TLR4-Myd88 Induces Ig Class Switch Recombination Via Papillomavirus

B Lymphocyte Activation by Human Papillomavirus-Like Particles Directly Induces Ig Class Switch Recombination via TLR4-MyD88 This information is current as of October 1, 2021. Rongcun Yang, Francisco Martinez Murillo, Michael J. Delannoy, R. Lee Blosser, William H. Yutzy IV, Satoshi Uematsu, Kiyoshi Takeda, Shizuo Akira, Raphael P. Viscidi and Richard B. S. Roden

J Immunol 2005; 174:7912-7919; ; Downloaded from doi: 10.4049/jimmunol.174.12.7912 http://www.jimmunol.org/content/174/12/7912

References This article cites 68 articles, 31 of which you can access for free at: http://www.jimmunol.org/ http://www.jimmunol.org/content/174/12/7912.full#ref-list-1

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists by guest on October 1, 2021

• Fast Publication! 4 weeks from acceptance to publication

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2005 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

B Lymphocyte Activation by Human Papillomavirus-Like Particles Directly Induces Ig Class Switch Recombination via TLR4-MyD881

Rongcun Yang,* Francisco Martinez Murillo,† Michael J. Delannoy,‡ R. Lee Blosser,‡ William H. Yutzy IV,* Satoshi Uematsu,ʈ Kiyoshi Takeda,ʈ Shizuo Akira,ʈ Raphael P. Viscidi,§ and Richard B. S. Roden2*¶

Vaccination with human papillomavirus type 16 (HPV16) L1 virus-like particles (VLP) induces both high titer neutralizing IgG and protective immunity. Because protection from experimental infection by papillomavirus is mediated by neutralizing IgG, we sought the mechanisms that trigger humoral immunity to HPV16 L1 VLP. We find that HPV16 L1 VLP bind to murine B lymphocytes thereby inducing activation-induced cytidine deaminase expression and Ig class switch recombination to cause the Downloaded from generation of IgG. HPV16 L1 VLP also activate production of proinflammatory factors IFN-␣, IL-6, MIP-1␣, RANTES, and KC, up-regulate the expression of costimulatory molecules by naive B cells, and increase the B1 B cell subpopulation. These B cell responses to HPV16 L1 VLP are dependent upon MyD88. Although MyD88؊/؊ B cells produce only ␮ transcript after exposure .to HPV16 L1 VLP, MyD88؉/؉ B cells express ␣, ␥, and ␮ Ig H chain and activation-induced cytidine deaminase transcripts Notably, TLR4 mutant C3H/HeJ mice exhibited significantly reduced HPV16 VLP-specific IgG1, IgG2a, IgG2b, and IgG3 titers

after vaccination as compared with the control C3H/HeOuJ mice. HPV16 L1 VLP directly activated class switch recombination http://www.jimmunol.org/ and costimulatory molecule expression by B cells of C3H/HeOuJ mice but not C3H/HeJ mice. Thus HPV16 L1 VLP directly activate B cells to induce CD4؉ T cell independent humoral immune responses via TLR4- and MyD88-dependent signaling. The Journal of Immunology, 2005, 174: 7912–7919.

eutralizing Abs are critical mediators of immunity to their expression on the surface of DCs (4). However, in the ab- microbial challenge. These Abs can be rapidly generated sence of T cell help, certain Ags induce Ag-specific B cell re- by CD4ϩ Th cell-independent mechanisms or more sponses, termed Th cell-independent humoral immunity (5, 6). Th N ϩ slowly as CD4 Th cell-dependent adaptive immune responses cell-independent responses can provide the host with the specific- (1). Innate recognition of pathogen-associated molecule patterns ity of adaptive immune system and the speed of the innate immu- by guest on October 1, 2021 signals APCs, typically dendritic cells (DCs),3 to express costimu- nity, enabling rapid production of neutralizing Abs to control in- latory molecules and secrete cytokines. These DC-derived signals vading microorganisms (7, 8). Several viruses, such as vesicular ϩ can drive the polarization of naive CD4 Th type 1 and type 2 cells stomatitis virus (9), polyomavirus (10), and rotavirus (11) have toward the Th1 or Th2 phenotype (2). Th1 cells produce IFN-␥ and been shown to be largely Th cell-independent in generating TNF-␣ that direct B cells to produce Ag-specific IgG2a, whereas neutralizing Ab. Th2 cells express IL-4, IL-5, IL-9, and IL-13 to promote IgG1 and Splenic B1 B cells located in marginal zone are considered to IgE class switching. The TNF superfamily members B lympho- play a critical role in Th cell-independent humoral responses (1). cyte-stimulating factor and a proliferation-inducing ligand These cells express CD5 and IgM (12). Recently it has been sug- (APRIL) expressed by monocytes and DCs also directly regulate gested that TLRs play a role in signaling events in B1 B cells and Ig class switch recombination (CSR) (3). IFN-␣ directly induce T cell-independent immune responses (1). TLRs mediate the recognition of pathogen-associated molecule pattern and subsequent

Departments of *Pathology, †Molecular Biology and Genetics, ‡Cell Biology, §Pe- activation of innate immunity (7, 13, 14) via an adaptor molecule diatrics, and ¶Gynecology and Obstetrics, Johns Hopkins University School of Med- MyD88 that plays a critical role in resistance to pathogens (15–18). ʈ icine, Baltimore, MD 21205; and Department of Host Defense, Research Institute for Members of the TLR family recognize particular pathogen-asso- Microbial Diseases, Osaka University, Suita, Osaka, Japan ciated molecular patterns, e.g., TLR4 recognizes bacterial LPS (15, Received for publication December 29, 2004. Accepted for publication March 22, 2005. 19), although it also mediates recognition of viruses including The costs of publication of this article were defrayed in part by the payment of page mouse mammary tumor virus (MMTV) and respiratory syncytial charges. This article must therefore be hereby marked advertisement in accordance virus (20–22). with 18 U.S.C. Section 1734 solely to indicate this fact. The highly ordered, close-packed xenogeneic structure of 1 This research was supported by the National Institutes of Health Grants PO1 HPV16 L1 VLP induces both high titer protective Ab (23–25) and AI48203 and P50 CA098252 (to R.B.S.R.), the Tobacco Restitution Fund, State of Maryland, and the American Cancer Society Grant Research Scholar Grant potent cell-mediated immune responses (26). Indeed, i.m. vacci- MBC-103111. nation of patients who have genital warts with HPV6 L1 VLP may 2 Address correspondence and reprint requests to Dr. Richard B. S. Roden, Depart- enhance regression (27). Similarly, vaccination of women with ment of Pathology, Ross 512B, Johns Hopkins University School of Medicine, 720 HPV16 L1 VLP was 91.2% (conﬁdence interval 80–97%) protec- Rutland Avenue, Baltimore, MD 21205. E-mail address: [email protected] tive against transient HPV16 infection, but 100% (90–100%) pro- 3 Abbreviations used in this paper: DC, dendritic cell; CSR, class switch recombination; VLP, virus-like particle; HPV, human papillomavirus; AID, activation-induced cy- tective against persistent HPV16 infection, suggesting possible L1- tidine deaminase; MMTV, mouse mammary tumor virus; GAG, glycosaminoglycan. mediated immune clearance of breakthrough infection (28).

Furthermore, the immunogenicity of weak foreign or self-Ags is ng/ml VLP or anti-mouse Ig. IFN-␣ was detected by capture ELISA ac- dramatically enhanced by coupling to VLP (29–32). However the cording to manufacturer’s instructions (PBL Biomedical Laboratories). mechanisms by which HPV16 L1 VLP trigger such potent hu- Transfection and reporter assays moral and cellular immunity without significant side effects in patients is poorly understood. Generation of TLR4 knockdown cell line shows TLR4 target sequence: TKD2, 5Ј-gatcccctctggtggctgtggagacattcaagagatgtctccacagccaccagattttt Several groups have demonstrated that HPV16 VLP can activate ggaaa and 5Ј-agcttttccaaaaatctggtggctgtggagacatctcttgaatgtctccacagcca innate responses in human monocyte-derived DCs (33), mouse ccagaggg. These oligonucleotide pairs were annealed and inserted be- bone marrow-derived DCs (34), and DC subpopulations from tween Bg1II and HindIII sites into pSuper vector (kindly provided by mouse splenic cells (35) to produce the proinflammatory factors T. R. Brummelkamp, Dutch Cancer Institute, Amsterdam, The Nether- that regulate adaptive immunity. For example, HPV16 L1 VLP lands) modified to carry hygromycin B resistance, and then transfected into macrophage cell line RAW264.7. The RAW264.7 TLR knockdown trigger production of type I IFN by bone marrow-derived DCs, and cell line was maintained in DMEM/10% FCS/hygromycin B. type I IFN receptor-deficient mice exhibit reduced humoral im- pNF-␬B-SEAP (secreted alkaline phosphatase) and positive control mune responses to HPV16 L1 VLP (35, 36). We demonstrate that pSEAP2 as well as negative control pTAL-SEAP reporter constructs (BD HPV16 L1 VLP can also directly activate B cells to induce acti- Clontech) were individually transfected into mouse RAW-264.7 macrophage cells with Lipofectamine 2000 (Invitrogen Life Technologies) in vation-induced cytidine deaminase (AID) and Ig CSR to cause the 24-well plates. After 24 h, the cells were stimulated using 25 ␮g/ml VLP. generation of IgGs via TLR4- and MyD88-dependent signaling The supernatants were collected at the different time points and analyzed pathway. This ability of HPV16 VLP to rapidly induce Th cell- by the chemiluminescence secreted alkaline phosphatase assay according independent immune responses independently of CD4ϩ T cells to the manufacturer’s protocol (BD Clontech). may play an important role in early control of virus spread and

Expression proﬁling using DNA microarrays Downloaded from mediate immunity in patients lacking CD4ϩ T cells that are more prone to HPV-related disease. The methodology is fully described (35). Materials and Methods Results ϩ Mice Generation of CD4 Th cell-independent responses upon vaccination with HPV16 VLP via MyD88 129/Sv-C57BL/6-MyD88Ϫ/Ϫ and MyD88ϩ/ϩ mice were maintained by

ϩ http://www.jimmunol.org/ Akira and colleagues (our study). The 6- to 8-wk-old male 129S6- To test for the role of CD4 T help in the generation of humoral Ϫ Ϫ ϩ ϩ CD4TM1KNW / and 129S6-CD4TM1KNW / , C3H/HeJ (TLR4 mutant), responses to HPV16 VLP, we immunized CD4ϩ/ϩ and CD4Ϫ/Ϫ and C3H/HeOuJ mice (The Jackson Laboratory) were maintained in a mice with HPV16 VLP or, as a control, the T cell-dependent Ag pathogen-free animal facility at least 1 wk before use (37, 38). Experiments were performed in accordance with institutional guidelines. OVA. Specific reactivity for each Ab isotype in pooled sera from groups of mice (n ϭ 6) was measured by ELISA. CD4ϩ/ϩ, but not Preparation of HPV16 L1 VLP Ϫ/Ϫ CD4 mice produced a robust specific IgG response to OVA as HPV16 L1 VLP were generated with recombinant baculoviruses and pu- expected (Fig. 1A). However, HPV16 VLP vaccination induced rified as previously reported (39). specific IgG in CD4Ϫ/Ϫ mice, although the titers were higher in CD4ϩ/ϩ mice (Fig. 1B). Thus HPV16 L1 VLP vaccination induces Stimulation on naive and VLP-activated B cells by guest on October 1, 2021 both CD4ϩ independent and dependent humoral responses. Fur- Enriched population of splenic B cells were obtained from naive or HPV16 VLP immunized mice using CD45R-specific (B220) (RA3-6B2, MACS) or thermore, consistent with other Th cell-independent Ags (43), no CD19-specific (1D3, MACS) beads according to the manufacturer’s in- IgE response to HPV16 VLP was observed (data not shown). structions (Miltenyi Biotec) (40). The cells were cultured in 24-well flat- Analogous results were obtained in mice upon CD4ϩ Th cell de- 6 bottom plates at 10 cells/ml in RPMI 1640 medium supplemented with pletion with anti-CD4 Ab (Fig. 1C). To investigate the role of TLR 10% FCS. To induce isotype switching, B cells were stimulated either with 25 ␮g/ml VLP alone or with 1000 U/ml recombinant mouse IL-4 or 10 signaling in inducing the Th cell-independent response to HPV16 ␮g/ml anti-CD40 Ab (HM40-3; BD Biosciences) (41). Cells were har- VLP, we also vaccinated mice lacking a key component of the Ϫ Ϫ vested on day 4 for flow cytometric or RT-PCR analyses. Supernatants TLR signal cascade, MyD88 (20). MyD88 / mice failed to pro- were harvested on day 6 for Ig isotype analysis by capture ELISA. duce HPV16 VLP-specific IgG after vaccination, although the IgM Flow cytometry of mouse splenic B cells response was retained (Fig. 1D and data not shown). To address a possible role for a defect in B cell development in MyD88Ϫ/Ϫ Freshly isolated splenic B cells were collected in ice-cold PBS and surface mice, we compared the ratio of different splenic cell populations, marker phenotypes were analyzed using PE-conjugated Ab to CD19 (1D3) ϩ ϩ ϩ ϩ ϩ or B220 (CD45R, RA3-6B20). To determine isotype switching, FITC-con- including IgM , IgD , B220 , CD5 , and CD19 B cells in Ϫ Ϫ ϩ ϩ jugated anti-IgM (331.1), anti-IgG1 (A85.10), anti-IgG2a (R19-15), anti- MyD88 / and MyD88 / mice. Consistent with previous re- IgG2b (R12-13), anti-IgG3 (R40-82), or anti-IgA (C10-3) (BD Pharmin- ports, the proportions of each of these B cell subsets were similar gen) Abs were used to stain the stimulated B cells. Cells were then washed in MyD88ϩ/ϩ and MyD88Ϫ/Ϫ mice (data not shown). twice before being resuspended in PBS containing 1% paraformaldehyde ϩ ϩ and 1% FCS and kept at 4°C before flow cytometric analysis (FACScan; CD5 IgM B cells correspond to the B1 subpopulation that is BD Biosciences). For each analysis, isotype-matched control mAb was associated with Th cell-independent humoral immunity. Upon used a negative control. comparison of splenocytes pooled from each group of mice (n ϭ ϩ ϩ Analysis of Ig and AID transcripts 6), we noted that the splenic population of CD5 IgM B cells doubled (1.14 vs 2.76%) after vaccination with HPV16 L1 VLP RT-PCR was performed using SuperScript one-step RT-PCR with but not with PBS (Fig. 2B). Interestingly, this increase in the Platinum Taq according to the protocol provided (Invitrogen Life Technologies). For amplification of AID and Ig transcripts, all primers and splenic B1 cell population did not occur in HPV16 VLP vaccinated Ϫ Ϫ amplification conditions were as described (42). The primers for amplifica- MyD88 / mice, suggesting that MyD88 signaling is critical for tion of GAPDH were the sense primer, 5Ј-ATGGTGAAGGTCGGT B1 B cell expansion in the development of Th cell-independent Ј GTGAACGGATTTGGC and antisense primer, 5 -CATCGAAGGTGGA humoral immunity to HPV16 VLP. AGAGTGGGAGTTGCTGT. Costimulatory molecules play a critical role in the induction of ELISA immunity, including Th cell-independent responses (44). We de- ϩ ELISA were performed using a mouse hybridoma isotyping kit (Biomeda) tected an elevated proportion of B220 B cells with high expres- ϩ ϩ as recommended by the manufacturer. The plates were coated with 100 sion of CD40 and CD80 in MyD88 / mice after vaccination with 7914 PAPILLOMA VLPs ACTIVATE B CELLS

FIGURE 1. Generation of CD4 T cell-independent humoral immune responses by HPV16 VLP via MyD88. A, CD4Ϫ/Ϫ and CD4ϩ/ϩ mice were immunized i.v. with 10 ␮g of OVA or PBS on days 0, 7, and 14, then sera were harvested on day 24. The pooled sera (n ϭ 6) were tested for Ag-specific IgG1, IgG2a, IgG2b, and IgG3 responses. B, Same as in A, but the mice were vaccinated with HPV16 VLP. C, Same as in B, except that CD4ϩ/ϩ mice, either with or without CD4ϩ T cell depletion, were vaccinated with HPV16 VLP. The CD4ϩ T cell depletion protocol was validated by flow cytometric analy- Ϫ Ϫ ϩ ϩ sis. D, MyD88 / and MyD88 / Downloaded from mice were immunized i.v. with 10 ␮g of HPV16 VLP or PBS on days 0, 7, and 14, then sera were harvested on day 24. The pooled sera (n ϭ 6) were tested for HPV16 VLP-specific IgG1, IgG2a, IgG2b, and IgG3 responses. Representative data of three or more http://www.jimmunol.org/ experiments are shown.

HPV16 L1 VLP (Fig. 2C). Notably, this did not occur in HPV16 HPV16 L1 VLP to naive CD19ϩ B cells by immunofluorescent VLP vaccinated MyD88Ϫ/Ϫ mice (Fig. 2C). Thus, our findings staining and analysis by fluorescence microscopy or flow cytom-

suggest that HPV16 L1 VLP directly activate B cells and induce etry (Fig. 3, A1–A6). Heparinase pretreatment of naive B cells by guest on October 1, 2021 CD4ϩ Th cell-independent humoral immune responses via reduced binding by HPV16 VLP (Fig. 3, A5 and A6). We then MyD88. tested for the ability of HPV16 L1 VLP trigger naive CD19ϩ B cells to undergo CSR, as assessed by up-regulated expression of Ϫ/Ϫ MyD88 B cells are impaired for activation of Ig CSR by the ␣, ␥1, ␥2a, ␥2b, and ␥3 H chain transcripts and down-regula- HPV16 L1 VLP tion of ␮ transcripts (Fig. 3B). Exposure to HPV16 L1 VLP caused To address whether HPV16 L1 VLP directly induce CD4ϩ Th naive B cells to undergo CSR and express ␣, ␥1, ␥2a, ␥2b, and ␥3 cell-independent immunity, we conﬁrmed direct binding of H chain transcripts. Expression of IgG was also conﬁrmed by

FIGURE 2. Up-regulation of the B1 subset and B cell costimulatory markers after HPV16 VLP vaccination is dependent upon MyD88. MyD88Ϫ/Ϫ and MyD88ϩ/ϩ mice (n ϭ 6) were immunized i.v. with 10 ␮g of HPV16 VLP or PBS on days 0, 7, and 14, and then their splenocytes were harvested on day 24. Pooled splenocytes defined by forward and side scatter (A) were analyzed for CD5 and IgM surface expression by flow cytometry (B). Pooled splenocytes from six MyD88ϩ/ϩ or MyD88Ϫ/Ϫ mice, vaccinated with either PBS or HPV16 VLP, were also analyzed for surface expression of B220 and CD40 or CD80 by flow cytometry (C). Representative data of three or more experiments are shown. The Journal of Immunology 7915 Downloaded from http://www.jimmunol.org/

FIGURE 3. HPV16 VLP directly activates CSR in B cells via MyD88-dependent pathway. A, Flow cytometric analysis showing binding of HPV16 VLP to MyD88ϩ/ϩ (A1, A2, A5, and A6) and MyD88Ϫ/Ϫ B cells (A3 and A4) isolated from naive mice. B cells (A6) were pretreated with heparatinase for 1 h at 37°C (48). Splenic B cells were incubated with PBS (A1) or HPV16 VLP (A2–A6)for1hat4°CinDulbecco’s PBS, and then stained for L1 VLP (H16.V5) PE- and FITC-labeled anti-CD19. The cells were analyzed by flow cytometry (A1–A3) or confocal scanning fluorescence microscopy (A4–A6). B, HPV16 VLP directly induce Ig CSR in vitro. B cells were purified from mouse splenic cells by CD19-MACS and incubated for 4 days in the presence of VLP (25 ␮g/ml). Transcription of AID and Ig was analyzed by RT-PCR. C, ELISA for specific isotypic Abs in supernatant of MyD88ϩ/ϩ and MyD88Ϫ/Ϫ B cell cultures, 6 days after stimulation with HPV16 VLP or PBS. D, MyD88 splenic B cells were purified by CD19 MACS from naive mice and then by guest on October 1, 2021 incubated for 4 days in the presence of 500 U/ml IL-4 or 10 ␮g/ml CD40 Ab. Individual Ab isotypes were analyzed by flow cytometry using isotype control Ab (D1), anti-IgG1 (D2), or anti-IgG2a (D3). E, B cell-based innate immune-like responses induced by HPV16 VLP in MyD88ϩ/ϩ B cells in vitro. B cells were stimulated with 25 ␮g/ml HPV16 VLP, control crude Sf9 cell lysate from same purification scheme or PBS. The supernatants were harvested after 24 h and assayed for IFN-␣ (PBL Biomedical Laboratories), IL-6, G-CSF, MIP-1␣, RANTES, and KC (Bio-Rad). F, Expression of CD40, CD80, and CD86 on B cells after culture in vitro for 36 h. Isotypic control (black histogram); unstimulated (red histogram, crude Sf9 cell lysate); stimulated with 25 ␮g/ml HPV16 VLP (green histogram) are shown.

ELISA and isotype-specific flow cytometric staining (Fig. 3C and including induction of IFN-␣4 mRNA by 9.9-fold. Production of data not shown). To examine whether MyD88 signaling is also IFN-␣ was quantified by ELISA and found to be elevated in super- critical for direct induction of CSR by HPV16 VLP, splenic B cells natants of B cell cultures stimulated by HPV16 VLP (Fig. 3E). were purified by CD19-specific MACS from MyD88ϩ/ϩ and To test for production of other proinflammatory mediators, we MyD88Ϫ/Ϫ mice and incubated with HPV16 L1 VLP or PBS harvested supernatants 24 h after exposure to either HPV16 VLP alone. The HPV16 L1 VLP bound equally well to MyD88Ϫ/Ϫ and or PBS for comparison to untreated B cells (45, 46). We concur- MyD88ϩ/ϩ CD19ϩ B cells (Fig. 3A). However, whereas rently analyzed these supernatants for the presence of IL-1␣, IL-␤, MyD88ϩ/ϩ B cells expressed ␣, ␥, and ␮ Ig H chain transcripts in IL-2, IL-3, IL-4, IL-5, IL-6, IL-10, IL-12 (p40), IL-12 (p70), IL- response to HPV16 VLP, only the ␮ transcript was present in the 17, TNF-␣, IFN-␥, GM-CSF, and G-CSF regulated upon activa- MyD88Ϫ/Ϫ B cells (Fig. 3B). Further, HPV16 VLP induced tran- tion of normal T expressed and secreted (RANTES), cytokine- scription and production of IgA, IgG1, IgG2a, IgG2b, and IgG3, induced neutrophil chemoattractant (KC/CXCL1), and MIP-1␣ and IgM in MyD88ϩ/ϩ purified B cells, but only IgM in using the Bio-Plex 18 cytokine assay (Bio-Rad). HPV16 VLP el- MyD88Ϫ/Ϫ B cells (Fig. 3C). Notably, MyD88Ϫ/Ϫ B cells se- evated production of MIP-1␣, RANTES, KC, G-CSF and espe- creted IgG in response to CD40 ligation and IL-4, demonstrat- cially IL-6 by B cells (Fig. 3E). Notably, MyD88Ϫ/Ϫ B cells were ing their viability and ability to undergo MyD88-independent impaired in their production of proinflammatory mediators after CSR (Fig. 3D). exposure to HPV16 L1 VLP (Fig. 3E). We also examined whether Because B cells undergo MyD88-dependent activation upon HPV16 L1 VLP act directly upon B cells to up-regulate the co- binding to HPV16 L1 VLP, we investigated their ability to gen- stimulatory molecules CD40, CD80, and CD86. Incubation of na- erate other innate immune responses. Therefore we compared the ive splenic B cells in vitro with HPV16 VLP significantly up- transcriptional response of B cells using Affymetrix U74A, U74B, regulated surface expression of CD40, CD80, and CD86 (Fig. 3F). and U74C microarrays 12 h after exposure to HPV16 VLP or LPS Again, MyD88Ϫ/Ϫ B cells exhibited reduced expression of these (Fig. 4). The microarray analysis indicated numerous common costimulatory molecules, especially CD86. Surprisingly, up-regu- transcriptional changes in B cells activated by HPV16 VLP and LPS, lation of CD86 was not observed in the B cells of HPV16 VLP 7916 PAPILLOMA VLPs ACTIVATE B CELLS

FIGURE 4. Transcriptional changes in purified B cells 6 h after stimulation with HPV16 VLP. RNA was prepared from splenic B cells 6 h after exposure to HPV16 VLPs (25 ␮g/ml), 0.1 ␮g/ml LPS (026: B6), 10 ␮g/ml anti-CD40 Ab, or PBS. The RNA was analyzed by Affymetrix microarray using the U74Av2 chip and values of absolute signal intensity based upon all probe pairs in the indicated probe sets are provided in the light yellow columns. The data were curated to show genes exhibiting Ͼ2-fold transcriptional changes as calculated using Micro Array Suite 5.0 software (Affymetrix) and sorted by ontology related to IFN. Transcriptional changes of 2- to 5-fold or Ͼ5-fold up-regulation are coded orange and red, respectively, and transcripts down- regulated 2- to 5-fold and Ͼ5 with respect to the PBS control are shaded light and dark green, respectively. Downloaded from vaccinated mice (data not shown), implying more complex regu- ing IgMϩ, IgDϩ, B220ϩ, CD5ϩ, and CD19ϩ B cells, between lation in vivo than in vitro. C3H/HeJ and C3H/HeOuJ mice suggesting that gross differences Endotoxin contamination, which could potentially induce CSR, in B cell development do not account for their differential response was below the level of detection in the HPV16 VLP 1.05 mg/ml to HPV16 VLP (data not shown). Furthermore, the humoral re- stock preparation (Ͻ0.058 EU/ml by Limulus assay E-Toxate; sponse to OVA was equivalent in C3H/HeJ and C3H/HeOuJ mice Sigma-Aldrich). Further, crude Sf9 cell lysate that was subjected (Fig. 5B2). To address the role of TLR4 signaling in Th cell- http://www.jimmunol.org/ to the same purification scheme with HPV16 L1 VLP failed to independent immune responses to HPV16 L1 VLP, we examined promote CSR. This suggests that potential contamination of the their ability to produce CSR and IgG as well as up-regulate co- HPV16 L1 VLP preparation with endotoxin or Sf9 cell proteins stimulatory molecules on purified CD19ϩ B cells derived from does not account for the observed induction of CSR. To examine C3H/HeJ and C3H/HeOuJ mice. In vitro, HPV16 VLP induced the potential for indirect activation of B cells in the purified pop- production of IgA, IgG1, IgG2a, IgG2b, and IgG3 and IgM in ulation via VLP activation of contaminating cell types such as CD19ϩ B cells of C3H/HeOuJ mice, but only IgM in B cells of monocytes, macrophages, or DCs, the B cell preparation was C3H/HeJ mice with defective TLR4 signaling (Fig. 5D). Similarly, stained with CD14, CD11c, and CD11b. Only 0.004% cells were HPV16 VLP also up-regulated expression of CD40 and CD80 in by guest on October 1, 2021 positive after staining with FITC Ab to CD14, CD11c, and CD11b CD19ϩ B cells of C3H/HeOuJ mice, but not in B cells of C3H/HeJ in splenic B cells purified by CD19-MACS after repeated selec- mice (Fig. 5E), further implicating TLR4 signaling in Th cell- tion, suggesting that the observed responses were the result of independent responses to HPV16 VLP. direct activation of the B cells by HPV16 VLPs. Studies described elsewhere (36) suggest that the HPV16 L1 VLP preparations lack T cell-derived signals enhance HPV16 VLP-induced CSR contaminating unmethylated DNA that could potentially activate B Because CD4ϩ T cells provide a significant contribution to the cells via TLR9. generation of HPV16 VLP-specific IgG (Fig. 1, B and C), we also TLR4 is involved in HPV16 VLP-direct Ig CSR examined the influence of key T cell-derived signals, IL-4 and CD40 ligation, upon HPV16 VLP-induced CSR in vitro (Fig. 6A). Our previous studies indicated that HPV16 L1 VLP activated IL-4 and CD40 ligation enhanced HPV16 VLP-induced CSR as NF-␬B-dependent transcription in RAW264.7 cells via MyD88 well as production of IgG1 and, to a lesser extent, other IgG iso- (36). To screen for TLRs that function in innate recognition of types by purified B cells (Fig. 6). Expression of IgG was also HPV16 L1VLP, we developed selectable small interfering RNA confirmed by ELISA and isotype-specific flow cytometric staining constructs to individually knockdown the mRNA levels for each (Fig. 6, B and C). Coadministration of anti-CD40 Ab with HPV16 TLR in RAW264.7 cells. A stable clone with reduced TLR4 ex- VLP enhanced both the transcription of AID and ␥ Ig, whereas ␮ pression was developed (Fig. 5, A1 and A2). Interestingly, knock- transcripts were down-regulated (Fig. 6). down of TLR4 mRNA partially inhibited the activation of NF-␬B- dependent transcription by HPV16 L1 VLP, as well as the TLR4 ligand LPS (Fig. 5A3) implicating TLR4 in innate recognition of Discussion HPV16 L1 VLP. Innate responses triggered by the TLR-MyD88 signaling pathway C3H/HeJ mice contain a dominant-negative point mutation promote adaptive immune responses and mediate adjuvant effects. within the cytoplasmic portion of TLR4 rendering them insensitive We demonstrate that vaccination with HPV16 L1 VLP can rapidly to bacterial LPS (19). To further investigate whether TLR4 is in- induce specific immune responses via TLR4- and MyD88-medi- volved in the generation of humoral immunity induced by HPV16 ated signaling. Because the highly ordered structure of HPV16 L1 L1 VLP, we immunized C3H/HeJ and control mice C3H/HeOuJ VLP is potently immunogenic in humans even without adjuvant with HPV16 VLP or the control protein OVA (Fig. 5, B and C). and provides protective immunity, HPV16 L1 VLP represent an The TLR4 mutant C3H/HeJ mice exhibited significantly reduced important model for the development of subunit vaccines. Indeed, HPV16 VLP-specific IgG2a, IgG2b, and IgG3 titers as compared the repetitiveness of many viral Ags is a key factor responsible for with the control C3H/HeOuJ mice (Fig. 5, B and C). Notably, there the efficiency of early and rapid B cell amplification for potent IgM were no significant differences among B cell populations, includ- responses and also for efficient switching to IgG (47). For example, The Journal of Immunology 7917 Downloaded from http://www.jimmunol.org/

FIGURE 5. TLR4 is involved in the Ig CSR induced by HPV16 VLP. A, Effect of knockdown of TLR4 by small interfering RNA on TLR4 mRNA levels estimated by semiquantitative RT-PCR (A1), for TLR4 protein levels as measured by MTS510 (eBioscience) Ab staining and flow cytometry (A2) and by its influence upon the NF-␬B-dependent transcriptional response to 25 ␮g/ml HPV16 VLP, 0.1 ␮g/ml LPS (026:B6), 10 ␮g/ml peptidoglycan Staphylo- coccus aureus (InvivoGen), 25 ␮g/ml poly(I:C) (InvivoGen), 5 ␮M CpG (ODN 1826; InvivoGen), or 25 ␮g/ml zymosan A (Sigma-Aldrich) (A3). B, ELISA reactivity by isotype of serum Abs from C3H/HeJ (TLR4 mutant) and C3H/HeOuJ mice after immunization by HPV16 VLP (B1) or OVA (B2). C3H/HeJ (TLR4 mutant) and C3H/HeOuJ mice were immunized with HPV16 VLP or OVA (10 ␮g), or PBS, respectively, on days 0, 7, and 14. Day 24 pooled sera (n ϭ 6) were analyzed for reactivity to HPV16 VLP by ELISA. C, Titration by isotype of serum Abs from C3H/HeJ (TLR4 mutant) and C3H/HeOuJ mice after immunization by HPV16 VLP. D, ELISA for specific Ab isotypes in supernatant of C3H/HeJ (TLR4 mutant) and C3H/HeOuJ B cell cultures, 6 days after stimulation with HPV16 VLP or control, crude sf9 cell lysates. E, Splenocytes from HeOuJ and HeJ mice, vaccinated with either PBS or HPV16 VLP, by guest on October 1, 2021 were subjected to double staining with PE-labeled B220 and FITC-labeled anti-CD40 or CD80 for flow cytometric analysis. Representative data of three or more experiments are shown.

B cells were unresponsive to the poorly organized vesicular sto- spacing and density of the epitopes also is critical in the response matitis virus-G (IND) present as self-Ag but responded promptly to papillomavirus VLP (32). The close-packed HPV16 L1 VLP to the same Ag presented in a highly organized form (23). The structure directly activates B cells to induce Ig CSR and the

FIGURE 6. Direct expression of IgG induced by HPV16 VLP is enhanced by T cell-derived signals. A, Splenic B cells were purified by CD19 MACS from mice immunized by HPV16 VLP, and then incubated for 4 days in the presence of VLP (25 ␮g/ml), with or without 500 U/ml IL-4 or 10 ␮g/ml CD40 Ab. Total RNAs were analyzed by RT-PCR using Ab isotype-specific and AID primers. B, ELISA measurement of isotypic-specific Ab in supernatants from B cells after 6 days of stimulation with HPV16 VLP. C, B cells were treated with VLP and after 4 days surface expression of CD19 and individual Ab isotypes were analyzed by flow cytometry. Representative data of three or more experiments are shown. 7918 PAPILLOMA VLPs ACTIVATE B CELLS production of IgG. Such Th cell-independent responses provide the (66). This likely reflects the ability of HPV16 L1 VLP and the host with the specificity of adaptive immune system and the speed failure of human polyomavirus VP1 VLP to directly activate DC of the innate immunity, enabling rapid production of neutralizing maturation (34) and B cells, suggesting differences in their recog- Abs to control invading microorganisms (7, 8). nition by the innate immune system. Immune recognition of HPV16 VLP via MyD88 suggests sig- CD4ϪCD8Ϫ␣␤ T cells or ␥␦ T cells can substitute for CD4ϩ T naling via TLRs. Indeed, studies in TLR4-defective mice suggest cell help to induce CSR after vaccination with formalin-inactivated that TLR4 contributes to the recognition of HPV16 VLP. It is also influenza virus or inoculation with vesicular stomatitis virus, re- notable that three viruses, namely respiratory syncytial virus, spectively (67, 68). It is also possible that these T cell subpopu- MMTV, and HPV16 that have been shown to bind heparan sulfate lations are also involved in T cell-dependent humoral immunity on the cell surface (21, 22, 48) are also recognized by TLR4- induced by HPV16 VLP. However, the ability to generate HPV16 dependent pathways (49, 50). Although viruses use many different VLP-specific IgGs in the absence of CD4ϩ T help suggests that it surface molecules to initiate infection, heparan sulfate glycosami- may be possible to induce immunity even in patients with impaired noglycan (GAG) represents an important surface binding receptor T cell function such as those undergoing organ transplantation or for a number of medically important viral pathogens (51). Given patient with HIV infection. These patients are particularly suscep- that cell surface GAGs are the primary receptors for HPV16 VLP, tible to HPV-induced cancers and thus even transient immunity and TLR4 is important in immune recognition of HPV16 VLP, it could be beneficial. is intriguing that GAG oligosaccharides activate DCs via TLR4 (50). Heparinase pretreatment prevents binding of HPV16 VLP to Disclosures B cells, also suggesting that activation of TLR4 is secondary to B

R. B. S. Roden is a paid consultant of Knobbe, Martens, Olson and Bear, Downloaded from cell binding via surface GAGs, as described for interaction of LLC and an arrangement regarding a patent dispute to HPV16 VLP is TLR4 and MMTV after binding to its primary surface receptor. being managed by the Office of Policy Coordination, Johns Hopkins Uni- Indeed, heparin blocks activation of human monocyte-derived DCs versity. The remaining authors have no financial conflict of interest. by HPV16 VLPs (52). Murine B cells express both TLR4 and TLR9, whereas human References B cells express only the latter (53). Therefore, Th cell-independent 1. Martin, F., A. M. Oliver, and J. F. Kearney. 2001. Marginal zone and B1 B cells responses to HPV16 VLPs in mice and humans may differ. How- unite in the early response against T-independent blood-borne particulate anti- http://www.jimmunol.org/ ever DCs also trigger Th cell-independent class switching (4) and gens. Immunity 14: 617–629. 2. Kapsenberg, M. L. 2003. Dendritic-cell control of pathogen-driven T-cell polar- HPV16 VLPs are potent activators of human myeloid and plas- ization. Nat. Rev. Immunol. 3: 984–993. macytoid DCs (54–56) as well as murine DC subsets (35, 36). 3. MacLennan, I., and C. Vinuesa. 2002. Dendritic cells, BAFF, and APRIL: innate HPV16 L1 VLPs induce class switching to IgG1, IgG2a, IgG2b, players in adaptive antibody responses. Immunity 17: 235–2238. 4. Litinskiy, M. B., B. Nardelli, D. M. Hilbert, B. He, A. Schaffer, P. Casali, and and IgG3, but not IgE. Notably, this pattern of isotypes is distinct A. Cerutti. 2002. DCs induce CD40-independent immunoglobulin class switch- from that observed upon TLR9-dependent CpG activation of B ing through BLyS and APRIL. Nat. Immunol. 3: 822–829. cells, which specifically fails to induce IgG1 (57, 58). This may 5. Bachmann, M. F., H. Hengartner, and R. M. Zinkernagel. 1995. T helper cell- independent neutralizing B cell response against vesicular stomatitis virus: role of reflect additional MyD88-independent signals generated via TLR4, antigen patterns in B cell induction? Eur. J. Immunol. 25: 3445–3451. by guest on October 1, 2021 but not TLR9 (59). 6. Fehr, T., M. F. Bachmann, H. Bluethmann, H. Kikutani, H. Hengartner, and AID is the only B cell-specific factor that is required for somatic R. M. Zinkernagel. 1996. T-independent activation of B cells by vesicular stomatitis virus: no evidence for the need of a second signal. Cell. Immunol. 168: hypermutation, gene conversion, and CSR. It is only expressed in 184–192. activated B cells such as germinal center B cells (42) and B cells 7. Vos, Q., A. Lees, Z. Q. Wu, C. M. Snapper, and J. J. Mond. 2000. B-cell acti- undergoing CSR or somatic hypermutation in vitro (60, 61). IL-4 vation by T-cell-independent type 2 antigens as an integral part of the humoral immune response to pathogenic microorganisms. Immunol. Rev. 176: 154–170. and CD40L promote AID expression (62). Our studies indicate 8. Szomolanyi-Tsuda, E., and R. M. Welsh. 1996. T cell-independent antibody- that MyD88 is also involved in the up-regulation of AID expres- mediated clearance of polyoma virus in T cell-deficient mice. J. Exp. Med. 183: sion. This pathway is likely significant for early Th cell-indepen- 403–411. 9. Freer, G., C. Burkhart, I. Ciernik, M. F. Bachmann, H. Hengartner, and dent humoral responses against Ags such as HPV16 L1 VLP that R. M. Zinkernagel. 1994. Vesicular stomatitis virus Indiana glycoprotein as a are recognized by TLRs on B cells. T-cell-dependent and -independent antigen. J. Virol. 68: 3650–3655. 10. Szomolanyi-Tsuda, E., J. D. Brien, J. E. Dorgan, R. L. Garcea, R. T. Woodland, HPV16 VLP induce expression of type I IFN, proinflammatory and R. M. Welsh. 2001. Antiviral T-cell-independent type 2 antibody responses cytokines, chemokines, and costimulatory molecules, which can induced in vivo in the absence of T and NK cells. Virology 280: 160–168. potentially amplify the B cell response by feedback or paracrine 11. Franco, M. A., and H. B. Greenberg. 1997. Immunity to rotavirus in T cell deficient mice. Virology 238: 169–179. pathways or interaction with Th cells. For example, HPV16 VLP 12. Waldschmidt, T., K. Snapp, T. Foy, L. Tygrett, and C. Carpenter. 1992. B-cell up-regulate CD40 on the surface of B cells (Fig. 3F), which can be subsets defined by the Fc⑀R. Ann. NY Acad. Sci. 651: 84–98. stimulated by CD40L, classically on the surface of Th cells. Sig- 13. Iwasaki, A., and R. Medzhitov. 2004. Toll-like receptor control of the adaptive immune responses. Nat. Immunol. 5: 987–995. nificantly, CD40L on the surface of adjacent B cells may provide 14. Akira, S., and H. Hemmi. 2003. Recognition of pathogen-associated molecular functional activation of CD40 in Th cell-independent responses patterns by TLR family. Immunol. Lett. 85: 85–95. (44). Paracrine or autocrine signaling by MIP-1␣, IFN-␣, and IL-6 15. Kawai, T., O. Adachi, T. Ogawa, K. Takeda, and S. Akira. 1999. Unresponsive- ness of MyD88-deficient mice to endotoxin. Immunity 11: 115–122. may regulate the Ab isotypes induced by HPV16 VLP and are 16. Scanga, C. A., A. Bafica, C. G. Feng, A. W. Cheever, S. Hieny, and A. Sher. consistent with a defense response (35, 63, 64). IFN-␣ can promote 2004. MyD88-deficient mice display a profound loss in resistance to Mycobac- isotypic switching by stimulating DCs and acts as a potent adju- terium tuberculosis associated with partially impaired Th1 cytokine and nitric oxide synthase 2 expression. Infect. Immun. 72: 2400–2404. vant of humoral immunity to monomeric Ag (4, 64, 65). Indeed, 17. Skerrett, S. J., H. D. Liggitt, A. M. Hajjar, and C. B. Wilson. 2004. Cutting edge: type I IFN receptor-deficient mice exhibit blunted CSR and spe- myeloid differentiation factor 88 is essential for pulmonary host defense against cific Ab production after vaccination with HPV16 VLP whereas Pseudomonas aeruginosa but not Staphylococcus aureus. J. Immunol. 172: ␣ 3377–3381. coadministration of IFN- with either OVA or HPV16 VLP en- 18. Akira, S., M. Yamamoto, and K. Takeda. 2003. Role of adapters in Toll-like hances the humoral immune response to these Ags (35). receptor signalling. Biochem. Soc. Trans. 31: 637–642. Although HPV16 L1 VLP vaccination i.v. and live polyomavi- 19. Poltorak, A., X. He, I. Smirnova, M. Y. Liu, C. Van Huffel, X. Du, D. Birdwell, E. Alejos, M. Silva, C. Galanos, et al. 1998. Defective LPS signaling in C3H/HeJ rus inoculation of mice induce Th cell-independent humoral re- and C57BL/10ScCr mice: mutations in Tlr4 gene. Science 282: 2085–2088. sponses, i.p. vaccination with polymavirus VP1 VLP does not 20. Akira, S. 2003. Mammalian Toll-like receptors. Curr. Opin. Immunol. 15: 5–11. The Journal of Immunology 7919

21. Zhang, Y., J. C. Rassa, M. E. deObaldia, L. M. Albritton, and S. R. Ross. 2003. 44. Szomolanyi-Tsuda, E., J. D. Brien, J. E. Dorgan, R. M. Welsh, and R. L. Garcea. Identification of the receptor binding domain of the mouse mammary tumor virus 2000. The role of CD40-CD154 interaction in antiviral T cell-independent IgG envelope protein. J. Virol. 77: 10468–10478. responses. J. Immunol. 164: 5877–5882. 22. Feldman, S. A., S. Audet, and J. A. Beeler. 2000. The fusion glycoprotein of 45. Krzysiek, R., E. A. Lefe`vre, W. Zou, A. Foussat, J. Bernard, A. Portier, human respiratory syncytial virus facilitates virus attachment and infectivity via P. Galanaud, and Y. Richard. 1999. Antigen receptor engagement selectively an interaction with cellular heparan sulfate. J. Virol. 74: 6442–6447. induces macrophage inflammatory protein-1␣ (MIP-1␣) and MIP-1␤ chemokine 23. Bachmann, M. F., U. H. Rohrer, T. M. Kundig, K. Burki, H. Hengartner, and production in human B cells. J. Immunol. 162: 4455–4463. R. M. Zinkernagel. 1993. The influence of antigen organization on B cell re- 46. Baccam, M., S.-Y. Woo, C. Vinson, and G. A. Bishop. 2003. CD40-mediated sponsiveness. Science 262: 1448–1451. transcriptional regulation of the IL-6 gene in B lymphocytes: involvement of 24. Breitburd, F., R. Kirnbauer, N. L. Hubbert, B. Nonnenmacher, NF-␬B, AP-1, and C/EBP. J. Immunol. 170: 3099–3108. C. Trin-Dinh-Desmarquet, G. Orth, J. T. Schiller, and D. R. Lowy. 1995. Im- 47. Bachmann, M. F., and R. M. Zinkernagel. 1997. Neutralizing antiviral B cell munization with viruslike particles from cottontail rabbit papillomavirus (CRPV) responses. Annu. Rev. Immunol. 15: 235–270. can protect against experimental CRPV infection. J. Virol. 69: 3959–3963. 48. Joyce, J. G., J. S. Tung, C. T. Przysiecki, J. C. Cook, E. D. Lehman, J. A. Sands, 25. Suzich, J. A., S. J. Ghim, F. J. Palmer-Hill, W. I. White, J. K. Tamura, J. A. Bell, K. U. Jansen, and P. M. Keller. 1999. The L1 major capsid protein of human J. A. Newsome, A. B. Jenson, and R. Schlegel. 1995. Systemic immunization papillomavirus type 11 recombinant virus-like particles interacts with heparin and with papillomavirus L1 protein completely prevents the development of viral cell-surface glycosaminoglycans on human keratinocytes. J. Biol. Chem. 274: mucosal papillomas. Proc. Natl. Acad. Sci. USA 92: 11553–11557. 5810–5822. 26. De Bruijn, M. L., H. L. Greenstone, H. Vermeulen, C. J. Melief, D. R. Lowy, 49. Kurt-Jones, E. A., L. Popova, L. Kwinn, L. M. Haynes, L. P. Jones, R. A. Tripp, J. T. Schiller, and W. M. Kast. 1998. L1-specific protection from tumor challenge E. E. Walsh, M. W. Freeman, D. T. Golenbock, L. J. Anderson, and elicited by HPV16 virus-like particles. Virology 250: 371–376. R. W. Finberg. 2000. Pattern recognition receptors TLR4 and CD14 mediate 27. Zhang, L. F., J. Zhou, S. Chen, L. L. Cai, Q. Y. Bao, F. Y. Zheng, J. Q. Lu, response to respiratory syncytial virus. Nat. Immunol. 1: 398–401. J. Padmanabha, K. Hengst, K. Malcolm, and I. H. Frazer. 2000. HPV6b virus like 50. Rassa, J. C., J. L. Meyers, Y. Zhang, R. Kudaravalli, and S. R. Ross. 2002. particles are potent immunogens without adjuvant in man. Vaccine 18: Murine retroviruses activate B cells via interaction with toll-like receptor 4. Proc. 1051–1058. Natl. Acad. Sci. USA 99: 2281–2286. 28. Koutsky, L. A., K. A. Ault, C. M. Wheeler, D. R. Brown, E. Barr, F. B. Alvarez, 51. Baranowski, E., C. M. Ruiz-Jarabo, and E. Domingo. 2001. Evolution of cell recognition by viruses. Science 292: 1102–1105.

L. M. Chiacchierini, K. U. Jansen, and Proof of Principle Study Investigators. Downloaded from 2002. A controlled trial of a human papillomavirus type 16 vaccine. N. Engl. 52. Yan, M., J. Peng, I. A. Jabbar, X. Liu, L. Filgueira, I. H. Frazer, and R. Thomas. J. Med. 347: 1645–1651. 2005. Activation of dendritic cells by human papillomavirus-like particles ␬ ␤ 29. Greenstone, H. L., J. D. Nieland, K. E. de Visser, M. L. De Bruijn, R. Kirnbauer, through TLR4 and NF- B-mediated signalling, moderated by TGF- . Immunol. R. B. Roden, D. R. Lowy, W. M. Kast, and J. T. Schiller. 1998. Chimeric pap- Cell Biol. 83: 83–91. illomavirus virus-like particles elicit antitumor immunity against the E7 oncop- 53. He, B., X. Qiao, and A. Cerutti. 2004. CpG DNA induces IgG class switch DNA rotein in an HPV16 tumor model. Proc. Natl. Acad. Sci. USA 95: 1800–1805. recombination by activating human B cells through an innate pathway that re- 30. Jochmus, I., K. Schafer, S. Faath, M. Muller, and L. Gissmann. 1999. Chimeric quires TLR9 and cooperates with IL-10. J. Immunol. 173: 4479–4491. virus-like particles of the human papillomavirus type 16 (HPV 16) as a prophy- 54. Lenz, P., C. D. Thompson, P. M. Day, S. M. Bacot, D. R. Lowy, and lactic and therapeutic vaccine. Arch. Med. Res. 30: 269–274. J. T. Schiller. 2003. Interaction of papillomavirus virus-like particles with human http://www.jimmunol.org/ myeloid antigen-presenting cells. Clin. Immunol. 106: 231–237. 31. Nieland, J. D., D. M. Da Silva, M. P. Velders, K. E. de Visser, J. T. Schiller, 55. Fausch, S. C., D. M. Da Silva, M. P. Rudolf, and W. M. Kast. 2002. Human M. Muller, and W. M. Kast. 1999. Chimeric papillomavirus virus-like particles papillomavirus virus-like particles do not activate Langerhans cells: a possible induce a murine self-antigen-specific protective and therapeutic antitumor im- immune escape mechanism used by human papillomaviruses. J. Immunol. 169: mune response. J. Cell Biochem. 73: 145–152. 3242–3249. 32. Chackerian, B., P. Lenz, D. R. Lowy, and J. T. Schiller. 2002. Determinants of 56. Bontkes, H. J., J. J. Ruizendaal, D. Kramer, C. J. Meijer, and E. Hooijberg. 2005. autoantibody induction by conjugated papillomavirus virus-like particles. J. Im- Plasmacytoid dendritic cells are present in cervical carcinoma and become acti- munol. 169: 6120–6126. vated by human papillomavirus type 16 virus-like particles. Gynecol. Oncol. 96: 33. Rudolf, M. P., S. C. Fausch, D. M. Da Silva, and W. M. Kast. 2001. Human 897–901. dendritic cells are activated by chimeric human papillomavirus type-16 virus-like 57. Liu, N., N. Ohnishi, L. Ni, S. Akira, and K. B. Bacon. 2003. CpG directly induces particles and induce epitope-specific human T cell responses in vitro. J. Immunol. T-bet expression and inhibits IgG1 and IgE switching in B cells. Nat. Immunol. 166: 5917–5924. 4: 687–693. by guest on October 1, 2021 34. Lenz, P., P. M. Day, Y.-Y. S. Pang, S. A. Frye, P. N. Jensen, D. R. Lowy, and 58. Lin, L., A. J. Gerth, and S. L. Peng. 2004. CpG DNA redirects class-switching J. T. Schiller. 2001. Papillomavirus-like particles induce acute activation of den- towards “Th1-like” Ig isotype production via TLR9 and MyD88. Eur. J. Immu- dritic cells. J. Immunol. 166: 5346–5355. nol. 34: 1483–1487. 35. Yang, R., F. M. Murillo, K.-Y. Lin, W. H. Yutzy, IV, S. Uematsu, K. Takeda, 59. Akira, S., and K. Hoshino. 2003. Myeloid differentiation factor 88-dependent and S. Akira, R. P. Viscidi, and R. B. S. Roden. 2004. Human papillomavirus type-16 -independent pathways in Toll-like receptor signaling. J. Infect. Dis. 187(Suppl. virus-like particles activate complementary defense responses in key dendritic 2): S356–S363. cell subpopulations. J. Immunol. 173: 2624–2631. 60. Nagaoka, H., M. Muramatsu, N. Yamamura, K. Kinoshita, and T. Honjo. 2002. 36. Yang, R., F. M. Murillo, H. Cui, R. Blosser, S. Uematsu, K. Takeda, S. Akira, Activation-induced deaminase (AID)-directed hypermutation in the immunoglob- R. P. Viscidi, and R. B. Roden. 2004. Papillomavirus-like particles stimulate ulin Smu region: implication of AID involvement in a common step of class ␣ murine bone marrow-derived dendritic cells to produce interferon and Th1 switch recombination and somatic hypermutation. J. Exp. Med. 195: 529–534. immune responses via MyD88. J. Virol. 78: 11152–11160. 61. Faili, A., S. Aoufouchi, Q. Gueranger, C. Zober, A. Leon, B. Bertocci, 37. Adachi, O., T. Kawai, K. Takeda, M. Matsumoto, H. Tsutsui, M. Sakagami, J. C. Weill, and C. A. Reynaud. 2002. AID-dependent somatic hypermutation K. Nakanishi, and S. Akira. 1998. Targeted disruption of the MyD88 gene results occurs as a DNA single-strand event in the BL2 cell line. Nat. Immunol. 3: in loss of IL-1- and IL-18-mediated function. Immunity 9: 143–150. 815–821. 38. Rahemtulla, A., W. P. Fung-Leung, M. W. Schilham, T. M. Kundig, 62. Dedeoglu, F., B. Horwitz, J. Chaudhuri, F. W. Alt, and R. S. Geha. 2004. In- S. R. Sambhara, A. Narendran, A. Arabian, A. Wakeham, C. J. Paige, ϩ duction of activation-induced cytidine deaminase gene expression by IL-4 and R. M. Zinkernagel, et al. 1991. Normal development and function of CD8 cells CD40 ligation is dependent on STAT6 and NF␬B. Int. Immunol. 16: 395–404. but markedly decreased helper cell activity in mice lacking CD4. Nature 353: 63. Lillard, J. W., Jr., U. P. Singh, P. N. Boyaka, S. Singh, D. D. Taub, and 180–184. J. R. McGhee. 2003. MIP-1␣ and MIP-1␤ differentially mediate mucosal and 39. Yang, R., W. H. Yutzy, IV, R. P. Viscidi, and R. B. Roden. 2003. Interaction of systemic adaptive immunity. Blood 101: 807–814. L2 with ␤-actin directs intracellular transport of papillomavirus and infection. 64. Jego, G., A. K. Palucka, J. P. Blanck, C. Chalouni, V. Pascual, and J. Banchereau. J. Biol. Chem. 278: 12546–12553. 2003. Plasmacytoid dendritic cells induce plasma cell differentiation through type 40. Lumsden, J. M., J. A. Williams, and R. J. Hodes. 2003. Differential requirements I interferon and interleukin 6. Immunity 19: 225–234. for expression of CD80/86 and CD40 on B cells for T-dependent antibody re- 65. Le Bon, A., G. Schiavoni, G. D’Agostino, I. Gresser, F. Belardelli, and sponses in vivo. J. Immunol. 170: 781–787. D. F. Tough. 2001. Type I interferons potently enhance humoral immunity and 41. Phan, T. G., M. Amesbury, S. Gardam, J. Crosbie, J. Hasbold, P. D. Hodgkin, can promote isotype switching by stimulating dendritic cells in vivo. Immunity A. Basten, and R. Brink. 2003. B cell receptor-independent stimuli trigger im- 14: 461–470. munoglobulin (Ig) class switch recombination and production of IgG autoanti- 66. Szomolanyi-Tsuda, E., and R. M. Welsh. 1998. T-cell-independent antiviral an- bodies by anergic self-reactive B cells. J. Exp. Med. 197: 845–860. tibody responses. Curr. Opin. Immunol. 10: 431–435. 42. Muramatsu, M., K. Kinoshita, S. Fagarasan, S. Yamada, Y. Shinkai, and 67. Sha, Z., and R. W. Compans. 2000. Induction of CD4ϩ T-cell-independent im- T. Honjo. 2000. Class switch recombination and hypermutation require activa- munoglobulin responses by inactivated influenza virus. J. Virol. 74: 4999–5005. tion-induced cytidine deaminase (AID), a potential RNA editing enzyme. Cell 68. Maloy, K. J., B. Odermatt, H. Hengartner, and R. M. Zinkernagel. 1998. Inter- 102: 553–563. feron ␥-producing ␥␦ T cell-dependent antibody isotype switching in the absence 43. Mond, J. J., A. Lees, and C. M. Snapper. 1995. T cell-independent antigens type of germinal center formation during virus infection. Proc. Natl. Acad. Sci. USA 2. Annu. Rev. Immunol. 13: 655–692. 95: 1160–1165.