Embryonic Myosin Heavy-Chain Mutations Cause Distal Arthrogryposis and Developmental Myosin Myopathy That Persists Postnatally

ORIGINAL CONTRIBUTION Embryonic Myosin Heavy-Chain Mutations Cause Distal Arthrogryposis and Developmental Myosin Myopathy That Persists Postnatally

Homa Tajsharghi, PhD; Eva Kimber, MD; Anna-Karin Kroksmark, PhD; Ragnar Jerre, MD; Mar Tulinius, MD, PhD; Anders Oldfors, MD, PhD

Background: Myosin is a molecular motor and the es- biopsy specimens were obtained, and in addition to mor- sential part of the thick filament of striated muscle. The phologic analysis, the expression of MyHC isoforms was expression of myosin heavy-chain (MyHC) isoforms is investigated at the protein and transcript levels. developmentally regulated. The embryonic isoform en- coded from MYH3 (OMIM *160720) is expressed dur- Results: We identified patients from 3 families with novel ing fetal life. Recently, mutations in MYH3 were demon- MYH3 mutations. These mutations affect developmen- strated to be associated with congenital joint contractures, tally conserved residues that are located in different re- that is, Freeman-Sheldon and Sheldon-Hall syndromes, gions of the adenosine triphosphate–binding pocket of which are both distal arthrogryposis syndromes. Muta- the MyHC head. The embryonic (MYH3) isoform was not tions in other MyHC isoforms cause myopathy. It is un- detected in any of the muscle biopsy samples, indicat- known whether MYH3 mutations cause myopathy be- ing a normal developmental downregulation of MYH3 in these patients. However, morphologic analysis of muscle cause muscle tissue has not been studied. biopsy specimens from the 4 patients revealed mild and Objectives: To determine whether novel MYH3 muta- variable myopathic features and a pathologic upregula- tions are associated with distal arthrogryposis and to dem- tion of the fetal MyHC isoform (MYH8) in 1 patient. onstrate myopathic changes in muscle biopsy speci- Conclusions: Distal arthrogryposis associated with MYH3 mens from 4 patients with distal arthrogryposis and MYH3 mutations is secondary to myosin myopathy, and post- mutations. natal muscle manifestations are variable. Design: In a cohort of patients with distal arthrogryposis, we analyzed the entire coding sequence of MYH3. Muscle Arch Neurol. 2008;65(8):1083-1090

YOSIN IS THE MAIN COM- gressive muscle weakness. Mutations have ponent of skeletal been reported in 2 of 3 MyHC isoforms ex- muscle sarcomeric pressed in adult limb skeletal muscle. In thick filaments addition to familial hypertrophic or di- (Figure 1). It con- lated cardiomyopathy,11 mutations in the sistsM of 2 globular heads attached to a long slow or ␤-cardiac MyHC gene (MYH7) ␣-helical–coiled coil rod domain. It is a cause skeletal myopathies such as myo- hexamer composed of 1 pair of myosin sin storage myopathy14-18 and Laing early- heavy chains (MyHCs) and 2 pairs of myo- onset distal myopathy.12,13 A mutation in sin light chains. The myosin globular head the MyHC IIa gene (MYH2) is associated Author Affiliations: domain of the myosin motor (myosin sub- with dominant myopathy characterized by Departments of Pathology (Drs Tajsharghi and Oldfors) fragment 1 [S1]) contains actin and aden- ophthalmoplegia, congenital joint con- and Orthopedics (Dr Jerre), osine triphosphate (ATP)–binding regions tractures, and rimmed vacuoles in muscle 7-9 Sahlgrenska University and is responsible for the force transduc- fibers. Recently, Freeman-Sheldon syn- Hospital; Departments of tion properties of myosin.1 Several striated drome and Sheldon-Hall syndrome, both Pediatrics, Institute for Clinical muscle MyHC genes have been de- distal arthrogryposis syndromes (DA2A Sciences, Sahlgrenska Academy scribed.2 The expression of myosin iso- and DA2B, respectively), have been re- at Go¨teborg University forms is developmentally regulated.3-5 ported as the first disorders associated with (Drs Kimber, Kroksmark, and Myosin myopathies have evolved as a mutations in embryonic MyHC (MYH3).10 Tulinius) and Queen Silvia’s new group of muscle diseases caused by Distal arthrogryposis syndromes are char- Children’s Hospital mutations in skeletal muscle myosin acterized by congenital contractures of at (Drs Kroksmark and Tulinius), 6 Go¨teborg; and Department of heavy-chain (MyHC) genes (Table 1). least 2 different body areas, with fre- Neuropediatrics, Uppsala The phenotypes of these diseases vary, quent involvement of the hands and feet, University Children´s Hospital, ranging from prenatal nonprogressive ar- but there may also be proximal joint Uppsala (Dr Kimber); Sweden. throgryposis syndromes to adult-onset pro- involvement.20,21

(REPRINTED) ARCH NEUROL / VOL 65 (NO. 8), AUG 2008 WWW.ARCHNEUROL.COM 1083

Z Z M B Tropomyosin Thick filament backbone (light meromyosin)

Titin

Myosin head (S1)

Actin Troponin T Troponin I Troponin C

Figure 1. Schematic illustration of the sarcomere. A, Electron micrograph of the skeletal muscle sarcomere. B, Schematic illustration of the sarcomere. Z- and M-bands are indicated. The thin filaments contain actin, tropomyosin, and troponin complex composed of troponins C, I, and T. The thick filaments are composed of myosin, with the globular heads forming cross-bridges with thin filaments and the light meromyosin, which constitutes the thick filament backbone and lies along the thick filament axis.

Table 1. Diseases Associated With Mutations in Skeletal Muscle Myosin Heavy Chains

Period of MyHC Muscle Expression in Gene Protein Fiber Type Skeletal Muscle3-5 Disease Major Clinical Characteristics References MYH2 MyHC IIa Type 2A From around Autosomal dominant myopathy Ophthalmoplegia, congenital 7-9 extraocular 24-wk with rimmed vacuoles, joint contractures, mild muscles gestational age ophthalmoplegia, and proximal muscle weakness in to adulthood congenital joint contractures childhood, and progressive course in adulthood MYH3 Embryonic MyHC Fetal development; From 6- to 24-wk Freeman-Sheldon syndrome Facial dysmorphism and 10 muscle gestational age; and Sheldon-Hall syndrome congenital joint contractures regeneration completely with predominant distal eliminated by involvement (distal 37-wk arthrogryposis) gestational age Familial hypertrophic or dilated Cardiac failure or sudden 11 cardiomyopathy cardiac death MYH7 MyHC I (slow) Skeletal muscle From 6- to 14-wk Laing early-onset distal Onset of muscle weakness in 12,13 (␤-cardiac type 1 (heart gestational age myopathy childhood; slowly progressive MyHC) ventricles) to adulthood with initial weakness of ankle dorsiflexion; rarely cardiomyopathy Myosin storage myopathy Onset from childhood to middle 14-18 age; weakness of limb girdle, scapuloperoneal, or distal muscles; mild or severe weakness affecting ambulation; rarely cardiomyopathy MYH8 Perinatal MyHC Fetal development; From 7- to 15-wk Trismus and Congenital contractures of 19 muscle gestational age pseudocamptodactyly hands, feet, and jaws with regeneration to around birth syndrome trismus and hand and foot deformities with pseudocamptodactyly

(REPRINTED) ARCH NEUROL / VOL 65 (NO. 8), AUG 2008 WWW.ARCHNEUROL.COM 1084

©2008 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/25/2021 Distal arthrogryposis syndromes are associated with (Figure 2). Patient 3 was a man with a milder form of missense mutations in various genes coding for sarco- DA2B. The clinical features included contractures, primarily meric proteins. The genes thus far demonstrated to be in the hands, with mild involvement of the jaws, feet, and involved in distal arthrogryposis syndromes are TNNI2 elbows, and normal muscle strength (Figure 3). No (troponin I) (OMIM *191043),22,23 TPM2 (␤- involvement of the shoulder joints was noted. He had 3 children who all had signs of distal arthrogryposis. Patient 4 had tropomyosin) (OMIM *190990),23,24 TNNT3 (troponin 25 sporadic DA2A with ptosis, very short stature, small and T) (OMIM *606092), MYH8 (perinatal MyHC) (OMIM contracted mouth, and joint contractures in the proximal 19 10 *160741), and MYH3 (embryonic MyHC). These find- and distal joints. Joint involvement included the ankles and ings indicate that distal arthrogryposis syndromes are feet. Muscle strength was difficult to evaluate owing to caused by myopathies with onset during fetal develop- young age, which was 4 years at the last assessment. ment, but few studies have involved analysis of muscle tissue in these diseases.22,24,26 In this article, we report novel GENETIC ANALYSES MYH3 mutations associated with distal arthrogryposis and demonstrate myopathic changes in muscle biopsy speci- Extraction of genomic DNA, sequence analysis, and the mens from 4 patients with distal arthrogryposis and MYH3 polymerase chain reaction were performed as previously mutations. described.22 The entire coding sequence of MYH3 was sequenced using previously described primers.10 The presence of each mutation was confirmed in each affected indi- METHODS vidual at restriction fragment length polymorphism analysis (Table 2). The restriction fragment length polymorphism PATIENTS was also used to screen for the presence of each mutation in 200 control chromosomes. In addition to MYH3, the entire Patients 1 and 2 were mother and daughter with DA2B. The coding region of the TPM2, TNNI2, TNNT3, TNNI1 (OMIM clinical features included short stature, scoliosis, mild facial *191042), TNNT1 (OMIM *191041), TNNC1 (OMIM dysmorphism, decreased muscle strength, and contractures *191040), and TNNC2 (OMIM *191039) genes was in proximal and distal joints including the shoulder joints sequenced in patients 1 and 3.

Figure 2. Patients 1 (A) and 2 (B) showing palmar malposition of the Figure 3. Patient 3 showing short flexor tendons and extension defects in thumbs and mild ulnar deviation and extension defects in the proximal the metacarpophalangeal joints. interphalangeal joints in patient 1.

Table 2. Polymerase Chain Reaction Primers and Restriction Enzymes Used for Mutation Analysis

Nucleotide Amino Acid Change Change Exon Forward Primers Reverse Primers Enzymes C602T T178M 5 5Ј-GGGTAGAATCGGGAAGCTCT-3Ј 5Ј-TGCTCCAAACACTTTCTAATGAA-3Ј NlaIII C769T A234T 7 5Ј-ATCCCCTGCTGGAGGCCTTTGGGGAC-3Ј 5Ј-AGAGAATGTGTGCGACAAGTAACTT-3Ј BsaHI A1454G D462G 13 5Ј-CCAACCTTTGAAACTTCTGGA-3Ј 5Ј-TCATGAAACCAATTTCCCTCA-3Ј MwoI

(REPRINTED) ARCH NEUROL / VOL 65 (NO. 8), AUG 2008 WWW.ARCHNEUROL.COM 1085

TTTCCCCCCCCCAAAGG T AA T GN AAAA A AA T GGG AA T TTCCCCC TAAGGGG T TTN TT CCC AAA GGG CCCCC T A A GGAAAACCCCC ATTTTC A T GNGGGGGGGGAAAA TTTTAAAAA CCC T T GluPhe Gly Ala IIe Leu Val Gly Ile Phe His Arg Val Thr Lys Asn GlyPhe Ala Glu Leu Glu Asn Gln Ser IIe LeuIle Thr➞Met Asp➞Gly Ala➞Thr 467 466 465 464 463 462 461 460 459 458 457 456 238 237 236 235234 233 232 231 230 229 228 171 172 173 174 175 176 177178

B IIa, 48%

I, 49%

I, 54% IIa, 52% IIx, 18% I, 81% Ila I I, 46% IIx, 8% IIa, 28%

Embryonic Ilx Embryonic, 0% IIa, 11% Embryonic, 0% IIx, 3% Embryonic, 0% Embryonic, 0% IIx, 2%

Control Subject Patient 1 Patient 2 Patient 3 Patient 4 Relative Expression of Myosin Heavy-Chain Messenger RNA

Figure 4. Genetic analyses of the embryonic MyHC gene (MYH3 ) in patients with distal arthrogryposis syndromes and the positions of the mutations. A, Sequence chromatograms of part of exon 13, exon 7, and exon 5 of MYH3 in patients 1 through 4, respectively. The T178M mutation is shown in the sense orientation, and the A234T and D462G mutations are shown in the reverse orientation on the genomic DNA. B, Illustration of quantitative analysis of relative expression of myosin heavy-chain (MyHC) I, MyHC IIa, MyHC IIx, and embryonic MyHC messenger RNA based on reverse transcriptase–polymerase chain reaction (PCR). The PCR was performed on complementary DNA with a fluorescein-labeled (6-carboxyfluorescein [6-FAM]) forward primer combined with backward primer to amplify MyHC IIa, MyHC IIx, and embryonic MyHC. Amplification of MyHC IIa, MyHC IIx, and embryonic MyHC results in 505–, 499–, and 496–base pair fragments, respectively. The MyHC I was amplified by using an MyHC I-specific fluorescein-labeled (hexachlorocarboxyfluorescein [HEX]) forward primer combined with the same backward primer. The fluorescent PCR products were separated in polyacrylamide gels, and the intensity of the respective peaks was analyzed. A muscle biopsy specimen with ongoing regeneration was used as control to detect the expression of embryonic MyHC.

MORPHOLOGIC ANALYSIS OF MUSCLE TISSUE labeled (hexachlorocarboxyfluorescein [HEX]) forward primer, TCCCCAAGGCCACCGACATGA, corresponding to nucleotide Morphologic enzyme-histochemical and immunohistochemi- 1697-1717 of human MyHC I complementary DNA (GenBank cal analyses were performed as previously described.9 To iden- XM-033374) combined with the same backward primer. Ampli- tify embryonic (MYH3) MyHC expression, a monoclonal an- fication of MyHC I also results in a 496–base pair fragment. tibody, F1.652 (Developmental Studies Hydridoma Bank, Department of Biologic Sciences, University of Iowa, Iowa City), at a concentration of 1:100 was used. ANALYSIS OF MYHC COMPOSITION IN MUSCLE TISSUE

ANALYSIS OF MYHC TRANSCRIPTS Proteins extracted from two 10-µm-thick sections of muscle IN MUSCLE TISSUE biopsy specimens were separated using 8% sodium dodecylsulfate–polyacrylamide gel electrophoresis.9 Total RNA was extracted from muscle tissue from the patients and control subjects as previously described.9 In addition to analysis of the percentage of the 3 major MyHC isoforms, MyHC I, MyHC RESULTS IIa, and MyHC IIx, by using previously described primers,9 the polymerase chain reaction was performed on complementary DNA GENETIC ANALYSES with a fluorescein-labeled (6-carboxyfluorescein [FAM]) forward primer, TCCCTAAGGCAACAGACACCT, corresponding to The entire coding sequence of MYH3 was investigated in nucleotide 1628-1648 of human MyHC IIa complementary DNA (GenBank AF111784) combined with a previously described back- the index subjects of the respective families. Three dif- ward primer to amplify MyHC IIa, MyHC IIx, and embryonic ferent missense mutations were identified (Figure 4A). MyHC. Amplification of MyHC IIa, MyHC IIx, and embryonic In patients 1 and 2 with DA2B, a heterozygous missense MYHC results in 505–, 499–, and 496–base pair fragments, respec- mutation in exon 13, A1454G, changing the negatively tively.MyHCIwasamplifiedusinganMyHCI–specificfluorescein- charged aspartate at position 462 to the nonpolar gly-

(REPRINTED) ARCH NEUROL / VOL 65 (NO. 8), AUG 2008 WWW.ARCHNEUROL.COM 1086

B D F

Figure 5. Muscle biopsy specimens from the deltoid muscle of patients 1 (A and B), 2 (C and D), and 3 (E and F) show increased variability of fiber size owing to scattered, small, type-1 fibers. This change is most obvious in patients 1 and 2. A, C, and E, Hematoxylin-eosin; B, D, and F, adenosine triphosphatase, pH 4.3. Bars indicate 65 µm.

cine, was identified. The D462G mutation was not iden- The relative amount of the expression of MyHC iso- tified in any of the 4 investigated relatives without distal forms at the protein level was determined using sodium arthrogryposis. In patient 3 with DA2B, a heterozygous dodecylsulfate–polyacrylamide gel electrophoresis. It missense mutation in exon 7, C769T, changing the non- roughly corresponded to the relative amounts of mes- polar alanine at position 234 to the polar threonine, was senger RNA (H.T., unpublished data, September 4, 2006). identified. The mutation was also identified in all 3 affected children of patient 3. In patient 4 with sporadic MORPHOLOGIC ANALYSIS DA2A, a heterozygous missense mutation in exon 5, C602T, changing the highly conserved threonine at position 178 to the methionine, was identified. The T178M Muscle biopsy specimens from the deltoid muscle in pa- was an apparent de novo mutation because neither of the tients 1 and 2 exhibited slight pathologic changes. There parents carried the mutation. was increased variability of fiber size owing to the pres- The mutations were confirmed at restriction fragment ence of frequent small type-1 fibers (Figure 5). There length polymorphism analysis and were not identified in was also a slightly abnormal type-1 fiber predominance. 200 control chromosomes (Table 2). One common poly- A muscle biopsy specimen from the deltoid muscle of pa- morphism at position 1192 changing alanine to threonine tient 3 showed scattered, small, type-1 fibers but no ob- was also identified in patients as well as control subjects. vious pathologic changes (Figure 5). Muscle biopsy specimens from the tibialis anterior muscle of patient 4 at ages EXPRESSION OF MYHC ISOFORMS 15 months and 5 years showed slight pathologic changes (Figure 6). The major abnormality at age 15 months The relative expression of the 3 major MyHC isoforms in was numerous fibers (Ͼ20% of all fibers) expressing the skeletal muscle and the presence of embryonic MyHC were fetal (perinatal) isoform of MyHC (MYH8). Specimens determined at the messenger RNA level using reverse tran- from 8 controls aged 10 to 15 months showed only oc- scription–polymerase chain reaction analysis (Figure 4B). casional muscle fibers (0%-2% of all fibers) expressing None of the muscle biopsy specimens from the patients fetal MyHC. The biopsy specimen obtained at age 5 years demonstrated expression of embryonic MyHC. However, showed marked type-1 fiber predominance and scat- analysis of a muscle biopsy specimen with ongoing regen- tered, small, type-1 fibers. No fibers expressed fetal MyHC eration, which was used as a positive control to detect em- at age 5 years in patient 4. Expression of embryonic MyHC bryonic MyHC, demonstrated expression of this isoform. (MYH3) was not identified in any patients.

(REPRINTED) ARCH NEUROL / VOL 65 (NO. 8), AUG 2008 WWW.ARCHNEUROL.COM 1087

B D F

Figure 6. Muscle biopsy specimens from the tibialis anterior muscle of patient 4 at age 15 months (A, C, and D) and at 5 years (E and F). A, At age 15 months, frequent fibers expressed the fetal (perinatal) isoform of myosin heavy-chain (MyHC). At age 15 months (C and D) and 5 years (E and F), there were minor pathologic changes with slightly increased interstitial connective tissue and frequent small type-1 fibers. B, A specimen from a representative healthy control subject aged 11 months shows only a few scattered muscle fibers expressing fetal MyHC. C and E, Hematoxylin-eosin; D and F, adenosine triphosphatase, pH 4.3. Bars indicate 50 µm.

ATP-binding site

Actin-binding site

Figure 7. Ribbon model of myosin heavy-chain (MyHC) subfragment 1 (S1) of chicken skeletal muscle. The adenosine triphosphate (ATP)– and actin-binding sites are indicated. The highly conserved ATP-binding site (Gly179-Thr186) is shown in red, and yellow spheres indicate the position of T178 in human embryonic MyHC, which was mutated (T178M) in patient 4. The position of A234, which was mutated (A234T) in patient 3, is indicated by light blue spheres. Orange spheres indicate the position of D462, which was mutated (D462G) in patients 1 and 2. The ribbon diagram was drawn using commercially available software (WebLab ViewerLite 3.2; Molecular Simulations, Inc, San Diego, California).

COMMENT logic evidence of myopathy in these patients. The 3 identified MYH3 mutations are located in different regions of the ATP-binding pocket of the MyHC of the myosin mo- In this study, we identified 3 MYH3 mutations in 4 pa- tor S1 domain (Figure 7). Their locations indicate that tients with DA2A and DA2B and also obtained morpho- they may disrupt ATP binding or ATP hydrolysis. The

(REPRINTED) ARCH NEUROL / VOL 65 (NO. 8), AUG 2008 WWW.ARCHNEUROL.COM 1088

©2008 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/25/2021 S261F R762C A234T D462G A1637V S292F R672H delL841 T178M D517Y E375K G769V K838E D1622A ∗ Y583S T178I V825D

ATG TAG

2 7 11 13 17 21 33 40

S1 S2 LMM

Figure 8. Genomic structure of MYH3 with location of the distal arthrogryposis–causing mutations and the embryonic MyHC protein. The 3 mutations reported herein are indicated in red. *The nucleotide substitution, C602T, which leads to the amino acid substitution threonine to methionine at position 178 (T178M), was erroneously described as giving rise to a threonine 178 isoleucine substitution (T178I) in a previous report.10 The major proteolytic subfragments S1, S2, and light meromyosin (LMM) of the MyHC protein are indicated.

mutated residue, T178M, in patient 4 is situated adja- (MYH2), in which there is an increased expression of the cent to the base of the ATP-binding pocket in the amino mutated MyHC IIa with age, which is accompanied by terminal 25-kDa domain known as the phosphate- muscle degeneration and progressive muscle weakness binding loop.27 The phosphate-binding loop is com- and wasting.8,9 However, the long-term course of joint posed of the invariant GESGAGKT (179-186 of embry- contractures and muscle weakness in patients with dis- onic myosin heavy-chain) sequence that is universally tal arthrogryposis associated with MYH3 mutations re- conserved in all myosins sequenced to date.27 Further- mains to be investigated. more, mutations in the T178 residue have previously been To our knowledge, few studies have addressed the reported in 3 patients with DA2A and 2 patients with question of muscle pathology in distal arthrogryposis as- DA2B.10 The mutated residue in patient 3, A234, is highly sociated with mutations in sarcomeric proteins. How- conserved in other human MyHC isoforms and during ever, available studies demonstrate that patients with evolution. It is located close to the helix (Leu217- distal arthrogryposis caused by mutations in the Gly232) that forms part of the nucleotide-binding pocket ␤-tropomyosin and troponin I genes may have in the 50-kDa segment of the S1 domain.27,28 The D462G myopathy.22,24 mutation in patients 1 and 2 is located in the highly con- In conclusion, the results of this study add MYH3 to served region, next to Ile463 and Gly465, which are of the list of MyHC genes that are involved in hereditary myo- major importance for the conformational changes dur- sin myopathies.6 Additional studies are necessary to es- ing ATP binding and hydrolysis.27,28 Because the ATP- tablish how MYH3 mutations affect structural and func- binding pocket governs the release of actin from the myo- tional dysfunction during fetal development. sin on nucleotide binding, the mutations may affect myosin-actin intraction.27 These mutations add to the pre- Accepted for Publication: February 25, 2008. viously reported mutations, which are distributed through Correspondence: Homa Tajsharghi, PhD, Department of the MYH3 gene10 (Figure 8). Pathology, Sahlgrenska University Hospital, Gula Stra˚- Embryonic MyHC is normally not expressed in post- ket 8, SE-413 45 Go¨teborg, Sweden (homa.tajsharghi natal human limb muscles unless there is ongoing muscle @gu.se). regeneration. Because there was a mutation in MYH3 and Author Contributions: Dr Tajsharghi had full access to some patients experienced muscle weakness, we inves- all of the data in the study and takes responsibility for tigated the expression of this gene at both the protein and the integrity of the data and the accuracy of the data analy- the transcript levels. We found no embryonic MyHC in sis. Study concept and design: Tajsharghi, Kimber, any of the examined samples. However, the muscle tis- Kroksmark, Tulinius, and Oldfors. Acquisition of data: sue was not free of pathologic changes. The abnormally Tajsharghi, Kimber, Kroksmark, Jerre, Tulinius, and high expression of fetal MyHC at age 15 months in pa- Oldfors. Analysis and interpretation of data: Tajsharghi, tient 4 may possibly reflect a developmental defect be- Kimber, Kroksmark, Tulinius, and Oldfors. Drafting of cause fetal MyHC is expressed during muscle develop- the manuscript: Tajsharghi. Critical revision of the manu- ment and then usually is downregulated perinatally. script for important intellectual content: Tajsharghi, Kimber, Other pathologic alterations were type-1 fiber pre- Kroksmark, Jerre, Tulinius, and Oldfors. Statistical analy- dominance and frequent small type-1 fibers. In patient sis: Tajsharghi. Obtained funding: Kimber and Oldfors. Ad- 4, there was also a slight increase in interstitial connec- ministrative, technical, and material support: Tajsharghi, tive tissue. It may, therefore, be speculated that in pa- Kroksmark, Jerre, and Tulinius. Study supervision: tients with distal arthrogryposis caused by MYH3 muta- Tajsharghi. tions, there is a severe myopathy during fetal development Financial Disclosure: None reported. that causes joint contractures, and when the embryonic Funding/Support: This study was supported by a grant MyHC is downregulated, there is a restitution of muscle from the Swedish Research Council (Project No. 7122) development, leaving some residual defects in muscle. (Dr Oldfors), Association Francaise Contre le Myopa- This may be compared with myopathy with congenital thies (Dr Oldfors), and Linne´a och Josef Carlssons Stiftelse joint contractures caused by mutations in MyHC IIa (Dr Kimber).

(REPRINTED) ARCH NEUROL / VOL 65 (NO. 8), AUG 2008 WWW.ARCHNEUROL.COM 1089

©2008 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/25/2021 Additional Contributions: Gabriella Alme´n, BSc, and Lili 14. Tajsharghi H, Thornell LE, Lindberg C, Lindvall B, Henriksson KG, Oldfors A. Seifi, BSc, provided technical assistance. We thank the Myosin storage myopathy associated with a heterozygous missense mutation in MYH7. Ann Neurol. 2003;54(4):494-500. patients for their participation in this study. 15. Tajsharghi H, Oldfors A, Macleod DP, Swash M. Homozygous mutation in MYH7 in myosin storage myopathy and cardiomyopathy [case report]. Neurology. 2007; REFERENCES 68(12):962. 16. Laing NG, Ceuterick-de Groote C, Dye DE, et al. Myosin storage myopathy: slow skeletal myosin (MYH7 ) mutation in two isolated cases. Neurology. 2005; 1. Weiss A, Schiaffino S, Leinwand LA. Comparative sequence analysis of the com- 64(3):527-529. plete human sarcomeric myosin heavy chain family: implications for functional diversity. J Mol Biol. 1999;290(1):61-75. 17. Tajsharghi H, Oldfors A, Swash M. Myosin storage myopathy with cardiomyo- 2. Weiss A, Leinwand LA. The mammalian myosin heavy chain gene family. Annu pathy [letter]. Neuromuscul Disord. 2007;17(9-10):725. Rev Cell Dev Biol. 1996;12:417-439. 18. Bohlega S, Abu-Amero SN, Wakil SM, et al. Mutation of the slow myosin heavy 3. Butler-Browne GS, Barbet JP, Thornell LE. Myosin heavy and light chain expres- chain rod domain underlies hyaline body myopathy. Neurology. 2004;62(9): sion during human skeletal muscle development and precocious muscle matura- 1518-1521. tion induced by thyroid hormone. Anat Embryol (Berl). 1990;181(6):513-522. 19. Veugelers M, Bressan M, McDermott DA, et al. Mutation of perinatal myosin heavy 4. Hughes SM, Cho M, Karsch-Mizrachi I, et al. Three slow myosin heavy chains chain associated with a Carney complex variant. N Engl J Med. 2004;351(5): sequentially expressed in developing mammalian skeletal muscle. Dev Biol. 1993; 460-469. 158(1):183-199. 20. Hall JG, Reed SD, Greene G. The distal arthrogryposes: delineation of new en- 5. Cho M, Hughes SM, Karsch-Mizrachi I, Travis M, Leinwand LA, Blau HM. Fast tities; review and nosologic discussion. Am J Med Genet. 1982;11(2):185- myosin heavy chains expressed in secondary mammalian muscle fibers at the 239. time of their inception. J Cell Sci. 1994;107(pt 9):2361-2371. 21. Bamshad M, Jorde LB, Carey JC. A revised and extended classification of the 6. Oldfors A. Hereditary myosin myopathies. Neuromuscul Disord. 2007;17(5): distal arthrogryposes. Am J Med Genet. 1996;65(4):277-281. 355-367. 22. Kimber E, Tajsharghi H, Kroksmark AK, Oldfors A, Tulinius M. A mutation in the 7. Darin N, Kyllerman M, Wahlstro¨m J, Martinsson T, Oldfors A. Autosomal domi- fast skeletal muscle troponin I gene causes myopathy and distal arthrogryposis. nant myopathy with congenital joint contractures, ophthalmoplegia, and rimmed Neurology. 2006;67(4):597-601. vacuoles. Ann Neurol. 1998;44(2):242-248. 23. Sung SS, Brassington AM, Grannatt K, et al. Mutations in genes encoding fast- 8. Martinsson T, Oldfors A, Darin N, et al. Autosomal dominant myopathy: mis- twitch contractile proteins cause distal arthrogryposis syndromes. Am J Hum sense mutation (Glu-706–Ͼ Lys) in the myosin heavy chain IIa gene. Proc Natl Genet. 2003;72(3):681-690. Acad Sci U S A. 2000;97(26):14614-14619. 24. Tajsharghi H, Kimber E, Holmgren D, Tulinius M, Oldfors A. Distal arthrogrypo- 9. Tajsharghi H, Thornell LE, Darin N, et al. Myosin heavy chain IIa gene mutation sis and muscle weakness associated with a beta-tropomyosin mutation. Neurology. E706K is pathogenic and its expression increases with age. Neurology. 2002; 2007;68(10):772-775. 58(5):780-786. 25. Sung SS, Brassington AM, Krakowiak PA, Carey JC, Jorde LB, Bamshad M. 10. Toydemir RM, Rutherford A, Whitby FG, Jorde LB, Carey JC, Bamshad MJ. Mutations in embryonic myosin heavy chain (MYH3 ) cause Freeman-Sheldon Mutations in TNNT3 cause multiple congenital contractures: a second locus for syndrome and Sheldon-Hall syndrome. Nat Genet. 2006;38(5):561-565. distal arthrogryposis type 2B. Am J Hum Genet. 2003;73(1):212-214. 11. Seidman JG, Seidman C. The genetic basis for cardiomyopathy: from mutation 26. Ochala J, Li M, Tajsharghi H, et al. Effects of a R133W beta-tropomyosin muta- identification to mechanistic paradigms. Cell. 2001;104(4):557-567. tion on regulation of muscle contraction in single human muscle fibres. J Physiol. 12. Meredith C, Herrmann R, Parry C, et al. Mutations in the slow skeletal muscle 2007;581(pt 3):1283-1292. fiber myosin heavy chain gene (MYH7 ) cause Laing early-onset distal myopa- 27. Ruppel KM, Spudich JA. Structure-function analysis of the motor domain of myosin. thy (MPD1). Am J Hum Genet. 2004;75(4):703-708. Annu Rev Cell Dev Biol. 1996;12:543-573. 13. Darin N, Tajsharghi H, Ostman-Smith I, Gilljam T, Oldfors A. New skeletal my- 28. Rayment I, Rypniewski WR, Schmidt-Ba¨se K, et al. Three-dimensional structure opathy and cardiomyopathy associated with a missense mutation in MYH7. of myosin subfragment-1: a molecular motor. Science. 1993;261(5117): Neurology. 2007;68(23):2041-2042. 50-58.

Announcement

Sign Up for Alerts—It’s Free! Archives of Neurology of- fers the ability to automatically receive the table of con- tents of Archives when it is published online. This also allows you to link to individual articles and view the ab- stract. It makes keeping up-to-date even easier! Go to http://pubs.ama-assn.org/misc/alerts.dtl to sign up for this free service.

(REPRINTED) ARCH NEUROL / VOL 65 (NO. 8), AUG 2008 WWW.ARCHNEUROL.COM 1090

©2008 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/25/2021 13. Tang MX, Cross P, Andrews H, et al. Incidence of AD in African-Americans, Ca- cortical features: prevalence, clinical characteristics, and association with car- ribbean Hispanics, and Caucasians in northern Manhattan. Neurology. 2001; diovascular risk factors in community-dwelling older persons (the InCHIANTI 56(1):49-56. Study). J Am Geriatr Soc. 2003;51(8):1064-1071. 14. Brickman AM, Schupf N, Manly JJ, et al. Brain morphology in older African Ameri- 27. Arvanitakis Z, Wilson RS, Schneider JA, Bienias JL, Evans DA, Bennett DA. cans, Caribbean Hispanics, and whites from northern Manhattan. Arch Neurol. Diabetes mellitus and progression of rigidity and gait disturbance in older persons. 2008;65(8):1053-1061. Neurology. 2004;63(6):996-1001. 15. Louis ED, Tang MX, Mayeux R. Factor structure of parkinsonian signs in the com- 28. Arvanitakis Z, Wilson RS, Bienias JL, Bennett DA. Diabetes and parkinsonian signs munity-dwelling elderly. Mov Disord. 2004;19(3):268-272. in older persons. Alzheimer Dis Assoc Disord. 2007;21(2):144-149. 16. Louis ED, Luchsinger JA. History of vascular disease and mild parkinsonian signs 29. Rosano C, Brach J, Longstreth WT Jr, Newman AB. Quantitative measures of in community-dwelling elderly individuals. Arch Neurol. 2006;63(5):717-722. gait characteristics indicate prevalence of underlying subclinical structural brain 17. Stern Y, Andrews H, Pittman J, et al. Diagnosis of dementia in a heterogeneous abnormalities in high-functioning older adults. Neuroepidemiology. 2006;26 population: development of a neuropsychological paradigm-based diagnosis of (1):52-60. dementia and quantified correction for the effects of education. Arch Neurol. 1992; 30. Tolosa ES, Santamaria J. Parkinsonism and basal ganglia infarcts. Neurology. 49(5):453-460. 1984;34(11):1516-1518. 18. American Psychiatric Association. Diagnostic and Statistical Manual of Mental 31. Richards M, Stern Y, Mayeux R. Subtle extrapyramidal signs can predict the de- Disorders. 3rd ed, revised. Washington, DC: American Psychiatric Association; velopment of dementia in elderly individuals. Neurology. 1993;43(11):2184- 1987. 2188. 19. Andresen EM, Malmgren JA, Carter WB, Patrick DL. Screening for depression in 32. Schneider JA, Li JL, Li Y, Wilson RS, Kordower JH, Bennett DA. Substantia ni- well older adults: evaluation of a short form of the CES-D (Center for Epidemio- gra tangles are related to gait impairment in older persons. Ann Neurol. 2006; logic Studies Depression Scale). AmJPrevMed. 1994;10(2):77-84. 20. Grunebaum MF, Oquendo MA, Manly JJ. Depressive symptoms and antidepres- 59(1):166-173. sant use in a random community sample of ethnically diverse, urban elder per- 33. Coffey CE, Wilkinson WE, Parashos IA, et al. Quantitative cerebral anatomy of sons [printed online May 25, 2007]. J Affect Disord. 2008;105(1-3):273-277. the aging human brain: a cross-sectional study using magnetic resonance imaging. 21. Buschke H, Fuld PA. Evaluating storage, retention, and retrieval in disordered Neurology. 1992;42(3, pt 1):527-536. memory and learning. Neurology. 1974;24(11):1019-1025. 34. Bhatia S, Bookheimer SY, Gaillard WD, Theodore WH. Measurement of whole 22. DeCarli C, Maisog J, Murphy DG, Teichberg D, Rapoport SI, Horwitz B. Method temporal lobe and hippocampus for MR volumetry: normative data. Neurology. for quantification of brain, ventricular, and subarachnoid CSF volumes from MR 1993;43(10):2006-2010. images. J Comput Assist Tomogr. 1992;16(2):274-284. 35. Mu Q, Xie J, Wen Z, Weng Y, Shuyun Z. A quantitative MR study of the hippo- 23. DeCarli C, Murphy DG, Tranh M, et al. The effect of white matter hyperintensity campal formation, the amygdala, and the temporal horn of the lateral ventricle volume on brain structure, cognitive performance, and cerebral metabolism of in healthy subjects 40 to 90 years of age. AJNR Am J Neuroradiol. 1999;20 glucose in 51 healthy adults. Neurology. 1995;45(11):2077-2084. (2):207-211. 24. DeCarli C, Murphy DG, Teichberg D, Campbell G, Sobering GS. Local histogram 36. Sullivan EV, Marsh L, Mathalon DH, Lim KO, Pfefferbaum A. Age-related decline correction of MRI spatially dependent image pixel intensity nonuniformity. J Magn in MRI volumes of temporal lobe gray matter but not hippocampus. Neurobiol Reson Imaging. 1996;6(3):519-528. Aging. 1995;16(4):591-606. 25. DeCarli C, Massaro J, Harvey D, et al. Measures of brain morphology and in- 37. Grieve SM, Clark CR, Williams LM, Peduto AJ, Gordon E. Preservation of limbic farction in the Framingham Heart Study: establishing what is normal. Neurobiol and paralimbic structures in aging. Hum Brain Mapp. 2005;25(4):391-401. Aging. 2005;26(4):491-510. 38. Li YJ, Ga SN, Huo Y, Li SY, Gao XG. Characteristics of hippocampal volumes in 26. Geroldi C, Ferrucci L, Bandinelli S, et al. Mild cognitive deterioration with sub- healthy Chinese from MRI. Neurol Res. 2007;29(8):803-806.

Correction

Error in Figure. In the article titled “Embryonic Myosin Heavy-Chain Mutations Cause Distal Arthrogryposis and Develop- mental Myosin Myopathy That Persists Postnatally,” by Tajsharghi et al, published in the August Archives (2008;65[8]:1083- 1090), there was an error in Figure 8 on page 1089 and in the text wherever the mutation T178M is mentioned. The heterozygous missense mutation C602T in exon 5 was erronously described as changing the highly conserved threonine at position 178 to methionine. In fact, the mutation leads to the amino acid substitution threonine to isoleucine at position 178. The last 2 nucleotides in exon 5 (AC) together with the first nucleotide in exon 6 (C) code for threonine. Therefore, the mutation changed codon 178 from ACC coding for threonine to ATC coding for isoleucine. This is restated in a new figure legend and shown in the corrected figure.

S261F R762C A234T D462G A1637V S292F R672H delL841 T178I E375K D517Y G769V K838E D1622A Y583S T178I V825D

ATG TAG

2 7 11 13 17 21 33 40

S1 S2 LMM

Figure 8. Genomic structure of MYH3 with location of the distal arthrogryposis-causing mutations and the embryonic MyHC protein. The 3 mutations reported herein are indicated in red. The major proteolytic fragments S1, S2, and light meromyosin (LMM) of the MyHC protein are indicated.

(REPRINTED) ARCH NEUROL / VOL 65 (NO. 12), DEC 2008 WWW.ARCHNEUROL.COM 1654