DOCSLIB.ORG

De Novo 3D Models of SARS-Cov-2 RNA Elements from Consensus Experimental Secondary Structures Ramya Rangan 1,†, Andrew M

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
De Novo 3D Models of SARS-Cov-2 RNA Elements from Consensus Experimental Secondary Structures Ramya Rangan 1,†, Andrew M 3092–3108 Nucleic Acids Research, 2021, Vol. 49, No. 6 Published online 8 March 2021 doi: 10.1093/nar/gkab119 De novo 3D models of SARS-CoV-2 RNA elements from consensus experimental secondary structures Ramya Rangan 1,†, Andrew M. Watkins 2,†, Jose Chacon 2, Rachael Kretsch 1, Wipapat Kladwang2, Ivan N. Zheludev 2, Jill Townley 3, Mats Rynge4, Gregory Thain 5 and Rhiju Das 1,2,6,* 1Biophysics Program, Stanford University, Stanford, CA 94305, USA, 2Department of Biochemistry, Stanford University School of Medicine, Stanford CA 94305, USA, 3Eterna Massive Open Laboratory, 4Information Sciences Institute, University of Southern California, Marina Del Rey, CA 90292, USA, 5Department of Computer Sciences, Downloaded from https://academic.oup.com/nar/article/49/6/3092/6163084 by guest on 02 October 2021 University of Wisconsin–Madison, Madison, WI 53706 USA and 6Department of Physics, Stanford University, Stanford, CA 94305, USA Received December 16, 2020; Revised February 08, 2021; Editorial Decision February 09, 2021; Accepted February 16, 2021 ABSTRACT GRAPHICAL ABSTRACT The rapid spread of COVID-19 is motivating develop- ment of antivirals targeting conserved SARS-CoV-2 molecular machinery. The SARS-CoV-2 genome in- cludes conserved RNA elements that offer poten- tial small-molecule drug targets, but most of their 3D structures have not been experimentally char- acterized. Here, we provide a compilation of chem- ical mapping data from our and other labs, sec- ondary structure models, and 3D model ensembles based on Rosetta’s FARFAR2 algorithm for SARS- CoV-2 RNA regions including the individual stems SL1-8 in the extended 5 UTR; the reverse com- plement of the 5 UTR SL1-4; the frameshift stim- ulating element (FSE); and the extended pseudo- knot, hypervariable region, and s2m of the 3 UTR. For eleven of these elements (the stems in SL1– 8, reverse complement of SL1–4, FSE, s2m and 3 UTR pseudoknot), modeling convergence supports INTRODUCTION the accuracy of predicted low energy states; sub- sequent cryo-EM characterization of the FSE con- The COVID-19 outbreak has rapidly spread through the firms modeling accuracy. To aid efforts to discover world, presenting an urgent need for therapeutics target- small molecule RNA binders guided by computa- ing the betacoronavirus SARS-CoV-2. RNA-targeting an- tional models, we provide a second set of similarly tivirals have potential to be effective against SARS-CoV- 2, as the virus’s RNA genome harbors conserved regions prepared models for RNA riboswitches that bind predicted to have stable secondary structures (1,2) that small molecules. Both datasets (‘FARFAR2-SARS- have been verified by chemical probing (3–8), some of CoV-2’, https://github.com/DasLab/FARFAR2-SARS- which have been shown to be essential for the life cycle CoV-2; and ‘FARFAR2-Apo-Riboswitch’, at https: of related betacoronaviruses (9). Efforts to identify small //github.com/DasLab/FARFAR2-Apo-Riboswitch’)in- molecules that target stereotyped 3D RNA folds have ad- clude up to 400 models for each RNA element, which vanced over recent years (10), making RNA structures may facilitate drug discovery approaches targeting like those in SARS-CoV-2 potentially attractive targets for dynamic ensembles of RNA molecules. small molecule drugs. *To whom correspondence should be addressed. Tel: +1 650 723 597; Email:[email protected] †The authors wish it to be known that, in their opinion, the first two authors should be regarded as Joint First Authors. C The Author(s) 2021. Published by Oxford University Press on behalf of Nucleic Acids Research. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted reuse, distribution, and reproduction in any medium, provided the original work is properly cited. Nucleic Acids Research, 2021, Vol. 49, No. 6 3093 Several RNA regions in betacoronavirus genomes, in- complement of SL1–4 in the 5 UTR, the FSE and its dimer- cluding the 5 UTR, the frameshift stimulating element ized form, the 3 UTR pseudoknot, and the 3 UTR hyper- (FSE), and 3 UTR, feature RNA structures with likely variable region, along with homology models of SL2 and functional importance. These regions include a series of five s2m. The use of Rosetta’s FARFAR2 is motivated by ex- conserved stem–loops in the 5 UTR, the FSE along with tensive testing: FARFAR2 has been benchmarked on all a proposed dimerized state, a pseudoknot in the 3 UTR community-wide RNA-Puzzle modeling challenges to date proposed to form two structures, and the hypervariable re- (22–24), achieving accurate prediction of complex 3D RNA gion in the 3 UTR, which includes an absolutely conserved folds for ligand-binding riboswitches and aptamers, and octanucleotide and the stem–loop II-like motif (‘s2m’). An producing models with 3–14 A˚ RMSD across six additional NMR structure of stem–loop 2 in the 5 UTR has been recent blind modeling challenges (21). For our SARS-CoV- solved, adopting a canonical CUYG tetraloop fold (11). A 2 study, the accuracy of our original de novo models for the crystal structure for s2m in the 3 UTR has been solved FSE predicted in early 2020 has been validated by subse- for the original SARS virus, SARS-CoV-1 (12). Since re- quent cryo-EM as well, as is described below. In addition Downloaded from https://academic.oup.com/nar/article/49/6/3092/6163084 by guest on 02 October 2021 porting this work on the bioRxiv preprint server, structures to providing structural ensembles for SARS-CoV-2 RNA for the FSE have been determined as an isolated RNA and elements, we provide analogous FARFAR2 de novo and in association with the ribosome through cryo-EM (13,14). homology models for 10 riboswitch aptamers, providing a Beyond these regions, however, 3D structures for RNA benchmark dataset for virtual screening approaches that genome regions of SARS-CoV-2 or homologs have not been make use of computational RNA models. solved. In advance of detailed experimental structural charac- terization, computational predictions for the 3D structural MATERIALS AND METHODS conformations adopted by conserved RNA elements may Chemical reactivity experiments aid the search for RNA-targeting antivirals. Representative conformations from these RNA molecules’ structural en- We collected chemical reactivity profiles for SL1–4 and sembles can serve as starting points for virtual screening of SL2–6 of the 5 UTR, the reverse complement of SL1–4, small-molecule drug candidates. For example, a computa- and the hypervariable region of the 3 UTR. The DNA tem- tional model for the FSE of SARS-CoV-1 was used in a vir- plates for the stem–loop 1–4 RNA were amplified from a tual screen to discover the small-molecule binder MTDB gBlock sequence for the extended 5 UTR, and the DNA (15), and recently, SARS-CoV-2 models for 5 UTR regions template for the hyper-variable region was amplified from a have been used for virtually docking small molecules (16). gBlock sequence for the 3 UTR. The SL2–6 construct was In other prior work by Stelzer et al.(17), virtual screening designed using the Primerize webserver (25) with built-in 5 of a library of compounds against an ensemble of mod- and 3 ‘reference hairpins’ for signal normalization flank- eled RNA structures led to the de novo discovery of a set ing the region of interest and building using PCR assem- of small molecules that bound a structured element in HIV- bly following the Primerize protocol (primers and gBlock 1 (the transactivation response element, TAR). Such work sequences ordered from Integrated DNA Technologies, se- motivates our modeling of not just a single ‘native’ struc- quences in Supplementary Table S5). For amplification off ture but an ensemble of states for SARS-CoV-2 RNA re- of gBlocks, primers were designed to add a Phi2.5 T7 RNA gions. As with HIV-1 TAR, many of the SARS-CoV-2 el- polymerase promoter sequence (26) (TTCTAATACGAC ements are unlikely to adopt a single conformation but in- TCACTATT) at the amplicon’s 5 end and a 20 bp Tail2 se- stead sample conformations from a heterogeneous ensem- quence (AAAGAAACAACAACAACAAC) at its 3 end. ble. Furthermore, transitions among these conformations The PCR reactions contained 5 ng of gBlock DNA tem- may be implicated in the viral life cycle, as RNA genome re- plate, 2 ␮M of forward and reverse primer, 0.2 mM of gions change long-range contacts with other RNA elements dNTPs, 2 units of Phusion DNA polymerase, and 1X of HF or form interactions with viral and host proteins at different buffer. The reactions were first denatured at 98◦Cfor30s. steps of replication, translation, and packaging. A possible Then for 35 cycles, the samples were denatured at 98◦Cfor therapeutic strategy is therefore to find drugs that stabilize 10 s, annealed at 64◦C for 30 s, and extended at 72◦Cfor an RNA element in a particular conformation incompatible 30◦C. This was followed by an incubation at 72◦Cfor10 with conformational changes and/or changing interactions min for a final extension. Assembly products were verified with biological partners at different stages of the complete for size via agarose gel electrophoresis and subsequently pu- viral replication cycle. Consistent with this hypothesis, prior rified using Agencourt RNAClean XP beads. Purified DNA genetic selection and mutagenesis experiments stabilizing was quantified via NanoDrop (Thermo Scientific) and8 single folds for stem–loops in the 5 UTR and the pseu- pmol of purified DNA was then used for in vitro transcrip- doknot in the 3 UTR demonstrate that changes to these tion with T7 TranscriptAid kits (Thermo Scientific). The re- RNA elements’ structural ensembles can prove lethal for vi- sulting RNA was purified with Agencourt RNAClean XP ral replication (18–20).
Load more

Recommended publications
  • Redesigning the Eterna100 for the Vienna 2 Folding Engine
    bioRxiv preprint doi: https://doi.org/10.1101/2021.08.26.457839; this version posted August 28, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Redesigning the Eterna100 for the Vienna 2 folding engine Rohan V. Koodli1,*, Boris Rudolfs2,*, Hannah K. Wayment-Steele3, Eterna Structure Designersγ, Rhiju Das4,5,^ 1Department of Electrical Engineering and Computer Sciences, University of California, Berkeley, Berkeley, CA 94720 2Department of Chemistry and Biochemistry, University of California, San Diego, La Jolla, California, 92110 3Department of Chemistry, Stanford University, Stanford, CA 94305 4Department of Biochemistry, Stanford University School of Medicine, Stanford, CA 94305 5Department of Physics, Stanford University, Stanford, CA 94305 *Indicates equal contribution γ Group Author: Membership of Eterna participants and list of player names is provided in Acknowledgments ^Corresponding Author: [email protected] bioRxiv preprint doi: https://doi.org/10.1101/2021.08.26.457839; this version posted August 28, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Abstract The rational design of RNA is becoming important for rapidly developing technologies in medicine and biochemistry. Recent work has led to the development of several RNA secondary structure design algorithms and corresponding benchmarks to evaluate their performance. However, the performance of these algorithms is linked to the nature of the underlying algorithms for predicting secondary structure from sequences.
    [Show full text]
  • Poorna Roy Phd Dissertation
    ANALYZING AND CLASSIFYING BIMOLECULAR INTERACTIONS: I. EFFECTS OF METAL BINDING ON AN IRON-SULFUR CLUSTER SCAFFOLD PROTEIN II. AUTOMATIC ANNOTATION OF RNA-PROTEIN INTERACTIONS FOR NDB Poorna Roy A Dissertation Submitted to the Graduate College of Bowling Green State University in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY August 2017 Committee: Neocles Leontis, Committee Co-Chair Andrew Torelli, Committee Co-Chair Vipaporn Phuntumart, Graduate Faculty Representative H. Peter Lu © 2017 Poorna Roy All Rights Reserved iii ABSTRACT Neocles B. Leontis and Andrew T. Torelli, Committee co-chairs This dissertation comprises two distinct parts; however the different research agendas are thematically linked by their complementary approaches to investigate the nature of important intermolecular interactions. The first part is the study of interactions between an iron-sulfur cluster scaffold protein, IscU, and different transition metal ions. Interactions between IscU and specific metal ions are investigated and compared with those of SufU, a homologous Fe-S cluster biosynthesis protein from Gram-positive bacteria whose metal-dependent conformational behavior remains unclear. These studies were extended with additional metal ions selected to determine whether coordination geometry at the active sites of IscU and its homolog influence metal ion selectivity. Comparing the conformational behavior and affinity for different transition metal ions revealed that metal-dependent conformational transitions exhibited by IscU may be a recurring strategy exhibited by U-type proteins involved in Fe-S cluster biosynthesis. The second part of the thesis focuses on automated detection and annotation of specific interactions between nucleotides and amino acid residues in RNA-protein complexes.
    [Show full text]
  • Designing Learning with Citizen Science and Games
    The Emerging Learning Design Journal Volume 4 Issue 1 Article 3 February 2018 Designing Learning with Citizen Science and Games Karen Schrier Marist College Follow this and additional works at: https://digitalcommons.montclair.edu/eldj Part of the Curriculum and Instruction Commons Recommended Citation Schrier, Karen (2018) "Designing Learning with Citizen Science and Games," The Emerging Learning Design Journal: Vol. 4 : Iss. 1 , Article 3. Available at: https://digitalcommons.montclair.edu/eldj/vol4/iss1/3 This Trends is brought to you for free and open access by Montclair State University Digital Commons. It has been accepted for inclusion in The Emerging Learning Design Journal by an authorized editor of Montclair State University Digital Commons. For more information, please contact [email protected]. Volume 4 (2017) pp. 19-26 http://eldj.montclair.edu eld.j ISSN 2474-8218 Emerging Learning Design Journal Trend Designing Learning with Citizen Science and Games Karen Schrier Marist College [email protected] April 29, 2017 ABSTRACT This emerging trends article introduces concepts such as citizen science (the inclusion of non-professionals in scientific knowledge production) and knowledge games (games that enable players to solve real-world problems through crowdsourcing and collective intelligence activities within a game). The article shares the strengths and limitations of using citizen science and knowledge games in the classroom, as well as initial tips and guidelines for bringing these types of experiences to
    [Show full text]
  • Geometric and Statistical Methods for the Analysis and Prediction of Structural Interactions Between Biomolecules Julie Bernauer
    Geometric and statistical methods for the analysis and prediction of structural interactions between biomolecules Julie Bernauer To cite this version: Julie Bernauer. Geometric and statistical methods for the analysis and prediction of structural interac- tions between biomolecules. Bioinformatics [q-bio.QM]. Université Paris-Sud XI, 2015. tel-01136261 HAL Id: tel-01136261 https://tel.archives-ouvertes.fr/tel-01136261 Submitted on 26 Mar 2015 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Copyright Methodes´ geom´ etriques´ et statistiques pour l'analyse et la prediction´ des interactions structurales de biomolecules´ HABILITATION À DIRIGER DES RECHERCHES (Sp´ecialit´eInformatique) UNIVERSITÉ PARIS-SUD 11 pr´esent´eeet soutenue publiquement le 13 janvier 2015 Julie Bernauer Pr´esident: Philippe Dague Professeur, Universit´eParis Sud, LRI/LaDHAC Rapporteurs : Patrice Koehl Professor, University of California, Davis, Department of Computer Science Erik Lindahl Professor, KTH Royal Institute of Technology & Stockholm University, Department of Biochemistry
    [Show full text]
  • Human Computation and Human Subject Tasks in Social Network Playful Applications
    University of Bremen Doctoral Thesis Human Computation and Human Subject Tasks in Social Network Playful Applications Supervisors: Author: Dr. Rainer Malaka Aneta Takhtamysheva Dr. Andreas Breiter A thesis submitted in fulfilment of the requirements for the degree of Doctor of Engineering (Dr.-Ing.) in the Digital Media Mathematics and Informatics March 2016 Declaration of Authorship I, Aneta Takhtamysheva, declare that this thesis titled, ’Human Computation and Human Subject Tasks in Social Network Playful Applications’ and the work presented in it are my own. I confirm that: This work was done wholly or mainly while in candidature for a research degree at this University. Where any part of this thesis has previously been submitted for a degree or any other qualification at this University or any other institution, this has been clearly stated. Where I have consulted the published work of others, this is always clearly at- tributed. Where I have quoted from the work of others, the source is always given. With the exception of such quotations, this thesis is entirely my own work. I have acknowledged all main sources of help. Where the thesis is based on work done by myself jointly with others, I have made clear exactly what was done by others and what I have contributed myself. Signed: Date: ii UNIVERSITY OF BREMEN Abstract Mathematics and Informatics Doctor of Engineering (Dr.-Ing.) Human Computation and Human Subject Tasks in Social Network Playful Applications by Aneta Takhtamysheva Universal connectivity has made crowdsourcing - an online activity of a crowd toward the completion of a goal requested by someone in an open call - possible.
    [Show full text]
  • RNA Structure Through Multidimensional Chemical Mapping
    REVIEW RNA structure through multidimensional chemical mapping Siqi Tian1 and Rhiju Das1,2* 1 Department of Biochemistry, Stanford University, Stanford, CA 94305, USA 2 Department of Physics, Stanford University, Stanford, CA 94305, USA Quarterly Reviews of Biophysics (2016), 49, e7, page 1 of 30 doi:10.1017/S0033583516000020 Abstract. The discoveries of myriad non-coding RNA molecules, each transiting through multiple flexible states in cells or virions, present major challenges for structure determination. Advances in high-throughput chemical mapping give new routes for characterizing entire tran- scriptomes in vivo, but the resulting one-dimensional data generally remain too information-poor to allow accurate de novo structure deter- mination. Multidimensional chemical mapping (MCM) methods seek to address this challenge. Mutate-and-map (M2), RNA interaction groups by mutational profiling (RING-MaP and MaP-2D analysis) and multiplexed •OH cleavage analysis (MOHCA) measure how the chemical reactivities of every nucleotide in an RNA molecule change in response to modifications at every other nucleotide. A growing body of in vitro blind tests and compensatory mutation/rescue experiments indicate that MCM methods give consistently accurate secondary structures and global tertiary structures for ribozymes, ribosomal domains and ligand-bound riboswitch aptamers up to 200 nucleotides in length. Importantly, MCM analyses provide detailed information on structurally heterogeneous RNA states, such as ligand-free riboswitches that are functionally important but difficult to resolve with other approaches. The sequencing requirements of currently available MCM pro- tocols scale at least quadratically with RNA length, precluding general application to transcriptomes or viral genomes at present. We propose a modify-cross-link-map (MXM) expansion to overcome this and other current limitations to resolving the in vivo ‘RNA structurome’.
    [Show full text]
  • New Visions in Citizen Science
    case study series vol 3 New Visions in Citizen Science by Anne Bowser and Lea Shanley New Visions in Citizen Science by Anne Bowser and Lea Shanley, Woodrow Wilson Center November 2013 Commons Lab | Case sTUDy series | vOL 3 NEW VISIONS IN CITIZEN SCIENCE Commons Lab Science and Technology Innovation Program Woodrow Wilson International Center for Scholars One Woodrow Wilson Plaza 1300 Pennsylvania Avenue, N.W. Washington, DC 20004-3027 www.CommonsLab.wilsoncenter.org Study Director: Lea Shanley Editor: Aaron Lovell Cover design: Kathy Butterfield and Diana Micheli © 2013, The Woodrow Wilson Center: This work is licensed under Creative Commons Attribution-NonCommercial-NoDerivs 3.0 Unported License: http://creativecommons. org/licenses/by-nc-nd/3.0/ This report may be reproduced in whole, or in part, for educational and non- commercial uses, pursuant to the Creative Commons Attribution-NonCommerical- NoDerivs 3.0 Unported License found at http://creativecommons.org/licenses/by-nc- nd/3.0/ and provided this copyright notice and the following attribution is given: Anne Bowser and Lea Shanley, New Visions in Citizen Science. Washington, DC: Wood- row Wilson International Center for Scholars, 2013. Users may not use technical measures to obstruct or control the reading or further copying of the copies that they make or distribute. Nongovernmental users may not accept compensation of any manner in exchange for copies. The Woodrow Wilson Center is open to certain derivative uses of this product beyond the limitations of the included Creative Commons License, particularly for educational materials targeted at expanding knowledge on the Commons Lab’s mandate. For more information, please contact [email protected].
    [Show full text]
  • Revisiting Citizen Science Through the Lens of Hybrid Intelligence
    Revisiting Citizen Science Through the Lens of Hybrid Intelligence Janet Rafnera, Miroslav Gajdacza, Gitte Kragha, Arthur Hjortha, Anna Ganderb, Blanka Pala, Aleks Berditchevskaiac, François Greyd, Kobi Gale, Avi Segale, Mike Walmsleyf, Josh Aaron Millerg, Dominik Dellermanh, Muki Haklayi, Pietro Micheluccij, Jacob Shersona a Center for Hybrid Intelligence, Denmark b University of Gothenburg, Sweden c Centre for Collective Intelligence Design, United Kingdom d Citizen Cyberlab e Ben Gurion University, Israel f University of Oxford, England g Northwestern University, USA h Vencortex i University College London, England j Human Computation Institute, USA Abstract Articial Intelligence (AI) can augment and sometimes even replace human cognition. Inspired by eorts to value human agency alongside productivity, we discuss the benets of solving Citizen Science (CS) tasks with Hybrid Intelligence (HI), a synergetic mixture of human and articial intelligence. Currently there is no clear framework or methodology on how to create such an eective mixture. Due to the unique participant-centered set of values and the abundance of tasks drawing upon both human common sense and complex 21st century skills, we believe that the eld of CS oers an invaluable testbed for the development of HI and human-centered AI of the 21st century, while beneting CS as well. In order to investigate this potential, we rst relate CS to adjacent computational disciplines. Then, we demonstrate that CS projects can be grouped according to their potential for HI-enhancement by examining two key dimensions: the level of digitization and the amount of knowledge or experience required for participation. Finally, we propose a framework for types of human-AI interaction in CS based on established criteria of HI.
    [Show full text]
  • RNA Design Rules from a Massive Open Laboratory
    Correction BIOCHEMISTRY Correction for “RNA design rules from a massive open labora- tory,” by Jeehyung Lee, Wipapat Kladwang, Minjae Lee, Daniel Cantu, Martin Azizyan, Hanjoo Kim, Alex Limpaecher, Sungroh Yoon, Adrien Treuille, Rhiju Das, and EteRNA Participants, which appeared in issue 6, February 11, 2014, of Proc Natl Acad Sci USA (111:2122–2127; first published January 27, 2014; 10.1073/ pnas.1313039111). The authors note that Snehal Gaikwad should be added to the author list between Alex Limpaecher and Sungroh Yoon. Snehal Gaikwad should be credited with designing research and per- forming research. The corrected author line, affiliation line, and author contributions appear below. The online version has been corrected. Jeehyung Leea, Wipapat Kladwangb, Minjae Leea, Daniel Cantub, Martin Azizyana, Hanjoo Kimc, Alex Limpaechera, Snehal Gaikwadd, Sungroh Yoonc, Adrien Treuillea,1, Rhiju Dasb,e, and EteRNA Participants aDepartment of Computer Science and dRobotics Institute, Carnegie Mellon University, Pittsburgh, PA 15206; Departments of bBiochemistry and ePhysics, Stanford University, Stanford, CA 94305; and cDepartment of Electrical and Computer Engineering, Seoul National University, Seoul 151-741, Korea Author contributions: J.L., M.A., S.G., S.Y., A.T., R.D., and EteRNA Participants designed research; J.L., W.K., M.L., D.C., M.A., H.K., A.L., S.G., S.Y., A.T., R.D., and EteRNA Participants performed research; J.L., W.K., M.L., D.C., M.A., H.K., A.L., S.Y., A.T., and EteRNA Participants analyzed data; and J.L., A.T., and R.D. wrote the paper. www.pnas.org/cgi/doi/10.1073/pnas.1518065112 E5900 | PNAS | October 27, 2015 | vol.
    [Show full text]
  • Eterna Project Information
    Project Information Overview, History, and Objectives Prepared By: Jonathan Romano Last Revised: 04/15/2021 Revision History Rev. Date Author Revision Description 1 02/28/2020 Jonathan Romano Initial copy 2 02/29/2020 Rhiju Das Copy improvements, historical clarification, improvements to platform development goals 3 03/17/2020 Leonard Copy improvements, move content to Oppenheimer software appendix, additional community section, project note for switch design 4 03/18/2020 Jonathan Romano Copy improvements, add note of upcoming COVID-19 challenge 5 04/14/2021 Sharif Ezzat Copy updates, removed value proposition, updated COVID-19 challenge information Acknowledgements This document is based on prior work by and discussions with a number of individuals affiliated with the Eterna project, including Rhiju Das, Benjamin Keep, Do Soon Kim, Leonard Oppenheimer, Jennifer Pearl, and Boris Rudolfs. 1 Table of Contents Revision History 1 Acknowledgements 1 Table of Contents 2 Introduction 3 Purpose 3 Intended Audience 3 Eterna Project Information 3 Overview 3 Description 3 Notable Achievements 4 Projects 4 Papers 4 Press Coverage 5 History 5 Origins 5 Science 5 Software 6 Players/Community 7 Future Objectives 8 Consortium/Commons Organization 8 Appendix 1: Eterna Software 9 Eterna’s Software Development History 9 Eterna’s Future Software Development 10 2 Introduction Purpose This document provides information about the Eterna project, how it has developed over time, and plans for how it might be maintained and expanded in the future. Intended Audience This background document helps educate Eterna staff, media, volunteers, and potential and actual commercial, academic, and funding partners. Eterna Project Information Overview Description Eterna is first and foremost a citizen science game, supporting research in basic and applied research to predict and design synthetic ribonucleic acid (RNA) structures.
    [Show full text]
  • BIO's Plan to Promote Opportunity and Access for the Underserved
    correspondence build confidence, have an open and honest transgender and queer or questioning) Michelle McMurry-Heath ✉ dialogue about the past, and work with local representation on biotech company boards, Biotechnology Innovation Organization, community leaders who can be that in C-suites and in functional leadership Washington, DC, USA. trusted voice. positions. ✉e-mail: [email protected] While the BIOEquality Agenda will BIO is deeply committed to address inequities in healthcare delivery, both BIOEquality and the Right Published online: 11 September 2020 STEM (science, technology, engineering Mix Matters campaign. In these https://doi.org/10.1038/s41587-020-0688-8 and math) programs and minority difficult and uncertain times, we will entrepreneurship, BIOEquality complements continue to build support for a more Competing interests M.M.-H. works for industry trade organization the the Right Mix Matters initiative we launched equitable future for the biotech sector and Biotechnology Innovation Organization (BIO). She was last year to accelerate gender, racial, the millions of patients across the world who employed by Johnson & Johnson and holds stock in ethnic and LGBTQ (lesbian, gay, bisexual, depend on our success. ❐ Johnson & Johnson. Leveling up citizen science To the Editor — Over the past decade, online science discovery games (SDGs) have become an increasingly popular practice for engaging the public in research activities. This methodology has had the most impact in molecular and cell biology, where participants are recruited for not only data collection and classification tasks, but also solving complex computational problems that require human supervision or insight. As the life sciences move toward increasingly large and ambitious projects, however, there is a need to complement existing models that try to attract users to yet another third-party website.
    [Show full text]
  • De Novo Protein Design by Citizen Scientists Brian Koepnick1,2, Jeff Flatten3, Tamir Husain3, Alex Ford1,2, Daniel-Adriano Silva1,2, Matthew J
    LETTER https://doi.org/10.1038/s41586-019-1274-4 De novo protein design by citizen scientists Brian Koepnick1,2, Jeff Flatten3, Tamir Husain3, Alex Ford1,2, Daniel-Adriano Silva1,2, Matthew J. Bick1,2, Aaron Bauer3, Gaohua Liu4,5, Yojiro Ishida6, Alexander Boykov11, Roger D. Estep11, Susan Kleinfelter11, Toke Nørgård-Solano11, Linda Wei11, Foldit Players10, Gaetano T. Montelione4,6, Frank DiMaio1,2, Zoran Popović3, Firas Khatib7, Seth Cooper8 & David Baker1,2,9* Online citizen science projects such as GalaxyZoo1, Eyewire2 and the designers. Disentangling the role of expert knowledge is particu- Phylo3 have proven very successful for data collection, annotation larly difficult for the extremely open-ended challenge posed by the first and processing, but for the most part have harnessed human pattern- subproblem (that is, crafting a plausible backbone), for which there are recognition skills rather than human creativity. An exception is the a practically unlimited number of solutions. Because full computer game EteRNA4, in which game players learn to build new RNA enumeration of backbones is not possible, there is considerable room structures by exploring the discrete two-dimensional space of for human creativity and intuition in generating and designing new Watson–Crick base pairing possibilities. Building new proteins, protein structures. however, is a more challenging task to present in a game, as both the To investigate how crowd-based creativity could contribute to solving representation and evaluation of a protein structure are intrinsically the de novo protein design problem, we incorporated de novo design three-dimensional. We posed the challenge of de novo protein tools into the protein-folding game Foldit.
    [Show full text]