Doctoral Thesis

Doctoral thesis

submitted in partial fulfilment of the requirements

for the academic degree “Doctor of Philosophy (PhD)”

Integrin alpha V and alpha 5 diversely regulate proliferation and adipogenic differentiation of human adipose derived stem cells.

Innsbruck, December 2016

Department of Plastic, Reconstructive and Aesthetic Surgery

Dissertation committee, support and supervision:

Prof. Dr. med. Gerhard Pierer, Prof. Dr. Günther Lepperdinger, Dr. Christian Ploner, PhD

submitted by:

Dr. med. univ. Evi M. Morandi

This work was written and submitted by

Dr. med. univ. Evi M. Morandi

Andreas Hofer Str. 26

6020 Innsbruck, Austria

Supervisor: Dr. Christian Ploner, PhD

The original paper containing this work has been accepted for publication in the open access online journal Scientific Reports on 09.06.2016 and was published on 01.07.2016:

ITGAV and ITGA5 diversely regulate proliferation and adipogenic differentiation of human adipose derived stem cells.

Morandi EM, Verstappen R, Zwierzina ME, Geley S, Pierer G, Ploner C. Sci Rep. 2016 Jul 1;6:28889.

Innsbruck, December 2016

To my husband.

Table of contents

1. Introduction ...... 6 1.1. Integrins, the niche and their physiologic significance in tissue engineering ...... 6 1.2. Integrin signaling and relevant intracellular pathways ...... 7 1.3. Integrins and disease ...... 9 1.4. Integrins and differentation ...... 11 1.5. RDG motif recognizing integrins and their substrates ...... 12 2. Materials and Methods ...... 14 2.1 Isolation and cell culture of human ASC ...... 14 2.2. Isolation of lipid droplet containing adipocytes by isopycnic centrifugation...... 15 2.3. Immunohistochemistry ...... 16 2.4. Proliferation assay ...... 16 2.5. Adhesion assay ...... 16 2.6. Spreading assay ...... 17 2.7. ASC trilineage differentiation ...... 17 2.8. Plasmid Construction and lentiviral transduction ...... 18 2.9. RNA isolation and quantitative RT-PCR ...... 19 2.10. Protein isolation from in-vivo differentiated adipocytes ...... 22 2.11. Immunoblotting ...... 22 2.12. Flow cytometry ...... 23 2.13. Pathscan Multi-Target Sandwich ELISA ...... 23 2.14. Statistics ...... 24 3. Results ...... 25 3.1. Integrin expression patterns of differentiated adipocytes and ASC ...... 25 3.2. RGD-receptors ITGA5 and ITGAV are repressed during adipogenesis...... 30 3.3. Loss of ITGAV moderately induced cell death and reduced cell proliferation ...... 32 3.4. Loss of ITGAV impacts on cell adhesion and spreading ...... 35 3.5. Intracellular signaling pathways are differentially regulated by ITGAV and ITGA5 ...... 38 3.6. Loss of ITGAV mediated upregulation of p21 ...... 41 3.7. Loss of ITGAV promotes adipogenic differentiation of ASC ...... 42 3.8. Intracellular signaling mediated by ITGAV and ITGA5 in adipogenesis...... 45 3.9. Pharmacological inhibition of ITGAV/B3 and ITGAV/B5 by cilengitide mimics loss of ITGAV in ASC ...... 47

4. Discussion ...... 51 5. Clinical and translational significance of this work...... 59 5.1. Joining the ranks of plastic surgeons in basic research – how to connect basic research to plastic surgery ...... 59 5.2. Big story short - A brief history and the fundamentals of tissue engineering ...... 61 5.3. Lipografting: an excellent example of translational application of scientific knowledge in clinical plastic surgery...... 65 6. Personal acknowledgements ...... 67 7. Funding statement ...... 68 8. Conflicts of interest ...... 68 9. Personal contribution ...... 68 10. Abstract ...... 69 11. References ...... 70 12. List of abbreviations ...... 86 13. Curriculum vitae ...... 90

1. Introduction

1.1. Integrins, the niche and their physiologic significance in tissue engineering

In regenerative medicine, exerting influence on cell viability and differentiation is of great interest in regenerative medicine, as reconstructing complex soft tissue defects still remains a major clinical challenge. Tissue engineering techniques, extracellular matrix (ECM) scaffolds and the application of multipotent adipose derived stem cells (ASC) (1) are largely investigated attempts in preclinical and translational research. Knowledge about possible external influence on ASC physiology as well as clinical experience in this field is still limited. Although mesenchymal stem cells (MSC) and their developmental potential are well characterized, the use of this knowledge for the efficient generation and manipulation of MSC-derived cells for tissue engineering in medical applications remain unclear. An upcoming body of literature describes multiple effects of the extracellular matrix (ECM) on MSC and ASC physiology, including proliferation and differentiation.

Figure 1: simplified scheme: cell niche, cellular interactions and specific functions in cell physiology that are influenced by biochemical, molecular and mechanical cues from the niche and cell cell interactions.

The ECM mediates these effects by specific molecular composition and mechanical properties (2-4). Characterizing interactions between cells and the ECM is therefore crucial for in-vitro expansion and differentiation of MSC as well as ASC as a multitude of functional, spatial and mechanical cues impact on cells and tissues, each of them being molecularly translated to finally end up in cellular response and herein answering the three major questions about cell fate: where is the cell, what is its purpose and what is the exact role in the integrity of the specific tissue? Answering these questions is not only crucial to cell fate but is also considered the key to success in tissue engineering.

The surrounding three-dimensional environment of cells is referred to as the niche. The niche itself is composed of paracrine messenger substances, proteins that compose the ECM, other cells and the intrinsic factors influencing the physiology of the cells, thus of all molecular and mechanical cues with impact on stem cell fate. Moreover, also oxygen content, reactive oxygen species and growth factor gradients as well as cell crosstalk and cell-ECM interactions contribute to the niche. However, only little is known about its maintenance, regulation and homeostasis. On the other hand, the golden goal of tissue engineering is to mimic the in-vivo niche as exact as possible to create an optimal environment for engineered cells and tissue and moreover to enable in-vitro manipulation under the most physiological conditions (5). It could be shown that adipose tissue is able to preserve tissue integrity -thus to survive without dissociation- ex-vivo if provided a biomimetic matrix in three-dimensional culture for up to two weeks. This is possible even without loss of stromal and endothelial cells and with preserved self-renewal capacity (6). In fact, these results are further underlining the importance of the niche and its exact composition. Not only the availability of adequate nutritional facts and paracrine signals but also the signals from the ECM contribute to the maintenance. Integrins provide the possibility of inside-out and outside-in signaling thus having a major impact on stem cell fate and regulating important physiologic processes such as differentiation, tissue development and proliferation as well as migration, cell death and senescence. In addition, cells can quickly respond to environmental changes via bidirectional signaling and conformational changes of transmembraneous proteins namely the integrin protein family (7) (8).

1.2. Integrin signaling and relevant intracellular pathways

The large integrin protein family comprises 18 α-subunits and 8 -subunits in mammals (9), which form at least 24 heterodimers of one alpha- and one beta- subunit (10). Tailored interactions between integrin heterodimers and the different components of the extracellular 7 matrix, as shown in Figure 1, are able to influence and direct cell fate: Upon binding to specific components of the ECM, integrins undergo a conformational change and form adhesive units (focal adhesions) via clustering (11). Being highly reactive structures, integrins can interact not only with intra- or extracellular binding partners, but have also been shown to associate with molecules of the cellular membrane such as cluster of differentiation (CD) proteins. In fact, CD47 deficient mice do have a lack in proper neutrophil function which could be linked to integrin beta 3, a subunit involved in neutrophil phagocytosis (12).

Via association with proteins of the cytoskeleton such as F-actin or talin, various adapter proteins (e.g. paxilin, rack 1, ect) and calcium binding proteins as well as protein kinases as ILK and FAK, the different integrin subunits organize communication of extracellular matrix components with the intracellular signaling(11, 13). Moreover, some of the integrin- interacting proteins are able to differentiate between activated and resting integrins and therefore are even more selective and specialized in their function: calreticulin for example could be shown to interact with activated alpha 2 beta 1 integrin only, mediating calcium influx into the cell and supporting cell adhesion (14).

Associated intracellular protein complexes consequently control numerous cellular developmental processes by modulating the interacting transduction signaling cascades (15- 17) such as PI3K/PDK1/AKT, MAPK or MEK-ERK pathways and impact on F-Actin dynamics via the regulation of Rho GTPase activity (15). Many of these kinases and molecules also are involved in the regulation of proliferation, migration and differentiation and thus are plainly able to influence cell destiny (18, 19) and tissue development. Therefore, a fundamental understanding of matrix-integrin interactions is important to elucidate basic extracellular matrix requirements of ASC.

In addition to signal transduction to the intracellular space, integrins can even regulate their affinity for their extracellular ligands. This happens by conformational changes in the extracellular binding domains and this event occurs in response to signals that are sensed at the integrin cytoplasmic tails. This process is termed inside-out signaling. An integrin that is not responsive for ligand binding is considered inactive (20). In addition to this regulation level, excessive activity of MAPK can suppress integrin activation in the fashion of a classic negative feedback loop system, even independently of the current activation status of the integrin, via H-Ras and Raf-1 (21).

Figure 2: Possible integrin ligands from the ECM and soluble ligands and their corresponding integrin subtype binding partners, grouped by ligand specifity (from Humphries et al. 2006 (22))

The binding of the integrin or small clusters of integrins to a specific ligand forms an initially talin-mediated connection between the cytoskeleton of the individual cell and the surrounding ECM as a nascent focal adhesion is formed subsequently (23). This action recruits additional pathway associated signaling proteins (24).

1.3. Integrins and disease

Concerning the function of integrins, their physiologic effects and their role in pathophysiology, a large body of literature about phenotypes in knock out mice is available. This straight forward method of analysis allows detailed insight in physiologic functions of the specific protein. Quite distinct phenotypes for most of the so far known integrin subunits have been shown, providing information about individual functions of specific protein family members. 9

The integrin beta-1 (ITGB1) subunit knock out phenotype for instance, turned out to be out lethal very early in embryogenesis due to gastrulation defects (25). It was shown in heterocygous mice that crucially the maturation of spleen and liver are impaired, but other organs develop normally (26). In homocygous ITGB1-null mice, lethal outcome shortly after integration of the blastocyst was confirmed (27) whereas another group was able to confirm that early death in this phenotype can be attributed mostly to the lack of integrin alpha-2 (ITGA2)/ITGB1 heterodimers. The lack of ITGA1/ITGB1 heterodimers however leads to an absolute increase in collagen synthesis, whereas ITGA3/ITGB1 or ITGA4/ITGB1 lead to severely impaired renal and lung development which are deadly within hours after birth or problems in cardiac development, respectively (28).

Null mutations in ITGA4 and ITGA5 subunits were reported to be lethal early in embryogenesis due to problems in vascular and cardiac development, which prevents further studies of this phenotypes - death occurs by detachment of the coronary arteries, rupture of the epicardium and pericardial tamponade, subsequently (29). Moreover, other authors rated the lack of interaction between ITGA4 and VCAM-1 to be problematic in the specific period of embryogenesis (30, 31). Interestingly, no severe pathology could be detected in ITGA1- null mouse embryos (32), merely an impairment in collagen synthesis during dermal wound healing was shown for ITGA1/ITAB1 heterodimer lacking animals (33).

Dermal and epidermal involvement has also been shown for ITGA6 null mutation mice with severe blistering similar to epidermolysis bullosa in humans – the phenotype was reported to be deadly in neonatal age for the examined animals (34). A similar skin involvement affecting the contact between basal epithelial cells and the basement membrane due to the formation of hemidesmosomes was found in ITGB4 null mice (35), which can be correlated to the human skin disorder junctional epidermolysis bullosa (36).

Concerning the RGD-recognizing integrin heterodimers, ITGAV containing heterodimers are of specific interest as they impair wound healing and angiogenesis but the ITGAV-null mutation mice do not necessarily experience lethal exitus prior to birth as early embryogenesis is normal and 20% of the animals are even born alive (37). However, they present with cleft palate deformity and die from internal organ hemorrhage due to vascular development disorder. Due to the impressive results of these studies, this impairment of angiogenesis following ITGAV knock out has been subjected to extensive studies in the field of pharmacology with the scope of developing new antitumor, chemotherapeutic drugs (38).

1.4. Integrins and differentation

Several authors suggested, that stem cells respond to differentiation fate influencing signals that are generated as a result of changed ECM composition. Frith et al. showed in 2012 (18) that differentiation of human bone marrow derived stem cells (hMSC) can be influenced by cultivating the cells on different substrates and hence targeting different specific integrins, that act as receptors for ECM proteins. Another group however found that 3T3-L1 adipocytes show decreased levels of adipogenic markers when cultivated on fibronectin rich substrates (39). On the other hand, knock down of ECM-binding receptors has been shown to result in characteristic phenotypes: Tailor-Volodarsky et al. were able to demonstrate that loss of integrin alpha11 (ITGA11) results in insufficient expression of Smad3 during cardiac myogenic differentation, which eventually leads to cardiac fibrosis in diabetic rats (40). This example shows that changes in receptor expression has similar effects as changes of the composition of the ECM (18), suggesting that despite overlapping binding specifity of integrin subtypes, tailored integrin-ECM interactions are distinctly able to influence cell fate.

As a major component of the extracellular matrix, fibronectin exerts a major impact on cell fate. In mice, the knock out of the fibronectin gene causes mesodermal, vascular, and neural tube defects that are lethal in the early stages of embryogenesis (41). Therefore, effects on adipogenesis in vivo or in mouse embryonic fibroblasts undergoing in vitro adipocyte differentiation could not be studied. Also, Antras et al. were able to show that during adipogenesis of 3T3-L1-adipocytes, pericellular fibronectin levels strongly decrease, connecting fibronectin expression essentially to differentation processes (42). This hypothesis is further reinforced by the fact, that preadipocytes cultured on fibronectin-rich substrates show decreased adipogenic potential in vitro (43).

Fibronectin is commonly known as an extracellular matrix protein, binding partner to at least 10 integrins (44). By alternative splicing of the pre-mRNA, several variants of the protein can be formed. The ECM protein has been shown to play an important role in suppressing adipogenic differentiation by altering the essential morphological changes (39), thus impairing early adipogenesis (45) and keeping cells in an undifferentiated state (46, 47). Interestingly, other authors were also able to show that a degradation of fibronectin in the ECM of hMSCs is crucial for the successful adipogenic differentiation (18), which could also be confirmed for 3T3L1 adipocytes (48).

1.5. RDG motif recognizing integrins and their substrates

RGD motifs are overall recognized by five heterodimers containing αV subunits, two α5β1 and α8β1 integrins and the αIIbβ3 dimer. In general, the RGD binding site is located at the interface between the α and β subunits and the RGD-binding integrins are considered the most promiscuous subtypes in the receptor family, with especially β3 integrins binding to a large number of extracellular matrix proteins and soluble ligands as depicted in Fig.1 (22).

While integrin alphaV (ITGAV) serves as a subunit for integrin receptors binding vitronectin, fibronectin, fibrinogen, von Willebrand factor, thrombospondin and osteopontin (49), integrin alpha5 (ITGA5) is mainly part of fibronectin- and osteopontin binding receptors. ITGA5, forming a dimer with ITGB1, is considered the classic fibronectin receptor (46), that has been well studied. Upon fibronectin binding, it activates FAK/Src, Rho-GTPases and MAPK eventually resulting in changes in growth, differentiation, cell shape and migration (15-17), thus excerting major impact on cell fate.

Figure 3: Scheme of an integrin heterodimer, binding an extracellular matrix protein constituent connecting the ECM essentially to the intracellular space.

In contrast, ITGAV was shown to play an important role in the regulation of cancer growth and metastasis (50) in different types of head and neck cancer, brain cancer and colorectal malignancies. Especially the ITGAV/ITGB3 heterodimer has been connected with tumor neoangiogenesis, whereas the ITGAV/ITGB1 receptor is implicated in tumor cell proliferation (51). However, the role of ITGAV as a fibronectin receptor and its impact on adipogenic differentation remains poorly defined. In summary, integrins are capable of bidirectional signaling actions, and were shown to be a highly reactive and promiscuous protein family with influence on various cellular functions.

To continue the research into the role of integrins in tissue remodeling, we analyzed the integrin expression profile of sorted primary ASC and adipocytes in-vivo in this work. We identified RGD-binding integrins to be consistently repressed during adipogenesis and outlined the differential roles of ITGAV and ITGA5 in ASC proliferation and differentiation. Finally, we defined a molecular mechanism how these integrins diversely regulate ASC proliferation and showed this specific phenotype to be mimicked by pharmaceutical inhibition of ITGAV signaling.

2. Materials and Methods

2.1 Isolation and cell culture of human ASC

ASCs were isolated from subcutaneous abdominal fat tissue obtained from patients (mean age 36.215.3 years; 88% female, 12% male) undergoing elective abdominoplasty. The study was approved by the Ethics Committee of the Medical University of Innsbruck (UN4368; EK 301/4.5), written informed consent was obtained from all donors and the methods were carried out in accordance with the approved guidelines. For ASC isolation, adipose tissue was washed with phosphate-buffered saline (PBS), minced into pieces and incubated with collagenase Type I (0.15% in PBS, Roche, Germany) for 1h at 37°C. After digestion, samples were centrifuged at 500xg for 10 min. The upper phase containing primary in-vivo differentiated adipocytes(52) was transferred into a new tube, washed with PBS and immediately subjected to RNA- and protein-isolation. Pelleted stromal vascular fraction

(SVF) was treated with erythrocyte lysis buffer (0.5M NH4Cl, 0.5M KH2PO4, 100mM EDTA, Roth, Germany) for 10min and spun at 500xg for 10min. The SVF pellet was resuspended in DMEM/F12 medium (Lonza, Austria), filtered through a 100µm and 40µm nylon mesh cell strainer (VWR, Austria)(52), counted with a CASYTM cell counter (Schärfe System, Germany) and plated at a density of 10000 cells/cm2 for culture in PM4 medium(53) containing DMEM/F12 (PAN Biotech, Germany) supplemented with 1ng/ml rhFGF2, 10ng/ml EGF (Immunotools, Germany), 500ng/ml Insulin (Roche, Austria), 2.5%FCS and 1%Penicillin/Streptomycin (GE Healthcare, Austria). Twenty-four hours after plating non adherent cells were washed off and attached cells were assessed for multipotency. For FACS- sorting, SVF-cells were stained with CD31-FITC, CD45-FITC, CD34-PE (Biolegend, UK), CD90-APC (eBioscience, Austria) and 7AAD (BD Pharmingen, Germany) and sorted on a FACS Aria II cell sorter (Becton Dickinson, Germany). The CD34+/CD90+/CD31-/CD45- /7AAD- ASC-subfraction(54) was directly subjected to RNA- and protein-isolation.

2.2. Isolation of lipid droplet containing adipocytes by isopycnic centrifugation.

Lipid-droplet containing cells were separated from undifferentiated cells using a modified density centrifugation protocol with a 6% OptiPrep® -0.5%FCS/PBS gradient. The gradient was generated by mixing 3 ml of OptiPrep® (Sigma Aldrich, Germany) with 11 ml of a 0.5% FCS/PBS solution. After centrifugation (30min, 800xg) at 20°C, trypsinized, in-vitro differentiated cells were layered on top of the gradient and spun for 30min at 800xg. The upper phase (~0.5ml) containing adipocytes with lipid-droplets and the cell pellet (undifferentiated cells without lipid droplets) were directly lysed in laemmli buffer and subjected to immunoblotting. All reagents were obtained from Sigma Aldrich, Germany.

Figure 4: Isolation of adipose derived stem cells. The figure shows all the major steps from the first contact of the surgeon with the donor patient, who is then undergoing surgery with simulateous harvest of fat grafts that from the resected tissue that are dedicated to be transported to the laboratory to obtain the SVF using the isolation protocol described in 2.1. and finally, plating cells for in vitro expansion in adipose derived stem cell proliferation medium PM4 as described above.

2.3. Immunohistochemistry Sections of paraformaldehyde fixed human tissue samples from fresh cadavers donated to the Department of Anatomy, Histology and Embryology of the Medical University of Innsbruck were stained with rabbit anti-ITGAV (ab179475, Abcam, UK), mouse anti-ITGA5 (MA5- 15568, Thermo Scientific, Austria), mouse anti-Fibronectin (MS-1351, Thermo Scientific, Austria) or rabbit anti-PLIN1 ((D1D8)XP, cell signaling, USA) antibodies applying a Ventana Roche Discovery Immunostainer (Ventana, Germany) according to the DAB-MAP discovery research standard procedure. A biotinylated immunoglobulin cocktail of goat anti-mouse-IgG, goat anti-mouse-IgM, goat anti-rabbit-IgG and protein block (760-4205, Ventana) was applied for 30min at room temperature. Hematoxylin (760-2021, Ventana) counterstained sections were manually dehydrated in downgraded alcohol series, cleared in xylene and permanently cover slipped with Entellan® (Merck, Germany). Positive controls (placenta, liver) and negative control slides were added to each experiment to validate the IHC staining reactions. Digital images were acquired using AxioVision microscope software linked to an AxioCamHRc camera and an AxioPlan2 microscope (Zeiss, Germany). Because the dead bodies were immediately anonymized, no certificate of non-objection was needed.

2.4. Proliferation assay

Cell proliferation was measured by resazurin-based PrestoBlue assay (Invitrogen, Germany) analyzing cell number by correlating mitochondrial activity (55). Cells were seeded in 96 well plates (5000 cells per well). PrestoBlue reagent was added at a concentration of 0.1mg/ml in PM4. Cells were incubated for 15 min at 37 °C. Fluorescence was measured at 530 nm according to the manufacturer’s instructions on a Tecan Genios spectrophotometer (Tecan, Germany).

2.5.Adhesion assay Cells were seeded onto optical 12-well plates at a density of 50,000 cells per well and allowed to attach for 24 hours while incubating at 37°C. The next day, cells were stained with Calcein AM Solution (Sigma-Aldrich, Germany) for 1 hour at 37°C in the dark, and then washed with PBS. Cells were detached with 200 μL Trypsin for 120 seconds. The reaction was stopped by adding 500 μL of PM4 medium. After 1 minute of shaking at 400rpm, detached cells were carefully removed. The remaining cells were lysed in 700 μL of PBS/10% Triton X-100 (VWR, Germany) for 15 minutes. Of each lysate, 100 μL was transferred onto 96-well plates 16 in triplicates and subjected to measurement with extinction/emission at 494/517 nm using a Chamaeleon plate reader. All results were normalized to lysates of non-trypsinized ASCs in control wells.

2.6.Spreading assay ASC were transfected with complementary shRNA oligonucleotides directed against ITGAV or a constitutive ITGAV overexpression vector as described below using the calcium phosphate method (56). Cells were trypsinize, plated onto optical 96-well plates and incubated at 37°C for designated time periods to allow standardized attachment. After that, cells were washed once with PBS and then fixed with 3%PFA for 30 min at room temperature. After staining with Cell mask orange (Invitrogen, ThermoScientific, Austria), and Hoechst (Sigma-Aldrich, Germany), images of adherent cells were taken. The area of cell attachment was subsequently calculated by using Cell profiler software using a specific pipeline. All reagents were obtained from Sigma Aldrich, Germany.

2.7. ASC trilineage differentiation

Adipogenic differentiation was induced using adipogenic induction medium (AIM) based on DMEM/F12 medium supplemented with 33µM biotin, 1µM troglitazone, 250µM 3-isobutyl- 1-methyl-xanthine (IBMX), 10µg/ml transferrin, 200pM T3, 100nM dexamethasone and 500nM insulin. After 72h, AIM was exchanged for adipocyte differentiation medium (ADM; AIM without IBMX) and cells were cultured until day 14. To induce chondrogenic differentiation, high density seeded cells were cultured for three weeks in StemPro basal medium containing StemPro chondrogenesis supplements (ThermoScientific, Austria). Osteogenic differentiation was induced by exposing proliferating cells (5000 cells/cm2) to osteogenic differentiation medium (DMEM, 10%FCS, 100nM dexamethasone, 50µM ascorbic acid, 10mM glycerol-2-phosphate) for three weeks. Cells were stained with Oil red O (ORO, adipogenesis), Alcian blue (chondrogenesis) or Alizarin red (osteogenesis). All reagents and dyes were obtained from Sigma Aldrich, Germany. For the assessment of intracellular lipid content, cells were fixed in 3%PFA for 10 min, washed with PBS and incubated with HCS LipidTOX™ Green Neutral Lipid Stain (ThermoScientific, Austria) for 30 min. Digital images were acquired using an inverse Zeiss Axiovert 200M microscope (Carl Zeiss, Austria) linked to an CoolSNAP FX CCD-camera and analyzed with ImageJ 1.46r Software (National Institutes of Health, USA) by counting differentiated cells per visual field.

Figure 5: Differentiated ASC in vitro (day 14 of adipogenesis), Oil Red O staining; Mag. 40x, phase microscopy.

2.8. Plasmid Construction and lentiviral transduction

Complementary shRNA oligonucleotides directed against ITGAV or ITGA5 (Supplementary table 1) were designed with Dharmacon siDesign-CENTER software, annealed and cloned into the BglII-HinDIII sites of pENTR-THT(57). The sequence verified THT-shRNA cassette was recombined into the lentiviral RNAi destination vector pHR-Dest-SFFV-Puro as previously described(57). For constitutive ITGAV or ITGA5 overexpression, ITGAV-cDNA isoform 2 (pEF1-human ITGAV-V5-His6(58)) was cloned into the BamHI/NotI site of pHR- SIN-CSGW-Not(59) replacing the eGFP cDNA. KpnI-digested and blunt ended ITGA5- cDNA from pEGFP-N3-ITGA5(60) was cloned into the blunt ended BamHI/NotI site of pHR-SIN-CSGW-Not. For survivin overexpression, survivin-cDNA (survivin variant 1 (NM_001168)) was cut from pLIB-survivin-IRES-YFP(61) (provided by M. Ausserlechner) using EcoRI and NotI and cloned into the BamHI/NotI site of pHR-SIN-CSGW-dNot. EcoRI and BamHI sites were blunt ended using a DNA-polymerase-I Klenow-fragment. 1.5µg of sequenced verified plasmids were then co-transfected with 0.9µg pSPAX2 packaging and 18

0.9µg pMD-G VSV-G pseudotyping plasmids using calcium phosphate transfection (56). Twenty-four and 48 hours post transfection, sterile filtered supernatants were diluted 1:2 with fresh PM4 medium and supplemented with 1µg/ml polybrene for infection; 48 hours after infection ASCs were selected for puromycin resistance (1µg/ml) and analyses were performed five days after transduction. All reagents were obtained from Sigma Aldrich, Germany.

Table 1. The table lists the RNAi sequences used in this study. Gene targeting sequences in shRNA oligonucleotides are underlined.

Code Sequence ITGAV-shRNA#a 5’-GATCCCCGGTCAAGATCAGTGAGAAATTCAAGAGATTTCT CACTGATCTTGACCTTTTTGGAAA-3' ITGAV-shRNA#c 5'-GATCCCCGGTGAACCTTCTAGAGGAATTCAAGAGATTCCT CTAGAAGGTTCACCTTTTTGGAAA-3' ITGA5-shRNA#a 5'-GATCCCCTGGACAAGGCTGTGGTATATTCAAGAGATATAC CACAGCCTTGTCCATTTTTGGAAA-3' ITGA5-shRNA#c 5'-GATCCCCGAGAGGAGCCTGTGGAGTATTCAAGAGATACTC CACAGGCTCCTCTCTTTTTGGAAA-3' Ctr-shRNA 5'-GATCCCCAATAGCGACTAAACACATCAATTCAAGAGATTG ATGTGTTTAGTCGCTATTTTTTTGGAAA-3'

2.9. RNA isolation and quantitative RT-PCR

RNA was isolated using TRIzol reagent (MRC Inc. Cincinnati, OH, USA) and cDNA was synthesized using random hexamer primers using iScript cDNA-synthesis kit (Biorad, Germany). The PCR reactions were performed in duplicates using the SsoAdvanced™ Universal SYBR® Green Supermix kit (Biorad, Germany) in a realplex-2 lightcycler (Eppendorf, Germany) using the following protocol: one step at 95°C for 3 min, followed by 40 cycles of 95°C (15 s), 60°C for 15 s, and 72°C for 10 s. The increase in fluorescence was measured in real time at the end of the extension step. The relative gene expression was estimated using the default baseline setting of the Mastercyler ep realplex software version 2.2 (Eppendorf).

All the primers were designed using NCBI Primer-blast software (www.ncbi.nlm.nih.gov/tools/primer-blast) and specificity was tested by the assessment of melting curve. The primer pairs are listed in Table 1. Prior to analysis of target genes, the reference genes were tested for stability and found to be stable comparing all groups and displaying comparable numbers of CT cycles. Quantification was carried out using the ΔCT method. CT values were normalized to the geometric mean of the reference genes glucuronidase beta (GUSB) and tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta (YWHAZ) (62). Primers (see Supplementary Table 1) were designed using NCBI Primer-blast software, and specificity was tested by the assessing the melting curve.

Table 2. The table lists all primers used in this study.

Quantitative RT-PCR primer: Code Sequence ITGA1 forward 5' - TGGTGGTGCTGCCCTCTTCTG - 3' ITGA1 reverse 5' - GTGAATCTAGGGTGACACGGTACTGC - 3' ITGA2 forward 5' - CCTTGAAGCCTATTCTGAGACTGCC - 3' ITGA2 reverse 5' - AATTCCAGTGTTGTATGCACTTTCCC - 3' ITGA3 forward 5' - ACTGTGAAGGCACGAGTGTGGAAC - 3' ITGA3 reverse 5' - ATGCTGGTTCGGAGGAATAGGG - 3' ITGA4 forward 5' - AGAGAGACAATCAGTGGTTGG - 3' ITGA4 reverse 5' - TCAGTTCTGTTCGTAAATCAGG - 3' ITGA5 forward 5' - TGCCTCCCTCACCATCTTC - 3' ITGA5 reverse 5' - TGCTTCTGCCAGTCCAGC - 3' ITGA6 forward 5' - GCTGGTTATAATCCTTCAATATCAATTGT - 3' ITGA6 reverse 5' - TTGGGCTCAGAACCTTGGTTT - 3' ITGA7 forward 5' - ATGGCTGTGGTGGCAGAAGGAG - 3' ITGA7 reverse 5' - GAATCTTCACCGCATGGTACTGGG - 3' ITGA8 forward 5' - CATCACTGCTGTAGCGCAGGTGG - 3' ITGA8 reverse 5' - GTTCCACCAATGGTCCAACCTCC - 3' ITGA9 forward 5' - CCATTGATGTGGTAGGAGGTGCC - 3' ITGA9 reverse 5' - CACAAGGAGGAGCCGAAGTAAGAGC - 3'

ITGA10 forward 5' - CATCCTGTCTTCCAGACTGGAGCC - 3' ITGA10 reverse 5' - TGGATGTAGGCTGAGGTCTGGGC - 3' ITGA11 forward 5' - ACCAATGGCTACCAGAAGACGGG - 3' ITGA11 reverse 5' - GGCCGAGGCGCATGTTGTC - 3' ITGAD forward 5' - GATGAGGGCCTAAGAAGCAGCCG - 3' ITGAD reverse 5' - GGTGGCCTTGCTGCTTGAAGC - 3' ITGAE forward 5' - TGAGGGACTGAATGCAGAGAAC - 3' ITGAE reverse 5' - CAACACCAGAAGTCCACCAAC - 3' ITGAL forward 5' - GGGGGGACTCGGTTGAATTGC - 3' ITGAL reverse 5' - GTGCTTGACTTGGTGGATCTTGGG - 3' ITGAM forward 5' - GTGAAGCCAATAACGCAGCTGC - 3' ITGAM reverse 5' - TGTCTGCCTCAGGGATGACATCC - 3' ITGAV forward 5' - GGATTGTTGCTACTGGCTGTTTTGG - 3' ITGAV reverse 5' - TCCCTTTCTTGTTCTTCTTGAGGTGG - 3' ITGAX forward 5' - CCTGTCCCTGGCGTCTACCACC - 3' ITGAX reverse 5' - ATGTCCTGCTCCTGTCTTGGGC - 3' YWHAZ forward 5' - ACTTGACATTGTGGACATCGGA - 3' YWHAZ reverse 5' - GTGGGACAGCATGGATGACA - 3' GUSB forward 5' - GGAATTTTGCCGATTTCATGAC - 3' GUSB reverse 5' - TCTCTGCCGAGTGAAGATCCC - 3' TBP forward 5' - GCCACGAACCACGGCACTG - 3' TBP reverse 5' - TTTCTTGCTGCCAGTCTGGACTG - 3' FABP4 forward 5' - TCAGTGTGAATGGGGATGTGATC - 3' FABP4 reverse 5' - TCAACGTCCCTTGGCTTATGC - 3' PPARG forward 5' - CACAAGAACAGATCCAGTGGTTGCAG - 3' PPARG reverse 5' - AATAATAAGGTGGAGATGCAGGCTCC - 3' ADIPOQ forward 5' - GATGGCAGAGATGGCACCC - 3' ADIPOQ reverse 5' - GGAATTTACCAGTGGAGCCA - 3' PLIN2 forward 5‘- CCTGTAAGGGGCTAGACAGGA - 3‘ PLIN2 reverse 5' - GTCACAGTAGTCGTCACAGCA - 3‘ SURVIVIN forward 5' - TTCAAGGAGCTGGAAGGCTG - 3' SURIVIN reverse 5' - GCAACCGGACGAATGCTTTT - 3' P21 forward 5' - GTACCCTTGTGCCTCGCTC - 3' P21 reverse 5' - GCGGATTAGGGCTTCCTCTTG - 3'

CTGF forward 5' - GGAGTGGGTGTGTGACGAGCC - 3' CTGF reverse 5' - GGACCAGGCAGTTGGCTCTAATC - 3' RUNX2 forward 5' - CCAAATTTGCCTAACCAGAA - 3' RUNX2 reverse 5' - GCTCGATTGCAATTGTCTCT - 3' SOX9 forward 5' - GTACCCGCACTTGCACAAC - 3' SOX9 reverse 5' - TCGCTCTCGTTCAGAAGTCTC - 3'

2.10. Protein isolation from in-vivo differentiated adipocytes Proteins from primary adipocytes were isolated by resuspending approximately 2x106 cells in 500µl isolation buffer containing 50mM Tris, 150mM NaCl, 0.2mM ETDA and supplemented with protease inhibitor (Roche, Germany) and 1875µl chloroform/methanol (1:2 mix). After homogenization and incubation on ice for 10min, 625µl chloroform and 625µl aqua bidest were added. The lysates were spun at 800xg for 5 minutes and the protein disks (middle layer) was resupended in 0.1% SDS, 40mM Tris, mixed with appropriate amount of laemmli buffer supplemented with 5% beta-mercaptoethanol and boiled for 5 minutes.

2.11. Immunoblotting

For immunoblotting 2.5x105 to 1x106 cells were lysed in laemmli buffer containing 5% 2-β- mercaptoethanol (Sigma Aldrich, Germany), sonicated and boiled for 5min at 95°C. Proteins were size fractionated on prestained gradient polyacrylamide gels (Mini-PROTEAN®TGX Stain-Free™ Precast Gels, Biorad, Germany), blotted onto 0.2µm PVDF membrane, blocked 2h in 5% low fat milk powder and incubated overnight with primary antibodies against ITGAV (BD Biosciences, Germany), ITGA5 (Biolegend, USA), AKT, phAKT (S473), phERK (Thr202/Tyr204), ERK, PLIN1, FABP4, YAP, TAZ (all from Cell signaling, USA), p21Cip1 (ThermoScientific, Austria), survivin (Enzo Lifesciences, Switzerland), p73 (Imgenex, USA), p53 (MyBiosource, USA), GAPDH (6c5, Santa Cruz, Germany). After washing, horseradish peroxidase-conjugated sheep-anti-mouse and sheep-anti-rabbit antibodies (all from Cell signaling, USA) were incubated for 1h and the reaction was visualized by enhanced chemiluminescence reagent ECL (Biorad, Germany) using a Biorad ChemidocMP gel analyzer for detection. Quantification was performed with the ImageLab 5.0 22 software (Biorad, Germany) according to the manufacturer’s instructions. Total protein loading was visualized using the ChemidocMP gel analyzer and employed as an internal loading control for all immunoblots (63).

2.12. Flow cytometry

Transduced ASCs were stained for integrin surface expression with ITGAV-PE and ITGA5- PE antibodies (Biolegend, UK) in PBS/2mM ETDA/0.5% BSA according to the manufacturer’s instruction and analyzed on a Calibur FACScan cytometer using CellQuestPro software 4.0.1 (BD Biosciences, USA). Cell death was determined by analysis of AnnexinV- FITC/propidium iodide stained cells using an AnnexinV-FITC staining kit (BD Pharmingen, Germany) according to the manufacturer’s instructions. To determine adipogenic differentiation by flow cytometry, in-vitro differentiated adipocytes were stained using HCS LipidTOX™ Green Neutral Lipid Stain (Thermo Scientific, Austria) according to the manufacturer’s instructions. In short, cells were stained with LipidTOX™/PBS diluted 1:500 for 20 min, trypsinized and finally subjected to FACS analysis.

2.13. Pathscan Multi-Target Sandwich ELISA

Screening for culprit signaling pathways causing the observed phenotype, samples from proliferating ASC and differentiated ASC (in-vitro adipogenesis day 14) were subjected to a multi-target sandwich ELISA analysis. Levels of phospho-ERK1/2 (Thr202/Tyr204), phospho-Stat1 (Tyr701), phospho-Stat3 (Tyr705), phospho-Akt (Thr308), phospho-Akt (Ser473), phospho-AMPKa (Thr172), phospho-S6 Ribosomal Protein (Ser235/236), phospho-mTOR (Ser2448), phospho-HSP27 (Ser78), phospho-Bad (Ser112), phospho-p70 S6 Kinase (Thr389), phospho-PRAS40 (Thr246), phospho-p53 (Ser15), phospho-p38 (Thr180/Tyr185), phospho-SAPK/JNK (Thr183/Tyr185), cleavage site PARP (Asp214), cleavage site Caspase-3 (Asp175), phospho-GSK-3b (Ser9) were determined using the PathScan Intracellular Signaling Multi-Target Sandwich enzyme-linked immunosorbent assay (ELISA) Kit (Cell Signaling Technology, Inc., Beverly, MA, USA) according to the manufacturer’s protocol. Chemiluminescent reaction was visualized using a Biorad ChemidocMP gel analyzer for detection (Biorad, Germany). Quantification was performed

23 with the ImageLab 5.0 software (Biorad, Germany) according to the manufacturer’s instructions.

2.14. Statistics

All experiments were repeated independently at least three times using cells from different donors. To assess quality of data, descriptive statistics were performed. Data were analyzed by unpaired student’s t-test and Mann-Whitney U test and are presented as mean +/-SD. P- values of <0.05 were considered statistically significant. Statistical analyses were carried out using Statview statistics software (SAS institute Inc., version 5.0.1) and Prism 5 (Graphpad software Inc., version 5.0).

3. Results

3.1. Integrin expression patterns of differentiated adipocytes and ASC

To determine integrin expression patterns, we isolated primary adipocytes and ASC (CD34+/CD90+/CD31-/CD45-) for qPCR analysis of 18 known alpha integrins. Multipotency of the isolated ASC was confirmed by in-vitro trilineage differentiation (Fig.6).

Figure 6A-D: Determination of ASC multipotency by trilineage differentiation. Isolated ASC (A) subjected to adipogenic (B), chondrogenic (C) and osteogenic (D) differentiation were stained using ORO , Alcian blue and Alizarin red after 14 days (adipocytes) or 3 weeks of differentiation (chondrocytes and osteoblasts), respectively. Scales B, D: 25µm, C: 50µm.

Figure 6E: Quantitative RT-PCR of differentiation marker genes (ADIPOQ for adipocytes, SOX9 for chondrocytes and RUNX2 for osteoblasts) was carried out using cDNA isolated from differentiated cells (E). Expression data were normalized to the mean of the reference gene GUSB. Shown data represent the meanSD of 3 donors. Asterisks indicate p-values <0.05.

Comparison of integrin expression levels in ASC and adipocytes was first carried out using in-vitro proliferating ASC and in-vitro differentiated ASC (Fig. 7). However, to depict the in vivo situation as exact as possible, we repeated this screen with sorted primary human ASC (CD34+/CD90+/CD31-/CD45-) and in-vivo differentiated adipocytes which were directly subjected to expression analysis (Fig. 8). We herein revealed that RGD-motif recognizing integrins, ITGA5, ITGAV, ITGA8 and ITGA2b were strongly repressed in differentiated adipocytes (Fig. 7, Fig.8A). Most prominently, ITGA5 mRNA declined more than 14-fold (mean fold regulation=14.9±8.5), whereas ITGAV (mean fold regulation=5.9±5.3) and ITGA8 (mean fold regulation=4.6±1.2) expression levels decreased more moderately. The 26 expression levels of ITGA2b mRNA were beyond detection limit. In contrast to the downregulation of RGD-motif recognizing integrins, laminin receptors ITGA6 (mean fold regulation=10.1±7.6) and ITGA7 (mean fold regulation=101.8±53.0) were strongly upregulated in differentiated adipocytes (Fig.8B). The third member of this group, ITGA3 (mean fold regulation=1.4±0.42), was not significantly regulated during adipogenesis. Among the alpha-I-domain containing integrins that predominantly recognize collagen, ITGA1 (mean fold regulation=3.9±2.3) and ITGA10 (mean fold regulation=6.5±8.1) were induced, while the expression of ITGA2 (mean fold regulation=2.3±1.2) and ITGA11 (mean fold regulation =25.9±13.1) was reduced in differentiated adipocytes. Integrins binding to an acidic motif termed “LDV” (22) that is present in fibronectin but also in other ligands such as VCAM1 and MadCAM1, ITGA4 (mean fold regulation=13.8±5.2), and ITGA9 (mean fold regulation=8.5±6.9) were repressed in terminal differentiated adipocytes (Fig. 8D), while the third member of this group, ITGAE, was slightly induced upon differentiation (mean fold regulation=1.6±0.75). The last group of integrins grouped as leukocyte specific integrins, ITGAL (mean=3.1±1.5), ITGAM (mean fold regulation=14.8±8.4), ITGAX (mean fold regulation=5.5±2.9) and ITGAD (mean fold regulation=5.6±5.7) were induced on mRNA level during differentiation in all donors (Fig.8E).

Figure 7: Integrin regulation in adipogenesis. The heatmap shows integrin expression in primary human ASC and in-vitro differentiated adipocytes isolated from subcutaneous fat tissue of 5 different donors. Data were acquired employing quantitative RT-PCR, values are depicted as fold change in gene expression, integrins were grouped automatically by clustering, the yellow cluster contains in-vitro differentiated cells (adipogenesis day 14), the blue cluster shows in-vitro proliferating cells.

However, compared to the cycle of threshold levels of the reference genes, the overall mRNA levels of these integrins were very low, with CT-values below 30 in sorted ASC. In summary, adipogenesis related regulation of integrins was dominated by repression of RGD-recognizing integrins and a strong upregulation of laminin receptors ITGA6 and ITGA7.

Figure 8A-E: Integrin regulation in adipogenesis. In-vivo integrin expression was analyzed in sorted primary human ASC (CD34+/CD90+/CD31-/CD45-) and in vivo differentiated adipocytes isolated from subcutaneous fat tissue of 3 donors employing quantitative RT-PCR, values are depicted as fold change in gene expression in a heatmap as depicted in Fig. 5F. Integrins were subsequently grouped according to their main binding motif: RGD-motif binding specific integrins (A), laminin recognizing integrins (B), collagen specific integrins (C), LDV-motif recognizing (D) and leukocyte specific integrins (E). Data were normalized to the geometric mean of reference genes GUSB and YWHAZ.

3.2. RGD-receptors ITGA5 and ITGAV are repressed during adipogenesis

As previous studies could demonstrate that culture of MSC on fibronectin or RGD-peptide coated plates promotes proliferation but not differentiation (39) and we found that all RGD- motif binding integrins were repressed during adipogenesis in-vivo, we focused on ITGAV and ITGA5 for functional analyses. Pharmacological inhibitors (64-66) have been designed for both integrins and are currently tested in clinical oncologic studies, what further prompted us to investigate their possible functional significance for tissue restoring applications.

First, we confirmed the mRNA expression data on protein level by immunohistochemistry and immunoblot analysis of sorted ASC- and primary adipocyte lysates. ITGA5 was strongly expressed in undifferentiated cells, but downregulated in differentiated adipocytes (Fig. 9A, Fig. 9D). ITGAV levels were similarly high in undifferentiated cells (Fig. 9D), however, expression was not completely abolished in mature adipocytes (Fig. 9B, 9D). Instead, residual protein accumulations at specific sites between adipocyte membranes were observed. This punctual pattern might indicate either the development of cell-cell contacts to enhance the mechanical properties of the tissue or the existence of RGD-containing ECM constituents surrounding adipocytes. Testing the second possibility, fibronectin staining showed increased levels in the ECM of undifferentiated cells but did not stain protein accumulations at adipocyte-adipocyte contact sites (Fig. 9C).

Figure 9: Expression of fibronectin receptors ITGAV and ITGA5 in-vivo and in-vitro. Immunohistochemistry analysis of paraffin fixed human subcutaneous fat tissue sections using specific antibodies for ITGA5 (A), ITGAV (B) and fibronectin (C). Arrows indicate ITGAV protein accumulations at connecting adipocyte membranes. Sorted ASC and primary adipocytes were subjected to immunoblot analysis of ITGA5 and ITGAV (D). FAPB4 expression was used as adipocyte specific marker. Cell lysates of in-vitro differentiated ASC (day 14) (left panel) and the same cells separated according to their lipid droplet content (LD, right panel) were subjected to immunoblotting detecting ITGAV, ITGA5 as well as adipocyte specific markers FABP4 and PLIN1 (E).

To investigate whether the observed regulations were also detectable in in-vitro differentiated cells, we subjected ASC to adipogenesis for 14 days and determined ITGA5 and ITGAV expression by immunoblotting. Compared to ITGA5 levels in ASC, ITGA5 expression in in- vitro differentiated adipocytes decreased corresponding to our in-vivo observations. Surprisingly, ITGAV expression was slightly induced upon in-vitro differentiation, which we suspected to be due to the amount of non-differentiated cells (Fig. 9E, left panel). To enrich differentiated cells, lipid droplet containing cells were selectively isolated by an OPTIPREPTM based density centrifugation method (67) and subjected to immunoblotting for ITGAV, ITGA5 (Fig. 9E, right panel) and adipocyte markers FABP4 and PLIN1. Similarly to in-vivo differentiated adipocytes, both integrins were strongly downregulated in differentiated cells. In contrast, cells subjected to adipogenesis that did not develop sufficient numbers of lipid droplets also showed reduced ITGA5 levels, but intriguingly showed an upregulation of ITGAV which might be explanatory for increased ITGAV levels in unseparated samples. In summary, these results supported our mRNA data showing a decline in ITGA5 and ITGAV during adipogenesis but also suggest differential functions of the two integrins in adipogenic differentiation.

3.3. Loss of ITGAV moderately induced cell death and reduced cell proliferation To further investigate the importance of ITGA5 and ITGAV in ASC physiology, we designed two independent shRNAs for each integrin and cloned them into lentiviral GATEWAYTM RNAi vectors (57) via recombination. For overexpression experiments, ITGA5 and ITGAV were expressed by lentiviral vectors (Fig. 10, Fig. 11). In ASC transduced with the lentiviral RNAi vector, ITGA5/ITGAV total protein levels were repressed to less than 10% of basal protein levels in control-shRNA (Ctr-shRNA) transduced cells (Fig. 11A). Analysis of ITGA5/ITGAV cell surface levels by immunostaining and flow cytometry revealed similar results, with an average knockdown efficiency of ~ 75-80% (Fig. 11A-C, 11B, 11C). Interestingly, we observed a compensatory upregulation of surface exposed ITGA5 in cells depleted for ITGAV. Vice versa, ITGAV was only moderately upregulated in ITGA5-KD cells. As this regulation was independent of mRNA levels (data not shown), increased synthesis, transport or protein stabilization of ITGA5 might occur in these cells upon loss of ITGAV.

Figure 10: Proof of knock down and overexpression vector functionality. In A, the surface protein expression of ITGAV (CD51) and ITGA5 (CD49e) is shown employing FACS analysis including corresponding IgGA and IgGB controls. C shows total protein expression of ITGAV and ITGA5 in Western Blot analysis.

As cell morphology of ITGAV-KD cells was different from ITGA5-KD or Ctr-shRNA infected cells (Fig. 12), we further analyzed proliferation and viability. Automated cell counting (Fig. 11E) and analysis of mitochondrial activity as marker of cell proliferation (Fig. 11D) showed a strong decrease of cell proliferation in ITGAV-KD cells at day 5 post infection. In contrast, ITGA5 depletion did not significantly reduce cell numbers or proliferation. However, at later time points the loss of ITGA5 resulted in similar low cell

33 numbers and no difference between the two integrins was observed (data not shown). To analyze whether decreased cell numbers resulted from increased cell death, we determined cell viability by AnnexinV/PI staining in transduced ASC (Fig. 11F). In contrast to ITGA5 depletion, ITGAV–KD showed a moderate, but not significant increase of apoptotic cell numbers (mean=9.5%6.8), indicating that some of the cells undergo cell death upon loss of ITGAV within the investigated time.

. Figure 11: Effect of ITGAV and ITGA5 knockdown and overexpression on cell proliferation and viability. Efficiency of different shRNAs targeting ITGAV and ITGA5 was determined by immunoblotting (A) and flow cytometry (B, C) 5 days after infection. Proliferation of transduced ASC was assessed by Prestoblue® proliferation assay (D) and automated cell count (E). Cell viability of AnnexinV/PI stained cells was determined by flow cytometry 5 days after transduction (F). Data represent the meanSD of 5 experiments targeting each integrin with two independent shRNA sequences. Presented data of KD-cells have been pooled. Asterisks indicate p-values <0.05

Figure 12: Effect of ITGAV and ITGA5 knock-down and overexpression on morphologic cell phenotype. Representative phase microscopy pictures of transduced ASC 5 days after infection. Scales indicate 50µM.

3.4. Loss of ITGAV impacts on cell adhesion and spreading

As integrins are proteins of paramount importance in terms of cellular migration and attachment, we hypothesized that spreading and adhesion functions would be impaired upon loss of ITGAV. Adhesion assays were performed as described above (Chapter 2.5). As anticipated, the experiment revealed a moderate but significant enhancement in strength of adhesion in the overexpression group up to 120% of control cells after 24 hours, which might be explained by a larger number of adhesion proteins. In fact, KD groups showed a significantly reduced strength of adhesion down to 30% compared to the control group cells (Fig.13). Interestingly, the spreading assay could confirm a significant decrease in overall area of cell attachment (pixel/cell) in ITGAV KD cells compared to control cells up to 51% at 30 minutes as well as one and two hours after plating. This could be shown for both shRNA isoforms and was accompanied by a rounded morphologic aspect of the cells, indicating an important role for ITGAV in the formation of focal adhesions. The hypothesis is further enforced by the large spreading area seen in cells overexpressing ITGAV (Fig.14 and Fig.15, respectively). Spreading area was further measured every hour until 24 hours after

Figure 13: Cell adhesion depicted in mean fluorescence intensity at OD 460-620nm. The bar plot shows the mean of the data from 7 independent experiments +/- SD (7 donors). Asterisks indicate *p<0,05.

Figure 14: Representative phase microscopy pictures of transduced ASC 5 days after infection. The spreading area is outlined in green using ImageJ software. Scales indicate 50µM.

Figure 15: Effect of ITGAV knock-down on cell spreading area (pixels/cell) at designated time points 30min., 60min. and 2 hours after seeding. Asterisks indicate p<0,05. The box plot shows the mean of the data from 5 independent experiments +/- SD (3 donors).

Figure 16: Effect of ITGAV knock-down on cell spreading area (pixels/cell) at designated time points after seeding. Asterisks indicate p<0,05. The box plot shows the mean of the data from 5 independent experiments +/- SD (3 donors).

37 attachment to check for variances at later time points. In KD cells, a slight but not significant decrease of attachment area could be observed from the first hour until 24 hours after seeding in both individually analyzed subgroups (ITGAV-KD and ITGAV-OE). In contrast to these findings, control cells further increased their area of attachment until 6 hours after seeding to end up with a spreading area similar to the area 2 hours after seeding, 24 hours after their first contact to the surface. A similar curve could be observed in the box plot analysis of cells of the overexpression group, which reached a more or less stable state after 4 hours (Fig. 16).

3.5. Intracellular signaling pathways are differentially regulated by ITGAV and ITGA5

Upon ligand binding by integrins many signaling pathways are activated, including the MAPK, AKT and Hippo pathway downstream SRC/FAK activation. One of the most cited pathways affected by integrin signaling is mediated by extracellular signal-regulated kinases 1/2 (ERK 1/2) (68), serine/threonine kinases which belong to the MAP kinase family. ERK 1/2 activity is controlled by upstream MAP kinase-kinase (MAP2K) mediated phosphorylation at Thr202/Tyr204 (69). Analysis of phospho-ERK1/2 in proliferating ITGAV- and ITGA5-KD cells did not show integrin specific differences in ERK1/2 phosphorylation at Thr202/Tyr204, indicating that this signaling pathway was not responsible for the cell cycle effects observed in ITGAV-KD cells (Fig. 14A). Next we analyzed S473 phosphorylation of AKT, as previous findings suggested a PI3-kinase dependent regulation of AKT activity upon integrin signaling at this phosphorylation site (70, 71). However, AKT phosphorylation was almost undetectable in transduced ASC and no integrin-specific differences could be observed (Fig. 17A). The expression of the two major downstream effectors of the Hippo signaling cascade, Yes-associated protein (YAP) and transcriptional co-activator with PDZ-binding motif (TAZ) was analyzed in ITGAV- and ITGA5 KD cells. Western blot analysis showed that neither loss of ITGAV nor ITGA5 exerted influence on YAP levels (Fig. 17B), while TAZ levels were about 2-fold lower in ITGAV-KD cells than in ITGA5-KD or control cells. To evaluate whether this decrease affected the expression of classical TAZ target genes we determined levels of CTGF and survivin/BIRC5 in these cells by quantitative RT-PCR. As expected, CTGF levels showed a moderate decrease in ITGAV- KD cells. More impressive, survivin was strongly repressed in ITGAV- but not in ITGA5-KD cells (Fig. 17B). Thus, the data suggested that ITGAV signaling is linked to the Hippo pathway by regulation of TAZ levels. In addition, repression of survivin, a widely known cell cycle regulator and caspase inhibitor (72, 73), might be responsible for the repressed 38 proliferation in ITGAV-KD cells. We performed rescue experiments by introducing transgenic survivin-cDNA or GFP-cDNA as control in ITGAV-KD cells by lentiviral transfection and analyzed proliferation. Although survivin expression strongly overwhelmed

Figure 17 A-C: Downstream pathway analysis links ITGAV signaling to the Hippo pathway. Phosphorylation of MAP-Kinase ERK1/2 and AKT in ITGAV- and ITGA5 depleted cells was analyzed by immunoblotting using phosphosite-specific antibodies (A). Cells were subjected to immunoblot analysis of YAP, TAZ and TAZ-target gene survivin (B). Regulation and mRNA expression of the YAP/TAZ target gene CTGF (C) and survivin (10D) in ITGAV- and ITGA5-KD cells was assessed by quantitative RT-PCR. Expression levels are presented as mean -ΔCT. Presented data of KD-cells have been pooled. All data represent the meanSD of 3 independent experiments.

Figure 17 D-F: Downstream pathway analysis links ITGAV signaling to the Hippo pathway. Regulation and mRNA expression of the YAP/TAZ target gene CTGF (10C) and survivin (D) in ITGAV- and ITGA5-KD cells was assessed by quantitative RT-PCR. Expression levels are presented as mean -ΔCT. Presented data of KD- cells have been pooled. Survivin- or GFP-cDNA transduced ASC were superinfected with ITGAV- and ITGA5- targeting shRNA constructs and subjected to immunoblotting 5 days after transduction (E). Cell proliferation analysis of double infected cells was performed at day 5 (F). All data represent the meanSD of 3 independent experiments.

levels in GFP-transduced cells (Fig. 17E), transgenic survivin was insufficient to rescue the proliferation phenotype induced by ITGAV-KD (Fig. 17F), suggesting that repression of survivin was not causative for the decrease in cell proliferation.

3.6. Loss of ITGAV mediated upregulation of p21 Since the so far investigated pathways did not sufficiently explain reduced cell proliferation upon loss of ITGAV, we investigated levels of cell cyclin-dependent kinase inhibitor 1A (p21Cip1), which has previously been shown to be stabilized upon disruption of filamentous actin (F-actin) (74). Interestingly, we observed an up to 4-fold upregulation of p21Cip1 mRNA and protein levels in ITGAV-depleted but not in ITGA5-KD cells (Fig. 15A, B) in ITGAV- KD cells. As possible known p21Cip1 regulators, we determined the levels of different members of the tumor suppressor protein p53 family (75). As shown in Fig. 18A, neither p53 nor p73 levels increased in ITGAV-depleted cells, suggesting alternative induction of p21 in ITGAV- and ITGA5 KD cells.

Figure 18: p21 is upregulated upon loss of ITGAV. ITGAV- and ITGA5-KD cells were subjected to immunoblotting 5 days after infection and analyzed for p21Cip1, p53 and p73 (A). p21 mRNA levels in ITGAV- and ITGA5-KD cells are expressed as fold change in gene expression (B). Presented data of KD-cells have been pooled. Data were normalized to the geometric mean of the two reference genes GUSB and YWHAZ. Shown data represent regulation values from independent 4 experiments.

3.7. Loss of ITGAV promotes adipogenic differentiation of ASC

Previous studies have already shown that expression of ITGA5 counteracts adipogenic differentiation (76). It has also been shown before that pericellular fibronectin levels strongly decrease during adipogenesis, connecting fibronectin signaling essentially to the differentiation process (42, 76). Since ITGAV levels declined, but were not as strongly repressed as ITGA5 in differentiating cells, we functionally tested whether the loss of ITGAV induced a similar phenotype as the loss of ITGA5 in ASC (Fig.19).

Figure 19: ITGAV and ITGA5 expression decrease adipogenesis. Lentivirally transduced cells were subjected to adipocyte differentiation and stained with ORO. Nuclei were visualized by Hoechst 33342. The number of differentiated cells was determined by counting of differentiated cells per visual field. A minimum of 5 pictures was analyzed per experiment. Scales indicate 50µM.

Vice versa, we performed gain of function experiments by constitutively expressing transgenic ITGAV- or ITGA5 in ASC to elucidate whether inhibition of differentiation is mediated by integrin expression. Transduced cells were subjected to adipogenesis and analyzed for the formation of lipid droplets (ORO and LipidTOX-Green, respectively) and expression of classical adipocyte marker genes. Microscopy (Fig. 19) and flow cytometry analysis of LipidTOX-green stained lipid droplets (Fig. 20B) revealed that loss of ITGA5 increased the numbers of lipid droplet containing cells up to twofold.

Similarly, depletion of ITGAV also enhanced adipogenic differentiation as well, but the increase in differentiation was more moderate. Vice versa, transgenic expression of ITGA5 or ITGAV reduced the numbers of well differentiated cells up to 60% (ITGAV-KD) and 50% (ITGA5-KD), respectively (Fig. 20A, B). In concordance, mRNA levels of typical adipocyte marker genes, peroxisome proliferator-activated receptor γ (PPARG), lipid droplet associated protein 2 (PLIN2), adipocyte specific fatty acid binding protein (FABP4) and adiponectin (ADIPOQ) evidenced the phenotypic observations (Fig. 19C). In all instances, levels of these marker genes in KD-cells exceeded those in Ctr-shRNA transduced or ITGA5/ITGAV- transgenic cells. PPARG reached higher levels in ITGA5-KD cells than in ITGAV-KD cells (p=0.048), which might hint for enhanced activation of adipogenesis regulating signaling cascades in these cells. In summary, the data demonstrate that loss of ITGAV and ITGA5 induced a similar but not necessarily the same differentiation phenotype arguing for distinct adipogenesis signaling mediated by these integrin subtypes.

Figure 20: ITGAV and ITGA5 expression decrease in adipogenesis. Lentivirally transduced cells were subjected to adipocyte differentiation. The number of differentiated cells (A) was determined by counting of differentiated cells per visual field (for microscopy pictures see Fig. 12) and flow cytometry analysis of LipidTOX Green stained cells (B). Shown data represent the meanSD of at least 5 independent experiments targeting each integrin with two independent shRNA sequences. Quantitative mRNA analysis was performed for adipocyte marker genes ADIPOQ, FABP4/AP2, PLIN2 and PPARG in ITGAV- and ITGA5 transduced ASC (C), shown data represent the meanSD of 3 independent experiments. Presented data of KD-cells have been pooled. Asterisks indicate p-values <0.05. 44

3.8. Intracellular signaling mediated by ITGAV and ITGA5 in adipogenesis

Screening for culprit signaling pathways for the adipogenesis phenotype seen in ITGAV-KD and ITGA5-KD cells as well as the vice versa phenotype found in overexpression groups, we employed a Pathscan Multi-Target Sandwich ELISA analysis that allows simultaneous screening for multiple pathways to get a fast, proper and broad overview on the possibly involved pathways.

Based on these data we herein mainly concentrated on p53, ERK1/2 and p38 signaling as well as mTOR signaling with a special focus on PRAS40, respectively. Raw values of three independent experiments using ASC from three different donors were analyzed employing chemilumescent expression analysis and all data were normalized against the control plasmid. The results (Fig.21) showed a specific expression pattern for phospho-p53 that matches the observations made and described earlier in Fig. 15A in ITGAV-KD cells for both KD plasmids and also both the proliferation and the differentiation group. However, phospho-p53 is the active form that leads to binding of p53 to the p21 promotor, and therefore to transcription of the downstream protein (77). These findings match and further enforce our theory of alternative induction of p21 in the analyzed cells as described in chapter 5 without major influence of integrin expression patterns on p53 expression. Especially the phospho- ERK1/2, phospho-p70-S6 kinase as well as phospho-p38, phospho-mTOR and phospho- PRAS40, respectively showed in parts differential regulation between the groups in this particular screen. This prompted us to further cell culture experiments which are discussed in chapter 5 (Fig.21). However, these data were not confirmed by western blotting in the end, where we did not find differences in the expression of phosphorylated phospho-ERK, phospho-p38, phospho-mTOR and phospho-PRAS40.

Figure 21: Pathscan Multi-Target Sandwich ELISA analysis. Expression data for phospho-AKT p53 (A), phospho-AKT p70s6k (B), phospho-ERK1/2 (C), phospho-mTOR (D), phospho-p38 (E) and phospho-PRAS40 (F) were pooled for each group (mean) and normalized to the mean of the control plasmid group. Data were collected in three independent experiments using cells from three different donors. A representative picture of the screen for phospho- PRAS40 in ITGA5-OE cells is shown in (G). Asterisks indicate p- values>0,05.

3.9.Pharmacological inhibition of ITGAV/B3 and ITGAV/B5 by cilengitide mimics loss of ITGAV in ASC

After assessing the importance for ITGAV and ITGA5 for the fate of mesenchymal progenitor cells isolated from human fat, we aimed to study the clinical feasibility of our observations by comparing the effects of ITGAV-KD with the pharmacological inhibition of ITGAV/ITGB3 and ITGAV/ITGB5 complexes using ITGAV heterodimer inhibitor cilengitide (Fig. 22).

Figure 22: Molecular structure of peptidic integrin inhibitor Cilengitide

The peptidic inhibitor (78, 79), that was originally developed for the treatment of glioblastoma, was added to undifferentiated ASC or continuously administrated during the differentiation protocol. The effect on proliferating cells was similar to that observed in ITGAV-KD cells, showing decreased cell proliferation (Fig. 23A). ITGAV and ITGB3 protein levels decreased after administration of 10µM cilengitide, corresponding to about 1/5 of a therapeutic dose of 2000 mg (80, 81) in a normal weight patient. At this concentration,

Figure 23: Pharmacological inhibition of ITGAVB3 / ITGAVB5 with cilengitide mimics loss of ITGAV. Proliferation of Cilengidite treated ASC was assessed by Prestoblue® proliferation assay 48h after treatment (A). Immunoblot analysis of 48h Cilengitide treated ASC using specific was performed (B). Number of differentiated cells was determined by counting of differentiated cells per visual field at day 14 of adipocyte differentiation (C). Asterisks indicate p-values <0.05, a minimum of 5 pictures were analyzed per experiment. Shown data represent the meanSD of 3 independent experiments. Day 14 differentiated ASC exposed to 10µM Cilengitide or control treatment DMSO were subjected to immunoblotting of adipocyte markers FABP4 and PLIN1 (D).

TAZ and survivin levels were repressed (Fig. 23B), correlating with our observations in ITGAV-depleted cells. Interestingly, neither ITGA5 counter-upregulation nor p21 accumulation was observed in cilengitide treated cells. In addition to the cell proliferation inhibiting effects, cilengitide treatment promoted adipogenesis.

A dose of 10µM cilengitide was sufficient to significantly increase the number of lipid containing cells (Fig. 24C). Higher concentrations (20µM, 50µM) even enforced the 48 phenotype, but also induced alterations in cell morphology and increased cell clustering indicating possible cell-toxic effects. On molecular level, PPARG, PLIN1 and FABP4 were strongly induced upon cilengitide treatment throughout adipogenesis (Fig. 23D) correlating well with the microscopic phenotype (Fig. 24). In summary, pharmacological inhibition of ITGAV/ITGB3 and ITGAV/ITGB5 phenotypically and molecularly corresponds to the loss of ITGAV and promotes adipocyte differentiation of ASC.

DMSO Figure 24: Pharmacological inhibition of ITGAVB3 / ITGAVB5 with cilengitide mimics loss of ITGAV. Cilengidite treated ASC were subjected to adipogenesis. Number of differentiated cells was determined by counting of differentiated cells per visual field at day 14 of adipocyte differentiation. A minimum of 5 pictures were analyzed per experiment. Microscopic analysis of day 14 differentiated ASC was carried out using ORO and Hoechst 33342, scale bar: 50µm.

10µM

50µM

C C 50

4. Discussion

The initial aim of this work was to identify essential regulators of matrix-cell interactions in ASCs that control cell fate and discriminate them from mature adipocytes. By systematically analysis of the expression of a wide panel of alpha integrins, which specifically recognize and bind ECM substrates, we elaborated distinct expression profiles for sorted CD34+/CD90+/CD31-/CD45- ASCs enriched from the SVF and primary adipocytes isolated from human subcutaneous tissue. Our data confirmed findings of previous in-vitro studies showing that integrins such as ITGA2, ITGA4(18), ITGA5 and ITGA6(82) are differentially expressed in ASCs and adipocytes. In addition, we also unraveled new adipogenesis-specific integrin regulations. For instance, ITGA7 was markedly upregulated in differentiated adipocytes. Similar to ITGA6, ITGA7 specifically binds to laminin, a substrate that has been shown to be an important ECM component of adipocytes containing large fat vacuoles(18, 76). Since antibody-mediated inhibition of ITGA6 does not alter the differentiation phenotype(76), ITGA7 might be the responsible one for laminin-dependent signaling in differentiating preadipocytes. Furthermore, we found that RGD-motif and LDV-recognizing integrins were consistently repressed during adipogenesis, whereas laminin and collagen receptors as well as the leukocyte specific integrins were upregulated in adipocytes. From these data, it is tempting to conclude that the in-vivo niche of ASCs is rich in matrix substrates containing RGD-motifs like fibronectin or vitronectin and is poor in laminin subtypes, as ASCs indeed express RGD-binding integrin subtypes at high levels but hardly express laminin recognizing integrins. However, the complexity of ECM architecture and the availability of distinct substrate isoforms that additionally mediate mechanical cues might dampen this simplified view.

Among RGD receptors, ITGA8 mRNA expression was lowest in ASCs, but as ITGA5 and ITGAV were highly expressed in ASCs and strongly repressed upon differentiation, we focused on these integrins for further functional analyses.

ITGA5 has previously been shown to be strongly repressed upon differentiation in 3T3-L1 preadipocytes(76), whereas this effect could not be observed in in-vitro differentiated hMSC from the bone marrow(18). Worth mentioning, although mRNA levels of AV clearly declined in differentiated adipocytes, AV protein accumulations could be detected sporadically at attaching adipocyte cytoplasma-membranes in-vivo (Fig.6B). This might either suggest for ITGAV specific substrates deposits in the adipocyte extracellular matrix or a possible 51 adaption to active mechanical forces in the native fat tissue and hints for an important role in maintaining tissue architecture and the three-dimensional ECM of adipose tissue.

Those differences in the protein expression were also observed in in-vitro differentiated adipocytes if separated according their lipid droplet content. Interestingly, those cells that do not develop sufficient numbers of lipid droplets showed a more moderate reduction (ITGA5) or even increase in protein levels (ITGAV), which can be interpreted as increased adherence of these cells onto stiff matrices (83). However - to our knowledge, ITGAV has not yet been linked to adipogenic differentiation, but has been shown to be important in the neural invasion of malignant tumors(84), tissue fibrosis(85) and also in neoangiogenesis(86, 87). The results on hand demonstrate that all members of this group are repressed during adipogenesis in-vivo and in-vitro.

Mainly because overall mRNA expression of ITGA8 was comparatively low in proliferating as well as in differentiated adipocytes, we focused on ITGA5 and ITGAV integrins to analyze their role for controlling human ASC physiology. This selection was further encouraged by the knowledge that specific inhibitors for both integrins had been designed and were both available and functionally tested. Volociximab, a specific ITGA5 inhibitor was originally designed to prevent neoangiogenesis in solid tumors and is actually tested clinical studies (88). Cilengitide, a peptide that based on a cyclo-RGDfV motif specifically inhibiting ITGAV function failed to improve the therapy of gliablastoma in a clinical phase III study. However, detailed knowledge on the function of these compounds based on functional analysis of the individual target integrins in benign and malign cell types might help to define new therapeutic applications.

The most obvious phenotype found in our experiments, was that knockdown of ITGAV but not ITGA5 reduced of cell proliferation. It has recently been demonstrated that ITGAV is required for the maturation of focal adhesions, whereas ITGA5 controls early attachment and assembly of nascent adhesions. Our data might postulate a functional role of ITGAV in cell cycle(89). ITGAV depletion was associated with a p53-independent induction of cell cycle regulator CDKN1A, the gene encoding p21Cip1 protein, suggesting that ITGAV expression might be required for proliferation following cellular adhesion. In contrast, although knockdown of ITGAV impaired adhesion, it only marginally increased apoptosis due to anoikis, suggesting functional redundancy to ITGA5 or other integrins.

In contrast to our findings in ASCs, proliferation inhibiting effects of ITGA5 have been described previously for a variety of cell types such as keratinocytes (90) or muscle cells (91). Although transgenic expression of ITGA5 increased proliferation in ASCs, the effect of RNAi mediated ITGA5 depletion on proliferation was not significant during the first six days after transduction. At later time-points proliferation levels approximated the level of proliferation in ITGAV-KD cells. These findings suggest that integrin signaling varies depending on the cell type. Under the cell culture conditions used in this study the effect of transgenic ITGA5 expression might not be as significant as it might be for cells that are additionally cultured in the presence of exogenous RGD-containing substrates as this might enhance integrin signaling On the other hand, this may be valid only for very early effects as adherent cells immediately begin to produce their own extracellular matrix upon attachment(92).

Adhesion, as the first step in attachment of cells, is mainly mediated by binding of integrins to ECM proteins and interaction with the cytoskeleton through their intracellular domain, respectively. Integrin activation herein is considered a factor of paramount importance in the formation of early (nascent) adhesions, whereas other proteins like talin do contribute also to nascent but most importantly to clustered adhesions. Especially regarding the formation and maturation of nascent adhesions, which are the crucial start of overall attachment, the roles of ITGAV and ITGA5 have been pointed out before in mouse knock-out models (93). It has been demonstrated that ITGAV is required for the maturation of focal adhesions, whereas ITGA5 controls early attachment and assembly of nascent adhesions (83). Moreover, cell adhesion and other physiologic cellular functions can be modulated by coating surfaces with ECM components or fragments. Herein, the RGD pattern containing substrates are important binding partners for both ITGAV and ITGA5, which were outlined as absolutely necessary but not solely sufficient for adhesion and subsequent migration by other authors (94). Also, such findings cannot be generalized or even seamlessly transferred to in-vivo situations because the niche and ECM that surround cells in vital tissues are dramatically more complex and cannot sufficiently be mirrored by any bioreactor available until today. Nevertheless, the employed assay showed a strong impairment of cell adhesion although only ITGAV was depleted and no other integrin was modulated in expression. This again indicates a strong role of the specific subtype in the maturation of nascent adhesions and late results of the spreading assay might also hint for a role of ITGAV in terms of maintenance and thus formation of the stable adhesome as postulated by other authors (95). In line with this, overexpression of ITGAV on the other hand increased adhesion significantly compared to control cells. However, the adhesion and spreading assays were carried out on uncoated surfaces, and thus 53 these results cannot be applied seamlessly to the in vivo situation which is much more complex.

As the role of integrins and their communication with the Hippo pathway have been defined in mechanosensing before (96), we could further confirm our findings by the fact that analysis of the Hippo signaling pathway revealed TAZ levels that were about 2-fold lower in ITGAV- KD cells than in ITGA5-KD or control cells (Fig. 17). Interestingly, YAP protein expression levels remained largely unchanged by loss of any integrin further investigated in this work although either YAP and TAZ are known to be phosphorylated and thus inhibited by cell detachment (97) and cytoskeleton reorganization via activation of Lats1/2 kinases (98) which is of major interest in the development of new anti-cancer substances.

Furthermore, we found that the major Hippo pathway mediator TAZ but not YAP was significantly repressed in ITGAV-KD cells and TAZ repression went along with a reduction in survivin expression. Since Hippo signaling is involved in fundamental processes like proliferation arrest, contact inhibition, sensing of mechanical cues and cytoskeletal changes(99), it is not surprising that this pathway is affected by ITGAV depletion. Although transgenic survivin did not rescue ITGAV-cells from reduced growth, the data strongly suggest – to our knowledge for the first time - a functional link between the Hippo pathway and integrin signaling. Whether the classical Hippo pathway cascade via LATs1/2 activation is involved or TAZ downregulation is due to another mechanism is the subject of current investigations.

In addition to these results, spreading assays that were carried out as complementary investigations showed a significant decrease of the attachment area per cell (Fig.13-16) in ITGAV-KD cells compared to control cells accompanied by a more rounded morphologic aspect of the cells and a decrease in adhesion efficiency (Fig.13). Again, this clearly outlines a major role of ITGAV heterodimers in early adhesion. In fact, similar effects have been shown for epithelization in wound healing before (100). In correspondence to this, the overall importance of RGD sequences as direct binding targets of ITGAV heterodimers for cellular adhesion of human dermal reticular fibroblasts seeded on fibronectin fragments was shown elsewhere. However, predominantly the loss of ITGB1 but not ITGAV has been found to be of major significance to keratinocyte adhesion in wound healing elsewhere, indicating a secondary role for ITGAV in epithelization namely as part of ITGAV/ITGB1 heterodimers (101). Again, the results might mirror a quite simplified setting compared to the in vivo situation, as they were carried out on uncoated surfaces. On the other hand, cells have been 54 proven to build their own, ideal matrix within a short time after attachment before (92), and any overlapping and therefore interfering signaling can be ruled out this way.

The strongest effect of ITGA5/ITGAV knockdown that we found in our work was a major increase in differentiation. Vice versa we observed adipogenesis inhibiting effects of transgenic ITGA5/ITGAV expression. In agreement with other authors (42, 43) who described a negative impact of fibronectin signaling on adipogenesis before, our experiments showed significantly enhanced differentiation of ASCs upon loss of ITGA5 or ITGAV, which can also be seen as mimicking the absence of fibronectin signaling. Vice versa, overexpression of both integrins strongly impaired adipogenesis, thus suggesting a negative impact on adipogenic differentiation by the presence of RGD motif mediated signaling as represented by fibronectin in-vivo. Although depletion of ITGAV decreased cell proliferation and slightly increased cell death at early time points after infection of proliferating cells, ITGAV-KD cells subjected to adipogenesis effectively underwent differentiation without any signs of cell death. In fact, it is widely known that cells plated to undergo differentiation have to be seeded at a high density in order to induce a proliferation stop by cell contact inhibition. From this observation, we conclude that loss of ITGAV primarily affects proliferating ASCs and has no effect on the viability of cell cycle arrested cells.

To search for responsible intracellular signaling mechanisms for the demonstrated differentiation phenotype we employed a Pathscan Multi-Target Sandwich ELISA analysis (Fig.21), that allows screening for activation of multiple pathways. Herein we first screened our results for activation of the ERK1/2 pathway as ERK1/2 signaling has previously been shown to regulate actin polymerization (102) which in return was linked to integrin signaling (103). In our experiments, ERK phosphorylation at Thr202/Tyr204 did not depend on the differential expression of individual integrins (Fig. 21C)., suggesting that ITGA5 and ITGAV signaling are not mediated by distinct activation of the MAPK-pathway only - a finding that also holds true for the AKT pathway according to the results of the ELISA screen.

Testing the hypothesis, that this specific phosphorylation site of ERK1/2 is not the one specific or responsible for changes in adipogenic differentiation, we carried out differentiation experiments using the potent MEK-inhibitor PD98059 to influence the signaling cascade upstream of MAPK/ERK1/2 as shown in previous works (104-106). Hypothesizing that adipogenesis is promoted by loss of inhibition of PPARG due to decreased ERK1/2 activity in ITAGV deficient cells, we carried out rescue experiments adding PD98059 to ITGAV-KD cells and, vice versa, on cells overexpressing ITGAV, expecting to prevent or reinforce, 55 respectively, the changes in adipogenesis seen in previous experiments (Fig.16). In contrast to our hypothesis, adipogenesis was not influenced by the MEK-inhibitor neither in KD cells nor in overexpression cells, suggesting that integrin mediated influence on adipogenesis is mediated by alternative pathways rather than MEK signaling.

Other authors have pointed out before, that the tuberous sclerosis protein 1–2 complex (TSC1–TSC2) is able to regulate adipocyte differentiation via control of mTORC1 activity and PPARG expression (107). Moreover, mechanistic target of rapamycin (mTOR) signaling was linked to adipogenesis by enhancing the process via PPARG upon depletion or knock down of mTOR (108). Therefore, mTOR has been described to be a physiologic inhibitor of adipogenic differentiation and to have an important function for the homeostasis in adipose tissue, as previously shown in vitro (109) as well as in vivo employing C57BL/6J mice (110). Also, mTOR is a substantial part of mammalian target of rapamycin complex 1 (mTORC1) which was shown to inhibit differentation processes of 3T3-L1 adipocytes upon treatment with fisetin, a flavonol phytochemical substance that is able to strongly suppress mTORC1 signaling. The specific phosphorylation site Ser-2448 in mTOR is found within a regulatory region and results in elevated mTOR activity in vitro and in vivo when deleted (111, 112). Pathscan sandwich ELISA analysis revealed matching expression patterns in ITGA5-KD cells with positive levels of Ser2448 phosphorylated mTOR in differentiated cells while showing significantly decreased levels in proliferating ITGA5-KD ASC (Fig. 21D). Contrarily, expression patterns in the other groups and interestingly, also in the ITGA5 overexpression group, did not reveal specific regulation patterns depending from integrin expression status, suggesting that integrin linked regulation is not essentially associated with mTOR signaling. A possible explanation for the resulting expression levels is that phospho-mTOR S2448 has been found to be induced upon insulin treatment (113), which is essential part of adipogenic differentation medium in even higher concentrations than used in PM4 medium which was used for proliferating cells in our experiments.

P70S6 kinase on the other hand, could be shown to directly mediate phosphorylation of Ser- 2448 in mTOR (114). In contrast to this, p70S6 kinase has been described a downstream target of mTORC1 and mTOR phosphorylated at S2448 via p70S6K is also found in mTORC2 (113). Still it remains elusive until today, if phosphorylation of mTOR by p70S6 kinase enhances or decreases mTOR signaling (114). However, relative expression of p70S6 kinase levels showed distinct regulations in the differentiation versus the undifferentiated group (Fig.21B), whereas there were no specific variations between knock down and

56 overexpression groups regarding ITGAV and ITGA5 which resembles to the results we found for mTOR especially for ITGAV-KD and ITGAV-OE groups. Thus, we conclude that Thr389 phosphorylated p70S6 kinase does not regulate adipogenesis by promoting specific signaling downstream of ITGAV or ITGA5, but might be depended of the global differentiation status of cells more than the distinctly reached level of differentiation. This holds true for p70S6 kinase as well as for mTOR, underlining their association to each other that is widely known in literature (115).

Previously it was shown, that p38 MAPK signaling cascade might be responsible for PPARG activation in adipogenesis (116-118). Moreover, p38 MAPK signaling could be linked to monocyte differentiation (119) and the development of brown adipocytes from white adipocytes in mice (120) which is referred to as “browning”. Also, silica nanoparticles were shown to inhibit differentiation in brown adipocytes by influencing p38 phosphorylation at the particular phosphorylation site (121). P38, especially the PKA-ASK1-p38 signaling connection in direct response to cAMP signaling was linked to important physiologic processes in brown as well as in white adipocytes (122). The activation of p38-MAPK on the other hand, could be shown to inhibit adipogenic differentiation in hMSC (123), and the inhibition of p38-MAPK was vice versa shown to promote adipogenesis in a mouse model (124). These findings together with our Pathscan results led us to the postulation of the hypothesis that activation of p38 via ITGAV or ITGA5 would be able to decrease PPARG activity. In different experiments, we could find no differential regulation of p38 in ITGAV- or ITGA5-KD cells neither in RT-PCR not Western blotting, thus falsifying the hypothesis. Also, we precisely analyzed the results for p38 phosphorylation at Thr180/Tyr182 in differentiated and undifferentiated ASC. Similar to the results found for ERK activation, the activation of the specific phosphorylation site of p38 did only in part depend on the differential expression of individual integrins but overall on the differentiation state of the individual cells of each sample, suggesting that this activation may not linked exclusively to integrin signaling and does mainly depend of the differentiation status of the cells but not on the degree or level of differentiation. In line with our findings, a recent translational study on fat grafts in mice showed that inhibition of p38 using the p38 MAPK inhibitor SB203580 is neither able to prevent resorption of the graft nor promoting adipogenesis of the ASC in the graft as initially expected and postulated by the authors (125) and thus, p38 did neither proof itself to be a potent regulator of adipogenesis nor to do so via integrin signaling.

Furthermore, in the Pathscan ELISA experiments no distinct activation pattern for phospho- p53 (Ser15) could be shown in the ITGAV-KD group, which matches the results obtained by western blotting (Fig.18A). P53 activation at Ser15 is followed by p53 binding to the p21Cip1 promotor which subsequently leads to transcriptional activation of p21Cip1 (77) as shown in Fig.15B. However, p53 could neither be shown in the ITGA5-KD group nor in the corresponding overexpression group (Fig. 21A), solely the ITGAV overexpression group showed a significant downregulation of phospho-p53 during adipogenesis. In summary, the observed effects are interpreted as ITGAV specific, connecting the proliferation phenotype to an alternative activation of p21Cip1 independend of p53 levels (Fig.18A).

Based on the ﬁnding that ITGAV knock down is able to enhance adipogenesis as described above, we tested whether the pharmacologic ITGAV/ITGB3 and ITGAV/ITGB5 heterodimer inhibitor cilengitide is able to mimic this phenotype (Fig. 23-24). As expected, pharmacological inhibition of ITGAV mimics total loss of ITGAV expression in both cell phenotype and intracellular signaling in a dose-dependent manner. Intriguingly, although all other downstream targets investigated showed regulations similar to that found in ITGAV- depleted cells, p21Cip1 levels were not increased following cilengitide treatment. Even longer exposure to the drug did not increase levels of this cell regulator, thus suggesting differential intracellular signaling. A possible explanation for this finding might be that shRNA-mediated ITGAV targeting affects the expression of all ITGAV heterodimers and is not restricted to ITGAV/ITGB3 and ITGAV/ITGB5, implying that upregulation of p21Cip1 in ITGAV-KD cells might result from the lack of ITGAV/ITGB1 and ITGAV/ITGB6 heterodimers. Also, this matched the findings of the Pathscan ELISA experiments as described above.

In summary, we identified ASC specific integrins and functional analyses demonstrated that integrins expressed in primary ASCs and adipocytes contribute to cellular processes by influencing intracellular signaling pathways. Our data also strongly suggest a negative impact of RDG motif signaling on adipogenic differentiation of ASCs via ITGA5 (76) and - to our best knowledge - for the first time via ITGAV.

5. Clinical and translational significance of this work

5.1. Joining the ranks of plastic surgeons in basic research – how to connect basic research to plastic surgery

In plastic surgery, aesthetic as well as reconstructive aims are the focus of treatment to obtain the best possible regeneration of form and function of the body and its parts. Performing procedures such as lipografting, skin transplantation or even free microvascular tissue transfer not only do require acquisition of excellent technical skills and training but also a profound knowledge of tissue and cell physiology. Therefore, a very refined and targeted approach to both clinical and scientific work is an especially challenging and important demand for young surgeons.

Plastic surgeons in all previous decades have made strong efforts to understand and further develop guidelines and principles - that remain applicable until today - in order to maximize the success of their treatments. Lately, an upcoming body of literature is dedicated to tissue engineering, cell therapy and even ex-vivo autologous cell expansion that are already in clinical use in burn surgery. Such treatment options offer new perspectives to modern, regenerative surgery and the necessity and opportunity to gain in-depth knowledge about cellular processes and interactions taking place in tissues. A new and exciting challenge for contemporary surgeons is now to adjust and adapt the fundamental principles that have been defined by their predecessors to match new therapies, options and treatments.

The earliest known principles of plastic and reconstructive surgery have been attributed to the French surgeon Ambrose Paré (126), who published his “five basic principles of plastic surgery” in 1564. As a pioneer of modern plastic surgery, Sir Harold Gillies (127) later build upon Paré’s early ideas and he took his principles to the next level. Recognizing that the restoring of human tissues is an especially challenging discipline of modern surgery, Gillies and his pupil Millard defined as their interesting and surprisingly fundamental central principle that “plastic surgery is a constant battle between blood supply and beauty.” The reshaping of human structures requires the fact that the vitality and integrity of living tissue have to be respected by any surgical and medical treatment. This principle clearly underlines the absolutely essential knowledge of cell and tissue physiology and is the first than can easily be translated to match new therapies in plastic surgery.

As a student of Sir Harold Gillies, Millard produced one of the most widely known efforts to outline and further define the principles of reconstructive surgery. In 1950, Millard drafted the rules that he had learned from Gillies troughout the years and published them entitled the “ten commandments” of plastic surgery. Nowadays, the work is widely known as the “Gillie’s principles” and teaches young plastic surgeons the deferential contact and respectful handling of human tissues. Also, the work of Gillies and Millard does apply to every single sector of translational research nowadays and medicine and it is particularly valuable to the youngest surgeons that do (and do have to) focus on clinical and scientific work - moreover, the principles teach a refined and targeted approach to both fields and allow the fusion of both worlds although they were originally thought and dedicated to be of use in clinical surgery.

5.2.Big story short - A brief history and the fundamentals of tissue engineering

Back in 1858, Virchow in Berlin was the first to describe that cells arise from pre-existing cells postulating his famous sentence „Omnis cellula e cellula“ – herein, the previous hypothesis of spontaneous regeneration of cells and tissues was falsified (128). This is nowadays considered the foundation of fundamental research on cell and tissue physiology. The German surgeon and pioneer in skin grafting Thiersch was the first to discover the potency of granulation tissue in wound healing. He described the technique of split thickness skin grafting to accelerate healing of chronical wounds which is also referred to as „Thiersch grafting“ (129, 130). This was an important milestone in regenerative surgery and also the first step towards modern tissue engineering approaches.

In 1897, Leon Loeb, who had been seeking a career in experimental medicine from the very beginning of his studies, published his findings about growing (tumor) cells in vitro (131) and he herein preceded many scientists in different sectors of basic research around the world. About one hundred years later, cell culture techniques were well established and interest was directed towards the growing and culturing of distinct cells lines. With the discovery of the enzyme trypsin in 1916 (132) that enabled scientists to create cell suspensions that could be evenly plated, and the acquirement of improved knowledge about cell culture medium and requirements of different cell types, in vitro research was experiencing a sudden boom.

The first known established cell line can be dated back to 1957, when HeLa cells were published to have been cultured in a novel medium containing calf serum (133). However, the raising and beginning of modern tissue engineering is dated 1998, when the development of stem cell lines and the isolation primary cells were implemented in the first place (134, 135). The biggest problems arising from these attempts were primarily concerning the cultivation and expansion of autologous and allogeneic differentiated cells due to natural senescence (136) and largely unknown special medium supplement requirements (137-140). Until today, researchers around the world work hard to study signaling pathways and cascades involved in cell proliferation and differentiation in order to develop techniques to influence cell physiology in vitro.

The four components that are the crucial factors in tissue engineering are cells, the surrounding extracellular matrix, bioreactors, as well as para-/endocrine substances (growth factors and cytokines) (141, 142). The ideal conditions also involve the creation of a suitable biochemical and biomechanical microenvironment in the matrix scaffold (143-145). For the

61 use in the human body, a cell filled scaffold should be inert, biodegradable and should not provoke foreign body reactions (145). To become integrated, blood vessels should be able to grow in from the surrounding tissues easily, and an adequate level of growth factors and cytokines must be provided within the establishing graft (146). In this processes, the scaffold is biodegraded while cells proliferate, differentiate and invade and populate the scaffold (147). Finally, the scaffold itself dissolves being fully replaced and the newly established tissue starts functioning (148).

Progenitor cells with the ability to differentiate into multiple cell types are of particular interest, because every tissue consists of different cell types. Stem cells are also characterized through being able to recreate themselves and therefore, maintain their own population. They can be isolated from any human being e.g. embryo, fetus, or an adult. While the use of embryonic stem cells in medicine is very controversial due to ethical reasons and conflicts, adult stem cells such as ASC of MSC are of broad use and interest as the can easily be obtained from the readily available fat tissue (ASC) and peripheral blood (PBMSC) of adult donors (149).

Cell growth to form a tissue is strongly depending from a supporting matrix or scaffold. It consists of structural proteins (150, 151), proteoglycans (152), hyaluronic acid (153, 154); and the interacting adhesive proteins that mediate cell-matrix-interactions such as the integrins that are dealt with in this work (155-158). The type of extracellular matrix is moreover depended from tissue type and specialization as it is able to influence stem cell fate and physiological processes (differentiation, proliferation, migration, …).

Cells are furthermore surrounded by their very own microenvironment and niche which is partly produced and built by the cells themselves after adherence to the scaffold (159, 160). Depending from their differentiation state, cells start to express different adhesion molecules or change their adhesion molecule expression pattern as the extracellular matrix of terminally differentiated cells is quite different to the niche of undifferentiated progenitor cells (161- 163). This is necessary for adhesion and to establish cell-cell-contacts as well as cell-matrix- contracts in the microenvironment and it is vice versa guiding stem cell fate which is partly depending from outside-in (and inside-out) signaling transmitted through specific adhesion molecules and other receptors (164-166).

On the other hand, the function of the tissue is determined by the amount of proteoglycans and hyaluronic acid depending from the availability of extracellular space and mechanical

62 forces and demands. Proteoglycans and glycosaminoglycans are able to bind growth factors, thus preventing their degradation by extracellular proteases.

In tissue engineering and regenerative medicine, a main focus remains on developing artificial matrices and scaffolds (163). A bioreactor is a system needed in order to mimic and reproduce physiological conditions in order to maintain cell proliferation for tissue regeneration. Parameters such as temperature, pH, pO2, biochemical gradients, and mechanical impacts have to be continuously controlled during the maturation period and should match the in vivo conditions as exact as possible in order to allow undisturbed and stable tissue growth (167).

Cytokines and growth factors are polypeptides and small molecules that initiate cell-specific responses by binding to their specific receptors but are not necessarily cell type specific. They usually circulate in the blood as inactive precursors that need to be transformed to their active form and then bound to the specific receptor to excert influence on cells and cell fate. By binding to their specific receptor, cytokines activate signal transduction cascades, eventually effecting changes in gene expression and therefore, mediating cellular responses which can consist of changes in expression of membrane proteins, stimulated or decreased secretion of molecules, proliferation or other physiologic cell functions.

E.g., TGF-β, epidermal growth factor (EGF), fibroblast growth factor (FGF) and platelet- derived growth factor (PDGF) are considered major actors in wound healing processes (168). They are not only of interest in basic sciences, but their effects also do form the scientific basis of newly established therapy approaches such as platelet rich plasma application in plastic and reconstructive surgery. EGF stimulates proliferation and migration of keratinocytes (169) in vitro and regeneration of epidermal cells and tissue (170, 171) also referred to as „epithelialization“ in vivo. EGF has been applied to dressings in order to enhance and accelerate epidermal regeneration in partial-thickness wounds and second- degree burns.

This application is of special interest in patient with limited autologous donor sites due to large wound surfaces. Fibroblast growth factor (FGF) on the other hand acts mainly on fibroblasts and the protein family comprises specific 20 subtypes of FGF. For example, FGF- β is known as a potent stimulator of endothelial cells that can contribute to the induction of angiogenesis. Platelet-derived growth factor (PDGF) attracts various cell types to the wound, including fibroblasts, myofibroblasts, neutrophils, and macrophages. It also stimulates secretion of growth factors by macrophages and the production of extracellular matrix

63 constituents, such as fibronectin, hyaluronic acid, various subtypes of collagen, and proteoglycans. It induces the remodeling phase of wound healing by stimulating the secretion of collagenase by fibroblasts and therefore contributes to tissue remodeling and scar strength by strongly supporting the replacement of collagen type III with collagen type I. In regenerative medicine, recombinant PDGF has been applied therapeutically to chronic diabetic ulcers (172-174). The TGF-β family does include more than 40 isoform members and they are secreted ubiquitary in the body. In contrast to the other growth factors mentioned above TGF-β must be activated in order to bind to its receptor (175). It was shown, that addition of TGF-β in a collagen scaffold resulted in faster epithelialization (176-178) in full- thickness skin defects. A branch of regenerative research focuses on the development of new delivery systems for cytokines and growth factors.

Tissue-engineered products can be classified as acellular or cellular which is from a juridical and medical point of view of importance for the application in clinical studies and the approval by the relevant authority for medicinal products. Acellular products do not contain cells and consist of a matrix that exerts its function by being integrated into the host tissues by matrix-host cell interactions (179, 180). The matrix must allow host cells to infiltrate and must also be biodegradable (181, 182). Incorporated growth factors carry out their specific functions by stimulating host cells to enhanced healing. Furthermore, the matrix ideally contains more than one ECM-protein aiming to simulate properties of the target tissue (183). However, cellular products do also contain living cells, such as fibroblasts and keratinocytes that are embedded in a carrier scaffold (184-186). Autologous cells should be obtained and used to minimize the risk of rejection. All such products are and must be overseen by strict monitoring processes.

Future developments will provide more insight into the very complex interactions of natural and of bioengineered tissues consisting of cytokines, cells and the extracellular matrix. As quite little is known about the influence of ECM constituents and properties on cell physiology, further investigations in order to control cell expansion and directed cell differentiation in vitro and in vivo are required.

5.3.Lipografting: an excellent example of translational application of scientific knowledge in clinical plastic surgery

In modern regenerative medicine -particularly in translational applications- exerting influence on cell viability and differentiation is of especially great interest. As reconstructing complex soft tissue defects still remains a clinical challenge, different techniques for restoration of large tissue defects, including extracellular matrix scaffolds and the application of ASC have been suggested in literature and do define a largely investigated field in preclinical research. A simple example of autologous tissue transfer, which does benefit from knowledge about how to exert influence on cells in order to improve wound healing, is the clinically well- established technique of free fat grafting - but the principal attempts are also applicable to various tissue engineering techniques that still remain largely experimental. However, knowledge about possible external influence on ASC physiology as well as clinical experience in this field is still limited. On the other hand, fat grafting is a common and widely accepted technique in plastic surgery. Its broad application profits by low complication rates, high patient satisfaction and good results (187). Also, the donor site morbidity is low because subcutaneous fat tissue is easily accessible and -in most cases- largely available. Survival of the free fat graft is largely dependent on local oxygen diffusion, pressure and shear stress (188, 189) in the wound bed or the grafting area. Despite the volume restoring effect, additional benefits like improvement of scar appearance and microcirculation of surrounding tissues have been described (190, 191).

The latest literature also describes attempts to improve nerve regeneration using fat tissue or ASC (192, 193). Adipose-derived mesenchymal stem cells have already been shown to stimulate axonal outgrowth from the proximal nerve stump in a rat sciatic nerve model (194), and regenerative effects such as remodeling of the extracellular matrix and stimulation of neoangiogenesis are mainly mediated by growth factors that are released from the grafted cells into the fresh wound bed via paracrine secretion (195). Research groups from other medical disciplines also showed beneficial effects of ASC on the healing of Crohn’s fistulae (196), chondroprotective and anti-inflammatory impact in osteoarthritis (197) and in a rat myocardial infarction model a functional improvement of cardiac function after application of ASC could be demonstrated (198).

However, the main indication for fat grafting in plastic surgery still remains the basic restoration of volume despite a broad panel of indications that have been suggested in literature. Most of the initial studies employing autologous adipose derived stem cells transfer 65 to repair soft tissue defects were encouraging - however, increased cell death and senescence of transplanted ASC often impaired long term effects. To overcome problems derived from poor take rates and survival of the grafted cells, basic research is employed to determine ECM substrates, environmental factors and mechanical cues that are responsible for ASC survival, proliferation and differentiation.

In order to further enhance knowledge about possible external influence on stem cell fate that is of use in the applications of ASC, the author together with the PI of the study and the head of our clinical department conducted the work in hand. The group will be planning on further studies into the field of integrin receptors, adipose derived stem cells, the extracellular matrix and the niche of ASC.

6. Personal acknowledgements

I herein want to thank my husband Johannes whom I dedicated this work to, for going through the years in the PhD program with me and for being there since I first met him.

Furthermore, I am deeply thankful to my parents and my younger sister for providing every emotional and financial support I could ever ask for.

I thank Prof. Gerhard Pierer for giving me the opportunity to earn a PhD under his support and motivation, and Christian Ploner for the supervision.

I thank my colleagues at the Department of Plastic, Reconstructive and Aesthetic surgery for accepting my absences due to PhD program obligations, for filling in for me and for teaching me surgery. Special thanks here apply for my former fellow PhD student Ralph Verstappen who sadly went abroad in the meantime and can never be replaced as a colleague.

Last but not least I am very thankful to Susanne Lobenwein for excellent technical assistance, for a good time together in the lab and for teaching me every technique I needed to conduct the experiments for this study.

The entire team of the Plastic surgery lab thanks J. Dobner for preparing protein lysates from adipocytes, F. Santer, M. Puhr, H. Klocker from the nearby Urology lab for kindly providing antibodies, constructive discussions and advice. We also thank M. Ausserlechner for providing plasmids, and R. Sigl and D. Bernhard for advice and repetitive critical reading of the manuscript. We thank C. Linhart for tips, tricks and support in the performance of statistic analysis.

7. Funding statement

This work was supported by the intramural funding program of the Medical University of Innsbruck for young scientists MUI-START, Project ST2010012010 and by the County of Tyrol translational research grant #273-01-14. None of the funders did participate in study design, data collection and analysis, preparation or publication of the manuscript.

8. Conflicts of interest

Neither the author of this doctoral thesis nor the co-authors of the publication have conflicts of interest to declare.

9. Personal contribution

As the author of the thesis in hand, I conducted the experiments, data analysis and created the figures with exception of the heatmap. Furthermore, I wrote the manuscript of the paper and the work in hand. Of course, I am grateful to all people listed above (6.) who teached and supported me throughout all the way and who were of great help in conducting the work in hand.

10. Abstract

The fate of human adipose tissue stem cells (ASC) is largely determined by biochemical and mechanical cues from the extracellular matrix (ECM), which are sensed and transmitted by integrins. It is well known that specific ECM constituents influence ASC proliferation and differentiation. Nevertheless, knowledge on how individual integrins regulate distinct processes is still limited. We performed gene profiling of 18 alpha integrins in sorted ASC and adipocytes, identifying downregulations of RGD-motif binding integrins integrin-alpha-V (ITGAV) and integrin-alpha-5 (ITGA5), upregulation of laminin binding and leukocyte- specific integrins and individual regulations of collagen and LDV-receptors in differentiated adipocytes in-vivo. Gene function analyses in in-vitro cultured ASC unraveled differential functions of ITGA5 and ITGAV. Knockdown of ITGAV, but not ITGA5 reduced proliferation, caused p21(Cip1) induction, repression of survivin and specific regulation of Hippo pathway mediator TAZ. Gene knockdown of both integrins promoted adipogenic differentiation, while transgenic expression impaired adipogenesis. Inhibition of ITGAV using cilengitide resulted in a similar phenotype, mimicking loss of pan-ITGAV expression using RNAi. Herein we show ASC specific integrin expression patterns and demonstrate distinct regulating roles of both integrins in human ASC and adipocyte physiology suggesting a negative impact of RDG-motif signaling on adipogenic differentiation of ASC via ITGA5 and ITGAV.

The original paper containing this work has been accepted for publication

in the open access online journal Scientific Reports on 09.06.2016 and was published on 01.07.2016.

11. References

1. Baglioni S, Francalanci M, Squecco R, Lombardi A, Cantini G, Angeli R, et al. Characterization of human adult stem-cell populations isolated from visceral and subcutaneous adipose tissue. FASEB journal : official publication of the Federation of American Societies for Experimental Biology. 2009;23(10):3494-505. 2. Guilak F, Cohen DM, Estes BT, Gimble JM, Liedtke W, Chen CS. Control of stem cell fate by physical interactions with the extracellular matrix. Cell Stem Cell. 2009;5(1):17- 26. 3. Engler AJ, Sen S, Sweeney HL, Discher DE. Matrix elasticity directs stem cell lineage specification. Cell. 2006;126(4):677-89. 4. Lin HY, Tsai CC, Chen LL, Chiou SH, Wang YJ, Hung SC. Fibronectin and laminin promote differentiation of human mesenchymal stem cells into insulin producing cells through activating Akt and ERK. J Biomed Sci. 2010;17:56. 5. Kaewsuwan S, Song SY, Kim JH, Sung JH. Mimicking the functional niche of adipose-derived stem cells for regenerative medicine. Expert Opin Biol Ther. 2012;12(12):1575-88. 6. Yang YI, Kim HI, Choi MY, Son SH, Seo MJ, Seo JY, et al. Ex vivo organ culture of adipose tissue for in situ mobilization of adipose-derived stem cells and defining the stem cell niche. J Cell Physiol. 2010;224(3):807-16. 7. Hu P, Luo BH. Integrin bi-directional signaling across the plasma membrane. J Cell Physiol. 2013;228(2):306-12. 8. Takagi J. Structural basis for ligand recognition by integrins. Curr Opin Cell Biol. 2007;19(5):557-64. 9. Hynes RO. Integrins: versatility, modulation, and signaling in cell adhesion. Cell. 1992;69(1):11-25. 10. Legate KR, Wickstrom SA, Fassler R. Genetic and cell biological analysis of integrin outside-in signaling. Genes Dev. 2009;23(4):397-418. 11. Dedhar S. Integrins and signal transduction. Curr Opin Hematol. 1999;6(1):37-43. 12. Zhou M, Brown EJ. Leukocyte response integrin and integrin-associated protein act as a signal transduction unit in generation of a phagocyte respiratory burst. J Exp Med. 1993;178(4):1165-74. 13. Kolanus W, Nagel W, Schiller B, Zeitlmann L, Godar S, Stockinger H, et al. Alpha L beta 2 integrin/LFA-1 binding to ICAM-1 induced by cytohesin-1, a cytoplasmic regulatory molecule. Cell. 1996;86(2):233-42. 70

14. Coppolino M, Leung-Hagesteijn C, Dedhar S, Wilkins J. Inducible interaction of integrin alpha 2 beta 1 with calreticulin. Dependence on the activation state of the integrin. J Biol Chem. 1995;270(39):23132-8. 15. Hynes RO. Integrins: bidirectional, allosteric signaling machines. Cell. 2002;110(6):673-87. 16. Selvarajan S, Lund LR, Takeuchi T, Craik CS, Werb Z. A plasma kallikrein- dependent plasminogen cascade required for adipocyte differentiation. Nat Cell Biol. 2001;3(3):267-75. 17. Zhong C, Chrzanowska-Wodnicka M, Brown J, Shaub A, Belkin AM, Burridge K. Rho-mediated contractility exposes a cryptic site in fibronectin and induces fibronectin matrix assembly. J Cell Biol. 1998;141(2):539-51. 18. Frith JE, Mills RJ, Hudson JE, Cooper-White JJ. Tailored integrin-extracellular matrix interactions to direct human mesenchymal stem cell differentiation. Stem Cells Dev. 2012;21(13):2442-56. 19. Schwab EH, Halbig M, Glenske K, Wagner AS, Wenisch S, Cavalcanti-Adam EA. Distinct effects of RGD-glycoproteins on Integrin-mediated adhesion and osteogenic differentiation of human mesenchymal stem cells. Int J Med Sci. 2013;10(13):1846-59. 20. Calderwood DA, Fujioka Y, de Pereda JM, Garcia-Alvarez B, Nakamoto T, Margolis B, et al. Integrin beta cytoplasmic domain interactions with phosphotyrosine-binding domains: a structural prototype for diversity in integrin signaling. Proceedings of the National Academy of Sciences of the United States of America. 2003;100(5):2272-7. 21. Hughes PE, Renshaw MW, Pfaff M, Forsyth J, Keivens VM, Schwartz MA, et al. Suppression of integrin activation: a novel function of a Ras/Raf-initiated MAP kinase pathway. Cell. 1997;88(4):521-30. 22. Humphries JD, Byron A, Humphries MJ. Integrin ligands at a glance. J Cell Sci. 2006;119(Pt 19):3901-3. 23. Harburger DS, Calderwood DA. Integrin signalling at a glance. J Cell Sci. 2009;122(Pt 2):159-63. 24. Giannone G, Sheetz MP. Substrate rigidity and force define form through tyrosine phosphatase and kinase pathways. Trends Cell Biol. 2006;16(4):213-23. 25. Stephens LE, Sutherland AE, Klimanskaya IV, Andrieux A, Meneses J, Pedersen RA, et al. Deletion of beta 1 integrins in mice results in inner cell mass failure and peri- implantation lethality. Genes Dev. 1995;9(15):1883-95.

26. Fassler R, Meyer M. Consequences of lack of beta 1 integrin gene expression in mice. Genes Dev. 1995;9(15):1896-908. 27. Fassler R, Pfaff M, Murphy J, Noegel AA, Johansson S, Timpl R, et al. Lack of beta 1 integrin gene in embryonic stem cells affects morphology, adhesion, and migration but not integration into the inner cell mass of blastocysts. J Cell Biol. 1995;128(5):979-88. 28. Sheppard D. In vivo functions of integrins: lessons from null mutations in mice. Matrix Biol. 2000;19(3):203-9. 29. Yang JT, Rayburn H, Hynes RO. Cell adhesion events mediated by alpha 4 integrins are essential in placental and cardiac development. Development. 1995;121(2):549-60. 30. Gurtner GC, Davis V, Li H, McCoy MJ, Sharpe A, Cybulsky MI. Targeted disruption of the murine VCAM1 gene: essential role of VCAM-1 in chorioallantoic fusion and placentation. Genes Dev. 1995;9(1):1-14. 31. Kwee L, Baldwin HS, Shen HM, Stewart CL, Buck C, Buck CA, et al. Defective development of the embryonic and extraembryonic circulatory systems in vascular cell adhesion molecule (VCAM-1) deficient mice. Development. 1995;121(2):489-503. 32. Gardner H, Kreidberg J, Koteliansky V, Jaenisch R. Deletion of integrin alpha 1 by homologous recombination permits normal murine development but gives rise to a specific deficit in cell adhesion. Dev Biol. 1996;175(2):301-13. 33. Pozzi A, Wary KK, Giancotti FG, Gardner HA. Integrin alpha1beta1 mediates a unique collagen-dependent proliferation pathway in vivo. J Cell Biol. 1998;142(2):587-94. 34. Georges-Labouesse E, Messaddeq N, Yehia G, Cadalbert L, Dierich A, Le Meur M. Absence of integrin alpha 6 leads to epidermolysis bullosa and neonatal death in mice. Nat Genet. 1996;13(3):370-3. 35. Dowling J, Yu QC, Fuchs E. Beta4 integrin is required for hemidesmosome formation, cell adhesion and cell survival. J Cell Biol. 1996;134(2):559-72. 36. Niessen CM, van der Raaij-Helmer MH, Hulsman EH, van der Neut R, Jonkman MF, Sonnenberg A. Deficiency of the integrin beta 4 subunit in junctional epidermolysis bullosa with pyloric atresia: consequences for hemidesmosome formation and adhesion properties. J Cell Sci. 1996;109 ( Pt 7):1695-706. 37. Bader BL, Rayburn H, Crowley D, Hynes RO. Extensive vasculogenesis, angiogenesis, and organogenesis precede lethality in mice lacking all alpha v integrins. Cell. 1998;95(4):507-19.

38. Wang JT, Liu Y, Kan X, Liu M, Lu JG. Cilengitide, a small molecule antagonist, targeted to integrin alphanu inhibits proliferation and induces apoptosis of laryngeal cancer cells in vitro. Eur Arch Otorhinolaryngol. 2014;271(8):2233-40. 39. Spiegelman BM, Ginty CA. Fibronectin modulation of cell shape and lipogenic gene expression in 3T3-adipocytes. Cell. 1983;35(3 Pt 2):657-66. 40. Talior-Volodarsky I, Connelly KA, Arora PD, Gullberg D, McCulloch CA. alpha11 integrin stimulates myofibroblast differentiation in diabetic cardiomyopathy. Cardiovascular research. 2012;96(2):265-75. 41. George EL, Georges-Labouesse EN, Patel-King RS, Rayburn H, Hynes RO. Defects in mesoderm, neural tube and vascular development in mouse embryos lacking fibronectin. Development. 1993;119(4):1079-91. 42. Antras J, Hilliou F, Redziniak G, Pairault J. Decreased biosynthesis of actin and cellular fibronectin during adipose conversion of 3T3-F442A cells. Reorganization of the cytoarchitecture and extracellular matrix fibronectin. Biology of the cell / under the auspices of the European Cell Biology Organization. 1989;66(3):247-54. 43. Kamiya S, Kato R, Wakabayashi M, Tohyama T, Enami I, Ueki M, et al. Fibronectin peptides derived from two distinct regions stimulate adipocyte differentiation by preventing fibronectin matrix assembly. Biochemistry. 2002;41(9):3270-7. 44. Johansson S, Svineng G, Wennerberg K, Armulik A, Lohikangas L. Fibronectin- integrin interactions. Frontiers in bioscience : a journal and virtual library. 1997;2:d126-46. 45. Lowell JR, McLarty JW. Factors relating to recurrence of chronic pulmonary histoplasmosis following treatment with amphotericin B. The American journal of the medical sciences. 1983;285(1):13-23. 46. Martino MM, Mochizuki M, Rothenfluh DA, Rempel SA, Hubbell JA, Barker TH. Controlling integrin specificity and stem cell differentiation in 2D and 3D environments through regulation of fibronectin domain stability. Biomaterials. 2009;30(6):1089-97. 47. Wang Y, Zhao L, Smas C, Sul HS. Pref-1 interacts with fibronectin to inhibit adipocyte differentiation. Mol Cell Biol. 2010;30(14):3480-92. 48. Kubo Y, Kaidzu S, Nakajima I, Takenouchi K, Nakamura F. Organization of extracellular matrix components during differentiation of adipocytes in long-term culture. In vitro cellular & developmental biology Animal. 2000;36(1):38-44. 49. Varner JA, Brooks PC, Cheresh DA. REVIEW: the integrin alpha V beta 3: angiogenesis and apoptosis. Cell adhesion and communication. 1995;3(4):367-74.

50. Lu JG, Li Y, Li L, Kan X. Overexpression of osteopontin and integrin alphav in laryngeal and hypopharyngeal carcinomas associated with differentiation and metastasis. Journal of cancer research and clinical oncology. 2011;137(11):1613-8. 51. Varner JA, Cheresh DA. Integrins and cancer. Curr Opin Cell Biol. 1996;8(5):724-30. 52. Bunnell BA, Flaat M, Gagliardi C, Patel B, Ripoll C. Adipose-derived stem cells: isolation, expansion and differentiation. Methods. 2008;45(2):115-20. 53. Skurk T, Ecklebe S, Hauner H. A novel technique to propagate primary human preadipocytes without loss of differentiation capacity. Obesity (Silver Spring). 2007;15(12):2925-31. 54. Zwierzina ME, Ejaz A, Bitsche M, Blumer MJ, Mitterberger MC, Mattesich M, et al. Characterization of DLK1(PREF1)(+)/CD34(+) cells in vascular stroma of human white adipose tissue. Stem cell research. 2015;15(2):403-18. 55. Gloeckner H, Jonuleit T, Lemke HD. Monitoring of cell viability and cell growth in a hollow-fiber bioreactor by use of the dye Alamar Blue. Journal of immunological methods. 2001;252(1-2):131-8. 56. Graham FL, van der Eb AJ. A new technique for the assay of infectivity of human adenovirus 5 DNA. Virology. 1973;52(2):456-67. 57. Sigl R, Ploner C, Shivalingaiah G, Kofler R, Geley S. Development of a multipurpose GATEWAY-based lentiviral tetracycline-regulated conditional RNAi system (GLTR). PLoS One. 2014;9(5):e97764. 58. Takagi J, Petre BM, Walz T, Springer TA. Global conformational rearrangements in integrin extracellular domains in outside-in and inside-out signaling. Cell. 2002;110(5):599- 11. 59. Ploner C, Rainer J, Niederegger H, Eduardoff M, Villunger A, Geley S, et al. The BCL2 rheostat in glucocorticoid-induced apoptosis of acute lymphoblastic leukemia. Leukemia. 2008;22(2):370-7. 60. Laukaitis CM, Webb DJ, Donais K, Horwitz AF. Differential dynamics of alpha 5 integrin, paxillin, and alpha-actinin during formation and disassembly of adhesions in migrating cells. J Cell Biol. 2001;153(7):1427-40. 61. Hagenbuchner J, Kuznetsov AV, Obexer P, Ausserlechner MJ. BIRC5/Survivin enhances aerobic glycolysis and drug resistance by altered regulation of the mitochondrial fusion/fission machinery. Oncogene. 2013;32(40):4748-57.

62. Fink T, Lund P, Pilgaard L, Rasmussen JG, Duroux M, Zachar V. Instability of standard PCR reference genes in adipose-derived stem cells during propagation, differentiation and hypoxic exposure. BMC Mol Biol. 2008;9:98. 63. Rivero-Gutierrez B, Anzola A, Martinez-Augustin O, de Medina FS. Stain-free detection as loading control alternative to Ponceau and housekeeping protein immunodetection in Western blotting. Analytical biochemistry. 2014;467:1-3. 64. Vansteenkiste J, Barlesi F, Waller CF, Bennouna J, Gridelli C, Goekkurt E, et al. Cilengitide combined with cetuximab and platinum-based chemotherapy as first-line treatment in advanced non-small-cell lung cancer (NSCLC) patients: results of an open-label, randomized, controlled phase II study (CERTO). Annals of oncology : official journal of the European Society for Medical Oncology / ESMO. 2015;26(8):1734-40. 65. Desgrosellier JS, Cheresh DA. Integrins in cancer: biological implications and therapeutic opportunities. Nat Rev Cancer. 2010;10(1):9-22. 66. Carter A. Integrins as target: first phase III trial launches, but questions remain. J Natl Cancer Inst. 2010;102(10):675-7. 67. Fernyhough ME, Vierck JL, Hausman GJ, Mir PS, Okine EK, Dodson MV. Primary adipocyte culture: adipocyte purification methods may lead to a new understanding of adipose tissue growth and development. Cytotechnology. 2004;46(2-3):163-72. 68. Arpaia E, Blaser H, Quintela-Fandino M, Duncan G, Leong HS, Ablack A, et al. The interaction between caveolin-1 and Rho-GTPases promotes metastasis by controlling the expression of alpha5-integrin and the activation of Src, Ras and Erk. Oncogene. 2012;31(7):884-96. 69. Jindra PT, Jin YP, Jacamo R, Rozengurt E, Reed EF. MHC class I and integrin ligation induce ERK activation via an mTORC2-dependent pathway. Biochem Biophys Res Commun. 2008;369(2):781-7. 70. Armulik A, Velling T, Johansson S. The integrin beta1 subunit transmembrane domain regulates phosphatidylinositol 3-kinase-dependent tyrosine phosphorylation of Crk-associated substrate. Molecular biology of the cell. 2004;15(6):2558-67. 71. Zeller KS, Idevall-Hagren O, Stefansson A, Velling T, Jackson SP, Downward J, et al. PI3-kinase p110alpha mediates beta1 integrin-induced Akt activation and membrane protrusion during cell attachment and initial spreading. Cell Signal. 2010;22(12):1838-48. 72. Fischer M, Quaas M, Nickel A, Engeland K. Indirect p53-dependent transcriptional repression of Survivin, CDC25C, and PLK1 genes requires the cyclin-dependent kinase

75 inhibitor p21/CDKN1A and CDE/CHR promoter sites binding the DREAM complex. Oncotarget. 2015. 73. Li Y, Liu D, Zhou Y, Li Y, Xie J, Lee RJ, et al. Silencing of Survivin Expression Leads to Reduced Proliferation and Cell Cycle Arrest in Cancer Cells. J Cancer. 2015;6(11):1187-94. 74. Coleman ML, Densham RM, Croft DR, Olson MF. Stability of p21Waf1/Cip1 CDK inhibitor protein is responsive to RhoA-mediated regulation of the actin cytoskeleton. Oncogene. 2006;25(19):2708-16. 75. Ryan KM, Phillips AC, Vousden KH. Regulation and function of the p53 tumor suppressor protein. Curr Opin Cell Biol. 2001;13(3):332-7. 76. Liu J, DeYoung SM, Zhang M, Zhang M, Cheng A, Saltiel AR. Changes in integrin expression during adipocyte differentiation. Cell Metab. 2005;2(3):165-77. 77. Hou L, Liu T, Wang J. Isoflurane suppresses the self-renewal of normal mouse neural stem cells in a p53-dependent manner by activating the Lkb1-p53-p21 signalling pathway. Mol Med Rep. 2015;12(5):7412-8. 78. Yamada S, Bu XY, Khankaldyyan V, Gonzales-Gomez I, McComb JG, Laug WE. Effect of the angiogenesis inhibitor Cilengitide (EMD 121974) on glioblastoma growth in nude mice. Neurosurgery. 2006;59(6):1304-12; discussion 12. 79. Idbaih A, Ducray F, Sierra Del Rio M, Hoang-Xuan K, Delattre JY. Therapeutic application of noncytotoxic molecular targeted therapy in gliomas: growth factor receptors and angiogenesis inhibitors. Oncologist. 2008;13(9):978-92. 80. Stupp R, Hegi ME, Gorlia T, Erridge SC, Perry J, Hong YK, et al. Cilengitide combined with standard treatment for patients with newly diagnosed glioblastoma with methylated MGMT promoter (CENTRIC EORTC 26071-22072 study): a multicentre, randomised, open-label, phase 3 trial. The Lancet Oncology. 2014;15(10):1100-8. 81. Khasraw M, Ameratunga MS, Grant R, Wheeler H, Pavlakis N. Antiangiogenic therapy for high-grade glioma. The Cochrane database of systematic reviews. 2014;9:CD008218. 82. Noro A, Sillat T, Virtanen I, Ingerpuu S, Back N, Konttinen YT, et al. Laminin production and basement membrane deposition by mesenchymal stem cells upon adipogenic differentiation. J Histochem Cytochem. 2013;61(10):719-30. 83. Sun Z, Lambacher A, Fassler R. Nascent adhesions: from fluctuations to a hierarchical organization. Curr Biol. 2014;24(17):R801-3.

84. Denadai MV, Viana LS, Affonso RJ, Jr., Silva SR, Oliveira ID, Toledo SR, et al. Expression of integrin genes and proteins in progression and dissemination of colorectal adenocarcinoma. BMC Clin Pathol. 2013;13:16. 85. Wang Z, Jinnin M, Kobayashi Y, Kudo H, Inoue K, Nakayama W, et al. Mice overexpressing integrin alphav in fibroblasts exhibit dermal thinning of the skin. J Dermatol Sci. 2015;79(3):268-78. 86. Nisato RE, Tille JC, Jonczyk A, Goodman SL, Pepper MS. alphav beta 3 and alphav beta 5 integrin antagonists inhibit angiogenesis in vitro. Angiogenesis. 2003;6(2):105-19. 87. Tomlinson RE, Schmieder AH, Quirk JD, Lanza GM, Silva MJ. Antagonizing the alphav beta3 integrin inhibits angiogenesis and impairs woven but not lamellar bone formation induced by mechanical loading. Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research. 2014;29(9):1970-80. 88. Almokadem S, Belani CP. Volociximab in cancer. Expert Opin Biol Ther. 2012;12(2):251-7. 89. Schiller HB, Hermann MR, Polleux J, Vignaud T, Zanivan S, Friedel CC, et al. beta1- and alphav-class integrins cooperate to regulate myosin II during rigidity sensing of fibronectin-based microenvironments. Nat Cell Biol. 2013;15(6):625-36. 90. Adams JC, Watt FM. Changes in keratinocyte adhesion during terminal differentiation: reduction in fibronectin binding precedes alpha 5 beta 1 integrin loss from the cell surface. Cell. 1990;63(2):425-35. 91. Mittal A, Pulina M, Hou SY, Astrof S. Fibronectin and integrin alpha 5 play requisite roles in cardiac morphogenesis. Dev Biol. 2013;381(1):73-82. 92. Trottier V, Marceau-Fortier G, Germain L, Vincent C, Fradette J. IFATS collection: Using human adipose-derived stem/stromal cells for the production of new skin substitutes. Stem Cells. 2008;26(10):2713-23. 93. Stenzel D, Lundkvist A, Sauvaget D, Busse M, Graupera M, van der Flier A, et al. Integrin-dependent and -independent functions of astrocytic fibronectin in retinal angiogenesis. Development. 2011;138(20):4451-63. 94. Missirlis D, Haraszti T, Scheele C, Wiegand T, Diaz C, Neubauer S, et al. Substrate engagement of integrins alpha5beta1 and alphavbeta3 is necessary, but not sufficient, for high directional persistence in migration on fibronectin. Sci Rep. 2016;6:23258. 95. Heisenberg CP, Fassler R. Cell-cell adhesion and extracellular matrix: diversity counts. Curr Opin Cell Biol. 2012;24(5):559-61.

96. Dupont S. Role of YAP/TAZ in cell-matrix adhesion-mediated signalling and mechanotransduction. Experimental cell research. 2015. 97. Dupont S, Morsut L, Aragona M, Enzo E, Giulitti S, Cordenonsi M, et al. Role of YAP/TAZ in mechanotransduction. Nature. 2011;474(7350):179-83. 98. Zhao B, Li L, Wang L, Wang CY, Yu J, Guan KL. Cell detachment activates the Hippo pathway via cytoskeleton reorganization to induce anoikis. Genes Dev. 2012;26(1):54- 68. 99. Yu FX, Zhao B, Guan KL. Hippo Pathway in Organ Size Control, Tissue Homeostasis, and Cancer. Cell. 2015;163(4):811-28. 100. Duperret EK, Dahal A, Ridky TW. Focal-adhesion-independent integrin-alphav regulation of FAK and c-Myc is necessary for 3D skin formation and tumor invasion. J Cell Sci. 2015;128(21):3997-4013. 101. Hall MD, Flickinger KS, Cutolo M, Zardi L, Culp LA. Adhesion of human dermal reticular fibroblasts on complementary fragments of fibronectin: aging in vivo or in vitro. Experimental cell research. 1988;179(1):115-36. 102. Han MY, Kosako H, Watanabe T, Hattori S. Extracellular signal-regulated kinase/mitogen-activated protein kinase regulates actin organization and cell motility by phosphorylating the actin cross-linking protein EPLIN. Mol Cell Biol. 2007;27(23):8190-204. 103. Nordenfelt P, Elliott HL, Springer TA. Coordinated integrin activation by actin- dependent force during T-cell migration. Nat Commun. 2016;7:13119. 104. Kobashi C, Asamizu S, Ishiki M, Iwata M, Usui I, Yamazaki K, et al. Inhibitory effect of IL-8 on insulin action in human adipocytes via MAP kinase pathway. J Inflamm (Lond). 2009;6:25. 105. Chandrasekar B, Patel DN, Mummidi S, Kim JW, Clark RA, Valente AJ. Interleukin- 18 suppresses adiponectin expression in 3T3-L1 adipocytes via a novel signal transduction pathway involving ERK1/2-dependent NFATc4 phosphorylation. J Biol Chem. 2008;283(7):4200-9. 106. Sakaue H, Ogawa W, Nakamura T, Mori T, Nakamura K, Kasuga M. Role of MAPK phosphatase-1 (MKP-1) in adipocyte differentiation. J Biol Chem. 2004;279(38):39951-7. 107. Zhang HH, Huang J, Duvel K, Boback B, Wu S, Squillace RM, et al. Insulin stimulates adipogenesis through the Akt-TSC2-mTORC1 pathway. PLoS One. 2009;4(7):e6189. 108. Yoon MS, Zhang C, Sun Y, Schoenherr CJ, Chen J. Mechanistic target of rapamycin controls homeostasis of adipogenesis. J Lipid Res. 2013;54(8):2166-73.

109. Bell A, Grunder L, Sorisky A. Rapamycin inhibits human adipocyte differentiation in primary culture. Obes Res. 2000;8(3):249-54. 110. Chang GR, Chiu YS, Wu YY, Chen WY, Liao JW, Chao TH, et al. Rapamycin protects against high fat diet-induced obesity in C57BL/6J mice. J Pharmacol Sci. 2009;109(4):496-503. 111. Sekulic A, Hudson CC, Homme JL, Yin P, Otterness DM, Karnitz LM, et al. A direct linkage between the phosphoinositide 3-kinase-AKT signaling pathway and the mammalian target of rapamycin in mitogen-stimulated and transformed cells. Cancer Res. 2000;60(13):3504-13. 112. Nave BT, Ouwens M, Withers DJ, Alessi DR, Shepherd PR. Mammalian target of rapamycin is a direct target for protein kinase B: identification of a convergence point for opposing effects of insulin and amino-acid deficiency on protein translation. Biochem J. 1999;344 Pt 2:427-31. 113. Rosner M, Siegel N, Valli A, Fuchs C, Hengstschlager M. mTOR phosphorylated at S2448 binds to raptor and rictor. Amino Acids. 2010;38(1):223-8. 114. Chiang GG, Abraham RT. Phosphorylation of mammalian target of rapamycin (mTOR) at Ser-2448 is mediated by p70S6 kinase. J Biol Chem. 2005;280(27):25485-90. 115. Cheng K, Hao M. Metformin Inhibits TGF-beta1-Induced Epithelial-to-Mesenchymal Transition via PKM2 Relative-mTOR/p70s6k Signaling Pathway in Cervical Carcinoma Cells. International journal of molecular sciences. 2016;17(12). 116. Li T, Wang W, Zhao JH, Zhou X, Li YM, Chen H. Pseudolaric acid B inhibits T-cell mediated immune response in vivo via p38MAPK signal cascades and PPARgamma activation. Life Sci. 2015;121:88-96. 117. Stechschulte LA, Hinds TD, Jr., Khuder SS, Shou W, Najjar SM, Sanchez ER. FKBP51 controls cellular adipogenesis through p38 kinase-mediated phosphorylation of GRalpha and PPARgamma. Mol Endocrinol. 2014;28(8):1265-75. 118. Stechschulte LA, Hinds TD, Jr., Ghanem SS, Shou W, Najjar SM, Sanchez ER. FKBP51 reciprocally regulates GRalpha and PPARgamma activation via the Akt-p38 pathway. Mol Endocrinol. 2014;28(8):1254-64. 119. Zhang O, Zhang J. Atorvastatin promotes human monocyte differentiation toward alternative M2 macrophages through p38 mitogen-activated protein kinase-dependent peroxisome proliferator-activated receptor gamma activation. Int Immunopharmacol. 2015;26(1):58-64.

120. Wang J, Sun GJ, Ding J, Zhang JX, Cui Y, Li HR, et al. WY14643 combined with all- trans retinoic acid acts via p38 MAPK to induce "browning" of white adipocytes in mice. Genet Mol Res. 2015;14(2):6978-84. 121. Son MJ, Kim WK, Kwak M, Oh KJ, Chang WS, Min JK, et al. Silica nanoparticles inhibit brown adipocyte differentiation via regulation of p38 phosphorylation. Nanotechnology. 2015;26(43):435101. 122. Hattori K, Naguro I, Okabe K, Funatsu T, Furutani S, Takeda K, et al. ASK1 signalling regulates brown and beige adipocyte function. Nat Commun. 2016;7:11158. 123. Liu GX, Zhu JC, Chen XY, Zhu AZ, Liu CC, Lai Q, et al. Inhibition of adipogenic differentiation of bone marrow mesenchymal stem cells by erythropoietin via activating ERK and P38 MAPK. Genet Mol Res. 2015;14(2):6968-77. 124. He Z, Zhu HH, Bauler TJ, Wang J, Ciaraldi T, Alderson N, et al. Nonreceptor tyrosine phosphatase Shp2 promotes adipogenesis through inhibition of p38 MAP kinase. Proceedings of the National Academy of Sciences of the United States of America. 2013;110(1):E79-88. 125. Filson SA, Keren A, Goldstein N, Ullmann Y. The Opposite Expected Effect of p38 Inhibitors on Fat Graft Survival. Plastic and reconstructive surgery Global open. 2016;4(7):e806. 126. Roche J. Stamps of greatness. Ambrose Pare (1510-1590). The Medical journal of Australia. 2013;199(3):214. 127. Molenaar JC. [From the library of the Netherlands Journal of Medicine. Rudolf Virchow: Die Cellularpathologie in ihrer Begrundung auf physiologische und pathologische Gewebelehre; 1858]. Nederlands tijdschrift voor geneeskunde. 2003;147(45):2236-44. 128. Rudolf Ludwig Karl Virchow (1821-1902) "Omnis Cellula E Cellula". Minn Med. 1966;49(3):533-4. 129. Husson FC. Skin Grafting According to Thiersch. Ann Surg. 1889;9(4):290-3. 130. Dobrzaniecki W. Homotransplantation and the Several Blood Groups: Considerations on Epidermal Grafts Made by the Thiersch Method. Ann Surg. 1929;90(5):926-38. 131. Bignold LP, Coghlan BL, Jersmann HP. Cancer morphology, carcinogenesis and genetic instability: a background. EXS. 2006(96):1-24. 132. Rous P, Jones FS. A Method for Obtaining Suspensions of Living Cells from the Fixed Tissues, and for the Plating out of Individual Cells. J Exp Med. 1916;23(4):549-55. 133. Lo Monaco GB. [Line of HeLa cells proliferating in medium containing calf serum]. Sperimentale. 1957;107(1):56-62.

134. Thomson JA, Marshall VS. Primate embryonic stem cells. Curr Top Dev Biol. 1998;38:133-65. 135. Herget T, Specht H, Esdar C, Oehrlein SA, Maelicke A. Retinoic acid induces apoptosis-associated neural differentiation of a murine teratocarcinoma cell line. J Neurochem. 1998;70(1):47-58. 136. Third Decennial Review Conference: cell, tissue, and organ culture. Gene expression and regulation in cultured cells. Natl Cancer Inst Monogr. 1978(48):1-401. 137. Caplan AI. Mesenchymal stem cells. J Orthop Res. 1991;9(5):641-50. 138. Shapiro F, Yao TJ, Raptis G, Reich L, Norton L, Moore MA. Optimization of conditions for ex vivo expansion of CD34+ cells from patients with stage IV breast cancer. Blood. 1994;84(10):3567-74. 139. Civin CI, Small D. Purification and expansion of human hematopoietic stem/progenitor cells. Ann N Y Acad Sci. 1995;770:91-8. 140. Shpall EJ, Gee A, Cagnoni PJ, Hogan C, Gehling U, Hami L, et al. Stem cell isolation. Curr Opin Hematol. 1995;2(6):452-9. 141. Nerem RM. Cellular engineering. Ann Biomed Eng. 1991;19(5):529-45. 142. Chang HN, Furusaki S. Membrane bioreactors: present and prospects. Adv Biochem Eng Biotechnol. 1991;44:27-64. 143. Rehfeldt F, Engler AJ, Eckhardt A, Ahmed F, Discher DE. Cell responses to the mechanochemical microenvironment--implications for regenerative medicine and drug delivery. Adv Drug Deliv Rev. 2007;59(13):1329-39. 144. Ludwig T, Kirmse R, Poole K, Schwarz US. Probing cellular microenvironments and tissue remodeling by atomic force microscopy. Pflugers Arch. 2008;456(1):29-49. 145. Tamplin ML, Martin AL, Ruple AD, Cook DW, Kaspar CW. Enzyme immunoassay for identification of Vibrio vulnificus in seawater, sediment, and oysters. Appl Environ Microbiol. 1991;57(4):1235-40. 146. Soffer-Tsur N, Peer D, Dvir T. ECM-based macroporous sponges release essential factors to support the growth of hematopoietic cells. J Control Release. 2016. 147. Ireland RG, Simmons CA. Human Pluripotent Stem Cell Mechanobiology: Manipulating the Biophysical Microenvironment for Regenerative Medicine and Tissue Engineering Applications. Stem Cells. 2015;33(11):3187-96. 148. Choi YC, Choi JS, Woo CH, Cho YW. Stem cell delivery systems inspired by tissue- specific niches. J Control Release. 2014;193:42-50.

149. Strioga M, Viswanathan S, Darinskas A, Slaby O, Michalek J. Same or not the same? Comparison of adipose tissue-derived versus bone marrow-derived mesenchymal stem and stromal cells. Stem Cells Dev. 2012;21(14):2724-52. 150. Zollinger AJ, Smith ML. Fibronectin, the extracellular glue. Matrix Biol. 2016. 151. Gundberg CM. Matrix proteins. Osteoporos Int. 2003;14 Suppl 5:S37-40; discussion S-2. 152. Kresse H, Schonherr E. Proteoglycans of the extracellular matrix and growth control. J Cell Physiol. 2001;189(3):266-74. 153. Monslow J, Govindaraju P, Pure E. Hyaluronan - a functional and structural sweet spot in the tissue microenvironment. Front Immunol. 2015;6:231. 154. Vigetti D, Karousou E, Viola M, Deleonibus S, De Luca G, Passi A. Hyaluronan: biosynthesis and signaling. Biochim Biophys Acta. 2014;1840(8):2452-9. 155. Danen EH. Integrins: regulators of tissue function and cancer progression. Curr Pharm Des. 2005;11(7):881-91. 156. Pozzi A, Zent R. Integrins: sensors of extracellular matrix and modulators of cell function. Nephron Exp Nephrol. 2003;94(3):e77-84. 157. Danen EH, Sonnenberg A. Integrins in regulation of tissue development and function. J Pathol. 2003;200(4):471-80. 158. Hood JD, Cheresh DA. Role of integrins in cell invasion and migration. Nat Rev Cancer. 2002;2(2):91-100. 159. Tan S, Barker N. Engineering the niche for stem cells. Growth Factors. 2013;31(6):175-84. 160. Buzanska L, Zychowicz M, Sarnowska A, Domanska-Janik K. [Bioengineering of neural stem cell niche]. Postepy Biochem. 2013;59(2):175-86. 161. Lu P, Weaver VM, Werb Z. The extracellular matrix: a dynamic niche in cancer progression. J Cell Biol. 2012;196(4):395-406. 162. Conway A, Schaffer DV. Biophysical regulation of stem cell behavior within the niche. Stem Cell Res Ther. 2012;3(6):50. 163. Agmon G, Christman KL. Controlling stem cell behavior with decellularized extracellular matrix scaffolds. Curr Opin Solid State Mater Sci. 2016;20(4):193-201. 164. Ginsberg MH, Du X, Plow EF. Inside-out integrin signalling. Curr Opin Cell Biol. 1992;4(5):766-71. 165. Fox JE. Transmembrane signaling across the platelet integrin glycoprotein IIb-IIIa. Ann N Y Acad Sci. 1994;714:75-87.

166. Nakstad B. [Integrins, structure and function]. Tidsskr Nor Laegeforen. 1993;113(5):595-9. 167. Moirangthem RD, Singh S, Adsul A, Jalnapurkar S, Limaye L, Kale VP. Hypoxic niche-mediated regeneration of hematopoiesis in the engraftment window is dominantly affected by oxygen tension in the milieu. Stem Cells Dev. 2015;24(20):2423-36. 168. Grazul-Bilska AT, Johnson ML, Bilski JJ, Redmer DA, Reynolds LP, Abdullah A, et al. Wound healing: the role of growth factors. Drugs Today (Barc). 2003;39(10):787-800. 169. Poindexter NJ, Williams RR, Powis G, Jen E, Caudle AS, Chada S, et al. IL-24 is expressed during wound repair and inhibits TGFalpha-induced migration and proliferation of keratinocytes. Exp Dermatol. 2010;19(8):714-22. 170. Shibata S, Tada Y, Asano Y, Hau CS, Kato T, Saeki H, et al. Adiponectin regulates cutaneous wound healing by promoting keratinocyte proliferation and migration via the ERK signaling pathway. J Immunol. 2012;189(6):3231-41. 171. Li M, Zhao Y, Hao H, Dai H, Han Q, Tong C, et al. Mesenchymal stem cell- conditioned medium improves the proliferation and migration of keratinocytes in a diabetes- like microenvironment. Int J Low Extrem Wounds. 2015;14(1):73-86. 172. Das S, Majid M, Baker AB. Syndecan-4 enhances PDGF-BB activity in diabetic wound healing. Acta Biomater. 2016;42:56-65. 173. Goudie EB, Gendics C, Lantis JC, 2nd. Multimodal therapy as an algorithm to limb salvage in diabetic patients with large heel ulcers. Int Wound J. 2012;9(2):132-8. 174. Mulder G, Tallis AJ, Marshall VT, Mozingo D, Phillips L, Pierce GF, et al. Treatment of nonhealing diabetic foot ulcers with a platelet-derived growth factor gene-activated matrix (GAM501): results of a phase 1/2 trial. Wound Repair Regen. 2009;17(6):772-9. 175. Tirado-Rodriguez B, Ortega E, Segura-Medina P, Huerta-Yepez S. TGF- beta: an important mediator of allergic disease and a molecule with dual activity in cancer development. J Immunol Res. 2014;2014:318481. 176. Kandhare AD, Alam J, Patil MV, Sinha A, Bodhankar SL. Wound healing potential of naringin ointment formulation via regulating the expression of inflammatory, apoptotic and growth mediators in experimental rats. Pharm Biol. 2016;54(3):419-32. 177. Uysal CA, Tobita M, Hyakusoku H, Mizuno H. The Effect of Bone-Marrow-Derived Stem Cells and Adipose-Derived Stem Cells on Wound Contraction and Epithelization. Adv Wound Care (New Rochelle). 2014;3(6):405-13.

178. Martinez-Ferrer M, Afshar-Sherif AR, Uwamariya C, de Crombrugghe B, Davidson JM, Bhowmick NA. Dermal transforming growth factor-beta responsiveness mediates wound contraction and epithelial closure. Am J Pathol. 2010;176(1):98-107. 179. Ghosh MM, Boyce SG, Freedlander E, MacNeil S. A simple human dermal model for assessment of in vitro attachment efficiency of stored cultured epithelial autografts. J Burn Care Rehabil. 1995;16(4):407-17. 180. Boyce ST, Hansbrough JF. Biologic attachment, growth, and differentiation of cultured human epidermal keratinocytes on a graftable collagen and chondroitin-6-sulfate substrate. Surgery. 1988;103(4):421-31. 181. Krejci NC, Cuono CB, Langdon RC, McGuire J. In vitro reconstitution of skin: fibroblasts facilitate keratinocyte growth and differentiation on acellular reticular dermis. J Invest Dermatol. 1991;97(5):843-8. 182. Livesey SA, Herndon DN, Hollyoak MA, Atkinson YH, Nag A. Transplanted acellular allograft dermal matrix. Potential as a template for the reconstruction of viable dermis. Transplantation. 1995;60(1):1-9. 183. Wainwright DJ. Use of an acellular allograft dermal matrix (AlloDerm) in the management of full-thickness burns. Burns. 1995;21(4):243-8. 184. Zhang J, Zhang CW, Du LQ, Wu XY. Acellular porcine corneal matrix as a carrier scaffold for cultivating human corneal epithelial cells and fibroblasts in vitro. Int J Ophthalmol. 2016;9(1):1-8. 185. Kelly BA, Proffen BL, Haslauer CM, Murray MM. Platelets and plasma stimulate sheep rotator cuff tendon tenocytes when cultured in an extracellular matrix scaffold. J Orthop Res. 2016;34(4):623-9. 186. Ahmed TA, Ringuette R, Wallace VA, Griffith M. Autologous fibrin glue as an encapsulating scaffold for delivery of retinal progenitor cells. Front Bioeng Biotechnol. 2014;2:85. 187. Le Brun JF, Dejode M, Campion L, Jaffre I, Bordes V, Classe JM, et al. [Quality of life after lipomodelling: retrospective study of 42 patients]. Annales de chirurgie plastique et esthetique. 2013;58(3):222-7. 188. Khouri RK, Jr., Khouri RE, Lujan-Hernandez JR, Khouri KR, Lancerotto L, Orgill DP. Diffusion and perfusion: the keys to fat grafting. Plastic and reconstructive surgery Global open. 2014;2(9):e220.

189. Lee JH, Kirkham JC, McCormack MC, Nicholls AM, Randolph MA, Austen WG, Jr. The effect of pressure and shear on autologous fat grafting. Plastic and reconstructive surgery. 2013;131(5):1125-36. 190. Pallua N, Baroncini A, Alharbi Z, Stromps JP. Improvement of facial scar appearance and microcirculation by autologous lipofilling. Journal of plastic, reconstructive & aesthetic surgery : JPRAS. 2014;67(8):1033-7. 191. Bruno A, Delli Santi G, Fasciani L, Cempanari M, Palombo M, Palombo P. Burn scar lipofilling: immunohistochemical and clinical outcomes. The Journal of craniofacial surgery. 2013;24(5):1806-14. 192. Morandi EM, Loizides A, Gruber H, Loscher WN, Pierer G, Baur EM. Lipografting as a novel therapeutic option in secondary tarsal tunnel release. Muscle & nerve. 2016. 193. Krzesniak NE, Noszczyk BH. Autologous Fat Transfer in Secondary Carpal Tunnel Release. Plastic and reconstructive surgery Global open. 2015;3(5):e401. 194. Erba P, Mantovani C, Kalbermatten DF, Pierer G, Terenghi G, Kingham PJ. Regeneration potential and survival of transplanted undifferentiated adipose tissue-derived stem cells in peripheral nerve conduits. Journal of plastic, reconstructive & aesthetic surgery : JPRAS. 2010;63(12):e811-7. 195. Kappos EA, Engels PE, Tremp M, Meyer zu Schwabedissen M, di Summa P, Fischmann A, et al. Peripheral Nerve Repair: Multimodal Comparison of the Long-Term Regenerative Potential of Adipose Tissue-Derived Cells in a Biodegradable Conduit. Stem Cells Dev. 2015;24(18):2127-41. 196. Lee WY, Park KJ, Cho YB, Yoon SN, Song KH, Kim do S, et al. Autologous adipose tissue-derived stem cells treatment demonstrated favorable and sustainable therapeutic effect for Crohn's fistula. Stem Cells. 2013;31(11):2575-81. 197. ter Huurne M, Schelbergen R, Blattes R, Blom A, de Munter W, Grevers LC, et al. Antiinflammatory and chondroprotective effects of intraarticular injection of adipose-derived stem cells in experimental osteoarthritis. Arthritis and rheumatism. 2012;64(11):3604-13. 198. Otsuki Y, Nakamura Y, Harada S, Yamamoto Y, Ogino K, Morikawa K, et al. Adipose stem cell sheets improved cardiac function in the rat myocardial infarction, but did not alter cardiac contractile responses to beta-adrenergic stimulation. Biomedical research. 2015;36(1):11-9.

12. List of abbreviations

ADM adipogenic differentiation medium

ADIPOQ Adiponectin

AIM adipogenic induction medium

AKT Actin

AMPKa AMP-activated protein kinase alpha

ASC adipose derived stem cells

Bad Bcl-2 Associated Death (protein)

CD cluster of differentiation, e.g. CD-47 cDNA complementary DNA

CT Cycle of threshold

CTGF connective tissue growth factor

Ctrl Control

DAB 3,3'-Diaminobenzidine

DMEM Dulbecco’s Modified Eagle Medium

ECM extracellular matrix

EDTA ethylene-diamineteraacetic acid

ERK Extracellular Signal-Regulated Kinase

F12 nutrient mixture F12

FABP4 fatty acid binding protein 4

F-actin filamentous actin

FAK focal adhesion kinase

FCS fetal calf serum 86

GAPDH Glyceraldehyde 3-phosphate dehydrogenase

GFP Green fluorescent protein

GUSB Glucuronidase Beta

GSK-3b glycogen synthase kinase 3 hMSC human bone marrow derived stem cells

HSP27 Heat shock protein 27

IBMX 3-isobutyl-1-methyl xanthine

Ig Immunoglobulin, e.g. IgM

IHC Immunohistochemistry

ILK integrin-linked kinase

ITGA Integrin alpha, e.g. ITGAV

ITGB Integrin beta, e.g. ITGB1

JNK Janus kinase; Jun amino-terminal kinase

KD Knock down

LATS1/2 Large Tumor Suppressor Kinase 1/2

LDV Leucine-Aspartate-Valine

MAPK Mitogen-activated protein kinase

MEK Mitogen-activated protein/Extracellular signal-regulated kinase kinase

MSC mesenchymal stem cells mRNA messenger ribonucleic acid mTOR Mammalian target of Rapamycin mTORc1/2 Mammalian target of Rapamycin complex 1/2

OE Overexpression

ORO Oil Red O p21Cip1 cyclin-dependent kinase inhibitor 1; CDK-interacting protein 1 (CIP1) p38 Protein 38

PARP Procyclic Acidic Repetitive Protein

PBS phosphate-buffered saline

PCR polymerase chain reaction

PDK1 Phosphoinositide-dependent protein kinase-1

PFA Paraformaldehyde

PI propidium iodide

PI3K Phosphatidylinositol-4,5-bisphosphate 3-kinase

PKA Protein kinase A

PLIN1 Perilipin-1

PM4 proliferation medium 4

PPARG Peroxisome Proliferator Activated Receptor Gamma

PRAS40 Proline-Rich Akt Substrate, 40 KDa qRT-PCR quantitative real-time PCR

RAF Rapidly accelerated fibrosarcoma protein

RAS Rat sarcoma protein

RGD Arginine-Glycine-Aspartate

RNA Ribonucleic acid

RNAi interfering RNA

RUNX2 Runt-related transcription factor 2

SAPK Stress-activated protein kinases

Scr Proto-oncogene tyrosine-protein kinase shRNA short-hairpin RNA

Smad3 Contraction of Sma (small body size) and Mad (Mothers against decapentaplegic) 3 protein

SOX9 SRY-Box 9 transcription factor

Stat Signal transducer and activator of transcription, e.g. Stat1, Stat3

TAZ transcriptional coactivator with PDZ-binding motif; Taffazin

TBP TATA-binding protein

TSC1/TSC2 tuberous sclerosis protein 1–2 complex

SVF stromal vascular fraction

VCAM1 vascular cell adhesion molecule 1

VSVG Vesicular stomatitis virus glycoprotein

YAP Yes-associated protein

YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide

13. Curriculum vitae

Academic education:

 10/2004-07/2010 Human medicine (Medical University Innsbruck)  10/2007 - 01/2010 Demonstrator for anatomy (Department for Anatomy, Medical University Innsbruck)  10/2010 Graduation in medicine (Medical University Innsbruck)

Postgraduate education:

 11/2010 - 02/2011 Italian state examination in human medicine (University of Bologna)  04/2011 German license to practice medicine (Medical Council Oberbayern)  05/2011 - 10/2011 Resident in trauma surgery (Lindau am Bodensee)  Since 2011/2011 Resident in plastic, reconstructive and aesthetic surgery (University clinic of Plastic, Reconstructive and Aesthetic Surgery Innsbruck)  04/2012 - 04/2013 Research year (Laboratory for Plastic, Reconstructive and Aesthetic Surgery Innsbruck)  04/2013 - 03/2014 Subsidiary subjects of specialist training (vascular surgery, anatomy, internal medicine)  PhD student in „Applied morphology and regeneration“ (Medical University Innsbruck)

Courses, observerships and trainings:

 04/2011- ÖGGH ultrasound course, Innsbruck  11/2012 - 21st European Course in Plastic Surgery of EBOPRAS  02/2013 – Training in microsurgery, Basel (DAM)  09/2013 - 11/2013 – Postgraduate course for principal investigation in clinical research (Medical Council Tirol)  11/2014 – Body contouring course, Dr. Georg Huemer (Linz)  03/2015 – Winter workshop in hand surgery (Garmisch-Partenkirchen)  06/2015 - Otoplasty surgery course (Baden bei Wien) 90

 04/2016 - Visiting doctor at Cliniqué Bizet, Dr. Francoise Firmin (Paris)  Regular attendance of AWF courses in plastic surgery (ÖGPÄRC)  10/2016: Specialist examination in Plastic, Reconstructive and Aesthetic Surgery (ÖGPÄRC)  12/2016: “Linzer Lappenkurs” – cadaver course in harvesting of free flaps (Linz)

Attendance of congresses, talks and posters:

 ÖGPÄRC 2012, Linz: „Extrazelluläre Matrix und Integrin-abhängige Kontrolle der Fettstammzellphysiologie”  ÖGPÄRC 2013, Velden: “ITGAV-dependent control of human ASC physiology” , “Gender bias in adipogenic stem cell research”  European Stem Cell Society Congress 2013, Marseille  Gemeinsame Jahrestagung der DGPRÄC, VDÄPC und ÖGPÄRC 2014, München: ”Integrin alpha V – ein essentieller Regulator der ASC Physiologie”  Laser Innsbruck 2014: “Integrin alpha V and its role in adipogenesis”  ÖGH 2015 – “Langzeitergebnis 17 Jahre nach Oberarmreplantation: ein Fallbericht” und “Replantation nach isolierter Daumenamputation – eine retrospektive Fallserie von 2006-2010  AANS 2015, Washington D.C.  11th Keele Meeting on Aluminium 2015, Lille: “The use of antiperspirants with aluminium salts and its relation to breast cancer – methods and implementation of biospecimen sampling”  EURAPS 2015, Edinburgh  ÖGPÄRC 2015, Salzburg: “Pectus excavatum Korrektur bei Frauen: Unterschiede in der Beurteilung zwischen Patientinnen, Ärzten und medizinischen Laien”  ÖGPÄRC 2016, Innsbruck: „Lipofilling als neue Therapieoption im Rahmen der sekundären Tarsaltunneldekompression”

Memberships:

 Since 10/2016: associate member of Österreichische Gesellschaft für Plastische, Ästhetische und Rekonstruktive Chirurgie (ÖGPÄRC) 91

Publications:

Authorships:

 ITGAV and ITGA5 diversely regulate proliferation and adipogenic differentiation of human adipose derived stem cells. Morandi EM, Verstappen R, Zwierzina ME, Geley S, Pierer G, Ploner C. Sci Rep. 2016 Jul 1;6:28889. doi: 10.1038/srep28889.  Differentiation between acute skin rejection in allotransplantation and T-cell mediated skin inflammation based on gene expression analysis. Wolfram D*, Morandi EM*, Eberhart N, Hautz T, Hackl H, Zelger B, Riede G, Wachter T, Dubrac S, Ploner C, Pierer G, Schneeberger S. Biomed Res Int. 2015;2015:259160. (*Authors contributed equally to the publication)  Lipografting as a novel therapeutic option in secondary tarsal tunnel release. Morandi EM, Loizides A, Gruber H, Löscher WN, Pierer G, Baur EM. Muscle Nerve. 2016 Apr 7. doi: 10.1002/mus.25135. [Epub ahead of print]

Co-authorships:

 The combined use of NPWT and instillation using an octenidine based wound rinsing solution: a case study. Matiasek J, Djedovic G, Mattesich M, Morandi E, Pauzenberger R, Pikula R, Verstappen R, Pierer G, Koller R, Rieger UM. J Wound Care. 2014 Nov;23(11):590, 592-6.  Use of an acellular dermal template for defect coverage on the penile shaft. Djedovic G, Matiasek J, Morandi E, Pierer G, Rieger UM. Eur J Plast Surg (2015) 38:421–424.