, 1967). This split within the family has been confirmed by evidence from plastid phylogenies (Ledo, et al., 1998; 2001) and places 4 genera in the Plumbaginoideae subfamily (Dyerophytum Kuntze, Plumbago L., Ceratostigma Bunge and Plumbagella Spach), while the remaining genera are placed in the more diverse Staticoideae subfamily, which has three main genera (Limonium Mill., Armeria Willd., and Acantholimon Boiss.) and a number of other small and monotypic genera (Lledo, et al., 2005).
1.3. Introduction to Dyerophytum
Dyerophytum is a small genus of shrubs and trees in the Plumbaginoideae subfamily of Plumbaginaceae (Cuénoud, et al., 2002; Lledó, et al., 2001; 2005) with an unusual disjunct distribution, being found in south-western Africa, India, Arabia and the island of Socotra (Weber-El Ghobary, 1986). Dyerophytum differs from the other members of the subfamily (Plumbago, Ceratostigma and Plumbagella) in its calyx being membranous, 5-winged and eglandular, corolla funnel-shaped and longer than calyx, and stamens free from the petals (Wright, 1909; Clarke, 1882; Welman, 2000; Zhengyi, et al., 1996; Hutchinson, 1973). Relationships of Dyerophytum to the other genera in Plumbaginoideae are currently unclear, as no appropriate phylogeny has been constructed. Previous molecular studies aiming to investigate higher level relationships in Plumbaginaceae and Caryophyllales have placed Dyerophytum as either sister to (Cuénoud, et al., 2002) or nested within (Lledó, et al., 2001; 2005) Plumbago, with Ceratostigma placed as the earliest diverging genus in the subfamily. It appears that the monotypic genus Plumbagella has never been included in any phylogenetic studies, so its relationship to Dyerophytum is unknown.
Dyerophytum is of palynological interest, like many other members of the Plumbaginacae family (Ferrero, et al., 2009a), as it is reported to show dimorphism in the exine sculpturing
3 of its pollen which indicates that the flowers are heterostylous (Weber-El Ghobary, 1986). Dyerophytum is also of cultural interest on Socotra where the plants have value as fodder for livestock, can be woven into bird traps, are dried and smoked as a tobacco substitute, and are used as a salt substitute in cooking due to the powdery salty coating on the leaves (Miller & Morris, 1988)
The genus was first published as Vogelia Lam. by Lamarck (1792) in honour of the German botanist Vogel (Drury, 1869) based on an illustration of material from southern Africa, corresponding to Vogelia africana Lam. A second species of Vogelia was published by Wight (1847) from Indian material sent by J.E. Stokes. In Stokes’ notes the new species was named V. perfoliata (Stocks ex Wight) due to the perfoliate attachment of the leaves to the stem, but Wight chose to name it after its country of origin and published the species as V. indica (Gibs. ex Wight). Morphologically similar material found in Oman was published the following year as a third species: V. arabica Boiss. (Boissier, 1848), but some authors later considered V. indica (Gibs. ex Wight) to be a synonym of V. arabica Boiss. (Drury, 1869; Almeida, 2001).
Decades later, the first Socotran specimens of the genus were discovered and were examined by Balfour (1888) who considered this material to belong to two distinct forms. One form was concluded to be an insular variety of V. indica rather than a distinct species, although it differed in a number of characters, so he published these specimens as V. indica (Gibs ex Wight) var. socotrana Balf.f. The other specimens were very morphologically distinct and believed to more closely resemble V. africana in their leaves, although differed from the African specimens in their floral characters, so were considered a distinct species. Balfour published this species as V. pendula Balf.f., noting its long hanging branches (Balfour, 1884).
Kuntze (1891) subsequently replaced the name Vogelia Lam. with Dyerophytum Kuntze in honour of the then Director of the Royal Botanic Gardens Kew, William Turner Thiselton- Dyer. This change was necessary as Vogelia had been previously published by both F.K. Medikus (1792) for plants belonging to Brassiciaceae and by J.F. Gmelin (1791) for plants belonging to Burmanniaceae (IPNI), so Vogelia Lam. is a later homonym and had to be abandoned. Kuntze (1891) published the replacement names: D. indicum (Gibs. ex Wight) Kuntze, D. africanum (Lam.) Kuntze and D. pendulum (Balf.f.) Kuntze, making no mention of V. arabica. Over a century later the new combination D. arabicum (Boiss.) M.R.Almeida was published (Almeida, 2001), but this name is often considered to be a synonym of D.
4 indicum (Gibs. ex Wight) Kuntze (Cooke, 1908; Clarke, 1882; Ghazanfar, 2007; Almeida, 1990).
Most recently, D. indicum (Gibs ex Wight) Kuntze var. socotrana Balf.f. was unofficially raised to species level as D. socotranum J.R. Edmondson. The new name had been written on herbarium specimens of D. indicum var. socotrana by Edmondson and was adopted into usage without ever being effectively published (Edmondson, personal communication). The name appeared in the 1997 IUCN Red List (Walter & Gillett, Eds., 1998) and World List of Threatened Trees (Oldfield, et al., 1998) as D. socotrana J.R. Edmondson and was later corrected to D. socotranum in the current IUCN Red List (Miller, 2004).
For the purposes of this study the following names will be used in the analyses: D. indicum, D. africanum, D. pendulum and D. socotranum, but the taxonomic status of these species and the application of names will be discussed as part of the taxonomic revision of Dyerophytum.
1.4. Introduction to Heterostyly 1.4.1. History and Definition
Botanists first noted the presence of species with different forms of hermaphrodite flowers in the 16th century (Cohen, 2010). This phenomenon was termed heterostyly by Hildebrand in 1867, describing a breeding system in which plants of a single species have two or three different forms of flowers which differ in the ratio of style to stamen length (Vuilleumier, 1967). Darwin modified this definition of heterostyly, limiting it to cases in which plants of each floral form are both self-incompatible and incompatible with other plants of the same floral form (Ganders, 1979). Darwin extensively studied heterostyly, particularly in the genus Primula L. (Primulaceae) and published his landmark book on the subject of heterostyly The Different Forms of Flowers on Plants of the Same Species in 1777, which was the starting point for research into the subject (Weller, 2009).
Heterostyly can be defined as the presence of two or more floral morphs within a species that exhibit reciprocal herkogamy (Barrett & Shore, 2008; Cohen, 2010), where herkogamy is defined as the spatial separation of pollen presentation and receipt within or between flowers of an individual plant (Webb & Lloyd, 1986). In most cases heterostyly manifests itself as distyly (see Figure 1.4.1.a) where two floral morphs occur, one with a long style and short stamens (the long style or “pin” form), the other with a short style and long stamens (the short
5 style or “thrum” form). The size difference between the floral organs is generally consistent within a species, with the style length in one morph corresponding to stamen length in the other morph and vice versa (Ganders, 1979). In rare cases a species can possess three different floral morphs so are termed tristylous (see Figure 1.4.1.b). In these plants two sets of stamens are present at different heights in the flower, so the style can exist in three positions: above the stamens (long style form), between the two sets of stamens (mid style form), or below the stamens (short style form) (Ganders, 1979). Difference in stamen height between morphs is often due to differences in the growth of the filaments during floral development (Dulberger, 1975), or in cases where stamens are epipetalous the dimorphism can be achieved by differential elongation of the corolla tube (Faivre, 2000). Differences in style height can also occur through different developmental routes, with some species showing structural dimorphism early in bud development and others showing differences in style growth rates in later stages of development (Faivre, 2000). These developmental differences result in the longer style containing more and/or longer stylar epidermal cells (Cohen, 2010).
Figure 1.4.1.a: Diagram showing difference in length of style and stamens in distylous flowers.
Figure adapted from Ganders (1979)
6
Figure 1.4.1b: Diagram showing difference in length of style and stamens in tristylous flowers.
Figure adapted from Ganders (1979)
1.4.2. Floral Polymorphisms
In addition to differences in style and stamen length, there are a number of other heteromorphic morphological characters associated with the heterostylous condition. Often the length of the corolla differs between morphs, with the short style (SS) morph having a longer corolla tube than the long style (LS) morph (Cohen, 2010), as is observed in some species of Lithospermum L. (Boraginaceae) (Levin, 1968). The corolla may also show dimorphism in the number or location of trichomes, such as in Pentanisia Harv. (Rubiaceae) where the SS morph has greater pubescence on the inner surface of the corolla tube than the LS morph (Massinga, et al., 2005).
Within the gynoecium not only does the length of the style differ, but in many cases the stigma shows dimorphism in size and in morphology of the surface cells (Dulberger & Ornduff, 2000). According to Dulberger (1974) stigma dimorphism occurs in 39 of the 53 heterostylous genera examined. Differences in stigma size occur occasionally, such as in Jepsonia heterandra Eastw. (Saxifragaceae) (Ornduff, 1971), where LS flowers have much larger stigmas than SS flowers, and a difference in stigma shape between morphs can be observed in Primula (McCubbin, 2008). Much more commonly in heterostylous species, there is dimorphism in size and shape of the papillae on the stigmatic surface, with LS morphs having longer papillae than SS morphs (Ganders, 1979). This papillae dimorphism is particularly striking in some members of the Plumbaginaceae family where the LS morph has a “papillate” stigma with longer papillae than the “cob” stigma of the SS morph (Baker,
7
1966) (see Figure 1.4.2.a). It has also been shown that these two stigma types can differ in the surface properties of their papillae, as Dulberger (1987) found dimorphism in both cuticle texture and chemical composition of papillate and cob stigmas. The difference in cuticle was observed to differentially affect the adherence of pollen grains, with pollen from long style flowers adhering more successfully to stigmas of short style flowers and vice versa.
Figure 1.4.2.a: Diagram showing difference in morphology of stigmatic papillae between papillate and cob stigmas
Figure adapted from Baker (1966)
Linked to differences in stigma morphology is heteromorphism in pollen, which was observed in 50 out of 55 heterostylous genera studied by Dulberger (1974). Most commonly, heterostylous plants show a dimorphism in pollen grain size, with the long stamens of the SS flowers usually producing larger grains than the shorter anthers of the LS flowers, although the reverse pattern is occasionally seen (Cohen, 2010). In tristylous species the mid style flowers may produce pollen intermediate in size between LS and SS pollen (Ganders, 1979). Difference in pollen grain size appears to correlate with the quantity of pollen produced, so flowers either produce many small grains or fewer larger grains (Cohen, 2010). This relationship has been demonstrated by Piper & Charlesworth (1986) who found that anthers from LS flowers produced approximately twice as many pollen grains as anthers from SS flowers in Primula vulgaris Huds.
In addition to heteromorphism in size, some heterostylous species produce pollen grains with different shapes, such as Lithospermum caroliniense MacMill. (Boraginaceae) where the LS flowers produce unusual dumbbell-shaped grains while the SS flowers produce ellipsoid grains (Cohen, 2010). Rarely, pollen grains show a striking dimorphism in colour between
8 morphs. This has been observed in Linum suffruticosum L. (Linaceae) which produces brick- red pollen from its LS flowers and white pollen from it SS flowers (Rogers, 1979). A further dimorphism is present in some heterostylous groups which show differences in ornamentation of the exine (the durable outer layer of the pollen grain (Ariizumi & Toriyama, 2011)) (Ganders, 1979). This feature is particularly well studied in the Plumbaginaceae (Baker, 1948), but is also present in members of its sister family Polygonaceae (Hong, 1999), as well as Oleaceae (Pandey & Troughton, 1974), Gentianaceae (Wolfe, et al., 2009) and Rubiaceae (Naiki & Nagamasu, 2003). It is hypothesised that these dimorphisms in pollen morphology are linked to stigma dimorphism, with the two acting as a type of lock and key mechanism regulating the germination of pollen grains (Cohen, 2010).
1.4.3. Genetic Basis of Heterostyly
Apart from the dimorphic morphological features associated with heterostyly, the other important component of this breeding system is the physiological self-incompatibility system that works to prevent fertilisation within a plant or between plants of the same floral morph (Weller, 2009). Darwin noticed this incompatibility between different floral morphs, so termed fertilisation between flowers of different morphs as “legitimate crosses” and fertilisation between flowers of the same morph as “illegitimate crosses”. He noted from his experimental work that more viable seed was produced by legitimate crosses than illegitimate crosses (Vuilleumier, 1967). It is widely accepted that the heteromorphism in style and stamen height associated with heterostyly is an adaptation to promote animal-mediated pollination (Dulberger, 1975) and acts by manipulating the placement of pollen on the body of the pollinator, as demonstrated by Wolfe & Barrett (1989). It is generally thought that this heteromorphism is a mechanical system separate from the physiological incompatibility system. Together these two mechanisms act to promote outcrossing between individual plants, thereby reducing the deleterious effects of inbreeding depression (Charlesworth & Charlesworth, 1987). However it is less clear whether “secondary” heteromorphic characters such as differences in stigmatic papillae and in pollen features are also independent, or whether they are directly involved in the physiological incompatibility system (Dulberger, 1975).
Genetic evidence has shed light on the connection between these morphological characters and incompatibility in heterostylous species. Early explanations for the genetic basis of heterostyly suggested that it was under the control of a single gene with two alleles: S and s.
9
It was shown that long style plants had the genotype homozygous for the recessive allele (ss) while short style plants were heterozygous (Vuilleumier, 1967). This was shown by Bateson & Gregory (1905) through crossing experiments in Primula, which demonstrated that heterostyly had a Mendelian pattern of inheritance. They found that LS plants crossed with each other always produced LS offspring (so were homozygous), while SS plants crossed with each other produced a mixture of SS and LS plants in a ratio of approximately 3:1, as expected for heterozygotes. The higher proportion of SS plants in the F1 generation indicated that that the allele for short styles was dominant over the allele for long styles. This experiment would have produced some homozygous (SS genotype) plants which are known to have a short style phenotype; however these forms are rare in nature (Vuilleumier, 1967). This diallelic (two allele) system contrasts with the type of self-incompatibility system commonly seen in non-heterostylous plants, which is controlled by a single highly polymorphic locus (multiallelic), making each individual compatible with almost every other individual in the population (Allen & Hiscock, 2008). It therefore appears that diallelic self- incompatibility is the less efficient system, as each individual is only compatible with half the population, raising questions as to how this system could be selected for over an apparently efficient multi-allelic system (Ganders, 1979).
Later work on the genetic basis of heterostyly demonstrated that the single locus model is an over-simplification, and that actually the syndrome is under the control of set of linked genes acting as a supergene (Lewis, 1949). These genes have been named based on the characters they control: G/g (gynoecium and gynoecial incompatibility type), A/a (androecium), and P/p (pollen and pollen incompatibility type) (Cohen, 2010). The partial independence of genes controlling heterostyly-related characters in this model accounts for the presence of species which possess some components of the heterostylous syndrome but not others. For example, Salvia brandegeei Epling (Lamiaceae) shows dimorphism in style and stamen length, but has no associated characters such as pollen dimorphism and possesses no self-incompatibility system (Barrett, et al., 2000), whereas Linum pubescens Banks & Sol. (Linaceae) shows dimorphism in style and stamen length and a functioning self-incompatibility sytem but has none of the typical heteromorphism in pollen size, shape or exine ornamentation (Dulberger, 1973). Many different combinations of heterostylous characters have been observed in the Plumbaginaceae family where heterostyly expression is particularly; for example Armeria maritima (Mill.) Willd. which has dimorphism in stigma and pollen morphology but no difference in style and stamen length between morphs (Baker, 1966).
10
1.4.4. Origins of Heterostyly
This variability in expression of heterostyly is a reflection of its polyphyletic origins. The breeding system has been reported in 28 angiosperm families (Barrett & Shore, 2008) but in many of these families it is present in only a few genera (Ganders, 1979). These 28 families (equating to 7.5% of all angiosperm families (Cohen, 2010)) are in disparate parts of the angiosperm tree, with heterostyly occurring in both monocots and eudicots, however it is absent in the Magnoliids and early diverging eudicots, so does appear to be correlated with the presence of more advanced floral structure. There appear to be no few other factors linking heterostylous taxa, with representatives in a variety of habitats and on every continent except Antarctica, although it does appear that the majority of heterostylous taxa are perennial rather than annual (Ganders, 1979). Darwin (1877) noted the presence of heterostyly in distantly related families and recognised that the syndrome must have arisen independently many times. Therefore when trying to understand the origin and evolution of heterostyly, it is important to recognise that these breeding systems are the result of convergent evolution of floral morphology, genetics and physiology in distantly related lineages as an adaptation to shared selection pressures (Ganders, 1979).
Not only has heterostyly arisen multiple times in the angiosperm tree, but even within families there appear to have been multiple origins of heterostyly, as well as multiple reversions to the non-heterostylous state (Cohen, 2010). Only one family (Menyanthaceae) has been reconstructed as ancestrally heterostylous (Cohen, 2010) when character states are mapped onto a phylogeny, indicating that heterostyly has a shared origin for taxa in this lineage. However, there are several examples within this family of species that have reverted to an isomorphic and self-compatible state as well as some that have become functionally dioecious (Tippery, et al., 2008). Heterostyly has also been shown to be the ancestral state of some genera, such as Primula (Mast, et al., 2007), however in the majority of cases the presence of multiple heterostylous lineages within a group are the result of parallel evolution (Cohen, 2010). For example, in the tribe Lithospermae (Boraginaceae) ancestral state reconstruction suggests that monomorphism is the ancestral state and that there have been at least four independent origins of heterostyly in this clade (Ferrero, et al., 2009b).
1.4.5. Evolution of Heterostyly
Given the complexity of the heterostylous syndrome and the number of independent origins of this breeding system in angiosperms it has been challenging to produce general
11 explanations of its evolution. In particular, there is difficulty in determining whether the evolution of a diallelic self-incompatibility system precedes or follows the evolution of dimorphic floral features, and whether diallelic self-incompatibility arose from a multi-allelic or self-compatible ancestral state (Cohen, 2020). An individual with a diallelic self- incompatibility system arising from a multi-allelic population would be at a great disadvantage compared the rest of the population as it would be compatible with much fewer individuals. It has therefore been suggested that the diallelic system must have arisen from a self-compatible ancestral state, as diallelic self-incompatibility would never be selected for in preference to the more efficient multi-allelic system (Ganders, 1979). This thinking contrasts with the suggestion by Crowe (1964) that the diallelic system evolved by gradual loss of alleles from the multi-allelic system, somehow leaving two alleles remaining, one of which is dominant over the other.
An alternative explanation from Vuilleumier (1967) is that self-compatibility arose from a multi-allelic self-incompatible ancestor by loss of all incompatibility alleles. This transition from outcrossing to inbreeding in a lineage has been hypothesised to be favourable under certain conditions such as in cases of long distance dispersal and colonisation of disturbed habitats where the ability to self-fertilise may be highly advantageous (Stebbins, 1957). A later change in selective pressures could then have resulted in diallelic self-incompatibility subsequently evolving using different alleles (Vuilleumier, 1967). A similar hypothesis was formalised with mathematical models by Charlesworth & Charlesworth (1979) who suggested series of events in which a diallelic incompatibility system could arise from within a self-compatible population suffering inbreeding depression, by dimorphism of stigma and pollen features. This is then followed by the evolution of reciprocal dimorphism in style and stamen length. It is thought that the physiological self-incompatibility system and floral dimorphism in heterostyly reinforce each other, and as the genes controlling these characters are strongly linked, any increase in selective pressure for outbreeding is likely to enhance both sets of traits. Differing levels of selective pressure could result in different levels of expression of heterostylous characters (Vuilleumier, 1967), leading to the variable heterostyly seen in groups like the Plumbaginaceae (Baker, 1948).
To summarise, it is clear that heterostyly has polyphyletic origins and is therefore the result of convergent evolution in many, often distantly related, lineages of plants. Within these lineages there are many examples of losses and gains of this character and between lineages there is great variation in the expression of the heterostylous syndrome. Heterostyly is
12 therefore a rather plastic character and its expression, as well as pattern of loss and gain in each group of plants, is likely to reflect the selection pressures specific to that lineage. It has therefore been difficult to develop general models to explain the evolution of this complex trait.
1.4.6. Heterostyly in Plumbaginaceae
The Plumbaginaceae family contains many heterostylous taxa as well as a number of monomorphic self-compatible taxa (Baker, 1948). Within the heterostylous taxa there is much variation in the expression of dimorphic characters related to heterostyly, making the family of great interest to those trying to understand the evolution of this complex breeding system (Ferrero, et al., 2009a). Heterostyly is present in both subfamilies of Plumbaginaceae, but in each of these lineages it is expressed quite differently so it has been suggested that the condition has evolved independently in Plumbaginoideae and Staticoideae (Baker, 1966). Within the Staticoideae, some taxa such as Limonium vulgare Mill. show all the typical features associated with heterostyly, including dimorphism in style and stamen length, stigma morphology and pollen exine sculpturing, and have been demonstrated to be self- incompatible (Baker, 1966). Most of the Staticoideae have two distinct stigma types: papillate (LS) and cob (SS), as illustrated in Figure 1.4.2.a. These stigma types are associated with dimorphic exine sculpturing, with LS flowers producing type B pollen which has a covering fine spines arranged randomly or in polygons, while SS flowers produce type A pollen which has very distinct polygonal areoles on its surface formed by rows of rods with swollen ends (Baker, 1948).
This set of heterostylous characters is present in most members of the Genuinae subsection of Limonium, however in most other sections of Limonium, as well as in Armeria and Limoniastrum Moench pollen and stigma dimorphism occurs but the style and stamen dimorphism usually characteristic of heterostyly is not present (Baker, 1966). Goniolimon Boiss. and Acantholimon exhibit pollen dimorphism but lack both style and stamen dimorphism as well as differences in stigma morphology (Baker, 1966). A number of species in these genera have been shown to be fully self-incompatible and are only fertile when fertilised with pollen from the other floral morph (Baker, 1948; 1966). In the small genus Aegialitis R. Br., which is thought to be the earliest diverging lineage within the subfamily (Lledó, 2001), there is no evidence for heterostyly so the flowers and pollen are considered completely monomorphic, although incompatibility has not been investigated in this group
13
(Baker, 1966). Aegialitis pollen is considered to most closely resemble that of Plumbago rather than other members of the Staticoideae due to the pattern of exine sculpturing, and this has prompted suggestion that the genus actually belongs within Plumbaginoideae (Weber-El Ghobary, 1984). Complete monomorphism of floral features and pollen is also found in Limonium sections: Arthrolimon, Pterolimon and Circinaria, and in some populations of Armeria. In most cases the pollen found in these monomorphic groups is of type A morphology (Baker, 1966).
Within the Plumbaginoideae subfamily there has been much disagreement about the presence or absence of heterostylous characters. According to Baker (1948), Dahlgren reported slight dimorphism in stigma morphology and in pollen grain size in Plumbago, although Baker dismisses this and describes all genera in this subfamily as monomorphic. In the same study, the pollen grains of Plumbaginoideae are described deeply tricolpate with an ornamentation of blunt spines. However in a later study Baker (1966), he appears to agree with Dahlgren that Plumbago shows dimorphism in pollen grain size and is therefore heterostylous. Confusingly, in his diagram of proposed series of events for the evolution of heterostyly in Plumbaginaceae that appears in the same paper, Baker still classes Plumbaginoideae as having monomorphic pollen. Monomorphism in the monospecific genus Plumbagella is confirmed though and is supported by reports of extensive self-fertilisation (Baker, 1966).
More recent work has confirmed the presence of pollen dimorphism in Plumbago and Ceratostigma. Nowicke & Skvarla (1977) found dimorphism in exine sculpturing in Plumbago europaea L. and Ceratostigma grifithii C.B. Clarke, with images clearly showing a contrast between pollen grains with pointed verrucae and grains with rounded verrucae. The authors though were cautious in recognising this heteromorphism as true heterostyly without more extensive sampling or investigation of associated characters. An investigation of breeding strategy in Plumbago auriculata Lam. (Ferrero, et al., 2009a) convincingly demonstrated heterostyly in this species, as they found two distinct self-incompatible floral morphs which showed style and stamen length dimorphism. These morphs also possessed dimorphism in corolla length, and in pollen grain size and quantity between morphs, although they reported no obvious difference in exine sculpturing.
In the two Dyerophytum species studied (D. indicum and D. africanum) evidence of heterostyly has also been reported. According to Weber-El Ghobary (1986), Dahlgren found evidence of two floral morphs in each species differentiated by dimorphism in the size and
14 shape of the stigmas and in their stigmatic surface. However, like many other species in the Plumbaginaceae this stigma heteromorphism is not associated with any dimorphism in style and stamen length (Weber-El Ghobary, 1986). As Nowicke & Skvarla (1977) reported for Plumbago europaea and Ceratostigma grifithii, the two species of Dyerophytum studied show dimorphism in exine sculpturing, with SS flowers producing pollen with verrucae broader than high and with a rounded top, while LS flowers produce pollen with verrucae higher than broad and with a distinct spinule on top (Weber-El Ghobary, 1986). However, unlike Plumbago auriculata (Ferrero, et al., 2009a), there appears to be no significant difference in pollen size between morphs (Weber-El Ghobary, 1986). Although the dimorphism in exine sculpturing is said to be very similar between the two species, Weber-El Ghobary (1986) report that the pollen of D. indicum is slightly larger than that of D. africanum, and that its verrucae are more widely spaced.
In summary, the expression of heterostyly in the Staticoideae subfamily is highly variable, which is likely to be the result of multiple losses and gains of gains of this character, with some species possibly representing intermediate forms along the evolutionary path to full expression of heterostyly. In the Plumbaginoideae subfamily heterostyly has been much less intensively studied and there is still great uncertainty about the presence of this trait in most species. Of the four genera in this subfamily, Plumbagella appears to be the only fully monomorphic and self-compatible genus, while Ceratostigma, Plumbago and Dyerophytum all have evidence of heterostyly in at least some species. However, it is not possible to determine whether these genera are uniformly heterostylous on the basis of current evidence as it is quite possible that, like members of Staticoideae, expression of heterostyly varies greatly between species within a genus and even within populations of the same species (Baker, 1966). Evidence of contrasting expression of floral and pollen dimorphisms in Plumbago europaea and Plumbago auriculata certainly suggest that this may be the case in Plumbaginoideae.
15
1.5. Introduction to Socotra 1.5.1. Geology and Climate
Socotra is a floristically rich archipelago, located south of the Arabian Peninsula in the Western Indian Ocean. The group consists of four islands: Socotra, Abd al Kuri, Samha, Darsa along with a number of rocky outcrops, with Socotra being by far the largest at 3600km2, compared to 133km2 for the next largest island Abd al Kuri (Banfield, et al., 2011) (see Figure 1.5.1.a). Although the islands belong to the nation of Yemen, they are actually nearer the African mainland than Arabia, with Socotra being 380km away from the coast of Yemen and divided by the deep Gulf of Aden, but only 250km from Somalia and separated by relatively shallow seas (Beydoun & Bichan, 1969; Kürschner, et al., 2006). The island of Abd al Kuri is even closer, being only 100km from Somalia (Kürschner, et al., 2006).
Figure 1.5.1.a: Map showing location of the islands of the Socotra archipelago
Figure adapted from Scholte & De Geest, (2010).
The Socotra archipelago differs from many other well-known island systems with interesting floras such as Galapagos and the Canaries, in that it is formed from a continental fragment which has become isolated from the mainland, as has occurred on Madagascar (Whittaker & Fernández-Palacios, 2007). The archipelago sits on a granite micro-plate known as the Socotra platform which is made up of Precambrian granite formed by volcanic activity, and was once connected to the Dhofar region of Oman (Samuel, et al., 1997). During the break-
16 up of Gondwanaland in the Mezozoic, sea floor spreading in the Gulf of Aden caused the Socotran plate to separate from the Arabian plate (Banfield, et al., 2011). This tectonic event has been variously dated to 15-35 Myr ago (Kürschner, et al., 2006), however recent evidence indicates that Socotra became isolated from mainland Arabia at least 17.6 Myr ago (Leroy, et al., 2004). Within the archipelago the duration of isolation differs due to the fall in sea levels linked to glaciation during the Pleistocene. This caused the sea floor between the islands to become exposed, connecting Socotra with Samha and Darsa to form a land mass known as “Greater Socotra”. This open plain did not reach the most westerly island of Abd al Kuri which has been isolated from all other landmasses since the rifting of the Gulf of Aden (Banfield, et al., 2011).
The island of Socotra has a complex geology as its base layer is made up of Precambrian granite and other igneous and metamorphic rocks, which this is then covered by a layer of Eocene and Cretaceous age limestone and sandstone (sedimentary) up to 700m deep (Beydoun & Bichan, 1969). At lower elevations Quaternary gravel and alluvial deposits form a plain along the southern coast and in places the decomposition of granite has formed very fertile red soils (Popov, 1957). The basal granite layer is exposed in three areas, the most important of which is the Haggier mountain range which form the highest point of the island at 1500m, and has a strong influence over the island’s climate (Beydoun & Bichan, 1969).
Socotra has a very variable climate due to its geographic position and its complex topography. The archipelago lies on the edge of both the sub-equatorial and northern tropical climate belts which results in the area being affected by a number of large weather phenomena (De Sanctis, et al., 2013), including the Indian Ocean dipole and the El Niño southern Oscillation (Banfield, et al., 2011). The major annual variation in climate is the result of north-easterly winter (Nov-March) and south-westerly summer (May-Sep) monsoons, and the transitionary autumn and spring periods that fall between them (Scholte & De Geest, 2010). The winter monsoons bring reliable rainfall, and rain also falls during spring and autumn, whereas the summer monsoons bring storms with hot desiccating winds and very little rain (Kürschner, et al., 2006).
The topography of Socotra strongly influences the rainfall and temperature patterns across the island, which in turn determine the vegetation patterns, as has been modelled for other more intensively studied islands such as Tenerife (Fernández‐Palacios & Nicolás, 1995). The coastal plains of Socotra have a mean annual temperature of around 30oC (Scholte & De
17
Geest, 2010), which is comparable to that of the neighbouring Arabian lowlands (Le Houerou, 2003). Like lowland Arabia most of the rainfall occurs during winter, but in Socotra the mean annual rainfall is higher at up to 200mm, which has allowed a more diverse flora to develop (Scholte & De Geest, 2010). At high elevations in the Haggier Mountains the climate is quite different, with annual rainfall and humidity thought to reach 1000mm and 100% respectively (Banfield, et al., 2011). This difference in moisture levels is due to fog and mist carried in by sea winds during both monsoon periods, and allows this zone to support a type of vegetation which requires much moister conditions (Kürschner, et al., 2006).
1.5.2. Endemism and Vegetation Types
These temporal and spatial climatic gradients along with topographic heterogeneity have resulted in great diversity of vegetation types across Socotra. These factors combined with a long isolation from other landmasses, have resulted in a flora which is not only diverse but is also unique (Banfield, et al., 2011). Of the 835 vascular plant species currently recorded on the Socotra archipelago, 308 (37%) are considered endemic (De Sanctis, et al., 2013), giving the islands an equal or greater number of endemics per unit of area than many islands/archipelagos better known for their floristic diversity, such as the Canaries, Galapagos and Madagascar (Banfield, et al., 2011). The native plants of Socotra represent a total of 114 families and 433 genera, including 15 genera which are entirely endemic. The majority of this diversity is centred on the main island of Socotra, with far fewer endemic species recorded on the smaller islands: Abd al Kuri (12), Samha (8), while only 12 species have ever been recorded on the smallest island Darsa (Banfield, et al., 2011).
A number of authors have attempted to categorise the island’s vegetation, beginning with the first major expeditions in the later 19th and early 20th centuries by botanists such as Balfour, Forbes and Vierhapper. These early accounts were mostly descriptive, whereas later authors have attempted to classify Socotra’s vegetation based on environmental variables (e.g. climate and geology) and/or plant community composition (De Sanctis, et al., 2013). A recent analysis of vegetation types on Socotra (De Sanctis, et al., 2013), found four major zones along an altitudinal gradient: an arid coastal plain, a transitionary zone between the coastal plain and upper limestone, an arid limestone zone, and a semi-arid upper granitic zone.
18
According to the system of De Sanctis, et al. (2013), at the lowest altitude (0-200m) the arid coastal plain consists of distinct halophytic formations and inner shrubland areas dominated by Croton L.. The halophytic areas consist of specialised species from predominantly halophytic families such as Chenopodiaceae, Zygophyllaceae and Plumbaginaceae, as well as salt-tolerant plants from non-halopytic families such as Poaceae and Verbenaceae. At higher altitude (200-400m) a transitionary zone exists between the alluvial substratum of the coastal plains and the higher limestone formations. This zone has steep escarpments dominated by Sterculia L. and Commiphora Jacq. woodland and Jatropha L. and Adenium Roem. & Schult. shrubland, while flatter areas have a combination of Boswellia Roxb. ex Colebr. woodland, Croton shrubland and grasslands. Above this transitionary zone is an arid limestone zone (400-1000m) of hills and plateaus which has unique Dracaena cinnabari Balf.f. woodland, as well as Boswellia woodland, Croton and Buxanthus Tiegh. shrubland, and dry grasslands. At the highest level (>1000m) a semi-arid zone exists on the granitic peaks of the Haggier mountains. This zone is strongly influenced by the additional moisture carried in by sea winds, which facilitates the growth of fern and epiphytic mosses (Kürschner, et al., 2006). Main vegetation types in this zone are: Leucas R. Br. and Pittosporum Banks ex Sol. woodland, Trichodesma R. Br. and Cephalocroton Hochst. shrubland, Coelocarpum Balf.f. and Hypericum L. shrubland, and grasslands.
1.5.3. Floristic Affinities
This complex pattern of different vegetation types on Socotra is thought to be linked to a complex pattern of floristic affinities to many geographic areas. Traditionally the Socotran flora has been linked to that of the neighbouring landmasses of NE tropical Africa and Arabia. Attempts to classify floristic regions at a global or continental scale have placed Socotra in a Somalia-Masai Regional Centre of Endemism (includes NE Africa and S Arabia) or in an Eritreo-Arabian floristic sub-region (Banfield, et al., 2011). Some vegetation types on Socotra clearly support a link to these areas, such as the Sterculia africana (Lour.) Fiori woodland of the transition zone which is present in a very similar form on the Arabian and African mainland (De Sanctis, et al., 2013; Kürschner, et al., 2006). The halophytic communities of the arid coastal plain also closely match those seen on the coast of mainland Arabia (De Sanctis, et al., 2013; Kürschner, et al., 2006), while the dry grassland of the arid limestone zone shares several species with the corresponding vegetation in southern and eastern Africa (De Sanctis, et al., 2013)
19
However, other plant communities on Socotra show affinities with more distant geographic regions, such as the unusual Dracaena Vand. ex L. woodland which is found in Arabia and NE Africa but also in distant Morocco and Macaronesia (Banfield, et al., 2011). By compiling data on the distributions of non-endemic species which grow on Socotra, Banfield, et al., (2011) indicated the relative importance of different parts of the world in their affinity to the Socotran flora. As expected, the majority of species have a distribution which includes either NE Africa and/or Arabia, however a surprising number of species are shared with tropical Asia (excluding Arabia) (32.2%), the Indian subcontinent (21%) and Pakistan (13.5%). These unexpected affinities and cases of taxa with significant disjunctions in their geographic distribution (e.g.) Dracaena, indicate that factors other than present day geographic proximity have played a part in determining the affinities of the Socotran flora.
1.5.4. Biogeographic Patterns
As Socotra is a continental fragment, its history of colonisation by plants is longer and more complex than oceanic islands like the Canaries and Hawaii that have never been connected to another landmass. Plants on continental islands may have arrived by long distance dispersal over ocean, as is also the case for oceanic islands. However there is an additional possibility on continental islands that the ancestors of plants currently present once formed a contiguous population across the mainland and the island when they were still connected, and the island population has since become isolated by vicariance (Whittaker, & Fernández-Palacios, 2007). The relative importance of vicariance versus dispersal has been discussed extensively for many islands, e.g. Madagascar (Yoder & Nowak, 2006) and New Zealand (Pole, 1994). In the study of Socotra, vicariance has traditionally been favoured over dispersal as the predominant force shaping the island’s flora (Banfield, et al., 2011).
Much of the evidence supporting a vicariant origin of the Socotran flora has been from studying disjunctions of endemic taxa. So-called Tethyan disjunctions have long been of interest to botanists such as Balfour (1888), who proposed that Socotra acts as a refuge for the Tethyan flora (Banfield, et al., 2011). During the Tertiary this vegetation formed a continuous belt across North Africa and southern Europe, which was then a collection of islands in the Tethys Sea with a wet-tropical climate (Fernández‐Palacios, et al., 2011). Climate change in the Pliocene resulted in desertification of the Sahara and transition to the present-day arid Mediterranean climate of southern Europe, causing extinction of most of the Tethyan flora (Rodríguez‐Sánchez & Arroyo, 2008). Relicts of this flora are thought to
20 remain in pockets of wetter climate such as Macaronesia and parts of Arabia and East Africa, including Socotra (Thiv, et al., 2010), so disjunctions of taxa between these refugia are considered to be the result of vicariance (Banfield, et al., 2011). Many groups of plants have been suggested as having a Tethyan disjunction as they occur Macaronesia and in East Africa/Arabia (Thiv, et al., 2010), and phylogenetic studies have confirmed this disjunction in a few taxa, such as Aeonium Webb & Berthel. (Mort, et al., 2002).
Tethyan disjunctions have been proposed for a number of Socotran plant groups, such as Dracaena, Campylanthus Roth (Scrophulariaceae), and Hemicrambe Webb (Brassicaceae) (Banfield, et al., 2011). The climate of Socotra makes it suitable as a refuge for Tethyan vegetation, as the influence of sea mists keeps areas of the island such as the Haggier Mountains and some cliffs and escarpments relatively humid. Such areas are termed wet refugia and are particularly diverse, with 42% of Socotra’s endemic species restricted to these areas (Banfield, et al., 2011). Calibrated phylogenies have been used to test for proposed Tethyan disjunctions in some taxa, with mixed results. To be consistent with this vicariant origin, the Macaronesian and NE African/Arabian lineages should be sister taxa that diverged during the Upper Miocene or Pliocene when the period of aridification began (Thiv, et al., 2010). These criteria were met in an analysis of Campylanthus, in which the Macaronesian and NE African/Arabian clades are estimated to have diverged between 2 and 10 MYA, which is consistent with the onset of aridity around 7 MYA (Thiv, et al., 2010). An analysis of proposed Tethyan disjunction in Asteraceae however, found quite different results (Andrus, et al., 2004). This study investigated the proposed relationship between the genus Vierea Webb & Berthel from the Canaries, and Pulicaria sect. Vieraeopsis Gamal-Eldin from Socotra and Southern Arabia, but found that they were not sister taxa. Instead, Vierea was found to be sister to a Mediterranean genus, refuting the hypothesis of a Tethyan disjunction between these groups.
In contrast to traditional thinking that the Socotran flora is mostly the result of vicariance, some studies have now indicated a much more recent origin of Socotran taxa due to long distance dispersal from nearby Arabia and NE Africa. A phylogenetic study of Echidnopsis Hook.f. (Apocynaceae) found the Socotran species in this genus to form a clade nested within a wider clade of Arabian and African taxa, leading the authors to suggest an east African origin for the Socotran species (Thiv & Meve, 2007). However, without an estimate of when the Socotran clade diverged, vicariant and dispersal hypotheses for these taxa cannot be tested. A phylogenetic study of Aerva Forssk. (Amaranthaceae) (Thiv, et al., 2006) found that
21 the two Socotran endemic species in this genus are sister taxa, and that the ancestral area for this clade is likely to have been Arabia. Dating analysis placed this divergence of this clade at a maximum of 10.6 MYA, which is considerably younger than current estimates (approximately 18 MYA (Leroy, et al., 2004)) for the separation of Socotra from the Arabian Peninsula. If these dates are correct then Socotran Aerva must have colonised Socotra long after it became isolated, and so must have arrived via dispersal from mainland Arabia. The importance of dispersal on Socotra is also supported by the presence of numerous non- endemic species which share a distribution with the surrounding regions of NE Africa, Arabia and the Indian subcontinent (Banfield, et al., 2011). The island populations of these species are presumably not reproductively isolated from the continental populations; otherwise they would be expected to undergo allopatric speciation due to genetic drift. This would therefore indicate that gene flow is still taking place between these populations (Banfield, et al., 2011). If dispersal events to Socotra are sufficiently frequent to maintain gene flow, then it seems logical that many of these species may have first arrived on the island by dispersal. It is also possible that these non-endemic taxa have not diverged from their continental populations as they may be such recent arrivals that there has not been sufficient time for speciation, or that habitats on Socotra and the mainland or so similar that there is no selective pressure for the island population to adapt differently.
Despite growing evidence for the role of dispersal in shaping Socotra’s flora, there are examples of apparently ancient taxa which have had their divergence dated to before the separation of the island. In a phylogenetic analysis of the Cucurbitaceae family (Schaefer, et al., 2009) the lineage leading to the endemic cucumber tree (Dendrosicyos socotranus Balf.f.) was dated to 22MYA. This dates the arrival of the species to before the estimated separation of Socotra from Arabia. The authors therefore suggest that this species is an island representative of a mainland progenitor species that has since gone extinct. Other groups such as Exacum L., show very complex biogeographical patterns. This genus has a palaeotropical distribution (including three species on Socotra) which had been suggested to be the result of vicariance caused by the break-up of Gondwana (Klackenberg, 1985). Dated phylogenetic analysis however, has indicated that the genus originated in Madagascar and has since had a complex history of dispersal, range expansion and extinction, making its current distribution the result of both vicariance and dispersal (Yuan, et al., 2005).
To summarise, the unique flora of Socotra shows complex patterns of biogeographical affinity, as is often the case for continental islands. The traditional view is that much of this
22 flora is an ancient relict of a once widespread type of vegetation that has since gone extinct in most regions due to aridification. The humid microclimates of higher parts of Socotra provide a wet refugial habitat in which these taxa can persist. The presence of taxa with Tethyan disjunctions like Campylanthus, indicate that there is an ancient component to the Socotran flora. However, there is growing evidence to support the recent origin of some species by long distance dispersal from NE Africa and Arabia. Most biogeographical hypotheses relating to the Socotran flora have been based on taxonomic distributions, but these can only be tested by estimating divergence times of Socotran lineages.
1.6. Hypotheses and Aims of Project
The specific hypotheses and aims of the project are as follows:
Dyerophytum is a monophyletic genus Dyerophytum is sister genus to Plumbago Dyerophytum belongs within the Plumbaginoideae subfamily of Plumbaginaceae. The two Dyerophytum species endemic to Socotra are the result of two separate dispersal events. D. pendulum is most closely related to D. africanum and D. socotranum is most closely related to D. indicum Dyerophytum contains four species All species of Dyerophytum have heteromorphic pollen
Aim: To produce an appropriate molecular phylogeny to determine the placement of Dyerophytum and the relationships within the genus.
No previous study has sampled all four species of Dyerophytum, so it is currently uncertain whether the genus is monophyletic. This study will include multiple accessions of all four Dyerophytum species, so that the phylogenetic tree will demonstrate whether these accessions form a single clade, making the genus monophyletic. In order to determine monophyly and to place Dyerophytum in its correct phylogenetic position, samples from the other three Plumbaginoideae genera (Plumbago, Ceratostigma and Plumbagella) will be included in the analysis, along with outgroups from the Staticoideae subfamily and the sister family Polygonaceae. The resulting phylogeny should confirm whether Dyerophytum belongs in the Plumbaginioideae subfamily as indicated by previous studies (Cuénoud, et al., 2002; Lledó,
23 et al., 2001; 2005), and should also indicate the relationships between Dyerophytum and the other Plumbaginoideae genera. In particular, previous studies have indicated that Dyerophytum is either sister to (Cuénoud, et al., 2002) or nested within (Lledó, et al., 2001; 2005) Plumbago. However, the purpose of these studies was to investigate higher level relationships so the taxon sampling and choice of molecular regions was not appropriate to determine the positions of these genera. For this study it is intended that the phylogeny produced will have appropriate taxon sampling and choice of molecular regions to allow testing of the hypothesis that Dyerophytum is sister to Plumbago.
Aim: To produce an appropriate molecular phylogeny to determine the relationships within Dyerophytum and to date the divergence of lineages using known calibration points.
Comments on Dyerophytum in the Botany of Socotra (Balfour, 1888) note that the foliage of D. pendulum most closely resembles that of D. africanum, while the leaves of D. socotranum more closely resemble those in D. indicum. If these morphological similarities reflect the underlying evolutionary relationships in this genus, it would indicate that Dyerophytum has arrived on Socotra through two separate dispersal events, with D. pendulum being the result of dispersal from SW Africa, while D. socotranum is the result of dispersal from India/Arabia. The construction of a molecular phylogeny of Dyerophytum will allow this hypothesis to be tested by determining whether the Socotran species are most closely related to the two continental species. Alternatively, it may indicate that the Socotran species are sister taxa that have diverged morphologically and are therefore the result of a single dispersal event. If this alternative hypothesis is true, then the phylogeny should indicate which of the two continental species the Socotran taxa are most closely related to and therefore descended from. Using this phylogenetic framework, an estimate of the divergence times of lineages within Dyerophytum will be calculated by using known calibration points to date nodes in the tree. This should produce an estimation of when Dyerophytum diverged from other lineages in Plumbaginaceae and when it dispersed to Socotra.
Aim: To produce a taxonomic revision of Dyerophytum.
There are no previous monographic treatments of Dyerophytum and there is considerable confusion in the taxonomic literature about species limits and nomenclature in this genus. A full taxonomic revision will therefore be carried out to determine how many taxonomic units are present and at what rank, which morphological characters define these units, and which taxon names should be used. This revision will involve examination of herbarium specimens
24 from several herbaria representing the full geographic range of Dyerophytum. Potentially informative morphological characters will be chosen after consultation of protologues and taxonomic literature and will be measured from the specimens. This data will be used to conduct a morphometric analysis of Dyerophytum which should identify morphologically distinct clusters corresponding to taxonomic units. A key and species descriptions will be written on the basis of this morphological data and correct names will be identified.
Aim: To examine pollen from all four Dyerophytum species for evidence of heteromorphism.
Heterostyly is known to occur in the Plumbaginaceae and is often associated with pollen heteromorphism. Previous work (Weber-El Ghobary, 1986) has found evidence of floral morphs with different exine sculpturing patterns in D. indicum and D. africanum; however this has never been investigated in the Socotran species of Dyerophytum. In this study, pollen will be sampled from multiple accessions of all four Dyerophytum species and will be imaged using scanning electron microscopy. The resulting images will be assessed for evidence of dimorphic exine sculpturing and other features such as size or shape dimorphism to test the hypothesis.
25
2. Materials and Methods
2.1. Taxonomic Sampling
A total of 41 accessions representing 18 species within the Plumbaginaceae family were selected for this study. As the study aims to elucidate relationships within Dyerophytum and the Plumbaginoideae subfamily, samples from all genera within Plumbaginoideae were included and outgroups were selected from the Staticoideae subfamily and from Polygonacaceae. Multiple accessions were included for all Dyerophytum species and for two Plumbago species. Provenance and voucher information for DNA extracted as part of this study are listed in Appendix 8.1. Accession numbers for additional sequences downloaded from GenBank are listed in Appendix 8.2.
2.2. Molecular Techniques
Total DNA from herbarium specimens was homogenised using a TissueLyser II (Qiagen, Valencia, California, USA) and extracted using the DNeasy Plant Mini Kit (Qiagen, Valencia, California, USA).
As little previous molecular work had been undertaken on Dyerophytum, several potentially informative plastid regions (identified in Shaw et al., 2007) were amplified and sequenced for a subset of samples. Two plastid regions were then selected on the basis of their ease of amplification and number of informative characters. In addition, the widely used ribosomal nuclear Internal Transcribed Spacer (ITS) was chosen. This region is informative for phylogenetic analysis due to its high frequency of point mutations and relatively infrequent insertions and deletions (Baldwin, et al., 1995). Primers used in the study are listed in Table 2.2.a.
Polymerase chain reaction (PCR) was carried out in Tetrad2 (Biorad) thermal cyclers in a total volume of 20μl containing 1x PCR buffer, 0.2mM of each dNTP, 2.5mM MgCl2, 1ųM of each primer, 1M betaine, 0.2M trehalose, 1 unit Taq polymerase (Platinum® Taq, Invitrogen) and 4ųl of dilute template DNA .
PCR products for ITS and atpI-atpH were amplified by a PCR program including: template denaturation for 4 min at 94oC followed by 35 cycles of 1 min denaturation at 94oC, 1 min annealing at 50oC, followed by 1 min extension at 72oC and 10 min final extension.
26 ndhF-rpl32 was amplified using a program with template denaturation for 4 min at 94oC, followed by 10 cycles of 30 sec denaturation at 94oC, 30 sec annealing at 50oC, 1.5 min extension at 72oC, and 10 min final extension, followed by 25 cycles of 30 sec denaturation at 94oC, 30 sec annealing at 46oC, 1.5 min extension at 72oC, and 10 min final extension. For samples which failed to amplify or sequence using these methods, internal primers were used with the following PCR program: template denaturation for 4 min at 94oC followed by 10 cycles of 30 sec denaturation at 94oC, 30 sec annealing at 50oC, 1 min extension at 72oC, 10 min final extension, then 25 cycles of 30 sec denaturation at 94oC, 30 sec annealing at 46oC, 1 min extension at 72oC, and 10 min final extension.
PCR products were checked on 1% agarose gels before being cleaned with ExoSAP-IT (USB, Cleveland, Ohio, USA). Sequencing reaction was carried out in a total volume of 10μl containing 0.5μl BigDye®, 2μl BigDye® Buffer (Applied Biosystems®), 0.32μl of 10μM primer, 1μl of 2M trehalose, 6.18μl H2O and 1μl of purified PCR product. Cycle sequencing (25 cycles, 30 sec denaturation at 95oC, 20 sec annealing at 50oC, 4-min extension at 60oC) was carried out in Tetrad2 (Biorad) thermal cyclers. Samples were run on an ABI 3730 automated DNA sequencer at Edinburgh Genepool sequencing facility. Raw sequence data was imported into Sequencher 4.2.1 (Gene Codes Corp., Ann Arbor, Michigan, USA), which was used to compile contiguous sequences (contigs) of each accession from electropherograms generated on the automated sequencer.
27
Table 2.2.a: Primers used in this study
Region Primer Primer Sequence (5’-3’) Source Sun, et al. 17SE ACGAATTCATGGTCCGGTGAAGTGTTCG (1994) ITS Sun, et al. 26SE TAGAATTCCCCGGTTCGCTCGCCGTTAC (1994) Shaw et al. atpI TATTTACAAGYGGTATTCAAGCT atpI- (2007) atpH Shaw et al. atpH CCAAYCCAGCAGCAATAAC (2007) Shaw et al. ndhF CCAATATCCCTTYYTTTTCCAA (2007) ndhF-ndhF/rpl32 Designed for ACTACGTATATCTYTGTTCTGTCTAG ndhF- INT-R this study rpl32 ndhF-ndhF/rpl32 Designed for CTCGTTTTCCATATTATCCAAC INT-F this study Shaw et al. rpl32 GAAAGGTATKATCCAYGMATATT (2007)
2.3. Phylogenetic Analysis
DNA sequences were aligned in MEGA 5.2 (Tamura, et al., 2011) using Clustal W (Larkin, et al., 2007) with the default settings applied, and then edited manually. Gaps were coded automatically using FastGap (Borchsenius, 2009) and included in analyses as a separate partition. An evolutionary model was selected for each dataset using JModelTest 2.1.5 (Darriba, et al., 2012; Guindon & Gascuel, 2003). Substitution models were compared using the Akaike Information Criterion (AIC) and the following models were selected for each partition: atpI-atpH (GTR+G), ndhF-rpl32 (GTR+I), ITS (GTR+G).
Bayesian inference (BI) analyses were performed in MrBayes 3.2.2. (Huelsenbeck & Ronquist, 2001; Ronquist & Huelsenbeck, 2003). Analyses were performed on three matrices: ITS, a combined plastid dataset (partitioned into atpI-atpH and ndhF-rpl32), and a combined plastid and nuclear dataset (partitioned into atpI-atpH, ndhF-rpl32 and ITS). Each
28 analysis was run for 5 million generations sampling once every 1 000 generations, with the models selected above applied to each partition. Time series plots were run in Tracer v1.6 (Rambaut, et al., 2014) to ensure analyses ran to completion and to determine required burn- in. In each case a 10% burn-in was set and the remaining trees were summarised. Trees were viewed and edited in FigTree v1.4.0 (Rambaut, 2014).
Maximum likelihood (ML) analyses were carried out in RAxML 7.0.4 (Stamatakis, 2014). The ML analysis for each of the three datasets (ITS, combined plastid dataset, combined nuclear and plastid dataset) used the GTR (General Time Reversible) substitution model, with the GAMMA parameter which allows for heterogeneity across sites within the sequences, and was instructed to perform 100 independent runs. Standard bootstrap analysis was performed with 100 replicates and resulting bootstrap values were mapped to the single most likely tree.
2.4. Molecular Dating Analysis
Dating analysis was performed on the combined plastid and nuclear dataset as this was the most fully resolved and supported tree. Molecular dating analysis is based on the molecular clock hypothesis proposed by Zuckerkandl & Pauling (1962), which suggested that the degree of molecular divergence between two species can be used to calculate the divergence time between them. For this study the Bayesian dating method was used and implemented in BEAST v2.1.3 (Drummond, et al., 2012; Bouckaert, et al., 2014). This method uses a probabilistic model of how evolutionary rates vary over time and produces divergence time estimates based on Markov chain Monte Carlo (MCMC) techniques (Sanderson, et al., 2004). A relaxed clock model was used, which allows the rate of evolution to vary between branches in the tree, and uncorrelated lognormal rate change was selected, which assumes that the rate of evolution changes along branches rather than at nodes (Drummond, et al., 2006).
Input files were prepared in BEAUti 2 (Bouckaert, et al., 2014) using the following parameters: substitution model GTR+I+G, (shape parameter estimated, proportion of invariable sites 0.5 and estimated), and Calibrated Yule model (Heled & Drummond, 2012), (birth rate prior defined as gamma distribution, shape = 0.001, scale = 1000). Priors were set for the two calibration points to be used: Plumbaginaceae stem node (Normal distribution, median age = 67.9 My, 95% confidence interval: min. = 65.63 My, max. = 78.21 My), Plumbaginaceae crown node (Normal distribution, median age = 41.67 My, 95% confidence interval: min. = 24.19 My, max. = 55.33 My). These node ages are secondary calibration
29 points (rather than primary calibration points such as fossils) calculated from a dated angiosperm tree which used 171 fossil calibration points (Magallon, S. (2014) Revised time- calibrated phylogeny of the angiosperms using 171 primary fossil calibrations. Manuscript in preparation.). Primary calibration points were not used as fossil data was unavailable for this family.
Five independent runs of the analysis were performed, with each analysis instructed to run for 10 million generations. Time series plots were inspected in Tracer v1.6 to ensure that analyses ran to completion and to determine required burn-in. It also allowed trace files from each independent run to be compared to ensure that each analysis converged on the same posterior probability value. Tree files produced by each independent run were combined in LogCombiner v2.1.3 (Bouckaert, et al., 2014) with a 10% burn-in applied. Trees were summarised in TreeAnnotator v2.1.2 (Bouckaert, et al., 2014) to produce a maximum clade credibility tree. The resulting tree was viewed and edited in FigTree v1.4.0.
2.5. Morphology
2.5.1. Character Analysis
Multivariate methods were used to characterise patterns of morphological variation within and between Dyerophytum species. Herbarium specimens representing the geographic range of all four Dyerophytum species were obtained for the project and a subset of these specimens was selected to study further. All material of Socotran plants was studied as only a limited amount has ever been collected, while specimens of D. indicum and D. africanum were selected based on the quality of the plant material and associated label information, also with the aim of representing as much of their geographical range as possible as many more specimens were available for these taxa. Herbarium specimens included in this analysis are listed in Appendix 8.3.
Morphological characters were selected for measurement based on diagnostic characters reported in floristic accounts, protologues and other taxonomic literature, and from my own observations. It was clear after studying the literature that there is variation in leaf shape and attachment within Dyerophytum. Two species (D. africanum and D. pendulum) have petiolate, spathulate leaves, while the other two species (D. indicum and D. socotranum) have orbicular/oval leaves with a sessile or perfoliate base. Leaf length and width and the ratio of these two values were therefore chosen as potentially useful characters to include in the
30 analysis. However, petiole length was not used as it was decided that the attenuate leaf base of the petiolate species would make it impossible to accurately determine where the leaf blade ends and the petiole begins, making measurements inconsistent between specimens.
The literature indicated that the number and arrangement of floral parts within Dyerophytum flowers is consistent, however the size and shape of these parts shows some variation. In particular, floristic accounts described differences in calyx morphology, with the calyx lobes of D. indicum described as lanceolate (Yadav & Meena, 2011) or narrowly ovate (Miller & Morris, 1988), while those of D. africanum are described as ovate (Wright, 1909). Calyx length was also reported as an important diagnostic character to differentiate D. pendulum and D. socotranum (Miller & Morris, 2004). My own observations confirmed that there is variation in calyx size and the shape of the individual sepals, so measurements were made of the length and width of the calyx, and the ratio of these values was calculated. In addition, the length and width of the individual sepals was measured, as well as the width of the membranous wing either side of the prominent sepal midrib, which was reported as an important character distinguishing D. socotranum from D. indicum (Balfour, 1888). Corolla length was also measured as this was suggested as a potentially useful character in the literature, particularly for distinguishing D. pendulum and D. socotranum (Miller & Morris, 2004).
Characters are listed in table Table 2.5.1.a with explanatory diagrams (see Figure 2.5.1.a). Larger characters (A, B, D, E and G) were measured directly from herbarium specimens using a dissecting microscope, while smaller characters (H, I and K) were measured using Leica Application Suite v4.2.0 (Leica Microsystems (Switzerland) Ltd.) from images taken using a Leica M275 microscope with a Leica DFC495 camera attached. For each specimen, three leaves and three flowers were selected for measurement (unless insufficient material was available) and an average of the three values was calculated for all characters for each specimen. Principal components analysis (PCA) was performed in Past (Hammer, et al., 2001) to analyse the variance in the data. This method is a type of ordination analysis that reduces the dimensionality of the dataset by identifying combinations of variables (components) that best summarise the patterns of variance (Peres-Neto, et al., 2003). This allows the data to be plotted in two dimensions so that clusters can be identified that might correspond to taxonomic units (as has been performed by Španiel, et al., (2011) for example).
31
On the basis of the morphological characters investigated, a taxonomic revision of Dyerophytum will be carried, providing species descriptions and a diagnostic key.
Table 2.5.1.a: List of characters measured for morphometric analysis
Character Explanation A Leaf length Distance from point of leaf attachment to stem to leaf tip (mm) B Leaf width Distance across broadest part of leaf blade (mm) C Leaf L:W Ratio of leaf length to leaf width D Calyx length Distance from base of calyx to tips of calyx segments (mm) E Calyx width Distance across the broadest part of the calyx (mm) F Calyx L:W Ratio of calyx length to calyx width G Corolla length Distance from base of flower to tips of corolla lobes (mm) H Sepal length Distance from base to tip of sepal (mm) I Sepal width Distance across the broadest part of the sepal (mm) J Sepal L:W Ratio of sepal length to sepal width K Wing width Distance from the midrib to edge of sepal across the broadest part (mm)
Figure 2.5.1.a: Diagrams showing morphological characters measured
A
B G H
K D I E
32
2.5.2. Scanning Electron Microscopy
Multiple specimens were chosen for each of the four Dyerophytum species. Provenance and voucher information are listed in Appendix 8.4. Flowers from herbarium specimens were dissected to extract the anthers, which were then tapped to release pollen onto carbon discs placed on stubs. Stubs were sputter coated using an Emitech K575X Sputter Coater. Pollen samples were then viewed using a Supra 55VP Scanning Electron Microscope. For each stub a single pollen grain was selected and two images were captured, one showing the entire pollen grain (×1 500 or ×1 200 magnification) and one showing surface detail (×8 000 or ×500 magnification).
33
3. Results 3.1. Phylogenetic Analysis
The number of taxa, aligned sequence lengths and summary statistics for each molecular matrix are presented in Table 3.1.a. An almost complete dataset was achieved for the plastid regions, however difficulties encountered when sequencing ITS meant that nine samples were missing from this dataset. Where ITS sequences were not available, these were treated as missing data within the combined plastid and nuclear matrix. Both BI and ML analyses were carried out, but topologies produced by each method were similar, except for ITS where there differences in some poorly-supported nodes. BI trees are therefore presented with both posterior probabilities and bootstrap values (except in cases where topology differed) mapped on.
34
Table 3.1.a: Summary of alignment statistics
Aligned sequence No. of No. of variable No. of parsimony Matrix Number of taxa length/ bp conserved sites sites informative sites Sequenced at Downloaded Total RBGE from GenBank atpI-atpH 35 1 36 875 572 256 110 ndhF-rpl32 30 0 30 1336 1040 240 145 Combined 35 1 36 2211 1528 480 245 plastid ITS 24 2 26 614 318 278 211 Combined plastid and 35 2 37 2707 1846 746 453 nuclear
35
3.1.1. Combined Plastid Analysis
The phylogeny (see Figure 3.1.1.a) strongly supports Dyerophytum as monophyletic with a posterior probability (P) = 1 and a bootstrap (BS) = 100. D. africanum is placed as the earliest diverging lineage within the genus (P = 1, BS = 100). Within the sister clade most D. indicum samples form a strongly supported clade (P = 1, BS = 99) which is sister to a clade containing both Socotran Dyerophytum species (P = 0.9939, BS = 99). A single D. indicum sample (7999) falls outside the main D. indicum clade (P = 1, BS = 100). Within the Socotran clade relationships are not resolved.
Dyerophytum is placed in the Plumbaginoideae subfamily as sister to a strongly supported clade containing most of the Plumbago samples (P = 1, BS = 100). Plumbago indica L.is placed as sister to Dyerophytum + main Plumbago clade with low support (P = 0.504, BS = 61). Plumbago europaea and Plumbagella micrantha form a strongly supported clade (P = 1, BS = 100) placed as sister to Dyerophytum and all other Plumbago. The two Ceratostigma samples form a clade (P = 1, BS = 100) which is placed sister to Dyerophytum and all Plumbago (P = 0.9308, BS = 79), so is the earliest diverging lineage within the Plumbaginoideae subfamily. Outgroups from the Staticoideae subfamily are strongly supported (P = 1, BS = 100) as a clade sister to Plumbaginoideae.
36
Figure 3.1.1.a: Bayesian consensus tree for combined plastid dataset
Posterior probabilities (in bold) and bootstrap values are presented.
37
3.1.2. ITS Analysis
Relationships within the nuclear phylogeny (see Figure 3.1.2.a) are generally congruent with those in the plastid phylogeny. Dyerophytum is again found to be monophyletic, although with lower support (P = 0.7815), and D. africanum is placed sister to the rest of the genus (P = 1). The remaining Dyerophytum samples are strongly supported as monophyletic (P = 0.9705), with the two D. indicum samples forming a clade (P= 0.9999, BS = 97) sister to the Socotran clade (P = 0.7066, BS = 82). Within the Socotran group D. socotranum forms a well-supported clade (P = 0.9851, BS = 85) within an unresolved group of D. pendulum.
Dyerophytum is placed as sister (P = 1) to a clade containing all other Plumbaginoideae genera (P = 0.6489, BS = 56). Within this clade all Plumbago samples with the exception of P. europaea form a clade (P = 0.9999, BS = 97) which includes P. indica. Again, Plumbago europaea forms a strongly supported clade with Plumbagella micrantha ( P = 1, BS = 65), which is sister to the main Plumbago clade. Ceratostigma is placed as sister to Plumbago and Plumbagella with lower support (P = 0.6489, BS = 56). Only two outgroups from the Staticoideae family are included as the other outgroup sequences were too divergent to be satisfactorily aligned with the Plumbaginoideae sequences. The two outgroups in the analysis are placed as sister to Plumbaginoideae.
38
Figure 3.1.2.a: Bayesian consensus tree for ITS dataset
Posterior probabilities (in bold) and bootstrap values are presented.
39
3.1.3. Combined Plastid and Nuclear Analysis
After inspecting the topology of the separate plastid and nuclear phylogenies it was decided that there were no hard incongruences as any differences in topology, e.g. position of Plumbago indica were poorly supported, so a combined analysis was carried out. The topology of this tree (see Figure 3.1.3.a) is generally is generally congruent with the plastid phylogeny, but the inclusion of ITS data has improved resolution within Dyerophytum.
Relationships within the combined tree are as described for the plastid tree, with the exception of Plumbago indica which is placed within the main Plumbago clade with strong support (P = 1, BS = 96), and within the Socotran clade of Dyerophytum where D. socotranum is resolved as a well-supported clade (P = 1, BS = 70) within an unresolved group of D. pendulum.
40
Figure 3.1.3.a: Bayesian consensus tree for combined plastid and nuclear dataset
Posterior probabilities (in bold) and bootstrap values are presented.
41
3.2. Molecular Dating Analysis
The maximum clade credibility tree produced by BEAST is shown with mean node ages and error bars marking the 95% confidence intervals (see Figure 3.2.a). The analysis dates the divergence of Dyerophytum from the rest of Plumbaginoideae to 5.18-17.62 MYA, the divergence of D. africanum from the rest of the genus to 2.96-11.28 MYA, the split between the Socotran clade and the main D. indicum clade to 0.71-3.10 MYA, and the split between D. socotranum and D. pendulum to 0.33-1.85 MYA.
42
Figure 3.2.a: Dated maximum clade credibility tree for combined plastid and nuclear dataset
Node age estimates (in Myr) are presented with error bars marking the 95% confidence intervals.
43
3.3. Morphometric Ordination Analysis
Characters were measured from a total of 64 herbarium specimens of Dyerophytum. After trying different combinations of characters in the analysis it was found that leaf L:W ratio, sepal length, sepal width, sepal L:W ratio and wing width were most informative. Leaf length and width were excluded, as the large range in leaf size in the dataset (8.5-89 cm long x 7- 77cm wide) meant that these characters overshadowed more subtle but more informative characters in the analysis. Calyx length, width and L:W were excluded as these attributes were better represented by sepal measurements which were measured more accurately using a microscope and attached camera system, rather than directly from the specimens. Corolla length was also excluded, as in most specimens the corolla was poorly preserved so measurements made are unlikely to represent the true value. Data used in the PCA analysis is provided in Appendix 8.5). Table 3.3.a shows the relative contributions of each character to each principal component (PC) calculated in the analysis, and Table 3.3.b shows the eigenvalues and percentage variance accounted for by each principal component
Table 3.3.a: Contributions of morphological characters to each principal component
PC 1 PC 2 PC 3 PC4 PC 5 Leaf L:W -0.034884 0.032913 0.98834 -0.14239 0.024665 Sepal length 0.93452 0.34941 0.029507 0.05915 0.014562 Sepal width -0.29989 0.77331 0.016153 0.28073 -0.48268 Sepal L:W 0.073245 -0.35967 0.14841 0.91434 -0.084993 Wing width -0.17364 0.38659 -0.0050468 0.24778 0.87119
Table 3.3.b: Eigenvalues and percentage variance accounted for by each principal component
PC Eigenvalue % variance 1 1.63101 52.771 2 1.28477 41.569 3 0.127964 4.1403 4 0.0440477 1.4252 5 0.00291879 0.094437
44
Graphs showing the most informative combinations of principal components are presented with each of the four putative species denoted by differently coloured symbols (see Figures 3.3.a-c).
PC1 plotted against PC2 produces a very distinct cluster corresponding to D. africanum and a large cluster of D. indicum, while clusters for D. socotranum and D. pendulum are somewhat overlapping and rather spread out. PC1 plotted against PC3 again produces a distinct cluster corresponding to D. africanum and a large cluster of D. indicum. However, in this graph, the two Socotran species form entirely separate clusters, although D. socotranum has a single outlier falling within the D. indicum cluster and D. pendulum has two individuals placed on the edge of the D. indicum cluster. PC2 plotted against PC3 produces overlapping clusters of D. africanum and D. indicum, but places D. socotranum and D. pendulum in distinct non- overlapping clusters, with the exception of a single outlier for D. pendulum which is placed with D. indicum and D. africanum.
45
Figure 3.3.a: PCA analysis showing principal components 1 and 2
Figure 3.3.b: PCA analysis showing principal components 1 and 3
46
Figure 3.3.c: PCA analysis showing principal components 2 and 3
47
3.4. Scanning Electron Microscopy
Images of representative pollen grains for each species of Dyerophytum produced in this study (see Figures 3.4. a-h) were compared to images and descriptions of pollen from Weber- El Ghobary (1986) to assess evidence for dimorphic exine sculpturing in each species of Dyerophytum. Images presented here appear to match descriptions of the two pollen types in D. africanum, with some grains having verrucae with a very distinct, almost conical, spinule on the top (see Figure 3.4.a), whereas other grains have verrucae with a more rounded top and only slight spinule (see Figure 3.4.b). In D. indicum there also appear to be two pollen types generally matching descriptions in the above paper. One type has verrucae with a distinct spinule (although shorter than the spinules in D. africanum) (see Figure 3.4.c), while the other type has verrucae with an almost completely rounded top and very slight points (see Figure 3.4.d). In both D. socotranum and D. pendulum there appears to be only a single pollen type which closely resembles the rounded-verrucae form in D. indicum (see Figures 3.4.e-h).
48
Figure 3.4.a: Electron micrographs of pollen grains in Dyerophytum africanum (collection no. 127)
× 1 500 magnification.
× 8 000 magnification.
49
Figure 3.4.b: Electron micrographs of pollen grains in Dyerophytum africanum (collection no. 6371)
× 1 500 magnification.
× 8 000 magnification.
50
Figure 3.4.c: Electron micrographs of pollen grains in Dyerophytum indicum (collection no. 729)
× 1 500 magnification.
× 7 500 magnification.
51
Figure 3.4.d: Electron micrographs of pollen grains in Dyerophytum indicum (collection no. 2251)
× 1 200 magnification.
× 8 000 magnification.
52
Figure 3.4.e: Electron micrographs of pollen grains in Dyerophytum pendulum (collection no. 217)
× 1 500 magnification.
× 8 000 magnification.
53
Figure 3.4.f: Electron micrographs of pollen grains in Dyerophytum pendulum (collection no. 14041)
× 1 500 magnification.
× 8 000 magnification.
54
Figure 3.4.g: Electron micrographs of pollen grains in Dyerophytum socotranum (collection no. 359)
× 1 500 magnification.
× 8 000 magnification.
55
Figure 3.4.h: Electron micrographs of pollen grains in Dyerophytum socotranum (collection no. 8684)
× 1 500 magnification.
× 8 000 magnification.
56
4. Discussion 4.1. Phylogenetic Position of Dyerophytum
All three phylogenies presented in this study support Dyerophytum as a monophyletic genus within the Plumbaginoideae subfamily, with both the plastid and combined plastid and nuclear datasets giving a support values of P = 1, BS = 100 for this clade, while the ITS gives a lower level of support (P = 0.7815). The monophyly of this genus has never been tested before, as previous phylogenies including Dyerophytum have never included samples representing all four species.
Previous phylogenies have placed Dyerophytum as either sister to (Cuénoud, et al., 2002) or nested within (Lledó, et al., 2001; 2005) Plumbago, but the choice of molecular regions and the density of taxon sampling has not been appropriate to place these genera. The plastid phylogeny places Dyerophytum as sister to a clade containing all but two species of Plumbago (P. europaea and P. indica). P. indica is placed as sister to Dyerophytum and the main Plumbago clade, but with low support. In the combined plastid and nuclear phylogeny the same Dyerophytm + Plumbago (except P. europaea) sister relationship is recovered but P. indica is instead placed in the main Plumbago clade with high support (P = 1, BS = 96). The ITS phylogeny produces a slightly different topology, with Dyerophytum placed sister to the rest of Plumbaginoideae (including Ceratostigma), but this molecular region is highly variable so is more suitable for resolving species-level relationships rather than relationships at deeper nodes (Baldwin, et al., 1995) where support values are generally low in this tree. In both the plastid and combined trees Ceratostigma is placed as the earliest diverging lineage within Plumbaginoideae, as found in previous molecular studies of the family (Lledó, et al., 1998, 2001, 2005; Cuénoud, et al., 2002).
In all three phylogenies, Plumbago europaea is unexpectedly placed as sister to Plumbagella micrantha with high support (P = 1 in all trees). This relationship has not appeared in previous phylogenies of Plumbaginoideae as Plumbagella has never been included in any previous analyses. Although this result is surprising, previous phylogenies have suggested that Plumbago europaea may not belong with other members of the genus. In each of the phylogenetic studies of Plumbaginaceae by Lledó, et al. P. europaea is placed as sister to P. zeylanica L. and P. capensis Thunb. (1998) or sister to P. zeylanica and Dyerophytum africanum (2001; 2005) which is consistent with the results presented in this study. The proposed sister relationship of Plumbago europaea and Plumbagella micrantha is significant
57 in terms of morphological evolution as Plumbagella has a unique pattern of embryo development) which is not found in Plumbago (Boyes, 1939; Boyes & Battaglia, 1951.
Investigation of the relationships within Plumbago were not one of the aims of this study, so taxon sampling in the phylogenies presented here is not sufficient to prove this relationship beyond doubt. It is there suggested for future work that relationships between Plumbago and Plumbagella are investigated further by including samples from the approximately 20 species (Ferrero, 2009a) in Plumbago (7 species included in this study), as well as multiple accessions of Plumbagella micrantha; with the aim of establishing whether all other Plumbago species fall within the main Plumbago clade or whether other species also belong in the Plumbago europaea + Plumbagella micrantha clade. If the relationships presented here are confirmed by further studies, then Plumbagella would need to be sunk into Plumbago and a new genus name would be needed for the main Plumbago clade as P. europaea is the type species for this genus.
4.2. Relationships in Dyerophytum
All three phylogenies presented in this study strongly support Dyerophytum africanum as a clade (P = 1 in all trees) and place this species as the earliest diverging lineage within the genus. The remaining species form a well-supported sister clade (P = 1 in plastid and combined trees, P = 0.9705 in ITS tree) to D. africanum. Within this group, most D. indicum samples form a strongly supported clade which is sister to clade containing the Socotran species. Relationships within the Socotran group are not resolved in the plastid phylogeny as the plastid regions used are insufficiently variable to resolve this close relationship. However, in the ITS phylogeny D. socotranum is supported as a monophyletic group (P = 0.9851) within an unresolved group of D. pendulum. When the ITS data is combined with the plastid data the resulting tree also supports D. socotranum as a clade (P = 1).
The sister relationship of these two Socotran endemic species indicates that they have evolved from the same common ancestor that arrived on Socotra and subsequently speciated. As this Socotran lineage is sister to a clade of D. indicum it is likely that this common ancestor was derived from an ancestral Asian/Arabian population of Dyerophytum. This series of events contrasts with the proposed hypothesis for this study: that the two Socotran species were the result of two dispersal events, with D. pendulum derived from D. africanum and D. socotranum derived from D. indicum. This hypothesis was based on the similarity in leaf morphology between these species pairs, as noted by Balfour (1888). In the alternative
58 hypothesis proposed here, there has instead been a single origin of the Socotran species with subsequent evolution of divergent leaf morphology.
This significant change in leaf morphology has not been matched by strong molecular divergence, as the plastid sequences lacked sufficient variable characters between the two species to resolve their relationship. Resolution within this clade was only provided by the more variable ITS region. This pattern of evolution involving dramatic (and often rapid) morphological differentiation accompanied by very little genetic divergence is commonly seen in adaptive radiations on islands (Steussy, et al., 2006) such as in Aeonium (Mort, et al., 2002) and Argyranthemum Webb. (Francisco-Ortega, et al., 1997) in Macaronesia. Although this type of evolutionary pattern is generally one that characterises oceanic islands, adaptive radiations are also recorded from Socotra (Banfield, et al., 2011), such as in Echidnopsis (Thiv & Meve, 2007). Although the Socotran species appear morphologically divergent based on their leaf characters, they are linked by their very similar calyx morphology, which differs from that in D. indicum and D. africanum.
A complication of evolutionary relationships in Dyerophytum is that a single D. indicum sample (7999) falls outside the main D. indicum clade and is placed as sister to the rest of the Asian/ Arabian and Socotran Dyerophytum. There does not appear to be any biogeographical reason for this accession to be distinct from the other D. indicum samples, as it is one of four samples from Oman included in the study, so it might be a single divergent sample that is not representative of a general pattern, or an artefact of a fault in sequencing. Alternatively, D. indicum might be a paraphyletic species as it is geographically widespread and has given rise to the two Socotran endemic species. Paraphyly can theoretically occur in a species due to allopatric speciation by founder effects (Carson & Templeton (1984), and is suggested by some authors to be very common (Crisp & Chandler, 1996). This type of speciation is hypothesised to happen when a founding population colonises a new area by dispersal or range expansion and is reproductively isolated from the ancestral population, so diverges from the ancestral population due to genetic drift and inbreeding (Rieseberg & Brouillet, 1994). This process can produce a derivative species which is monophyletic as it was founded by a single colonisation event (by range expansion or long distance dispersal), and a progenitor species which is paraphyletic as the derivative species is nested within it (Rieseberg & Brouillet, 1994). An example cited as a case of a paraphyletic progenitor species is that of the Banksia integrifolia L.f. (Proteaceae) species complex. Thiele & Ladiges (1994) investigated this Australian plant, finding four morphologically defined units of which
59 three overlapped in distribution. The morphologically and geographically distinct fourth unit (derivative group) was not designated as a separate species as cladistic analysis found it to be deeply nested within the other three units, making the progenitor species paraphyletic.
With the data presented in this study it is not possible make any confident suggestions to explain the position of this D. indicum accession, especially as ITS was not successfully amplified for this sample. There was considerable difficulty encountered in sequencing ITS for many of the samples in this study so the ITS dataset is somewhat limited. In particular, only two D. indicum samples were successfully sequenced for this region, which is completely insufficient to determine relationships within this widespread and potentially paraphyletic species. In future work it would therefore be useful to sequence ITS for a greater number of D. indicum samples, to allow testing of monophyly in this species and to further investigate its relationship to the Socotran sister clade.
4.3. Biogeography
As discussed earlier, Socotra is a continental fragment rather than an oceanic island and so the evolution of its flora is likely to have involved a combination of both vicariance and dispersal. Recent studies utilising dated phylogenies have confirmed some cases of vicariant origin for Socotran taxa (e.g. Schaefer, et al., 2009) while others have challenged traditional thinking that the Socotran flora has primarily been shaped by vicariance, and have instead indicated the importance of dispersal (e.g. Thiv, et al., 2006). The evidence presented in this study also appears to support the role of dispersal in the evolution of the Socotran flora. The molecular phylogenies produced for this study place the Socotran endemic species Dyerophytum pendulum and D. socotranum as sister taxa, and place this clade as sister to a clade of Arabian/Asian D. indicum, which in turn are sister to the southern African species D. africanum. This topology suggests that the Socotran lineage is derived from an ancestral population in Arabia or Asia, but sister relationship alone does not indicate whether the Socotran lineage diverged due to vicariance or dispersal.
The dated phylogeny presented here, which was constructed in BEAST, dates the divergence of the Socotran lineage to 1.82 MYA (0.71-3.10 MYA). This date is very recent and places the arrival of Dyerophytum on Socotra long after the island became isolated from the Arabian Peninsula, which is estimated to have taken place around 18 MYA (Leroy, et al., 2004). Such a recent date strongly supports an origin of the Socotran species of Dyerophytum by dispersal rather than vicariance. A recent origin by dispersal has been demonstrated in other Socotran
60 groups, such as Echidnopsis (Thiv & Meve, 2007), but what is somewhat unusual in this case is the distribution of the progenitor species. Most Socotran species are thought to have an affinity with the NE Africa and Arabia region, so a widespread progenitor species would be expected to be distributed across this floristic region. However, in Dyerophytum, the progenitor species of the Socotran lineage (D. indicum) is absent from Africa despite being found in presumably similar habitats across Arabia. This pattern is further complicated by the presence of D. africanum in southern Africa, which is estimated to have diverged from the rest of the genus 6.76 MYA (2.96-11.28 MYA). If Dyerophytum has managed to reach such distant locations as India and SW Africa, it is unclear why it has never colonised NE Africa. Although the Red Sea divides these two regions, at its narrowest point between Yemen and Djibouti the distance is much shorter than that between Arabia and Socotra. Dyerophytum has evidently been able to disperse across such a distance in the past, so there is presumably an unseen barrier to colonisation of NE Africa by D. indicum, perhaps related to interactions with other taxa (e.g. pollinators or competitors). An alternative possibility is that Dyerophytum was once widespread across Africa and Arabia, but has since become extinct in North Africa.
Given the unusual disjunction within this genus, it is impossible to infer and ancestral area of origin for Dyerophytum. The earliest divergence within the genus is between the southern African and Asia/Arabian lineages, so if the sister clade to Dyerophytum was restricted to either of these regions this might indicate a possible area of origin. However, Dyerophytum is sister to the main clade of Plumbago, which is pantropical (Kubitzki, 1993). As the centre of diversity of Plumbaginaceae is considered to be central Asia, an origin in Asia/Arabia and subsequent colonisation of southern Africa seems more likely than the reverse series of events, but this is purely conjecture.
Within the Socotran clade of Dyerophytum, the split between D. pendulum and D. socotranum is dated to 1.02 MYA (0.33-1.85 MYA). As discussed earlier, there has been significant divergence in leaf morphology between these species, and the data presented here indicates that this change has been rapid. The speciation of this lineage into two highly distinct taxonomic units is somewhat unusual on Socotra, where the evolution of endemic taxa is thought to be most frequently caused by anagenesis rather than the dramatic adaptive radiations often seen on oceanic islands (Banfield, et al., 2011). Evolution of a new species by anagenesis involves the founding of an island population, which gradually diverges from the mainland population through time to become an endemic species without giving rise to
61 further lineages (Stuessy, et al., 2006). Socotran Dyerophytum differs from this model and instead appears to be case of a modest radiation (where a founding population becomes isolated and differentiates into multiple lineages, with the original form not surviving (Banfield, et al., 2011).
Radiations may be considered adaptive where the different lineages appear to fulfil different ecological roles, whereas non-adaptive radiations occur when radiation occurs but the resulting species have overlapping distributions and show little ecological differentiation (Rundell & Price, 2009). In the case of Dyerophytum on Socotra it appears that the radiation has been adaptive as the two species occupy different ranges on the island. Looking at the distribution maps (see Figures 4.3.a and 4.3.b), D. pendulum is clearly clustered in a region corresponding to the Haggier Mountains, and occupies an altitude range of 600-1000m (Miller & Morris, 2004). In contrast, D. socotranum is more scattered across the eastern half of the island, occupying an altitude range of 30-650m (Miller & Morris, 2004), and does not appear to overlap significantly with the distribution of D. pendulum. As well as being differentiated geographically and by altitude range, it seems that the two species differ in substrate preference, with the range of D. pendulum corresponding to areas of granitic rocks, whereas D. socotranum occurs in areas which correspond to limestone substrates (see Figure 4.3.c). This strongly indicates that the species inhabit different niches, with D. pendulum occupying the humid high-altitude granitic zone of the Haggier Mountains, while D. socotranum occupies the more arid and lower altitude limestone cliffs and wadi sides (Miller & Morris, 2004). Such a clear distinction in niches between Socotran endemics has also been observed in Boswellia which has seven species endemic to the island, with each having non- overlapping ranges. They also show different adaptations, with a divide between simple- leaved cliff-dwelling species with swollen holdfasts to attach them to the rocks, and pinnate- leaved species which grow on the ground (Banfield, et al., 2011).
After examination of the dated phylogeny presented here, it seems clear that D. socotranum and D. pendulum originated from a single dispersal event to Socotra, which was followed by adaptive radiation into two lineages with distinct niches. As always with molecular dating techniques, there is a degree of uncertainty in the node age estimates, particularly in this case as secondary calibration points were used rather than primary fossil data. However, even the 95% confidence interval for the age of the Socotran clade is comfortably below the estimated age of separation for Socotra, so there is a reasonable level of confidence in this result. As with the undated phylogenies presented in this study, there is some uncertainty associated
62 with the relationship between D. indicum and the Socotran clade which could be investigated further by including a greater number of D. indicum samples in future analyses.
A peculiar feature of the Socotran clade is the strong support for D. socotranum as a clade, while D. pendulum is unresolved in the Bayesian consensus trees. This could be explained if D. pendulum was thought to have given rise to D. socotranum by isolation of a peripheral population, but this seems highly unlikely as D. socotranum is much more widespread across Socotra than D. pendulum. The use of additional highly variable genetic regions for phylogenetic analysis in this genus could help resolve this relationship further. The apparent differentiation of niche space between these species is interesting and could be a significant example of adaptive radiation on Socotra; however the distribution data currently available is rather limited. More detailed distribution data for this species and additional ecological data such as substrate type, would allow much better understanding of the abiotic factors that have driven speciation in this clade.
63
Figure 4.3.a: Distribution map of Dyerophytum pendulum on Socotra
Figure reproduced from Miller & Morris (2004)
Figure 4.3.b: Distribution map of Dyerophytum socotranum on Socotra
Figure reproduced from Miller & Morris (2004)
64
Figure 4.3.c: Geological map of Socotra
Figure reproduced from Fleitmann, et al. (2004).
65
4.4. Morphological Characters
After examination of all the available material it was found that the leaves and calyx provided the most informative characters for species delimitation in Dyerophytum. Amongst the specimens examined, presence or absence of a petiole could be used to define groups and there was also informative variation in leaf shape. Most floral characters within Dyerophytum are fairly uniform as there was no variation observed in the number and arrangement of floral parts, however the distinctive membranous calyx in this genus shows considerable variation in the size and shape of its lobes, which was found to be very informative in defining groups.
Some characters mentioned in the taxonomic literature were found to be uninformative for species delimitation or could not be measured from the material available. Balfour (1888) mentions that the bracts of D. socotranum are “hardly so cuspidate as in the type [of D. indicum]”, but after examination of the specimens no useful variation in bract morphology could be seen in Dyerophytum. The size and shape of the corolla tube and lobes in this genus has been described in several floristic accounts, although not suggested as a diagnostic character. In practise it was very difficult to accurately measure corolla characters as this structure is very brittle when dry, so was poorly preserved on many specimens, and when intact was usually twisted rather than pressed flat. Therefore in the taxonomic account, the corolla length is given as a maximum value, as smaller values for each species were generally from broken or twisted corollas. Corolla lobe morphology was not described as this was almost impossible to measure from herbarium material. Leaf dimensions were of less taxonomic value than the ratio of these measurements as leaf size varies enormously (10x difference between largest and smallest leaves) between leaves on a single specimen, and between specimens which otherwise appear to belong to the same group. As Dyerophytum often grows as quite large shrubs and small trees it is likely that stems taken from different parts of the plant, and from plants of different ages, will differ in their leaf size. Leaf L:W ratio was instead used as a surrogate for leaf shape, although this has its limitations as it does not account for the presence of a petiole, so a petiolate leaf with a broad blade may have a very similar L:W ratio to an orbicular sessile leaf despite their obvious difference in shape. Summary statistics for morphological characters measured are provided in Appendix 8.6.
The limitations of working with herbarium specimens means that some characters which may be useful for identification in the field, e.g. corolla morphology, were not possible to study in detail. Flower colour may also be a helpful field character but this is lost in dried specimens,
66 is often omitted from specimen labels, and if recorded is generally not done so in a consistent way that would allow comparisons to be made. These sorts of characters could be much better recorded by taking photographs of the live plants, which would allow the construction of photographic keys suitable for identifying plants in the field. These visual rather than descriptive keys are especially valuable when working in areas where there is a language barrier between researchers and those with detailed local knowledge of the native plants.
The results of the PCA analysis confirm the presence of four distinct taxonomic units within Dyerophytum, as also indicated by the molecular phylogenies presented in this study. In Figures 3.3.a and 3.3.b, D. africanum appears as a highly distinct cluster, which is to be expected as this lineage is the earliest diverging within the genus and completely geographically isolated from the other three species. This isolation manifests itself in the very distinctive calyx morphology of this species, which differs greatly from the calyx type in the rest of the genus. In each of the three PCA figures, D. indicum forms quite a broad cluster compared to the other three species. This is likely to be due to its much wider geographic distribution than the other species, as the habitats across its range will differ to some extent and this would be expected to result in more diverse morphology in response. The two Socotran species form a broad cluster close to D. indicum in Figure 3.3.a, but much better separated from each other in Figure 3.3.b and especially in Figure 3.3.c , although in each of these graphs there are one or two outliers from the Socotran species placed within the D. indicum cluster.
The differing degree of separation of the four clusters in each graph is the result of different loadings of the principal components. PC1 is primarily composed of sepal length (loading = 0.93), while PC2 is mainly sepal width (loading = 0.77) and wing width (loading = 0.39), which explains why Figure 3.3.a places D. africanum as a very distinct cluster as its sepal shape contrasts strongly with the other three species which share relatively similar sepal morphology. The PC1 axis separates the data into long sepal (D. indicum + D. pendulum) and short sepal (D. africanum + D. socotranum) groups, while the PC2 axis separates the data into wide sepal (D. indicum + D. africanum) and narrow sepal (D. socotranum + D. pendulum) groups. In combination these axes separate the data into four general clusters, although the two Socotran species and D. indicum are somewhat spread out along the PC1 axis suggesting that there is considerable intraspecific variation in sepal length.
67
PC3 only accounts for 4.1% of the variation in the dataset compared to 52.8% and 41.6% for PCs 1 and 2 respectively, however it mostly consists of leaf L:W ratio (loading = 0.99), which brings important leaf shape characters into the analysis. Together PC1 and PC3 very successfully separate the dataset into four clusters (see Figure 3.3.b), as the species can be very generally characterised as having either a low (D. indicum + D. socotranum) or high (D. africanum + D. pendulum) leaf L:W ratio which is separated along the PC3 axis, and either long (D. indicum + D. pendulum) or short (D. africanum + D. socotranum) sepals which is separated along the PC1 axis, giving four unique combinations of characters. Figure 3.3.c fails to separate D. indicum and D. africanum using PC3, as although the former tends to have a lower L:W ratio than the latter species, the wide variation in leaf shape in D. indicum means that there is some overlap between these groups with respect to that character. D. pendulum and D. socotranum have much more consistently high and low leaf L:W ratio respectively, so are placed separate from each other. The second axis (PC2) reinforces these three major clusters as D. indicum and D. africanum both have relatively broad sepals (although actual sepal shape is quite different) so are placed together with respect to this axis. In contrast, D. pendulum and D. socotranum usually have much narrower sepals than the other two species, causing them to be placed separately from D. indicum and D. africanum.
In summary, although the PCA analysis seems to confirm that there are four morphologically distinct units within Dyerophytum, no single set of axes perfectly separates the data into four non-overlapping clusters. This is an inherent limitation with attempting to represent complex 3-dimensional structures such as leaves and sepals with simple measurements, and then presenting the resulting multi-dimensional dataset on a simplified 2-dimensional graph. However, despite these limitations, careful comparison of the various combinations of principal components indicates that four distinct taxonomic units can be recognised. These units correspond to the species currently recognised within Dyerophytum and do not appear to support any further subdivisions, as although D. indicum does tend to have a broader cluster of data points compared to the other species, no consistent pattern can be seen within this cluster that would merit it being divided into multiple units. This is said with the caveat that the dataset used in this study is not fully representative of the entire distribution of this species (especially within India), and is biased towards denser sampling in Arabia due to historical patterns in plant collecting activity. There are also some data points which are considered outliers in each graph, but this is to be expected when working with herbarium material which is of variable quality and does not always represent equivalent stages in the
68 life cycle of a plant, or variation in morphology between parts of a plant (e.g. leaves of upper branches compared to low branches).
When the loadings of each principal component are taken into account, the analysis suggests a unique combination of characters for each of the four species (see Table 4.4.a). Given this division of Dyerophytum into four species, the taxonomic value of the morphological characters examined will be discussed, and a taxonomic revision of the genus presented.
Table 4.4.a: combinations of character states in Dyerophytum indicated by PCA analysis
Species Leaf L:W ratio Sepal length Sepal width D. indicum Low Long Wide D. africanum High Short Wide D. pendulum High Long Narrow D. socotranum Low Short Narrow
4.5. Taxonomy
Amongst the specimens examined, two major groups can be identified based on leaf attachment (see Figure 4.5.a), with some specimens having leaves which taper into a petiole, while others have a completely sessile leaf base. Within the petiolate specimens a further division can be made based on the shape of the leaf blade, with one group of specimens (corresponding to D. africanum) having a more cuneate leaf shape, and the other group (corresponding to D. pendulum) having a more elliptic-obovate shape, though this distinction is not always clear. Although D. africanum and D, pendulum may share superficially similar foliage (as noted by Balour (1888)), their entirely separate ranges (in SW Africa and Socotra respectively) mean that they would never be confused in the field. The more striking difference between the two taxa is in the flowers which differ strongly in their calyx morphology (see Figure 4.5.b). D. africanum has ovate sepals with a distinct acuminate apex and deeply wrinkled wings either side of the midrib; whereas D. pendulum has calyx lobes which are generally longer but approximately half as wide and a very different shape, being lanceolate-oblong, with almost straight sides and very narrow wings which are only slightly wrinkled.
Within the sessile-leaved specimens there is greater difficulty in separating the two species. Leaf shape in D. socotranum is fairly consistently orbicular to obovate with an emarginate
69 apex, and most specimens have an obviously perfoliate leaf base; however this leaf shape also exists within the range of variation present in D. indicum. This widespread species shows much greater variation in leaf size and shape than other members of Dyerophytum and shows considerable variation even between leaves on the same specimen. Like D. socotranum the leaves may be orbicular-obovate, but may also be longer and more oval in outline, with an emarginate or rounded apex, and a base which may or may not be perfoliate. Although these two species cannot be reliably separated on leaf characters, like D. africanum and D. pendulum, they can be separated based on the calyx morphology. Sepals of D. indicum are generally longer than those of D. socotranum and differ in shape, having a lanceolate outline and rounded base with fairly broad wrinkled wings that taper to an acute apex. Sepals in D. socotranum are generally shorter and have very narrow slightly wrinkled wings with almost straight sides, giving a narrowly lanceolate-oblong shape. The difference in sepal shape observed in this study matches the description in the Botany of Socotra (Balfour, 1888), in which D. socotranum is distinguished from D. indicum by having sepals which “are not so broad, their membranous margin is narrower, with its transverse bullate undulation very slightly marked, indeed conspicuous only towards the apex of the sepal, and at its base it is not so rounded but more abruptly truncate.”
Unlike D. africanum and D. pendulum, this pair of superficially similar species share a much closer distribution, with D. indicum growing in Arabia and India, while D. socotranum is restricted to Socotra. This pattern led Balfour (1888) to consider D. socotranum as an insular form of D. indicum rather than a species in its own right. The phylogenetic evidence presented in this study contradicts this hypothesis, as it indicates that D. socotranum is actually more closely related to its morphologically distinct Socotran neighbour D. pendulum than it is to D. indicum. To retain D. socotranum as a variety of D. indicum would make this species paraphyletic, as it would exclude D. pendulum. As all three taxonomic units can reliably distinguished by both morphological and molecular characters it is more logical to maintain D. socotranum as an endemic species rather than an insular form. As discussed in the taxonomic history of Dyerophytum (see section 1.3), the name D. socotranum has been adopted into use after being written on herbarium sheets. However, this does not constitute effective publication, so it is recommended that the name D. socotranum be properly published, thereby raising the taxon from varietal to species rank.
70
Figure 4.5.a: Photographs showing representative leaf shapes in herbarium specimens of Dyerophytum
Clockwise from top left image: Dyerophytum africanum, Dyerophytum indicum, Dyerophytum socotranum, Dyerophytum pendulum.
Ruler used for scale in photographs is marked in mm.
71
Figure 4.5.b: Photographs showing representative floral morphology in herbarium specimens of Dyerophytum
From left to right: Dyerophytum africanum, Dyerophytum indicum, Dyerophytum pendulum, Dyerophytum socotranum.
Ruler used for scale in photographs is marked in mm.
72
4.6. Heterostyly
Heterostyly in Dyerophytum has been previously investigated by Dahlgren and Weber-El Ghobary (1986), both of whom found evidence of dimorphic exine sculpturing in D. indicum and D. africanum. SEM images of pollen grains from these species presented here (see Figures 3.4.a-h) confirm their findings. Like Weber-El Ghobary (1986) this study has found evidence of two pollen morphs in each of these species, with one type having verrucae with a distinct spinule on top, and the other type having verrucae with a rounded top and a slight point. The pollen types differ somewhat between the two species, with D. africanum having larger spinules than D. indicum, so that the long-spinule type pollen of D. indicum most closely resembles the short-spinule type of D. africanum. This dimorphism in exine sculpturing was considered sufficient by Weber-El Ghobary (1986) to designate these species as heterostylous despite the absence of reciprocal herkogamy (dimorphism in style and stamen length) which is usually an important component of the heterostylous syndrome. However, it is reported in the above paper that Dahlgren did find dimorphism in stigma size and surface morphology. This supports the designation of heterostyly in these species as the combination of pollen and stigma dimorphism is thought to work as a lock and key mechanism regulating the germination of pollen grains as part of the self-incompatibility system in heterostylous species (Cohen, 2010).
Without breeding experiments to test for self-incompatibility and cross-compatibility between floral morphs (as has been performed for Plumbago auriculata by Ferrero, et al. (2009a)) the designation of heterostyly in these species cannot be certain. However, assuming the pollen dimorphism demonstrated in this study and by Weber-El Ghobary (1986) reflects a distylous breeding system in these species, this would be a rare but not unique case of heterostyly without reciprocal herkogamy. This type of heterostyly has been recorded in members of the Staticoideae subfamily, with Armeria, Limoniastrum and some sections of Limonium possessing dimorphic pollen and stigmas without style and stamen dimorphism (Baker, 1966). Even more unusually, the genera Goniolimon and Acantholimon exhibit pollen dimorphism without style and stamen dimorphism and also without any dimophism of the stigmas, and yet plants with different pollen morphs in these species have been shown to be self-incompatible and cross-compatible through breeding experiments (Baker, 1966). A similar type of heterostyly to that seen in Dyerophytum may also occur in some species of Ceratostigma and Plumbago, with Nowicke & Skvarla (1977) reporting dimorphic exine sculpturing in Ceratostigma griffithii and Plumbago europaea. It is not clear whether these
73 species have constant style and stigma length as has been reported for Dyerophytum, but Baker (1966) considered these genera to be monomorphic. It is thought that these different combinations of characters in Plumbaginaceae may represent a series of stages in the evolution and breakdown of heterostyly (Baker, 1966).
Previous investigations of heterostyly in Dyerophytum have failed to examine any material from the two Socotran endemic species: D. pendulum and D. socotranum. In this study it was hypothesised that pollen dimorphism would be present throughout the genus, but after examination of pollen from multiple specimens of each species no evidence can be seen that would support their designation as dimorphic. Pollen in these species appears quite uniform and almost identical in appearance to the rounded-verrucae form observed in D. indicum. In the absence of additional data on stigma morphology and self-incompatibility it is not possible to definitively say that these species are not heterostylous. However, in light of the phylogenetic evidence presented in this study, it is quite possible that during the colonisation of Socotra by a presumably heterostylous ancestor from Asia/Arabia there was a selective pressure for self-compatibility, and heterostyly was lost in this lineage.
Populations which have dispersed to islands can undergo rapid genetic changes both due to genetic drift and the pressure to adapt to a new environment. Founding populations undergo genetic drift because typically only a small number of individuals arrive during a long distance dispersal event, and these individuals will therefore only a represent a fraction of the genetic diversity present in the continental population (Whittaker & Fernández-Palacios, 2007). As the founding population may be small and very genetically uniform, there is strong selection pressure for individuals to be able to breed with these closely related individuals and to be capable of self-fertilisation (Stebbins, 1857). In some cases only a single propagule may arrive on an island, so the species will only be able to colonise if it is capable of self- fertilisation.
This strong short-term advantage for island colonists to be self-compatible, despite the longer term negative consequences of homozygosity and inbreeding depression, has been termed “Baker’s rule” (Baker, 1955; Stebbins, 1957). This rule has also been extended to weeds of highly disturbed habitats which are frequently subjected to population decimation (Baker, 1955) and also peripheral populations of widespread species which have become isolated (Stebbins, 1957). If this theory is correct, there should a selective disadvantage in these bottleneck situations for plants with self-incompatible breeding systems, e.g. due to
74 heterostyly and dioecy. Although there is scepticism about Baker’s rule from authors such as Busch, (2011) due to doubts about the precise conditions under which self-fertilisation is favoured, there do seem to be a number of examples consistent with the idea that colonists of islands and marginal habitats tend to lose self-incompatibility.
Examples cited in support of Baker’s rule include the species Coprosma pumila Hook. (Rubiaceae) which is present as an outbreeding dioecious form on New Zealand, whereas on the extremely isolated Macquarie Island 950km away, the same species is present in a monoecious and presumably self-compatible form (Taylor, 1954, Baker, 1955). This volcanic island is thought to have been completely covered by an ice sheet during the Pleistocene epoch (Taylor, 1954) which began approximately 1.8 MYA (Gradstein, et al., 2004). As plants are not thought to have been able to survive on the island during this time, the dispersal of Coprosma pumila to Macquarie and its subsequent loss of self-incompatibility must have taken place later than this date, making the evolution of a monoecious condition quite recent in this population. Amongst heterostylous plants there are also examples which seem to support Baker’s rule, such Eichhorni paniculata (Spreng.) Solnis. (Pontederiaceae) which is tristylous in its continental range of NE Brazil, but was found to be monomorphic and self- pollinating on the island of Jamaica (Barrett, 1985). The author attributed this loss of heterostyly in the island population to the absence of specialised pollinators (in this case long-tongued solitary bees) which visited the Brazillian population. Loss of heterostyly in geographically isolated populations has also been recorded in Plumbaginaceae. Baker (1966) reports that monomorphic forms of the usually heterostylous Armeria maritima are found in isolated and marginal environments such as Siberia, where it is hypothesised that a reduced availability of pollinators has resulted in a selective advantage for self-pollination.
Whether small founding populations or shortage of specific pollinators is responsible for the loss of heterostyly on islands is unclear, but there do seem to be many cases where heterostyly (and dioecy) has been lost in isolated populations. The example of Coprosma pumila on Macquarie Island also demonstrates that this change can take place relatively quickly and in a timescale which is comparable to that in Dyerophytum, where the monomorphic Socotran clade diverged from the heterostylous D. indicum clade 0.7-3.1 MYA. Much further investigation is needed to better understand the evolution of breeding systems in Dyerophytum. In particular, the possibility of floral dimorphisms (e.g. style and stamen length, stigma morphology) normally associated with heterostyly need to be more thoroughly studied; as such work was not within the scope of this project. In addition, to test
75 whether D. indicum and D. africanum are truly self-incompatible and cross-compatible between floral morphs, and the Socotran species are self-fertile as indicated by their pollen morphology, breeding experiments (such as those conducted on Plumbago auriculata by Ferrero, et al., (2009a)) would need to be undertaken. Such a study may be able to establish whether the change in breeding system in the genus is related to differences in pollinator availability between Socotra and Asia/Arabia. This would be of great interest, as very little is currently known about the evolution of plant breeding systems on Socotra, and an understanding of this aspect of a plant’s biology can be crucial to conservation efforts.
76
5. Conclusions
This study has demonstrated that Dyerophytum is a genus consisting of four morphologically distinct species, and is placed in the Plumbaginoideae subfamily of Plumbaginaceae. Dyerophytum is placed as sister to a main clade of Plumbago, but relationships with this genus are complicated by the unexpected sister relationship of Plumbago europaea with Plumbagella micrantha, which requires further investigation. Within Dyerophytum the two Socotran species form a clade which has been shown to have a very recent origin, so must be the result of long distance dispersal from Asia/Arabia. The differentiation of this Socotran lineage of Dyerophytum into two taxa appears to be a case of adaptive radiation, as each species occupies a distinct niche in terms of altitude, substrate and geographic range. This case adds more support to the idea that the Socotran flora has been shaped by both vicariance and dispersal, and contains both ancient and recent components. Relationships between the Socotran species and the widespread species D. indicum are not entirely clear, as there is a possibility that this species may be paraphyletic. Wider sampling across the geographic range of this species in any future phylogenetic analyses may help to resolve relationships within this species and to the Socotran clade. The presence of dimorphic exine sculpturing has been confirmed in two species of Dyerophytum, but seems to be absent in the Socotran species. This loss of heterostyly may well be the result of selective pressures on island colonists to become self-compatible, but further work is required to better understand the evolution of breeding systems in this genus. The results presented in this study provide much needed insight into the evolution of plants on the unique and under-studied island of Socotra.
77
6. Taxonomic Revision
A list of specimens consulted is provided in Appendix 8.3.
Dyerophytum Kuntze Revis. Gen. Pl. 2: 394. (1891)
Syn.: Vogelia Lam. Illustr. Tabl. Encycl. 1, 2:. Pl. 149 (1792); Wright in Fl. Cap. (Harvey) 4, 1: 425 (1906)
Shrubs and small trees. Stems terete, finely striated. Leaves simple, alternate, sessile or petiolate, glabrous, grey green with white powdery coating, margin entire. Flowers actinomorphic, hermaphrodite, on short pedicels in terminal paniculate spikes, bracts and bracteoles small, lanceolate. Calyx persistent, green, yellow or reddish with red-brown stripes, strongly 5-ribbed, lobes free almost to base, membranous wings between prominent ribs transversely wrinkled. Corolla funnel-shaped, 5-lobed, white-yellow with red-purple stripes. Stamens free, inserted opposite corolla lobes, filaments slender, anthers exserted just beyond throat of corolla tube. Ovary superior, 5-angled, 1-locular. Style terminal, 5- branched, densely hairy at base. Fruit a capsule, circumscissile at base, splitting upwards into 5 valves. Seeds smooth, pyriform.
Key:
1. Leaves petiolate...... 2
+ Leaves sessile...... 3
2. Leaves broadly cuneate-obtuse, calyx lobes 6-8 x 3-4.5 mm, ovate, apex acuminate, wings deeply wrinkled, corolla tube to 15mm...... 1. D. africanum
+ Leaves broadly elliptic-obovate, calyx lobes 7-11 x 1-2.5mm, narrowly lanceolate-oblong, apex acute, wings slightly wrinkled, corolla tube to 20mm...... 2. D. pendulum
3. Leaves orbicular to obovate, apex emarginate, calyx lobes 6-8.5 x 0.5-2mm, narrowly lanceolate-oblong, wings slightly wrinkled, corolla tube to 20mm………….3. D. socotranum
+ Leaves orbicular to oval, apex emarginate or obtuse, calyx lobes 7-11 x 1.5-4mm, lanceolate, wings moderately wrinkled, corolla tube to 25mm……………..…...4. D. indicum
78
1. Dyerophytum africanum (Lam.) Kuntze in Revis. Gen. Pl. 2: 394. (1891); Syn.: Vogelia Africana Lam. Illustr. Tabl. Encycl. 1, 2: Pl. 149 (1792); Wright in Fl. Cap. (Harvey) 4, 1: 425 (1906); Type: Interior of Cape, without exact locality, Levaillant in Lam. Illustr. Tabl. Encycl. 1, 2: Pl. 149 (1792); Illustr.: Fl. S. Africa (ed. L.E.W. Codd, et al.) (1963) 26: 18; Thes. Cap. (Harvey) (1859) 1: Pl. 198.
Shrub to 1m. Leaves 10-30 x 5-20mm, spathulate, tapering into petiole, blade broadly cuneate-obtuse, apex us. cuspidate, occ. emarginate. Calyx 6-8 x 3-5mm, lobes 6-8 x 3-4.5 mm, ovate, apex acuminate, wings 1.3-2.2mm wide either side of midrib, deeply wrinkled. Corolla tube to 15mm.
Arid areas and rocky/gravelly slopes. 150-1850m
South Africa (N & W Cape), Namibia, Angola
Note: Species separated from all other Dyerophytum based on its geographic range and its very distinct flowers which have a shorter corolla and much broader and more deeply wrinkled calyx lobes. Leaf shape is quite similar to D. pendulum but is more cuneate.
2. Dyerophytum pendulum (Balf.f.) Kuntze in Revis. Gen. Pl. 2: 394. (1891); Syn.: Vogelia pendula Balf.f in Proc. Roy. Soc. Edinb. 12: 76. (1884). Type: Yemen (Socotra) Balfour 411 (E, P, GH); Yemen (Socotra) Wadi Dilal Scweinfurth 586 (E, P); Illustr. Trans. Roy. Soc. Edin. 31: Tab. XLIV; Illustr.: Ethnoflora of Socotra (Miller & Morris, 2004), 221.
Tree to 3.5m. Leaves 15-35 x 5-20mm, spathulate, tapering into petiole, blade broadly elliptic-obovate, apex cuspidate. Calyx 6-11 x 2-4mm, lobes 7-11 x 1-2.5mm, narrowly lanceolate-oblong, apex acute, wings 0.4-1.0mm either side of midrib, slightly wrinkled. Corolla tube to 20mm.
Deciduous woodland and limestone rocks. 250-1000m
Yemen (Socotra). Endemic.
Note: Species separated from D. africanum and D. indicum based on its geographic range. It differs from D. indicum and the other Socotran species (D. socotranum) in the presence of a petiole. It also differs from D. socotranum in having longer calyx lobes.
79
3. Dyerophytum socotranum J.R. Edmondson (ined.); Syn.: Dyerophytum indicum (Gibs. ex Wight) Kuntze var. socotrana Balf.f. in Revis. Gen. Pl. 2: 394. (1891); Syn.: Vogelia indica (Gibs. ex Wight) var. socotrana Balf.f. in Proc. Roy. Soc. Edinb. Xii. (1883), 406; Type: Yemen (Socotra) Balfour 416 (E, K, P, GH); Yemen (Socotra) Schweinfurth 523 (E); Illustr.: Ethnoflora of Socotra (Miller & Morris, 2004), 221.
Tree or shrub to 3m. Leaves 15-40 x 15-50mm, base sessile and usually perfoliate, blade orbicular to obovate, apex emarginate, often with small apiculate tip. Calyx 6-8 x 2-4mm, lobes 6-8.5 x 0.5-2mm, narrowly lanceolate-oblong, apex acute, wings 0.3-0.8mm either side of midrib, slightly wrinkled. Corolla tube to 20mm.
Mixed sclerophyllous and evergreen scrub, amongst limestone boulders on escarpments and wadi sides.
Yemen (Socotra). Endemic.
Note: Species separated from D. africanum and D. indicum based on its geographic range. Foliage often resembles that of D. indicum but can separated based on the flowers, as the calyx lobes are shorter, narrower and less deeply wrinkled. D. socotranum can be separated from D. pendulum by its sessile leaf base.
4. Dyerophytum indicum (Gibs. ex Wight) Kuntze in Revis. Gen. Pl. 2: 394. (1891); Syn.: Dyerophytum arabicum (Boiss.) M.R.Almeida in Fl. Maharashtra 3A: 156 (2001); Syn.: Vogelia arabica Boiss. in Prodr. (A. P. de Candolle) 12: 696 (1848) Type: Oman Aucher Eloy 5285 (MPU, P); Syn.: Vogelia perfoliata (Stocks ex Wight) in Calcutta J. Nat. Hist. vii:17 (1847); Syn.: Vogelia indica (Gibs. ex Wight) in Calcutta J. Nat. Hist. 7: 17 (1847); Icon. Pl. Ind. Orient. 3: Part 4: 5-6 (R. Wight) (1846); Type: Humicul Ghavt leading down to Sungunnure in the Deccan, Gibson in (R. Wight) Illustr. Icon. Pl. Ind. Orient. 3: Pl. 1075 (1846); Illustr.: Fl. of Ahmednagar Dist. (Pradhan & Singh) (1999), 336; Fl. Of Rajasthan S & SE Region (Tiagi & Aery) (2007), 318; Fl. Maharashtra 3A Fig. 67, Pl. 39; Plants of Dhofar (Miller & Morris, 1988), 229.
Shrub to 3m. Leaves 10-90 x10-80mm, base sessile and sometimes perfoliate, blade orbicular to oval, apex emarginate or obtuse, sometimes with small apiculate tip. Calyx 6-13 x 2-5mm,
80 lobes 7-11 x 1.5-4mm, lanceolate, apex acute, wings 0.5-1.8mm either side of midrib, moderately wrinkled. Corolla tube to 25mm.
India (N & W), Yemen, Oman, United Arab Emirates
Note: Species separated from all other Dyerophytum based on its geographic range. Foliage is often very similar to D. socotranum, but can be separated based on the flowers as the corolla is longer and the calyx lobes are longer, broader, and more deeply wrinkled.
81
7. References
Albert, V. A., Williams, S. E., & Chase, M. W. (1992). Carnivorous plants: phylogeny and structural evolution. Science, 257(5076), 1491-1495.
Allen, A. M., & Hiscock, S. J. (2008). Evolution and phylogeny of self-incompatibility systems in angiosperms. In Self-incompatibility in flowering plants (pp. 73-101). Springer Berlin Heidelberg.
Almeida, M. R. (1998). Flora of Maharashtra, 3: 156-157
Almeida, S. M. (1990). Plumbaginaceae in The flora of Savantwadi: Maharashtra, India. 1: 237-238, Journal of Economic and Taxonomic Botany, Additional Series 8 (1)
Andrew Samuel, M., Harbury, N., Bott, R., & Manan Thabet, A. (1997). Field observations from the Socotran platform: their interpretation and correlation to Southern Oman. Marine and petroleum geology, 14(6), 661-673.
Andrus, N., Trusty, J., Santos-Guerra, A., Jansen, R. K., & Francisco-Ortega, J. (2004). Using molecular phylogenies to test phytogeographical links between East/South Africa– Southern Arabia and the Macaronesian islands—a review, and the case of Vierea and Pulicaria section Vieraeopsis (Asteraceae). Taxon, 53(2), 333-346.
Ariizumi, T., & Toriyama, K. (2011). Genetic regulation of sporopollenin synthesis and pollen exine development. Annual Review of Plant Biology, 62, 437-460.
Baker, H. G. (1948). Dimorphism and monomorphism in the Plumbaginaceae I. A survey of the family. Annals of Botany, 12(3), 207-219.
Baker, H. G. (1955). Self-compatibility and establishment after 'long-distance' dispersal. Evolution, 9(3), 347-349.
Baker, H. G. (1966). The evolution, functioning and breakdown of heteromorphic incompatibility systems. I. The Plumbaginaceae. Evolution, 20 (3), 349-368.
Baldwin, B. G., Sanderson, M. J., Porter, J. M., Wojciechowski, M. F., Campbell, C. S., & Donoghue, M. J. (1995). The ITS region of nuclear ribosomal DNA: a valuable source of evidence on angiosperm phylogeny. Annals of the Missouri Botanical Garden, 247-277.
82
Balfour, I. B. (1888) Botany of Socotra. Transactions of the Royal Society of Edinburgh, 31: 149-151
Balfour, I.B. (1884) Diagnoses plantarum novarum Phanerogamarum Socotrensium. Proceedings of the Royal Society of Edinburgh, 12: 76
Banfield, L. M., Van Damme, K., & Miller, A. G. (2011). Evolution and biogeography of the flora of the Socotra Archipelago (Yemen) in Bramwell, D., & Caujapé-Castells, J. (Eds.) The biology of island floras. (pp. 197-225). Cambridge University Press: Cambridge, UK.
Barrett, S. C. H. (1985). Floral trimorphism and monomorphism in continental and island populations of Eichhornia paniculata (Spreng.) Solms. (Pontederiaceae). Biological Journal of the Linnean Society, 25(1), 41-60.
Barrett, S. C. H., & Shore, J. S. (2008). New insights on heterostyly: comparative biology, ecology and genetics. In Self-incompatibility in flowering plants (pp. 3-32). Springer Berlin Heidelberg.
Barrett, S. C. H., Wilken, D. H., & Cole, W. W. (2000). Heterostyly in the Lamiaceae: The case of Salvia brandegeei. Plant Systematics and Evolution, 223(3-4), 211-219.
Bateson, W., & Gregory, R. P. (1905). On the inheritance of heterostylism in Primula. Proceedings of the Royal Society of London. Series B, Containing Papers of a Biological Character, 76(513), 581-586.
Bedell, H.G. and J.L. Reveal. (1982). Amended outlines and indices for six recently published systems of angiosperm classification. Phytologia 51: 65-156.
Behnke, H. D., & Turner, B. L. (1971). On specific sieve-tube plastids in Caryophyllales: further investigations with special reference to the Bataceae. Taxon, 731-737.
Beydoun, Z. R., & Bichan, H. R. (1969). The geology of Socotra Island, Gulf of Aden. Quarterly Journal of the Geological Society, 125(1-4), 413-441.
Boissier, E. (1848) Plumbaginacae in Prodromus Systematis Naturalis Regni Vegetabilis 12: 696
83
Borchsenius, F. (2009). FastGap 1.2. Department of Biological Sciences, University of Aarhus, Aarhus, Denmark.
Bouckaert, R., Heled, J., Kühnert, D., Vaughan, T., Wu, C-H., Xie, D., Suchard, MA., Rambaut, A., & Drummond, A. J. (2014). BEAST 2: A Software Platform for Bayesian Evolutionary Analysis. PLoS Computational Biology, 10(4)
Boyes, J. W. (1939). Embryo-sac development in Plumbagella. Proceedings of the National Academy of Sciences of the United States of America, 25(3), 141.
Boyes, J. W., & Battaglia, E. (1951). Embryo-Sac Development in the Plumbaginaceae. Caryologia, 3(3), 305-310.
Busch, J. W. (2011). Demography, pollination, and Baker's law. Evolution, 65(5), 1511-1513.
Carson, H. L., & Templeton, A. R. (1984). Genetic revolutions in relation to speciation phenomena: the founding of new populations. Annual Review of Ecology and Systematics, 15: 97-131.
Charlesworth, D., & Charlesworth, B. (1987). Inbreeding depression and its evolutionary consequences. Annual review of ecology and systematics, 18: 237-268.
Chase, M. W., Soltis, D. E., Olmstead, R. G., Morgan, D., Les, D. H., Mishler, B. D., ... & Albert, V. A. (1993). Phylogenetics of seed plants: an analysis of nucleotide sequences from the plastid gene rbcL. Annals of the Missouri Botanical Garden, 90 (3) 528-580.
Clarke, C.B. (1882) Plumbaginaeae in Flora of British India 3: 478-481, Ed. Hooker, J.D.
Clinckemaillie, D., & Smets, E. (1992). Floral similarities between Plumbaginaceae and Primulaceae: systematic significance. Belgian Journal of Botany, 125(1), 151-153.
Cohen, J. I. (2010). “A case to which no parallel exists”: The influence of Darwin’s Different Forms of Flowers. American Journal of Botany, 97(5), 701-716.
Cooke, T. (1908). Plumbaginaceae in The flora of the presidency of Bombay 2: 76-79.
Crisp, M. D., & Chandler, G. T. (1996). Paraphyletic species. Telopea, 6(4), 813-844.
84
Cronquist, A. (1968). The Evolution and Classification of Flowering Plants. Houghton Mifflin Co., Boston.
Crowe, L. K. (1964). The evolution of outbreeding in plants I. Heredity, 19, 43-5.
Cuénoud, P., Savolainen, V., Chatrou, L. W., Powell, M., Grayer, R. J., & Chase, M. W. (2002). Molecular phylogenetics of Caryophyllales based on nuclear 18S rDNA and plastid rbcL, atpB, and matK DNA sequences. American Journal of Botany, 89(1), 132-144.
Dahlgren, R. (1983). General aspects of angiosperm evolution and macrosystematics. Nordic Journal of Botany, 3(1), 119-149.
Darriba D, Taboada G.L., Doallo R., Posada D. (2012). jModelTest 2: more models, new heuristics and parallel computing. Nature Methods 9(8), 772.
Darwin, C. (1877). The different forms of flowers on plants of the same species. John Murray, Albemarle Street.
De Sanctis, M., Adeeb, A., Farcomeni, A., Patriarca, C., Saed, A., & Attorre, F. (2013). Classification and distribution patterns of plant communities on Socotra Island, Yemen. Applied Vegetation Science, 16(1), 148-165.
Downie, S. R., & Palmer, J. D. (1994). A chloroplast DNA phylogeny of the Caryophyllales based on structural and inverted repeat restriction site variation. Systematic Botany, 19 (2), 236-252.
Drummond, A. J., Ho, S. Y., Phillips, M. J., & Rambaut, A. (2006). Relaxed phylogenetics and dating with confidence. PLoS biology, 4(5), e88.
Drummond, A. J., Suchard, M. A., Xie, D., & Rambaut, A. (2012). Bayesian phylogenetics with BEAUti and the BEAST 1.7. Molecular biology and evolution, 29(8), 1969-1973.
Drury, H. (1869). Plumbaginaceae in Handbook of the Indian flora. 2: 572-575
Dulberger, R. (1973). Distyly in Linum pubescens and L. mucronatum. Botanical Journal of the Linnean Society, 66(2), 117-126.
85
Dulberger, R. (1974). Structural dimorphism of stigmatic papillae in distylous Linum species. American Journal of Botany, 61 (3) 238-243.
Dulberger, R. (1975). S-gene action and the significance of characters in the heterostylous syndrome. Heredity, 35(3), 407-15.
Dulberger, R. (1987). Fine structure and cytochemistry of the stigma surface and incompatibility in some distylous Linum species. Annals of Botany, 59(2), 203-217.
Dulberger, R., & Ornduff, R. (2000). Stigma morphology in distylous and non-heterostylous species of Villarsia (Menyanthaceae). Plant Systematics and Evolution, 225(1-4), 171-184.
Eckardt, T. (1976). Classical morphological features of centrospermous families. Plant Systematics and Evolution, 126(1), 5-25.
Faivre, A. E. (2000). Ontogenetic differences in heterostylous plants and implications for development from a herkogamous ancestor. Evolution, 54(3), 847-858.
Fay, M. F., Cameron, K. M., Prance, G. T., Lledó, M. D., & Chase, M. W. (1997). Familial relationships of Rhabdodendron (Rhabdodendraceae): plastid rbcL sequences indicate a caryophyllid placement. Kew Bulletin, 52 (4) 923-932.
Fernández‐Palacios, J. M., & Nicolás, J. P. (1995). Altitudinal pattern of vegetation variation on Tenerife. Journal of Vegetation Science, 6(2), 183-190.
Fernández‐Palacios, J. M., de Nascimento, L., Otto, R., Delgado, J. D., García‐del‐Rey, E., Arévalo, J. R., & Whittaker, R. J. (2011). A reconstruction of Palaeo‐Macaronesia, with particular reference to the long‐term biogeography of the Atlantic island laurel forests. Journal of Biogeography, 38(2), 226-246.
Ferrero, V., De Vega, C., Stafford, G. I., Van Staden, J., & Johnson, S. D. (2009a). Heterostyly and pollinators in Plumbago auriculata (Plumbaginaceae). South African Journal of Botany, 75(4), 778-784.
Ferrero, V., Arroyo, J., Vargas, P., Thompson, J. D., & Navarro, L. (2009b). Evolutionary transitions of style polymorphisms in Lithodora (Boraginaceae). Perspectives in Plant Ecology, Evolution and Systematics, 11(2), 111-125.
86
Fleitmann, D., Matter, A., Burns, S. J., Al-Subbary, A., & Al-Aowah, M. A. (2004). Geology and Quaternary climate history of Socotra. Fauna of Arabia, 20, 27-44.
Francisco-Ortega, J., Santos-Guerra, A., Hines, A., & Jansen, R. (1997). Molecular evidence for a Mediterranean origin of the Macaronesian endemic genus Argyranthemum (Asteraceae). American Journal of Botany, 84(11), 1595-1595.
Ganders, F. R. (1979). The biology of heterostyly. New Zealand Journal of Botany, 17(4), 607-635.
Ghazanfar, S. A. (2007). Flora of the Sultanate of Oman. 1: 90
Giannasi, D. E., Zurawski, G., Learn, G., & Clegg, M. T. (1992). Evolutionary relationships of the Caryophyllidae based on comparative rbcL sequences. Systematic Botany, 17 (1), 1-15.
Gradstein, F. M., Ogg, J. G., & Smith, A. G. (Eds.). (2004). A geologic time scale (Vol. 86). Cambridge University Press.
Guindon, S. & Gascuel, O. (2003). A simple, fast and accurate method to estimate large phylogenies by maximum-likelihood". Systematic Biology 52: 696-704.
Hammer, Ø., Harper, D.A.T., Ryan, P.D.(2001). PAST: Paleontological statistics software package for education and data analysis. Palaeontologia Electronica 4(1): 9pp. http://palaeo- electronica.org/2001_1/past/issue1_01.htm
Hanson, A. D., Rathinasabapathi, B., Rivoal, J., Burnet, M., Dillon, M. O., & Gage, D. A. (1994). Osmoprotective compounds in the Plumbaginaceae: a natural experiment in metabolic engineering of stress tolerance. Proceedings of the National Academy of Sciences, 91(1), 306-310.
Harborne, J. B. (1967). Comparative biochemistry of the flavonoids-IV.: Correlations between chemistry, pollen morphology and systematics in the family Plumbaginaceae. Phytochemistry, 6(10), 1415-1428.
Heled, J., & Drummond, A. J. (2012). Calibrated tree priors for relaxed phylogenetics and divergence time estimation. Systematic biology, 61 (1): 138-149
Heywood, V. H. (1993). Flowering plants of the world (2nd Ed.), Firefly Books.
87
Hickey, M., & King, C. (1988). 100 families of flowering plants. Cambridge University Press.
Hong, S. P. (1999). Pollen dimorphism in heterostylous species of Oxygonum (Polygonaceae, Polygoneae). Systematics and Geography of Plants, 68: 245-252.
Hoot, S. B., Magallon, S., & Crane, P. R. (1999). Phylogeny of basal eudicots based on three molecular data sets: atpB, rbcL, and 18S nuclear ribosomal DNA sequences. Annals of the Missouri Botanical Garden, 86 (1),1-32.
Huelsenbeck, J. P. and F. Ronquist. (2001). MRBAYES: Bayesian inference of phylogeny. Bioinformatics 17: 754-755.
Hutchinson, J. (1973). Plumbaginaceae in Families of flowering plants. (3rd Ed.), Macmillan and co. 560-561.
Klackenberg, J. (1985). The genus Exacum (Gentianaceae). Opera Bot, (84), 1-144.
Kubitzki, K. (1993). Plumbaginaceae. Pp. 523-530 in The families and genera of vascular plants, eds. Kubitzki, K., Rohwer, J. G., and Bittrich, V. Berlin: Springer-Verlag.
Kürschner, H., Hein, P., Kilian, N., & Hubaishan, M. A. (2006). Diversity and zonation of the forests and woodlands of the mountains of northern Socotra, Yemen. Englera, 28: 11-55.
Lamarck, J. D. M. (1792). Tableau encyclopédique et méthodique des trois règnes de la nature: Botanique. Panckoucke, Paris.
Larkin, M. A., Blackshields, G., Brown, N. P., Chenna, R., McGettigan, P. A., McWilliam, H., ... & Higgins, D. G. (2007). Clustal W and Clustal X version 2.0. Bioinformatics, 23(21), 2947-2948.
Le Houerou, H. N. (2003). Bioclimatology and phytogeography of the Red Sea and Aden Gulf Basins: A monograph (with a particular reference to the highland evergreen sclerophylls and lowland halophytes). Arid Land Research and Management, 17(3), 177-256.
Leroy, S., Gente, P., Fournier, M., d'Acremont, E., Patriat, P., Beslier, M. O., ... & Huchon, P. (2004). From rifting to spreading in the eastern Gulf of Aden: a geophysical survey of a young oceanic basin from margin to margin. Terra Nova, 16(4), 185-192.
88
Levin, D. A. (1968). The breeding system of Lithospermum caroliniense: adaptation and counteradaptation. American Naturalist, (102) 427-441.
Lewis, D. (1949). Incompatibility in flowering plants. Biological reviews, 24(4), 472-496.
Liphschitz, N., & Waisel, Y. (1982). Adaptation of plants to saline environments: salt excretion and glandular structure. In Contributions to the Ecology of Halophytes (pp. 197- 214). Springer Netherlands.
Lledo, M. D., Crespo, M. B., Cameron, K. M., Fay, M. F., & Chase, M. W. (1998). Systematics of Plumbaginaceae based upon cladistic analysis of rbcL sequence data. Systematic Botany, 23 (1), 21-29.
Lledó, M. D., Crespo, M. B., Fay, M. F., & Chase, M. W. (2005). Molecular phylogenetics of Limonium and related genera (Plumbaginaceae): biogeographical and systematic implications. American Journal of Botany, 92(7), 1189-1198.
Lledó, M. D., Karis, P. O., Crespo, M. B., Fay, M. F., & Chase, M. W. (2001). Phylogenetic position and taxonomic status of the genus Aegialitis and subfamilies Staticoideae and Plumbaginoideae (Plumbaginaceae): evidence from plastid DNA sequences and morphology. Plant Systematics and Evolution, 229(1-2), 107-124.
Mabry, T. J. (1977). The order Centrospermae. Annals of the Missouri Botanical Garden, 64 (2) 210-220.
Massinga, P. H., Johnson, S. D., & Harder, L. D. (2005). Heteromorphic incompatibility and efficiency of pollination in two distylous Pentanisia species (Rubiaceae). Annals of botany, 95(3), 389-399.
Mast, A. R., Kelso, S., & Conti, E. (2006). Are any primroses (Primula) primitively monomorphic? New Phytologist, 171(3), 605-616.
McCubbin, A. (2008). Heteromorphic self-incompatibility in Primula: twenty-first century tools promise to unravel a classic nineteenth century model system. In Self-incompatibility in flowering plants (pp. 289-308). Springer Berlin Heidelberg.
89
Meimberg, H., Dittrich, P., Bringmann, G., Schlauer, J., & Heubl, G. (2000). Molecular phylogeny of Caryophyllidae s.l. based on matK sequences with special emphasis on carnivorous taxa. Plant Biology, 2(2), 218-228.
Miller, A. (2004) Dyerophytum socotranum. The IUCN Red List of Threatened Species. Version 2014.2. www.iucnredlist.org Downloaded on 31 July 2014.
Miller, A. G., & Morris, M. (1988). Plants of Dhofar: the southern region of Oman, traditional, economic and medicinal uses. Oman: Office of the Adviser for Conservation of the Environment, Diwan of Royal Court Sultanate of Oman, 228
Miller, A. G., & Morris, M. (2004). Ethnoflora of Socotra. Royal Botanic Garden, Edinburgh.
Mort, M. E., Soltis, D. E., Soltis, P. S., Francisco-Ortega, J., & Santos-Guerra, A. (2002). Phylogenetics and evolution of the Macaronesian clade of Crassulaceae inferred from nuclear and chloroplast sequence data. Systematic Botany, 27(2), 271-288.
Morton, C. M., Karol, K. G., & Chase, M. W. (1997). Taxonomic affinities of Physena (Physenaceae) and Asteropeia (Theaceae). The Botanical Review, 63(3), 231-239.
Naiki, A., & Nagamasu, H. (2003). Distyly and pollen dimorphism in Damnacanthus (Rubiaceae). Journal of plant research, 116(2), 105-113.
Nowicke, J. W., & Skvarla, J. J. (1977). Pollen morphology and the relationship of the Plumbaginaceae, Polygonaceae, and Primulaceae to the order Centrospermae. Smithsonian Contrib. Bot, (37), 1-7.
Oldfield, S., Lusty, C., & MacKinven, A. (1998). The world list of threatened trees. World Conservation Press.
Ornduff, R. (1971). The reproductive system of Jepsonia heterandra. Evolution, 25 (2) 300- 311.
Pandey, K. K., & Troughton, J. H. (1974). Scanning electron microscopic obser vations of pollen grains and stigma in the self-incompatible heteromorphic species Primula malacoides Franch. and Forsythia x intermedia Zab., and genetics of sporopollenin deposition. Euphytica, 23(2), 337-344.
90
Peres-Neto, P. R., Jackson, D. A., & Somers, K. M. (2003). Giving meaningful interpretation to ordination axes: assessing loading significance in principal component analysis. Ecology, 84(9), 2347-2363.
Piper, J., & Charlesworth, B. (1986). The evolution of distyly in Primula vulgaris. Biological Journal of the Linnean Society, 29(2), 123-137.
Pole, M. (1994). The New Zealand flora-entirely long-distance dispersal? Journal of biogeography, 21: 625-635.
Popov, G. B. (1957). The vegetation of Socotra. Journal of the Linnean Society of London, Botany, 55(362), 706-720.
Rieseberg, L. H., & Brouillet, L. (1994). Are many plant species paraphyletic? Taxon, 43: 21- 32.
Rodríguez‐Sánchez, F., & Arroyo, J. (2008). Reconstructing the demise of Tethyan plants: climate‐driven range dynamics of Laurus since the Pliocene. Global Ecology and Biogeography, 17(6), 685-695.
Rogers, C. M. (1979). Distyly and pollen dimorphism in Linum suffruticosum (Linaceae). Plant Systematics and Evolution, 131(1-2), 127-132.
Ronquist, F. and J. P. Huelsenbeck. (2003). MRBAYES 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19:1572-1574.
Rambaut, A. (2014) FigTree v1.4.0 Available at: http://tree.bio.ed.ac.uk/software/figtree/
Rambaut, A., Suchard, M.A., Xie, W. & Drummond, A.J. (2014) Tracer v1.6. Available at: http://tree.bio.ed.ac.uk/software/tracer/
Rundell, R. J., & Price, T. D. (2009). Adaptive radiation, nonadaptive radiation, ecological speciation and nonecological speciation. Trends in Ecology & Evolution, 24(7), 394-399.
Sanderson, M. J., Thorne, J. L., Wikström, N., & Bremer, K. (2004). Molecular evidence on plant divergence times. American Journal of Botany, 91(10), 1656-1665.
91
Savolainen, V., Fay, M. F., Albach, D. C., Backlund, A., van der Bank, M., Cameron, K. M., ... & Chase, M. W. (2000a). Phylogeny of the eudicots: a nearly complete familial analysis based on rbcL gene sequences. Kew Bulletin, 55: 257-309.
Savolainen, V., Chase, M. W., Hoot, S. B., Morton, C. M., Soltis, D. E., Bayer, C., ... & Qiu, Y. L. (2000b). Phylogenetics of flowering plants based on combined analysis of plastid atpB and rbcL gene sequences. Systematic Biology, 49(2), 306-362.
Schaefer, H., Heibl, C., & Renner, S. S. (2009). Gourds afloat: a dated phylogeny reveals an Asian origin of the gourd family (Cucurbitaceae) and numerous oversea dispersal events. Proceedings of the Royal Society B: Biological Sciences, 276 (1658), 843-851.
Scholte, P., & De Geest, P. (2010). The climate of Socotra Island (Yemen): a first-time assessment of the timing of the monsoon wind reversal and its influence on precipitation and vegetation patterns. Journal of Arid Environments, 74(11), 1507-1515.
Shaw, J., Lickey, E. B., Schilling, E. E., & Small, R. L. (2007). Comparison of whole chloroplast genome sequences to choose noncoding regions for phylogenetic studies in angiosperms: the tortoise and the hare III. American Journal of Botany, 94(3), 275-288.
Soltis, D. E., soltis, P. S., Chase, M. W., Mort, M. E., Albach, D. C., Zanis, M., ... & Farris, J. S. (2000). Angiosperm phylogeny inferred from 18S rDNA, rbcL, and atpB sequences. Botanical Journal of the Linnean Society, 133(4), 381-461.
Španiel, S., Marhold, K., Filová, B., & Zozomová-Lihová, J. (2011). Genetic and morphological variation in the diploid–polyploid Alyssum montanum in Central Europe: taxonomic and evolutionary considerations. Plant Systematics and Evolution, 294(1-2), 1-25.
Stamatakis, A. (2014) RAxML Version 8: A tool for Phylogenetic Analysis and Post- Analysis of Large Phylogenies. Bioinformatics, 30 (9): 1312-1313.
Stebbins, G. L. (1957). Self fertilization and population variability in the higher plants. American Naturalist, 91 (861), 337-354.
Stuessy, T. F., Jakubowsky, G., Gómez, R. S., Pfosser, M., Schlüter, P. M., Fer, T., ... & Kato, H. (2006). Anagenetic evolution in island plants. Journal of Biogeography, 33(7), 1259-1265.
92
Sun, Y., Skinner, D. Z., Liang, G. H., & Hulbert, S. H. (1994). Phylogenetic analysis of Sorghum and related taxa using internal transcribed spacers of nuclear ribosomal DNA. Theoretical and Applied Genetics, 89(1), 26-32.
Tamura K, Peterson D, Peterson N, Stecher G, Nei M, and Kumar S (2011) MEGA5: Molecular Evolutionary Genetics Analysis using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods. Molecular Biology and Evolution 28: 2731- 2739.
Taylor, B. W. (1954). An example of long distance dispersal. Ecology, 35 (4), 569-572.
The International Plant Names Index. Published online at: www.ipni.org
Thiele, K., & Ladiges, P. Y. (1994). The Banksia integrifolia L.f. species complex (Proteaceae). Australian Systematic Botany, 7(4), 393-408.
Thiv, M., & Meve, U. (2007). A phylogenetic study of Echidnopsis Hook. f. (Apocynaceae- Asclepiadoideae) -taxonomic implications and the colonization of the Socotran archipelago. Plant Systematics and Evolution, 265(1-2), 71-86.
Thiv, M., Thulin, M., Hjertson, M., Kropf, M., & Linder, H. P. (2010). Evidence for a vicariant origin of Macaronesian–Eritreo/Arabian disjunctions in Campylanthus Roth (Plantaginaceae). Molecular Phylogenetics and Evolution, 54(2), 607-616
Thiv, M., Thulin, M., Kilian, N., & Linder, H. P. (2006). Eritreo-Arabian affinities of the Socotran flora as revealed from the molecular phylogeny of Aerva (Amaranthaceae). Systematic Botany, 31(3), 560-570.
Thorne, R.F. (1992). Classification and geography of the flowering plants. Botanical Review 58: 225-348.
Tippery, N. P., Les, D. H., Padgett, D. J., & Jacobs, S. W. (2008). Generic circumscription in Menyanthaceae: a phylogenetic evaluation. Systematic Botany, 33(3), 598-612.
Vuilleumier, B. S. (1967). The origin and evolutionary development of heterostyly in the angiosperms. Evolution, 21 (2), 210-226.
93
Walter, K. S., & Gillett, H. J. (Eds.). (1998). 1997 IUCN Red List of threatened plants. IUCN.
Webb, C. J., & Lloyd, D. G. (1986). The avoidance of interference between the presentation of pollen and stigmas in angiosperms II. Herkogamy. New Zealand journal of botany, 24(1), 163-178.
Weber-El Ghobary, M. O. (1984). The systematic relationships of Aegialitis (Plumbaginaceae) as revealed by pollen morphology. Plant systematics and evolution, 144(1), 53-58.
Weber-El Ghobary, M. O. (1986). Dimorphic exine sculpturing in two distylous species of Dyerophytum (Plumbaginaceae). Plant systematics and evolution, 152(3-4), 267-276.
Weller, S. G. (2009). The different forms of flowers–what have we learned since Darwin?. Botanical Journal of the Linnean Society, 160(3), 249-261.
Welman, W.G. (2000) Plumbaginaceae in Seed Plants of Southern Africa: Families and Genera, 447-448, Ed. Leistner, O.A.
Whittaker, R. J., & Fernández-Palacios, J. M. (2007). Island biogeography: ecology, evolution, and conservation. Oxford University Press.
Wight (1847) Notes on Indian Botany. Calcutta Journal of Natural History, 7:17
Williams, S. E., Albert, V. A., & Chase, M. W. (1994). Relationships of Droseraceae: a cladistic analysis of rbcL sequence and morphological data. American Journal of Botany, 81 (8), 1027-1037.
Wolfe, L. M., & Barrett, S. C. (1989). Patterns of pollen removal and deposition in tristylous Pontederia cordata L.(Pontederiaceae). Biological Journal of the Linnean Society, 36(4), 317-329.
Wolfe, L. M., Massinga, P. H., & Johnson, S. D. (2009). A quantitative evaluation of the distylous syndrome in Sebaea grandis (Gentianaceae). South African Journal of Botany, 75(4), 785-790.
94
Wright, C.H. (1909) Plumbaginaceae in Flora Capensis 4: 418-426, Ed. Thiselton-Dyer, W.T.
Yadav, B.L. & Meena, K.L. (2011) Plumbaginaceae in Flora of South Central Rajasthan, Scientific Publishers (India), 206-207
Yoder, A. D., & Nowak, M. D. (2006). Has vicariance or dispersal been the predominant biogeographic force in Madagascar? Only time will tell. Annual Review of Ecology, Evolution, and Systematics, 37: 405-431.
Yuan, Y. M., Wohlhauser, S., Möller, M., Klackenberg, J., Callmander, M. W., & Küpfer, P. (2005). Phylogeny and biogeography of Exacum (Gentianaceae): a disjunctive distribution in the Indian Ocean Basin resulted from long distance dispersal and extensive radiation. Systematic Biology, 54(1), 21-34.
Zhengyi, W., Raven, P. H., & Deyuan, H. (1996) Plumbagella in Flora of China, 15: 191 Science Press.
Zuckerkandl, E., & Pauling, L. (1962). Molecular disease, evolution and genetic heterogeneity, in Horizons in Biochemistry, pp. 189-225
95
8. Appendix 8.1.: Provenance and voucher information for DNA samples extracted.
Species Family Collector(s) Collector Collection Collection Herbarium EDNA Number Number Country Date Dyerophytum indicum Plumbaginaceae Miller 2251 Oman 23.03.1979 E EDNA14-0035466 Dyerophytum indicum Plumbaginaceae Balaidi & Guarino H31 Yemen 25.09.1989 E EDNA14-0035662 Dyerophytum indicum Plumbaginaceae Collenette 7999 Oman 21.03.1992 E EDNA14-0035663 Dyerophytum indicum Plumbaginaceae Thulin 11425 Oman 01.11.2006 K EDNA14-0035664 Dyerophytum indicum Plumbaginaceae Thulin, Beyer & 9761 Yemen 12.11.1998 K EDNA14-0035665 Hussain Dyerophytum indicum Plumbaginaceae Usher-Smith 11 Oman 25.03.1985 E EDNA14-0035674 Dyerophytum africanum Plumbaginaceae Balkwill, McDade & 11771 South Africa 04.04.2000 E EDNA14-0035467 Lundberg Dyerophytum africanum Plumbaginaceae Wanntorp 6 Namibia 01.03.1968 K EDNA14-0035658 Dyerophytum africanum Plumbaginaceae Wanntorp 870 Namibia 14.04.1968 K EDNA14-0035659 Dyerophytum africanum Plumbaginaceae Taylor 8406 South Africa 02.04.1973 K EDNA14-0035660 Dyerophytum africanum Plumbaginaceae McDonald 696 South Africa 28.09.1981 K EDNA14-0035661 Dyerophytum pendulum Plumbaginaceae Miller 17160 Yemen (Socotra) 01.03.1999 E EDNA14-0035468 Dyerophytum pendulum Plumbaginaceae Miller, Alexander & 14250 Yemen (Socotra) 30.03.1996 E EDNA14-0035668 Ali Dyerophytum pendulum Plumbaginaceae Miller, et al. 10104a Yemen (Socotra) 26.01.1990 E EDNA14-0035669 Dyerophytum socotranum Plumbaginaceae Miller 17068 Yemen (Socotra) 10.02.1999 E EDNA14-0035469
96
Dyerophytum socotranum Plumbaginaceae Miller, et al. 10300 Yemen (Socotra) 06.02.1990 E EDNA14-0035670 Dyerophytum socotranum Plumbaginaceae Thulin & Gifri 8684 Yemen (Socotra) 21.01.1994 E EDNA14-0035671 Dyerophytum socotranum Plumbaginaceae Miller, et al. 8273 Yemen (Socotra) 20.02.1989 E EDNA14-0035673 Plumbago dawei Plumbaginaceae Abdallah, Kalema, 213 Tanzania 03.02.1993 UPS EDNA14-0035470 Falck & Roponen Plumbago caerulea Plumbaginaceae Darwin Chilean DCI1774 Chile 30.11.2004 E EDNA14-0035679 Initiative Plumbago europaea Plumbaginaceae Gardner & Knees 8951 Croatia 22.09.2013 E EDNA14-0035680 Plumbago europaea Plumbaginaceae Wendelbo & Assadi 14596 Iran 31.08.1974 E EDNA14-0035681 Plumbago europaea Plumbaginaceae Davis 55221 Morocco 14.07.1973 E EDNA14-0035682 Plumbago indica Plumbaginaceae Middleton 2250 Thailand 19.01.2004 E EDNA14-0035683 Plumbago zeylanica Plumbaginaceae McLeish 700 Oman 03.09.1986 E EDNA14-0035684 Plumbago zeylanica Plumbaginaceae Chih-Chia Wang 897 Taiwan 11.11.1991 E EDNA14-0035685
Plumbago zeylanica Plumbaginaceae Long & Rae 602 Botswana 02.04.1987 E EDNA14-0035686
Plumbago auriculata Plumbaginaceae Carmichael s.n. Tanzania 14.08.1968 E EDNA14-0035687 Plumbago scandens Plumbaginaceae Ratter, Pott, Narciso 5093 Brazil 04.10.1985 E EDNA14-0035688 & Camargo Plumbagella micrantha Plumbaginaceae Ho, Bartholomew & 1093 China 10.08.1993 E EDNA14-0035672 Gilbert Ceratostigma minus Plumbaginaceae Boufford, et al. 29022 China 22.07.1988 E EDNA14-0035675 Ceratostigma Plumbaginaceae Sino-British Qinghai 448 China 26.06.2000 E EDNA14-0035676 plumbaginoides Alpine Garden Society Expedition
97
Arenaria pungens Plumbaginaceae Sales & Hedge 04/12 Portugal 2004-06-18 E EDNA14-0036117 Limonium lobatum Plumbaginaceae Danin & 29 Occupied 2013-04-28 E EDNA14-0036118 Dsukhorukov Palestinian Territory Limoniastrum Plumbaginaceae Sales & Hedge 98/21 Portugal 1998-04-21 E EDNA14-0036120 monopetalum Acantholimon vedicum Plumbaginaceae Fayvush et al 10/1121 Armenia 2010-06-15 E EDNA14-0036121
8.2.: Accession numbers of sequences downloaded from GenBank
Species Family GenBank Region Accession Fagopyrum esculentum Polygonaceae EU254477 atpI-atpH Cephalorhizum turcomanicum Plumbaginaceae JX983658 ITS Plumbago europaea Plumbaginaceae HE602417.1 ITS
98
8.3.: List of herbarium specimens included in morphometric analysis and in taxonomic revision
Species Collector(s) Collector Number Collection Country Collection Date Herbarium Dyerophytum indicum Martin JM253 Oman/UAE border 6.3.1998 Edinburgh Dyerophytum indicum Usher-Smith 11 Oman 25.3.1985 Edinburgh Dyerophytum indicum Western 729 Oman 21.2.1985 Edinburgh Dyerophytum indicum Edmondson 3350 Oman 13.3.1980 Edinburgh Dyerophytum indicum Radcliffe-Smith 3695 Oman 27.2.1976 Edinburgh Dyerophytum indicum Thulin, et al. 9761 Yemen 12.11.1998 Uppsala Dyerophytum indicum Thulin 11425 Oman 1.11.2006 Uppsala Dyerophytum indicum McLeish 2085 Oman 12.6.1993 Edinburgh Dyerophytum indicum Wight s.n. India ? Edinburgh Dyerophytum indicum Miller & Nyberg M9551 Oman 29.9.1989 Edinburgh Dyerophytum indicum Collenette 7999 Oman 21.3.1992 Edinburgh Dyerophytum indicum Scott 73 India 6.2.1971 Kew Dyerophytum indicum Parker 3383 India 28.12.1936 Kew Dyerophytum indicum Radcliffe-Smith 5218 Oman 25.9.1977 Kew Dyerophytum indicum Bent 97 Oman 1895 Kew Dyerophytum indicum Crow 121 India 6.2.1971 Kew Dyerophytum indicum Pilgrim s.n. S. Arabia 1906 Kew Dyerophytum indicum Miller 6187 Oman 19.9.1984 Edinburgh Dyerophytum indicum Nierta 1771 India 29.1.1894 Edinburgh
99
Dyerophytum indicum Whitcombe 151 Oman 13.3.1978 Edinburgh Dyerophytum indicum* Whitcombe 292 Oman 6.9.1978 Edinburgh Dyerophytum indicum* Weston RW842 Oman 24.2.1986 Edinburgh Dyerophytum indicum* Lumley 12 UAE 9.2.1979 Kew Dyerophytum indicum Thulin, et al. 9718 Yemen 11.11.1998 Kew Dyerophytum indicum Gallagher 8694/26 Oman 15.9.1995 Edinburgh Dyerophytum indicum Guarino & Balaidi H31 Yemen 25.9.1989 Edinburgh Dyerophytum indicum Dalzell s.n. India Presented 1878 Kew Dyerophytum indicum Kurschner 99-209 Oman 7.6.1999 Berlin Dyerophytum pendulum Miller 14250 Yemen 30.03.1996 Edinburgh Dyerophytum pendulum Miller 14041 Yemen ? Edinburgh Dyerophytum pendulum Miller 17160 Yemen 01.03.1999 Edinburgh Dyerophytum pendulum Thulin & Gifri 8810 Yemen 28.1.1994 Edinburgh Dyerophytum pendulum* Balfour 411 Yemen ? Edinburgh Dyerophytum pendulum Ogilvie-Grant-Forbes s.n. Yemen 1888-1899 Edinburgh Expedition Dyerophytum pendulum Miller, et al. M10104A Yemen 26.1.1990 Edinburgh Dyerophytum pendulum Schweinfurth 586 Yemen 1881 Kew Dyerophytum pendulum Mies 742 Yemen 19.3.1997 Dyerophytum pendulum Smith & Lavranos 217 Yemen 1967 Kew Dyerophytum socotranum Miller 17068 Yemen 1888 Edinburgh
100
Dyerophytum socotranum Thulin & Gifri 8684 (duplicate) Yemen 21.1.1994 Edinburgh Dyerophytum socotranum Miller, et al. M8273 Yemen 20.2.1989 Edinburgh Dyerophytum socotranum Miller, et al. M10300 Yemen 6.2.1990 Edinburgh Dyerophytum socotranum* Balfour 416 Yemen 1888 Edinburgh Dyerophytum socotranum Smith & Lavranos 359 Yemen 12.4.1967 Kew Dyerophytum socotranum Schweinfurth 523 Yemen 1881 Kew Dyerophytum socotranum Mr & Mrs Bent s.n. Yemen 1897 Kew Dyerophytum africanum Taylor 8406 South Africa 2.4.1973 Paris Dyerophytum africanum Seydel 433 Namibia 23.2.1955 Berlin Dyerophytum africanum Seydel 3317 Namibia 11.2.1963 Berlin Dyerophytum africanum Seydel 2997 Namibia 30.9.1961 Berlin Dyerophytum africanum Seydel 4025 Namibia 1.6.1964 Berlin Dyerophytum africanum Kers 1624 Namibia 5.2.1963 Paris Dyerophytum africanum Werdermann & 594 South Africa 15.10.1958 Berlin Oberdieck Dyerophytum africanum Walter & Walter 2531 Namibia 11.4.1953 Berlin Dyerophytum africanum Balkwill, et al. 11771 South Africa 4.4.2000 Berlin Dyerophytum africanum Wasserfall 1035 South Africa 10.7.1946 Kew Dyerophytum africanum Oliver, et al. 6371 ? 7.5.1976 Kew Dyerophytum africanum Pillaus 6582 SW Africa 10.1931 Kew Dyerophytum africanum Compton s.n. SW Africa 26.8.1927 Kew
101
Dyerophytum africanum de Winter 3284 SW Africa 28.4.1955 Kew Dyerophytum africanum Muller 127 SW Africa 5.4.1975 Kew Dyerophytum africanum Mannheimer, et al. CM2608 Namibia 21.9.2004 Kew
Note: specimens marked with an asterisk were consulted for the taxonomic revision but were excluded from the morphometric analysis due to absence or poor quality of flowering material.
102
8.4.: Provenance and voucher information for samples studied using SEM
Species Collector(s) Collector Collection Country Collection Date Herbarium Number Dyerophytum indicum Miller 2251 Oman 23.03.1979 E Dyerophytum indicum Martin JM253 UAE/Oman border 6.3.1998 E Dyerophytum indicum Usher-Smith 11 Oman 25.3.1985 E Dyerophytum indicum Western 729 Oman 21.2.1985 E Dyerophytum indicum Thulin 11425 Oman 1.11.2006 UPS Dyerophytum indicum Crow 121 India 6.2.1971 K Dyerophytum indicum Scott 73 India 6.2.1971 K Dyerophytum africanum Abbott s.n. Namibia 22.4.1969 K Dyerophytum africanum Balkwill, et al. 11771 South Africa 4.4.2000 E Dyerophytum africanum Oliver, et al. 6371 Namibia 7.5.1976 K Dyerophytum africanum Mannheimer, et al. CM2608 Namibia 21.9.2004 K Dyerophytum africanum Muller 127 SW Africa 5.4.1975 K Dyerophytum africanum Seydel 3317 Namibia 11.2.1963 B Dyerophytum pendulum Miller, et al. M10104A Yemen (Socotra) 26.1.1990 E Dyerophytum pendulum Thulin & Gifri 8810 Yemen (Socotra) 28.1.1994 E Dyerophytum pendulum Mies 742 Yemen (Socotra) 19.3.1997 UPS Dyerophytum pendulum Smith & Lavranos 217 Yemen (Socotra) 1967 K Dyerophytum pendulum Ogilvie-Grant-Forbes Expedition 212 Yemen (Socotra) 1888-1899 E
103
Dyerophytum pendulum Balfour 411 Yemen (Socotra) ? E Dyerophytum pendulum Miller, et al. 17160 Yemen (Socotra) 01.03.1999 E Dyerophytum pendulum Miller & Alexander 14041 Yemen (Socotra) 29.02.1996 E Dyerophytum pendulum Miller, et al. 14250 Yemen (Socotra) 30.03.1996 E Dyerophytum socotranum Miller, et al. M10300 Yemen (Socotra) 6.2.1990 E Dyerophytum socotranum Miller, et al. M8273 Yemen (Socotra) 20.2.1989 E Dyerophytum socotranum Miller 17068 Yemen (Socotra) 10.02.1999 E Dyerophytum socotranum Thulin & Gifri 8684 Yemen (Socotra) 21.1.1994 E Dyerophytum socotranum Thulin & Gifri 8684 Yemen (Socotra) 21.1.1994 E Dyerophytum socotranum Smith & Lavranos 359 Yemen (Socotra) 12.4.1967 K Dyerophytum socotranum Mr & Mrs Bent s.n. Yemen (Socotra) 1897 K
104
8.5.: Morphometric data used in PCA analysis
Species Leaf L:W ratio Sepal length/ mm Sepal width/ mm Sepal L:W ratio Wing width/ mm Dyerophytum indicum 1.03 9.210 2.443 1.160 1.002 Dyerophytum indicum 0.89 8.216 3.152 0.899 1.369 Dyerophytum indicum 1.05 7.963 2.363 1.058 0.986 Dyerophytum indicum 0.77 8.045 2.378 1.262 1.023 Dyerophytum indicum 1.25 8.845 2.210 1.433 1.054 Dyerophytum indicum 0.71 10.490 2.836 1.234 1.334 Dyerophytum indicum 0.79 8.723 2.271 1.174 1.064 Dyerophytum indicum 1.18 10.819 2.649 1.447 1.101 Dyerophytum indicum 0.99 8.960 1.911 1.308 0.861 Dyerophytum indicum 1.36 7.832 1.786 1.213 0.756 Dyerophytum indicum 0.94 8.208 2.965 1.180 1.272 Dyerophytum indicum 1.18 7.769 1.811 1.657 0.790 Dyerophytum indicum 1.43 8.639 2.979 1.119 1.357 Dyerophytum indicum 1.10 10.184 2.787 1.435 1.326 Dyerophytum indicum 0.81 9.749 3.041 1.316 1.295 Dyerophytum indicum 1.09 9.893 3.624 1.104 1.697 Dyerophytum indicum 1.28 9.160 2.440 1.366 0.960 Dyerophytum indicum 1.15 9.153 3.033 1.264 1.286 Dyerophytum indicum 1.12 9.402 2.037 1.800 1.001 Dyerophytum indicum 1.01 9.646 2.957 1.240 1.352 Dyerophytum indicum 1.02 9.160 2.753 1.211 1.228
105
Dyerophytum indicum 0.74 10.410 3.458 0.964 1.561 Dyerophytum indicum 0.81 9.375 2.711 1.353 1.209 Dyerophytum indicum 1.41 6.540 1.930 1.468 0.845 Dyerophytum indicum 1.15 9.184 2.671 1.123 1.102 Dyerophytum pendulum 1.49 9.185 1.375 1.818 0.562 Dyerophytum pendulum 1.94 8.298 1.135 2.055 0.448 Dyerophytum pendulum 1.72 8.872 1.227 2.310 0.451 Dyerophytum pendulum 1.87 9.095 1.188 2.386 0.432 Dyerophytum pendulum 1.72 8.899 1.552 1.719 0.573 Dyerophytum pendulum 1.56 8.883 1.488 1.793 0.537 Dyerophytum pendulum 1.85 10.133 1.991 1.674 0.847 Dyerophytum pendulum 1.37 7.510 1.305 1.660 0.468 Dyerophytum pendulum 1.54 7.608 1.050 2.540 0.400 Dyerophytum socotranum 0.68 7.186 1.761 1.704 0.707 Dyerophytum socotranum 0.52 7.081 1.348 1.731 0.587 Dyerophytum socotranum 0.64 6.297 1.165 2.003 0.499 Dyerophytum socotranum 0.81 6.336 1.136 2.493 0.467 Dyerophytum socotranum 0.58 6.506 1.047 2.546 0.470 Dyerophytum socotranum 0.72 7.926 1.434 2.093 0.626 Dyerophytum socotranum 0.65 6.592 0.975 2.564 0.407 Dyerophytum africanum 1.23 6.877 3.476 1.055 1.699 Dyerophytum africanum 1.12 7.669 3.630 1.148 1.820 Dyerophytum africanum 1.35 6.552 3.388 1.082 1.555 Dyerophytum africanum 1.84 6.865 3.431 1.166 1.595 Dyerophytum africanum 1.52 7.498 4.070 1.106 1.920 Dyerophytum africanum 1.23 6.211 3.837 1.129 1.904
106
Dyerophytum africanum 1.65 6.678 4.033 0.950 1.832 Dyerophytum africanum 1.68 7.326 3.246 1.232 1.581 Dyerophytum africanum 1.79 6.398 3.823 1.221 1.868 Dyerophytum africanum 1.54 7.580 3.391 0.983 1.590 Dyerophytum africanum 1.03 7.095 3.587 0.976 1.591 Dyerophytum africanum 1.20 7.641 3.463 1.203 1.715 Dyerophytum africanum 1.25 6.996 3.936 0.974 2.035 Dyerophytum africanum 1.49 6.585 4.017 1.162 1.880 Dyerophytum africanum 1.13 6.683 3.264 1.174 1.600 Dyerophytum africanum 1.23 7.149 3.411 1.075 1.665
107
8.6.: Summary statistics for morphometric data
Species Leaf length/ mm Leaf width/ mm Leaf L:W ratio Calyx length/ mm Min. Max. Mean. Min. Max. Mean. Min. Max. Mean. Min. Max. Mean. Dyerophytum indicum 8.5 89 38.1 10.5 77 35.8 0.71 1.43 1.05 6.5 13 8.7 Dyerophytum africanum 10 26 15.1 7 17.5 11.3 1.01 1.84 1.37 6 8 6.9 Dyerophytum pendulum 15.5 33 23.4 6.5 20.5 13.9 1.37 1.94 1.69 6.5 11 7.5 Dyerophytum socotranum 15.5 36 22.4 18.5 49.5 32.4 0.52 0.96 0.72 6 7.5 6.6
Species Calyx width/ mm Calyx L:W ratio Corolla length/ mm Sepal length/ mm Min. Max. Mean. Min. Max. Mean. Min. Max. Mean. Min. Max. Mean. Dyerophytum indicum 2 4.5 3.2 2.13 3.69 2.76 10 25.5 16.1 7.193 11.076 9.023 Dyerophytum africanum 3 5 3.9 1.40 1.84 1.83 7.5 15 11.0 6.109 7.850 6.967 Dyerophytum pendulum 2 3.5 2.4 2.5 3.54 3.16 12.5 20.5 15.0 7.123 10.761 8.720 Dyerophytum socotranum 2 3.5 2.7 2.33 2.79 2.49 9 17.5 12.6 6.047 8.322 6.846
108
Species Sepal width/ mm Sepal L:W ratio Wing width/ mm Min. Max. Mean. Min. Max. Mean. Min. Max. Mean. Dyerophytum indicum 1.511 3.821 2.608 2.606 4.689 3.546 0.587 1.798 1.153 Dyerophytum africanum 2.940 4.435 3.529 1.618 2.257 2.022 1.303 2.144 1.690 Dyerophytum pendulum 0.930 2.326 1.368 5.090 7.658 6.520 0.404 0.921 0.524 Dyerophytum socotranum 0.854 1.917 1.267 4.081 6.761 5.545 0.311 0.732 0.538
109