US 2011 0124911A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2011/0124911 A1 Burk et al. (43) Pub. Date: May 26, 2011

(54) SEM-SYNTHETICTEREPHTHALIC ACID (57) ABSTRACT VLAMCROORGANISMIS THAT PRODUCE The invention provides a non-naturally occurring microbial MUCONCACID organism having a muconate pathway having at least one exogenous nucleic acid encoding a muconate pathway (76) Inventors: Mark J. Burk, San Diego, CA enzyme expressed in a sufficient amount to produce mucon (US); Robin E. Osterhout, San ate. The muconate pathway including an enzyme selected Diego, CA (US); Jun Sun, San from the group consisting of a beta-ketothiolase, a beta-ke Diego, CA (US) toadipyl-CoA hydrolase, a beta-ketoadipyl-CoA transferase, a beta-ketoadipyl-CoA ligase, a 2-fumarylacetate reductase, (21) Appl. No.: 12/851,478 a 2-fumarylacetate dehydrogenase, a trans-3-hydroxy-4-hex endioate dehydratase, a 2-fumarylacetate aminotransferase, a (22) Filed: Aug. 5, 2010 2-fumarylacetate aminating oxidoreductase, a trans-3- amino-4-hexenoate deaminase, a beta-ketoadipate enol-lac Related U.S. Application Data tone hydrolase, a muconolactone isomerase, a muconate cycloisomerase, a beta-ketoadipyl-CoA dehydrogenase, a (60) Provisional application No. 61/231,637, filed on Aug. 3-hydroxyadipyl-CoA dehydratase, a 2.3-dehydroadipyl 5, 2009. CoA transferase, a 2.3-dehydroadipyl-CoA hydrolase, a 2.3- dehydroadipyl-CoA ligase, a muconate reductase, a 2-maley Publication Classification lacetate reductase, a 2-maleylacetate dehydrogenase, a cis-3- hydroxy-4-hexendioate dehydratase, a 2-maleylacetate (51) Int. C. aminoatransferase, a 2-maleylacetate aminating oxidoreduc CD7C 63/26 (2006.01) tase, a cis-3-amino-4-hexendioate deaminase, and a mucon CI2N I/2 (2006.01) ate cis/trans isomerase. Other muconate pathway enzymes CI2P 7/44 (2006.01) also are provided. Additionally provided are methods of pro (52) U.S. Cl...... 562/480:435/252.33: 435/142 ducing muconate. Patent Application Publication May 26, 2011 Sheet 1 of 6 US 2011/O124911A1

O O 2 s S o D al O 1 O

n O

O O

a. Vo O O 92 L t c5 5.2 $2J. : --

C - O

2 cs c s >

Patent Application Publication US 2011/O124911A1

Patent Application Publication US 2011/O124911A1

US 2011/O124911 A1 May 26, 2011

SEM-SYNTHETICTEREPHTHALIC ACID pathways for producing trans,trans-muconate and cis, trans VLAMCROORGANISMIS THAT PRODUCE muconate would be useful because these isomers can serve as MUCONCACID direct synthetic intermediates for producing renewable PTA via the inverse electron demand Diels-Alder reaction with acetylene. The present invention satisfies this need and pro 0001. This application claims the benefit of priority of vides related advantages as well. U.S. Provisional Application No. 61/231,637, filed Aug. 5, 2009, the entire contents of which are incorporated herein by this reference. SUMMARY OF INVENTION

BACKGROUND OF THE INVENTION 0008. The invention provides a non-naturally occurring microbial organism having a muconate pathway having at 0002 The present disclosure relates generally to the least one exogenous nucleic acid encoding a muconate path design of engineered organisms and, more specifically to way enzyme expressed in a sufficient amount to produce organisms having selected genotypes for the production of muconate. The muconate pathway including an enzyme muconic acid. selected from the group consisting of a beta-ketothiolase, a 0003 Terephthalate (also known as terephthalic acid and beta-ketoadipyl-CoA hydrolase, a beta-ketoadipyl-CoA PTA) is the immediate precursor of polyethylene terephtha transferase, a beta-ketoadipyl-CoA ligase, a 2-fumarylacetate late (PET), used to make clothing, resins, plastic bottles and reductase, a 2-fumarylacetate dehydrogenase, a trans-3-hy even as a poultry feed additive. Nearly all PTA is produced droxy-4-hexendioate dehydratase, a 2-fumarylacetate ami from para-Xylene by the oxidation in airina process known as notransferase, a 2-fumarylacetate aminating oxidoreductase, the Mid Century Process (Roffia et al., Ind. Eng. Chem. Prod. a trans-3-amino-4-hexenoate deaminase, a beta-ketoadipate Res. Dev. 23:629-634 (1984)). This oxidation is conducted at enol-lactone hydrolase, a muconolactone isomerase, a high temperature in an acetic acid solvent with a catalyst muconate cycloisomerase, a beta-ketoadipyl-CoA dehydro composed of cobalt and/or manganese salts. Para-Xylene is genase, a 3-hydroxyadipyl-CoA dehydratase, a 2.3-dehy derived from petrochemical sources, and is formed by high droadipyl-CoA transferase, a 2,3-dehydroadipyl-CoA hydro severity catalytic reforming of naphtha. Xylene is also lase, a 2.3-dehydroadipyl-CoA ligase, a muconate reductase, obtained from the pyrolysis gasoline stream in a naphtha a 2-maleylacetate reductase, a 2-maleylacetate dehydroge steam cracker and by toluene disproportion. nase, a cis-3-hydroxy-4-hexendioate dehydratase, a 2-maley 0004 PTA, toluene and other aromatic precursors are lacetate aminoatransferase, a 2-maleylacetate aminating oxi naturally degraded by some bacteria. However, these degra doreductase, a cis-3-amino-4-hexendioate deaminase, and a dation pathways typically involve monooxygenases that muconate cis/trans isomerase. Other muconate pathway operate irreversibly in the degradative direction. Hence, bio enzymes also are provided. Additionally provided are meth synthetic pathways for PTA are severely limited by the prop ods of producing muconate. erties of known enzymes to date. 0005 Muconate (also known as muconic acid, MA) is an unsaturated dicarboxylic acid used as a raw material for res BRIEF DESCRIPTION OF THE DRAWINGS ins, pharmaceuticals and agrochemicals. Muconate can be converted to adipic acid, a precursor of Nylon-6,6, via hydro 0009 FIG. 1 shows the synthesis of terepthalate from genation (Draths and Frost, J. Am. Chem. Soc. 116:399-400 muconate and acetylene via Diels-Alder chemistry. P1 is (1994)). Alternately, muconate can be hydrogenated using cyclohexa-2,5-diene-1,4-dicarboxylate. biometallic nanocatalysts (Thomas et al., Chem. Commun. 0010 FIG. 2 shows pathways to trans-trans muconate 10:1126-1127 (2003)). from succinyl CoA. Enzymes are A) beta-ketothiolase, B) 0006 Muconate is a common degradation product of beta-ketoadipyl-CoA hydrolase, transferase and/or ligase, C) diverse aromatic compounds in microbes. Several biocata 2-fumarylacetate reductase, D) 2-fumarylacetate dehydroge lytic strategies for making cis,cis-muconate have been devel nase, E) trans-3-hydroxy-4-hexendioate dehydratase, F) oped. Engineered E. coli strains producing muconate from 2-fumarylacetate aminotransferase and/or 2-fumarylacetate glucose via shikimate pathway enzymes have been developed aminating oxidoreductase, G) trans-3-amino-4-hexenoate in the Frost lab (U.S. Pat. No. 5,487.987 (1996): Niu et al., deaminase, H) beta-ketoadipate enol-lactone hydrolase, I) Biotechnol Prog., 18:201-211 (2002)). These strains are able muconolactone isomerase, J) muconate cycloisomerase, K) to produce 36.8 g/L of cis,cis-muconate after 48 hours of beta-ketoadipyl-CoA dehydrogenase, L) 3-hydroxyadipyl culturing under fed-batch fermenter conditions (22% of the CoA dehydratase, M) 2.3-dehydroadipyl-CoA transferase, maximum theoretical yield from glucose). Muconate has also hydrolase or ligase, N) muconate reductase, O) 2-maleylac been produced biocatalytically from aromatic starting mate etate reductase, P) 2-maleylacetate dehydrogenase, Q) cis-3- rials such as toluene, benzoic acid and catechol. Strains pro hydroxy-4-hexendioate dehydratase, R) 2-maleylacetate ducing muconate from benzoate achieved titers of 13.5 g/L aminotransferase and/or 2-maleylacetate aminating oxi and productivity of 5.5 g/L/hr (Choi et al., J. Ferment. Bioeng. doreductase, S) cis-3-amino-4-hexendioate deaminase, T) 84:70-76 (1997)). Muconate has also been generated from the muconate cis/trans isomerase, W) muconate cis/trans effluents of a styrene monomer production plant (Wu et al., isomerase. Enzyme and Microbiology Technology 35:598-604 (2004)). 0011 FIG. 3 shows pathways to muconate from pyruvate 0007 All biocatalytic pathways identified to date proceed and malonate semialdehyde. Enzymes are A) 4-hydroxy-2- through enzymes in the shikimate pathway, or degradation ketovalerate aldolase, B) 2-oxopentenoate hydratase, C) enzymes from catechol. Consequently, they are limited to 4-oxalocrotonate dehydrogenase, D) 2-hydroxy-4-hexene producing the cis, cis isomer of muconate, since these path dioate dehydratase, E) 4-hydroxy-2-oxohexanedioate oxi ways involve ring-opening chemistry. The development of doreductase, F) 2,4-dihydroxyadipate dehydratase (acting on US 2011/O124911 A1 May 26, 2011

2-hydroxy), G) 2,4-dihydroxyadipate dehydratase (acting on 0019. As used herein, the term “non-naturally occurring 4-hydroxyl group) and H) 3-hydroxy-4-hexenedioate dehy when used in reference to a microbial organism or microor dratase. ganism of the invention is intended to mean that the microbial 0012 FIG. 4 shows pathways to muconate from pyruvate organism has at least one genetic alteration not normally and succinic semialdehyde. Enzymes are A) HODHaldolase, foundina naturally occurring Strain of the referenced species, B) OHED hydratase, C) OHED decarboxylase, D) HODH including wild-type strains of the referenced species. Genetic formate-lyase and/or HODH dehydrogenase, E) OHED for alterations include, for example, modifications introducing mate-lyase and/or OHED dehydrogenase, F) 6-OHE dehy expressible nucleic acids encoding metabolic polypeptides, drogenase, G) 3-hydroxyadipyl-CoA dehydratase, H) 2.3- other nucleic acid additions, nucleic acid deletions and/or dehydroadipyl-CoA hydrolase, transferase or ligase, I) other functional disruption of the microbial genetic material. muconate reductase. Abbreviations are: HODH-4-hydroxy Such modifications include, for example, coding regions and 2-oxoheptane-1,7-dioate, OHED-2-oxohept-4-ene-1,7-dio functional fragments thereof, for heterologous, homologous ate, 6-OHE=6-oxo-2,3-dehydrohexanoate. or both heterologous and homologous polypeptides for the 0013 FIG. 5 shows pathways to muconate from lysine. Enzymes are A) lysine aminotransferase and/or aminating referenced species. Additional modifications include, for oxidoreductase, B) 2-aminoadipate semialdehyde dehydro example, non-coding regulatory regions in which the modi genase, C) 2-aminoadipate deaminase, D) muconate reduc fications alter expression of a gene or operon. Exemplary tase, E) lysine-2,3-aminomutase, F) 3,6-diaminohexanoate metabolic polypeptides include enzymes or proteins within a aminotransferase and/or aminating oxidoreductase, G) muconate biosynthetic pathway. 3-aminoadipate semialdehyde dehydrogenase, H) 3-aminoa 0020. A metabolic modification refers to a biochemical dipate deaminase. reaction that is altered from its naturally occurring state. 0014 FIG. 6 shows 3 thiolases with demonstrated thiolase Therefore, non-naturally occurring microorganisms can have activity resulting in acetoacetyl-CoA formation (left panel). genetic modifications to nucleic acids encoding metabolic FIG. 6 also shows that several enzymes demonstrated selec polypeptides or, functional fragments thereof. Exemplary tive condensation of Succinyl-CoA and acetyl-CoA to form metabolic modifications are disclosed herein. B-ketoadipyl-CoA as the sole product (right panel). 0021. As used herein, the term "isolated when used in reference to a microbial organism is intended to mean an DETAILED DESCRIPTION OF THE INVENTION organism that is Substantially free of at least one component 0015 The present invention is directed, in part, to a bio as the referenced microbial organism is found in nature. The synthetic pathway for synthesizing muconate from simple term includes a microbial organism that is removed from carbohydrate feedstocks, which in turn provides a viable syn Some or all components as it is found in its natural environ thetic route to PTA. In particular, pathways disclosed herein ment. The term also includes a microbial organism that is provide trans,trans-muconate or cis, trans-muconate biocata removed from Some or all components as the microbial lytically from simple Sugars. The all trans or cis, trans isomer organism is found in non-naturally occurring environments. of muconate is then converted to PTA in a two step process via Therefore, an isolated microbial organism is partly or com inverse electron demand Diels-Alder reaction with acetylene pletely separated from other Substances as it is found in nature followed by oxidation in air or oxygen. The Diels-Alder or as it is grown, stored or subsisted in non-naturally occur reaction between muconate and acetylene proceeds to form ring environments. Specific examples of isolated microbial cyclohexa-2,5-diene-1,4-dicarboxylate (P1), as shown in organisms include partially pure microbes, Substantially pure FIG.1. Subsequent exposure to air or oxygen rapidly converts microbes and microbes cultured in a medium that is non P1 to PTA. naturally occurring. 0016. This invention is also directed, in part, to non-natu 0022. As used herein, the terms “microbial.” “microbial rally occurring microorganisms that express genes encoding organism' or “microorganism' is intended to mean any enzymes that catalyze muconate production. Pathways for the organism that exists as a microscopic cell that is included production of muconate disclosed herein are derived from within the domains of archaea, bacteria or eukarya. There central metabolic precursors. Successfully engineering these fore, the term is intended to encompass prokaryotic or pathways entails identifying an appropriate set of enzymes eukaryotic cells or organisms having a microscopic size and with Sufficient activity and specificity, cloning their corre includes bacteria, archaea and eubacteria of all species as well sponding genes into a production host, optimizing the expres as eukaryotic microorganisms such as yeast and fungi. The sion of these genes in the production host, optimizing fermen term also includes cell cultures of any species that can be tation conditions, and assaying for product formation cultured for the production of a biochemical. following fermentation. (0023. As used herein, the term “CoA' or “coenzyme A' is 0017. The maximum theoretical yield of muconic acid is intended to mean an organic cofactor or prosthetic group 1.09 moles per mole glucose utilized. Achieving this yield (nonprotein portion of an enzyme) whose presence is involves assimilation of CO as shown in equation 1 below: required for the activity of many enzymes (the apoenzyme) to form an active enzyme system. Coenzyme A functions in (equation 1) certain condensing enzymes, acts in acetyl or other acyl group 0.018. As used herein, the term “muconate' is used inter transfer and in fatty acid synthesis and oxidation, pyruvate changeably with muconic acid. Muconate is also used to refer oxidation and in other acetylation. to any of the possible isomeric forms: trans,trans, cis,trans, 0024. As used herein, the term “substantially anaerobic' and cis,cis. However, the present invention provides path when used in reference to a culture or growth condition is ways to the useful trans,trans and cis, trans forms, in particu intended to mean that the amount of oxygen is less than about lar. 10% of saturation for dissolved oxygen in liquid media. The US 2011/O124911 A1 May 26, 2011

term also is intended to include sealed chambers of liquid or sidered orthologs if they share three-dimensional structure Solid medium maintained with an atmosphere of less than but not necessarily sequence similarity, of a Sufficient amount about 1% oxygen. to indicate that they have evolved from a common ancestor to 0025 “Exogenous” as it is used herein is intended to mean the extent that the primary sequence similarity is not identi that the referenced molecule or the referenced activity is fiable. Genes that are orthologous can encode proteins with introduced into the host microbial organism. The molecule sequence similarity of about 25% to 100% amino acid can be introduced, for example, by introduction of an encod sequence identity. Genes encoding proteins sharing an amino ing nucleic acid into the host genetic material Such as by acid similarity less that 25% can also be considered to have integration into a host chromosome or as non-chromosomal arisen by vertical descent if their three-dimensional structure genetic material Such as a plasmid. Therefore, the term as it is also shows similarities. Members of the serine protease fam used in reference to expression of an encoding nucleic acid ily of enzymes, including tissue plasminogen activator and refers to introduction of the encoding nucleic acid in an elastase, are considered to have arisen by Vertical descent expressible form into the microbial organism. When used in from a common ancestor. reference to a biosynthetic activity, the term refers to an 0029 Orthologs include genes or their encoded gene prod activity that is introduced into the host reference organism. ucts that through, for example, evolution, have diverged in The source can be, for example, a homologous or heterolo structure or overall activity. For example, where one species gous encoding nucleic acid that expresses the referenced encodes a gene product exhibiting two functions and where activity following introduction into the host microbial organ Such functions have been separated into distinct genes in a ism. Therefore, the term “endogenous” refers to a referenced second species, the three genes and their corresponding prod molecule or activity that is present in the host. Similarly, the ucts are considered to be orthologs. For the production of a term when used in reference to expression of an encoding biochemical product, those skilled in the art will understand nucleic acid refers to expression of an encoding nucleic acid that the orthologous gene harboring the metabolic activity to contained within the microbial organism. The term "heterolo be introduced or disrupted is to be chosen for construction of gous” refers to a molecule or activity derived from a source the non-naturally occurring microorganism. An example of other than the referenced species whereas “homologous' orthologs exhibiting separable activities is where distinct refers to a molecule or activity derived from the host micro activities have been separated into distinct gene products bial organism. Accordingly, exogenous expression of an between two or more species or within a single species. A encoding nucleic acid of the invention can utilize either or specific example is the separation of elastase proteolysis and both a heterologous or homologous encoding nucleic acid. plasminogen proteolysis, two types of serine protease activ 0026. The non-naturally occurring microbal organisms of ity, into distinct molecules as plasminogen activator and the invention can contain stable genetic alterations, which elastase. A second example is the separation of mycoplasma refers to microorganisms that can be cultured for greater than 5'-3' exonuclease and Drosophila DNA polymerase III activ five generations without loss of the alteration. Generally, ity. The DNA polymerase from the first species can be con stable genetic alterations include modifications that persist sidered an ortholog to either or both of the exonuclease or the greater than 10 generations, particularly stable modifications polymerase from the second species and vice versa. will persist more than about 25 generations, and more par 0030. In contrast, paralogs are homologs related by, for ticularly, stable genetic modifications will be greater than 50 example, duplication followed by evolutionary divergence generations, including indefinitely. and have similar or common, but not identical functions. 0027. Those skilled in the art will understand that the Paralogs can originate or derive from, for example, the same genetic alterations, including metabolic modifications exem species or from a different species. For example, microsomal plified herein, are described with reference to a suitable host epoxide hydrolase (epoxide hydrolase I) and soluble epoxide organism such as E. coli and their corresponding metabolic hydrolase (epoxide hydrolase II) can be considered paralogs reactions or a Suitable source organism for desired genetic because they represent two distinct enzymes, co-evolved material Such as genes for a desired metabolic pathway. How from a common ancestor, that catalyze distinct reactions and ever, given the complete genome sequencing of a wide variety have distinct functions in the same species. Paralogs are pro of organisms and the high level of skill in the area of genom teins from the same species with significant sequence simi ics, those skilled in the art will readily be able to apply the larity to each other suggesting that they are homologous, or teachings and guidance provided herein to essentially all related through co-evolution from a common ancestor. other organisms. For example, the E. coli metabolic alter Groups of paralogous protein families include Hip A ations exemplified herein can readily be applied to other homologs, luciferase genes, peptidases, and others. species by incorporating the same or analogous encoding 0031. A nonorthologous gene displacement is a non nucleic acid from species other than the referenced species. orthologous gene from one species that can Substitute for a Such genetic alterations include, for example, genetic alter referenced gene function in a different species. Substitution ations of species homologs, in general, and in particular, includes, for example, being able to perform Substantially the orthologs, paralogs or nonorthologous gene displacements. same or a similar function in the species of origin compared to 0028. An ortholog is a gene or genes that are related by the referenced function in the different species. Although vertical descent and are responsible for substantially the same generally, a nonorthologous gene displacement will be iden or identical functions in different organisms. For example, tifiable as structurally related to a known gene encoding the mouse epoxide hydrolase and human epoxide hydrolase can referenced function, less structurally related but functionally be considered orthologs for the biological function of similar genes and their corresponding gene products never hydrolysis of epoxides. Genes are related by vertical descent theless will still fall within the meaning of the term as it is when, for example, they share sequence similarity of Suffi used herein. Functional similarity requires, for example, at cient amount to indicate they are homologous, or related by least some structural similarity in the active site or binding evolution from a common ancestor. Genes can also be con region of a nonorthologous gene product compared to a gene US 2011/O124911 A1 May 26, 2011

encoding the function sought to be substituted. Therefore, a encoding a muconate pathway enzyme expressed in a suffi nonorthologous gene includes, for example, a paralog or an cient amount to produce muconate. The muconate pathway unrelated gene. includes an enzyme selected from the group consisting of a 0032. Therefore, in identifying and constructing the non beta-ketothiolase, a beta-ketoadipyl-CoA hydrolase, a beta naturally occurring microbial organisms of the invention hav ketoadipyl-CoA transferase, a beta-ketoadipyl-CoA ligase, a ing muconate biosynthetic capability, those skilled in the art 2-fumarylacetate reductase, a 2-fumarylacetate dehydroge will understand with applying the teaching and guidance nase, a trans-3-hydroxy-4-hexendioate dehydratase, a 2-fu provided herein to a particular species that the identification marylacetate aminotransferase, a 2-fumarylacetate aminating of metabolic modifications can include identification and oxidoreductase, a trans-3-amino-4-hexenoate deaminase, a inclusion or inactivation of orthologs. To the extent that para beta-ketoadipate enol-lactone hydrolase, a muconolactone logs and/or nonorthologous gene displacements are present in isomerase, a muconate cycloisomerase, a beta-ketoadipyl the referenced microorganism that encode an enzyme cata CoA dehydrogenase, a 3-hydroxyadipyl-CoA dehydratase, a lyzing a similar or Substantially similar metabolic reaction, 2,3-dehydroadipyl-CoA transferase, a 2.3-dehydroadipyl those skilled in the art also can utilize these evolutionally CoA hydrolase, a 2.3-dehydroadipyl-CoA ligase, a muconate related genes. reductase, a 2-maleylacetate reductase, a 2-maleylacetate 0033 Orthologs, paralogs and nonorthologous gene dis dehydrogenase, a cis-3-hydroxy-4-hexendioate dehydratase, placements can be determined by methods well known to a 2-maleylacetate aminotransferase, a 2-maleylacetate ami those skilled in the art. For example, inspection of nucleic nating oxidoreductase, a cis-3-amino-4-hexendioate deami acid oramino acid sequences for two polypeptides will reveal nase, and a muconate cis/trans isomerase. sequence identity and similarities between the compared 0036. In particular embodiments, the muconate pathway sequences. Based on Such similarities, one skilled in the art includes a set of muconate pathway enzymes shown in FIG.2 can determine if the similarity is sufficiently high to indicate and selected from the group consisting of the proteins are related through evolution from a common 0037 A) (1) beta-ketothiolase, (2) an enzyme selected ancestor. Algorithms well known to those skilled in the art, from beta-ketoadipyl-CoA hydrolase, beta-ketoadipyl-CoA such as Align, BLAST, Clustal W and others compare and transferase, and beta-ketoadipyl-CoA ligase, (3) beta-ketoa determine a raw sequence similarity or identity, and also dipate enol-lactone hydrolase, (4) muconolactone isomerase, determine the presence or significance of gaps in the sequence (5) muconate cycloisomerase, and (6) a muconate cis/trans which can be assigned a weight or score. Such algorithms also isomerase: are known in the art and are similarly applicable for deter 0038 B) (1) beta-ketothiolase, (2) an enzyme selected mining nucleotide sequence similarity or identity. Parameters from beta-ketoadipyl-CoA hydrolase, beta-ketoadipyl-CoA for sufficient similarity to determine relatedness are com transferase and beta-ketoadipyl-CoA ligase, (3) 2-maleylac puted based on well known methods for calculating statistical etate reductase, (4) 2-maleylacetate dehydrogenase, (5) cis similarity, or the chance of finding a similar match in a ran 3-hydroxy-4-hexendioate dehydratase, and (6) muconate cis/ dom polypeptide, and the significance of the match deter trans isomerase; mined. A computer comparison of two or more sequences 0039 C) (1) beta-ketothiolase, (2) an enzyme selected can, if desired, also be optimized visually by those skilled in from beta-ketoadipyl-CoA hydrolase, beta-ketoadipyl-CoA the art. Related gene products or proteins can be expected to transferase and beta-ketoadipyl-CoA ligase, (3) 2-maleylac have a high similarity, for example, 25% to 100% sequence etate reductase, (4) an enzyme selected from 2-maleylacetate identity. Proteins that are unrelated can have an identity which aminotransferase and 2-maleylacetate aminating oxi is essentially the same as would be expected to occur by doreductase, (5) cis-3-amino-4-hexenoate deaminase, and (6) chance, if a database of sufficient size is scanned (about 5%). muconate cis/trans isomerase; Sequences between 5% and 24% may or may not represent 0040 D) (1) beta-ketothiolase, (2) beta-ketoadipyl-CoA Sufficient homology to conclude that the compared sequences dehydrogenase, (3) 3-hydroxyadipyl-CoA dehydratase, (4) are related. Additional statistical analysis to determine the an enzyme selected from 2,3-dehydroadipyl-CoA trans significance of such matches given the size of the data set can ferase, 2,3-dehydroadipyl-CoA hydrolase and 2,3-dehydroa be carried out to determine the relevance of these sequences. dipyl-CoA ligase, and (5) muconate reductase; 0034 Exemplary parameters for determining relatedness 0041 E) (1) beta-ketothiolase, (2) an enzyme selected of two or more sequences using the BLAST algorithm, for from beta-ketoadipyl-CoA hydrolase, beta-ketoadipyl-CoA example, can be as set forth below. Briefly, amino acid transferase and beta-ketoadipyl-CoA ligase, (3)2-fumarylac sequence alignments can be performed using BLASTP ver etate reductase, (4) 2-fumarylacetate dehydrogenase, and (5) sion 2.0.8 (Jan. 5, 1999) and the following parameters: trans-3-hydroxy-4-hexendioate dehydratase; Matrix: 0 BLOSUM62; gap open: 11; gap extension: 1; 0042 F) (1) beta-ketothiolase, (2) an enzyme selected X dropoff 50; expect: 10.0; wordsize: 3; filter: on. Nucleic from beta-ketoadipyl-CoA hydrolase, beta-ketoadipyl-CoA acid sequence alignments can be performed using BLASTN transferase and beta-ketoadipyl-CoA ligase, (3)2-fumarylac version 2.0.6 (Sep. 16, 1998) and the following parameters: etate reductase, (4) an enzyme selected from 2-fumarylac Match: 1; mismatch: -2, gap open: 5; gap extension: 2; etate aminotransferase and 2-fumarylacetate aminating oxi X dropoff 50; expect: 10.0; wordsize: 11; filter: off. Those doreductase, and (5) trans-3-amino-4-hexenoate deaminase. skilled in the art will know what modifications can be made to 0043. In some embodiments, a microbial organism having the above parameters to either increase or decrease the strin a pathway exemplified by those shown in FIG. 2 can include gency of the comparison, for example, and determine the two or more exogenous nucleic acids each encoding a mucon relatedness of two or more sequences. ate pathway enzyme, including three, four, five, six, that is up 0035. In some embodiments, the invention provides a non to all of the of enzymes in a muconate pathway. The non naturally occurring microbial organism having a muconate naturally occurring microbial organism having at least one pathway that includes at least one exogenous nucleic acid exogenous nucleic acid can include a heterologous nucleic US 2011/O124911 A1 May 26, 2011 acid. A non-naturally occurring microbial organism having a dipyl-CoA hydrolase, 2,3-dehydroadipyl-CoA transferase pathway exemplified by those shown in FIG. 2 can be cul and 2,3-dehydroadipyl-CoA ligase, and (5) muconate reduc tured in a Substantially anaerobic culture medium. tase; and 0044. In some embodiments, the invention provides a non 0054 C)(1) HODHaldolase, (2) an enzyme selected from naturally occurring microbial organism having a muconate HODH formate-lyase and HODH dehydrogenase, (3) 3-hy droxyadipyl-CoA dehydratase, (4) an enzyme selected from pathway that includes at least one exogenous nucleic acid 2,3-dehydroadipyl-CoA hydrolase, 2,3-dehydroadipyl-CoA encoding a muconate pathway enzyme expressed in a suffi transferase and 2.3-dehydroadipyl-CoA ligase, and (5) cient amount to produce muconate. The muconate pathway muconate reductase includes an enzyme selected from the group consisting of a 0055. In some embodiments, a microbial organism having 4-hydroxy-2-ketovalerate aldolase, a 2-oxopentenoate a pathway exemplified by those shown in FIG. 4 can include hydratase, a 4-oxalocrotonate dehydrogenase, a 2-hydroxy two or more exogenous nucleic acids each encoding a mucon 4-hexenedioate dehydratase, a 4-hydroxy-2-oxohexanedio ate pathway enzyme, including three, four, five, that is up to ate oxidoreductase, a 2,4-dihydroxyadipate dehydratase (act all of the of enzymes in a muconate pathway. The non-natu ing on 2-hydroxy), a 2,4-dihydroxyadipate dehydratase rally occurring microbial organism having at least one exog (acting on 4-hydroxyl group) and a 3-hydroxy-4-hexenedio enous nucleic acid can include a heterologous nucleic acid. A ate dehydratase. non-naturally occurring microbial organism having a path 0045. In particular embodiments, the muconate pathway way exemplified by those shown in FIG. 4 can be cultured in includes a set of muconate pathway enzymes shown in FIG.3 a Substantially anaerobic culture medium. and selected from the group consisting of 0056. In some embodiments, the invention provides a non 0046 A) (1) 4-hydroxy-2-ketovalerate aldolase, (2) naturally occurring microbial organism having a muconate 2-oxopentenoate hydratase, (3) 4-Oxalocrotonate dehydroge pathway that includes at least one exogenous nucleic acid nase, (4) 2-hydroxy-4-hexenedioate dehydratase; encoding a muconate pathway enzyme expressed in a suffi 0047 B) (1) 4-hydroxy-2-ketovalerate aldolase, (2) 4-hy cient amount to produce muconate. The muconate pathway droxy-2-oxohexanedioate oxidoreductase, (3) 2,4-dihy includes an enzyme selected from the group consisting of a droxyadipate dehydratase (acting on 2-hydroxy), (4) 3-hy lysine aminotransferase, alysineaminating oxidoreductase, a droxy-4-hexenedioate dehydratase; and 2-aminoadipate semialdehyde dehydrogenase, a 2-aminoadi 0048 C) (1) 4-hydroxy-2-ketovalerate aldolase, (2) 4-hy pate deaminase, a muconate reductase, a lysine-2,3-amino droxy-2-oxohexanedioate oxidoreductase, (3) 2,4-dihy mutase, a 3,6-diaminohexanoate aminotransferase, a 3,6-di droxyadipate dehydratase (acting on 4-hydroxyl group), (4) aminohexanoate aminating oxidoreductase, a 2-hydroxy-4-hexenedioate dehydratase. 3-aminoadipate semialdehyde dehydrogenase, and a 3-ami noadipate deaminase. 0049. In some embodiments, a microbial organism having a pathway exemplified by those shown in FIG. 3 can include 0057. In particular embodiments, the muconate pathway two or more exogenous nucleic acids each encoding a mucon includes a set of muconate pathway enzymes shown in FIG.5 ate pathway enzyme, including three, four, that is up to all of and selected from the group consisting of the of enzymes in a muconate pathway. The non-naturally 0.058 A) (1) lysine aminotransferase, (2) lysine aminating occurring microbial organism having at least one exogenous oxidoreductase, (3) 2-aminoadipate semialdehyde dehydro nucleic acid can include a heterologous nucleic acid. A non genase, (4) 2-aminoadipate deaminase, and (5) muconate naturally occurring microbial organism having a pathway reductase exemplified by those shown in FIG. 3 can be cultured in a 0059 B) (1) lysine-2,3-aminomutase, (2) 3,6-diamino hexanoate aminotransferase, (3)3,6-diaminohexanoate ami Substantially anaerobic culture medium. nating oxidoreductase, (4) 3-aminoadipate semialdehyde 0050. In some embodiments, the invention provides a non dehydrogenase, (5) 3-aminoadipate deaminase, and (6) naturally occurring microbial organism having a muconate muconate reductase. pathway that includes at least one exogenous nucleic acid encoding a muconate pathway enzyme expressed in a suffi 0060. In some embodiments, a microbial organism having cient amount to produce muconate. The muconate pathway a pathway exemplified by those shown in FIG. 5 can include includes an enzyme selected from the group consisting of an two or more exogenous nucleic acids each encoding a mucon HODHaldolase, an OHED hydratase, an OHED decarboxy ate pathway enzyme, including three, four, five, six, that is up lase, an HODH formate-lyase, an HODH dehydrogenase, an to all of the of enzymes in a muconate pathway. The non OHED formate-lyase, an OHED dehydrogenase, a 6-OHE naturally occurring microbial organism having at least one dehydrogenase, a 3-hydroxyadipyl-CoA dehydratase, a 2.3- exogenous nucleic acid can include a heterologous nucleic dehydroadipyl-CoA hydrolase, a 2,3-dehydroadipyl-CoA acid. A non-naturally occurring microbial organism having a transferase, a 2.3-dehydroadipyl-CoA ligase, and a muconate pathway exemplified by those shown in FIG. 2 can be cul reductase. tured in a Substantially anaerobic culture medium. 0061. In an additional embodiment, the invention provides 0051. In particular embodiments, the muconate pathway a non-naturally occurring microbial organism having a includes a set of muconate pathway enzymes shown in FIG. 4 muconate pathway, wherein the non-naturally occurring and selected from the group consisting of microbial organism comprises at least one exogenous nucleic 0052 A) (1) HODH aldolase, (2) OHED hydratase, (3) acid encoding an enzyme or protein that converts a substrate OHED decarboxylase, (4) 6-OHE dehydrogenase, and (5) to a product selected from the group consisting of Succinyl muconate reductase; CoA to beta-ketoadipyl-CoA, beta-ketoadipyl-CoA to 3-hy 0053 B) (1) HODHaldolase, (2) OHED hydratase, (3) an droxyadipyl-CoA, 3-hydroxyadipyl-CoA to 2,3-dehydroad enzyme selected from OHED formate-lyase and OHED ipyl-CoA, 2,3-dehydroadipyl-CoA to 2,3-dehydroadipate, dehydrogenase, (4) an enzyme selected from 2,3-dehydroa and 2.3-dehydroadipate to trans,trans-muconate. Alterna US 2011/O124911 A1 May 26, 2011 tively, the non-naturally occurring microbial organism com least one exogenous nucleic acid encoding an enzyme or prises at least one exogenous nucleic acid encoding an protein that converts a substrate to a product selected from the enzyme or protein that converts a Substrate to a product group consisting of pyruvate and malonate semialdehyde to selected from the group consisting of Succinyl-CoA to beta 4-hydroxy-2-oxohexandioate, 4-hydroxy-2-oxohexandioate, ketoadipyl-CoA, beta-ketoadipyl-CoA to beta-ketoadipate, 4-hydroxy-2-oxohexandioate to 2,4-dihydroxyadipate, 2,4- beta-ketoadipate to 2-maleylacetate, 2-maleylacetate to cis dihydroxyadipate to 3-hydroxy-4-hexendioate, and 3-hy 3-hydroxy-4-hexendioate, cis-3-hydroxy-4-hexendioate to droxy-4-hexendioate to muconate. Thus, the invention pro cis, trans-muconate, and cis, trans-muconate to trans,trans vides a non-naturally occurring microbial organism muconate. Alternatively, the non-naturally occurring micro containing at least one exogenous nucleic acid encoding an bial organism comprises at least one exogenous nucleic acid enzyme or protein, where the enzyme or protein converts the encoding an enzyme or protein that converts a Substrate to a Substrates and products of a muconate pathway, Such as those product selected from the group consisting of Succinyl-CoA shown in FIG. 3. to beta-ketoadipyl-CoA, beta-ketoadipyl-CoA to beta-ketoa 0063. In an additional embodiment, the invention provides dipate, beta-ketoadipate to 2-maleylacetate, 2-maleylacetate a non-naturally occurring microbial organism having a to cis-3-amino-4-hexendioate, cis-3-amino-4-hexendioate to muconate pathway, wherein the non-naturally occurring cis, trans-muconate, and cis, trans-muconate to trans,trans microbial organism comprises at least one exogenous nucleic muconate. Alternatively, the non-naturally occurring micro acid encoding an enzyme or protein that converts a substrate bial organism comprises at least one exogenous nucleic acid to a product selected from the group consisting of pyruvate encoding an enzyme or protein that converts a Substrate to a and succinic semialdehyde to HODH, HODH to 3-hydroxya product selected from the group consisting of Succinyl-CoA dipyl-CoA, 3-hydroxy adipyl-CoA to 2,3-dehydroadipyl to beta-ketoadipyl-CoA, beta-ketoadipyl-CoA to beta-ketoa CoA, 2,3-dehydroadipyl-CoA to 2,3-dehydroadipate, and dipate, beta-ketoadipate to 2-fumarylacetate, 2-fumarylac 2,3-dehydroadipate to muconate. Alternatively, the non-natu etate to trans-3-hydroxy-4-hexendioate, and trans-3-hy rally occurring microbial organism comprises at least one droxy-4-dienoate to trans,trans-muconate. Alternatively, the exogenous nucleic acid encoding an enzyme or protein that non-naturally occurring microbial organism comprises at converts a Substrate to a product selected from the group least one exogenous nucleic acid encoding an enzyme or consisting of pyruvate and succinic semialdehyde to HODH, protein that converts a substrate to a product selected from the HODH to OHED, OHED to 2,3-dehydroadipyl-CoA, 2,3- group consisting of Succinyl-CoA to beta-ketoadipyl-CoA, dehydroadipyl-CoA to 2,3-dehydroadipate, and 2,3-dehy beta-ketoadipyl-CoA to beta-ketoadipate, beta-ketoadipate droadipate to muconate. Alternatively, the non-naturally to 2-fumarylacetate, 2-fumarylacetate to trans-3-amino-4- occurring microbial organism comprises at least one exog hexendioate, trans-3-amino-4-hexendioate to trans,trans-mu enous nucleic acid encoding an enzyme or protein that con conate. Alternatively, the non-naturally occurring microbial verts a substrate to a product selected from the group consist organism comprises at least one exogenous nucleic acid ing of pyruvate and succinic semialdehyde to HODH, HODH encoding an enzyme or protein that converts a Substrate to a to OHED, OHED to 6-OHE, 6-OHE to 2,3-dehydroadipate, product selected from the group consisting of Succinyl-CoA and 2,3-dehydroadipate to muconate. Thus, the invention pro to beta-ketoadipyl-CoA, beta-ketoadipyl-CoA to beta-ketoa vides a non-naturally occurring microbial organism contain dipate, beta-ketoadipate to beta-ketoadipate enol-lactone, ing at least one exogenous nucleic acid encoding an enzyme beta-ketoadipate enol-lactone to muconolactone, muconolac or protein, where the enzyme or protein converts the Sub tone to cis,cis-muconate, cis,cis-muconate to cis, trans-mu strates and products of a muconate pathway, such as those conate, and cis, trans muconate to trans,trans-muconate. shown in FIG. 4. Thus, the invention provides a non-naturally occurring micro 0064. In an additional embodiment, the invention provides bial organism containing at least one exogenous nucleic acid a non-naturally occurring microbial organism having a encoding an enzyme or protein, where the enzyme or protein muconate pathway, wherein the non-naturally occurring converts the Substrates and products of a muconate pathway, microbial organism comprises at least one exogenous nucleic such as those shown in FIG. 2. acid encoding an enzyme or protein that converts a substrate 0062. In an additional embodiment, the invention provides to a product selected from the group consisting of lysine to a non-naturally occurring microbial organism having a 2-aminoadipate semialdehyde, 2-aminoadipate semialde muconate pathway, wherein the non-naturally occurring hyde to 2-aminoadipate, 2-aminoadipate to 2,3-dehydroadi microbial organism comprises at least one exogenous nucleic pate, and 2,3-dehydroadipate to muconate. Alternatively, the acid encoding an enzyme or protein that converts a substrate non-naturally occurring microbial organism comprises at to a product selected from the group consisting of pyruvate least one exogenous nucleic acid encoding an enzyme or and malonate semialdehyde to 4-hydroxy-2-oxohexandioate, protein that converts a substrate to a product selected from the 4-hydroxy-2-oxohexandioate to 4-oxalocrotonate, 4-Oxalo group consisting of lysine to 3,6-diaminohexanoate, 3,6-di crotonate to 2-hydroxy-4-hexendioate, and 2-hydroxy-4- aminohexanoate to 3-aminoadipate semialdehyde, 3-aminoa hexendioate to muconate. Alternatively, the non-naturally dipate semialdehyde to 3-aminoadipate, 3-aminoadipate to occurring microbial organism comprises at least one exog 2,3-dehydroadipate, and 2,3-dehydroadipate to muconate. enous nucleic acid encoding an enzyme or protein that con Thus, the invention provides a non-naturally occurring micro verts a Substrate to a product selected from the group consist bial organism containing at least one exogenous nucleic acid ing of pyruvate and malonate semialdehyde to 4-hydroxy-2- encoding an enzyme or protein, where the enzyme or protein oxohexandioate, 4-hydroxy-2-oxohexandioate, 4-hydroxy converts the Substrates and products of a muconate pathway, 2-oxohexandioate tO 2,4-dihydroxyadipate, 2,4- such as those shown in FIG. 5. dihydroxyadipate to 2-hydroxy-4-hexendioate, and 0065. The invention is described herein with general ref 2-hydroxy-4-hexendioate to muconate. Alternatively, the erence to the metabolic reaction, reactant or product thereof, non-naturally occurring microbial organism comprises at or with specific reference to one or more nucleic acids or US 2011/O124911 A1 May 26, 2011

genes encoding an enzyme associated with or catalyzing, or a ATP per glucose utilized at the maximum muconate yield. protein associated with, the referenced metabolic reaction, The first step of this pathway, the condensation of Succinyl reactant or product. Unless otherwise expressly stated herein, CoA and acetyl-CoA by beta-ketothiolase, has been demon those skilled in the art will understand that reference to a strated by Applicants is shown below in Example I. reaction also constitutes reference to the reactants and prod 0072 Another pathway for muconate synthesis involves ucts of the reaction. Similarly, unless otherwise expressly the condensation of pyruvate and malonate semialdehyde, as stated herein, reference to a reactant or product also refer shown in FIG.3. Malonate semialdehyde can beformed in the ences the reaction, and reference to any of these metabolic cell by several different pathways. Two example pathways constituents also references the gene or genes encoding the are: 1) decarboxylation of oxaloacetate, and 2) conversion of enzymes that catalyze or proteins involved in the referenced 2-phosphoglycerate to glycerol which can then be dehydrated reaction, reactant or product. Likewise, given the well known to malonate semialdehyde by a diol dehydratase. In one path fields of metabolic biochemistry, enzymology and genomics, way, malonate semialdehyde and pyruvate are condensed to reference herein to a gene or encoding nucleic acid also form 4-hydroxy-2-oxohexanedioate (Step A). This product is constitutes a reference to the corresponding encoded enzyme dehydrated to form 4-oxalocrotonate (Step B). 4-Oxalocro and the reaction it catalyzes or a protein associated with the tonate is converted to muconate by reduction and dehydration reaction as well as the reactants and products of the reaction. of the 2-keto group (Steps C and D). 0066 Muconate can be produced from succinyl-CoA via beta-ketoadipate in a minimum of five enzymatic steps, 0073. Alternately, the 2-keto group of 4-hydroxy-2-oxo shown in FIG. 2. In the first step of all pathways, succinyl hexanedioate is reduced by an alcohol-forming oxidoreduc CoA is joined to acetyl-CoA by a beta-ketothiolase to form tase (Step E). The product, 2,4-dihydroxyadipate is then beta-ketoadipyl-CoA (Step A). In one embodiment, the beta dehydrated at the 2- or 4-hydroxy position to form 2-hydroxy keto functional group is reduced and dehydrated to form 4-hexenedioate (Step G) or 3-hydroxy-4-hexenedioate (Step 2,3-dehydroadipyl-CoA (Steps K and L). The CoA moiety is F). Subsequent dehydration yields the diene, muconate (Steps then removed by a CoA hydrolase, transferase or ligase to D or H). This pathway is energetically favorable and is useful form 2,3-dehydroadipate (Step M). Finally, 2,3-dehydroadi because it does not require carboxylation steps. Also, the pate is oxidized to form the conjugated diene muconate by an pathway is driven by the stability of the muconate end prod enoate oxidoreductase (Step N). uct. 0067. In other embodiments, beta-ketoadipyl-CoA is con 0074. Several pathways for producing muconate from verted to beta-ketoadipate by a CoA hydrolase, transferase or pyruvate and succinic semialdehyde are detailed in FIG. 4. ligase (Step B). Beta-ketoadipate is then converted to 2-ma Such pathways entail aldol condensation of pyruvate with leylacetate by maleylacetate reductase (Step O). The beta Succinic semialdehyde to 4-hydroxy-2-oxoheptane-1,7-dio ketone of 2-maleylacetate is then reduced to form cis-3-hy ate (HODH) by HODH aldolase (Step A). In one route, droxy-4-hexenoate (Step P). This product is further HODH is dehydrated to form 2-oxohept-4-ene-1,7-dioate dehydrated to cis, trans-muconate in Step Q. Step W provides (OHED) by OHED hydratase (Step B). OHED is then decar a muconate cis/trans-isomerase to provide trans,trans-mu boxylated to form 6-oxo-2,3-dehydrohexanoate (6-OHE) COnate. (Step C). This product is subsequently oxidized to the diacid 0068 A similar route entails the conversion of 2-maley and then further oxidized to muconate (Steps F, I). lacetate to cis-3-amino-4-hexenoate by an aminotransferase (0075 Alternately, HODH is converted to 3-hydroxyad or aminating oxidoreductase (Step R). Deamination of cis-3- ipyl-CoA by a formate-lyase or an acylating decarboxylating amino-4-hexenoate is Subsequently carried out to form cis, dehydrogenase (Step D). The 3-hydroxy group of 3-hy trans-muconate (StepS). droxyadipyl-CoA is then dehydrated to form the enoyl-CoA 0069. Alternatively, beta-ketoadipate can be converted to (Step G). The CoA moiety of 2,3-dehydroadipyl-CoA is 2-fumarylacetate by action of a fumarylacetate reductase removed by a CoA hydrolase, ligase or transferase (Step H). (Step C). Such a reductase can be engineered by directed Finally, 2,3-dehydroadipate is oxidized to muconate by evolution, for example, of the corresponding maleylacetate muconate reductase (Step 1). reductase. Reduction of the keto group and dehydration pro (0076. In yet another route, OHED is converted to 2,3- vides trans,trans-muconate (Steps D and E). Alternatively, dehydroadipyl-CoA by a formate-lyase or acylating decar reductive amination, followed by deamination also affords boxylating dehydrogenase (Step E). 2.3-Dehydroadipyl-CoA the trans,trans-muconate product (Steps F and G) is then transformed to muconate. 0070. In yet another route, beta-ketoadipate can be 0077 Pathways for producing muconate from lysine are cyclized to an enol-lactone by beta-ketoadipylenol-lactone detailed in FIG. 5. In one embodiment, lysine is converted to hydrolase (Step H). The double bond in the lactone ring is 2-aminoadipate semialdehyde by an aminotransferase or then shifted by muconolactone isomerase (Step I). Finally, aminating oxidoreductase (Step A). 2-Aminoadipate semial muconolactone is converted to cis,cis-muconate by muconate dehyde is then oxidized to form 2-aminoadipate (Step B). The cycloisomerase (Step J). Muconate cycloisomerase may 2-amino group is then deaminated by a 2-aminoadipate selectively form the cis,cis isomer of muconate. Further addi deaminase (Step C). The product, 2,3-dehydroadipate is fur tion of a cis/trans isomerase converts the cis,cis isomer to the ther oxidized to muconate by muconate reductase (Step D). favored trans, trans or trans, cis configurations (Steps T and 0078. In an alternate route, the 2-amino group of lysine is W, which can be incorporated into a single isomerization shifted to the 3-position by lysine-2,3-aminomutase (Step E). step). The product, 3,6-diaminohexanoate, is converted to 3-ami 0071. The pathways detailed in FIG.2 can achieve a maxi noadipate semialdehyde by an aminotransferase oraminating mum theoretical yield of 1.09 moles muconate per mole oxidoreductase (Step F). Oxidation of the aldehyde (Step G) glucose utilized under anaerobic and aerobic conditions. With and deamination (Step H) yields 2,3-dehydroadipate, which and without aeration, the maximum ATP yield is 1 mole of is then converted to muconate (Step D). US 2011/O124911 A1 May 26, 2011

0079 All transformations depicted in FIGS. 2-5 fall into Microbiology 153:357-365 (2007)) and the fact that paah the general categories of transformations shown in Table 1. mutants cannot grow on phenylacetate (Ismail et al., Eur: J. Below is described a number of biochemically characterized Biochem. 270:3047-3054 (2003)), it is expected that the E. genes in each category. Specifically listed are genes that can coli paaH gene encodes a 3-hydroxyacyl-CoA dehydroge be applied to catalyze the appropriate transformations in nase. Genbank information related to these genes is Summa FIGS. 2-5 when properly cloned and expressed. rized in Table 2 below. 0080 Table 1 shows the enzyme types useful to convert common central metabolic intermediates into muconate. The TABLE 2 first three digits of each label correspond to the first three Gene GI fi Accession No. Organism Enzyme Commission number digits which denote the general type of transformation independent of Substrate specificity. fadB 119811 P21177.2 Escherichia coi fad 3334437 P77399.1 Escherichia coi paaH 16129356 NP 415913.1 Escherichia coi TABLE 1. phaC 26990000 NP 745425.1 Pseudomonas puttida paaC 1066.36095 ABF82235.1 Pseudomonas fittorescens Label Function 1.1.1a Oxidoreductase (Oxo to alcohol, and reverse) 1.2.1.a. Oxidoreductase (acid to oxo) I0083. Additional exemplary oxidoreductases capable of 1.2.1.c Oxidoreductase (2-ketoacid to acyl-CoA) converting 3-oxoacyl-CoA molecules to their corresponding 1.3.1.a Oxidoreductase (alkene to alkane, and reverse) 3-hydroxyacyl-CoA molecules include 3-hydroxybutyryl 1.4.1.a Oxidoreductase (aminating) CoA dehydrogenases. The enzyme from Clostridium aceto 2.3.1.b Acyltransferase (beta-ketothiolase) 2.3.1.d Acyltransferase (formate C-acyltransferase) butyllicum, encoded by hbd, has been cloned and functionally 2.6.1.a. Aminotransferase expressed in E. coli (Youngleson et al., J. Bacteriol. 171: 2.8.3.a. CoA transferase 6800-6807 (1989)). Additional genes include Hbd1 (C-termi 3.1.1.a. Enol-lactone hydrolase nal domain) and Hbd2 (N-terminal domain) in Clostridium 3.1.2.a. CoA hydrolase 4.1.1.a. Carboxy-lyase kluyveri (Hillmer and Gottschalk, FEBS Lett. 21:351-354 4.1.2.a. Aldehyde-lyase (1972)) and HSD17B10 in Bos taurus (Wakil et al., J. Biol. 4.2.1.a. Hydro-lyase Chem. 207:631-638 (1954)). Yet other genes demonstrated to 4.3.1.a. Ammonia-lyase reduce acetoacetyl-CoA to 3-hydroxybutyryl-CoA are phbB 5.2.1.a. Cistrans isomerase 5.3.3.3 Lactone isomerase from Zoogloea ramigera (Ploux et al., Eur: J. Biochem. 174: 5.4.3.a. Aminomutase 177-182 (1988)) and phaB from Rhodobacter sphaeroides 5.5.1.a. Lactone cycloisomerase (Alberet al., Mol. Microbiol. 61:297-309 (2006)). The former ..a CoA synthetase gene is NADPH-dependent, its nucleotide sequence has been determined (Peoples and Sinskey, Mol. Microbiol. 3:349-357 I0081. Several transformations depicted in FIGS. 2-5 (1989)) and the gene has been expressed in E. coli. Substrate require oxidoreductases that convertaketone functionality to specificity studies on the gene led to the conclusion that it a hydroxyl group. The conversion of beta-ketoadipyl-CoA to could accept 3-oxopropionyl-CoA as an alternate substrate 3-hydroxyadipyl-CoA (FIG. 2, Step K) is catalyzed by a (Ploux et al., Eur: J. Biochem. 174:177-182 (1988)). Genbank 3-oxoacyl-CoA dehydrogenase. The reduction of 2-fumary information related to these genes is summarized in Table 3 lacetate to trans-3-hydroxy-4-hexendioate (FIG. 2, Step D) or below. 2-maleylacetate to cis-3-hydroxy-4-hexendioate (FIG. 2, TABLE 3 Step P), is catalyzed by an oxidoreductase that converts a 3-oxoacid to a 3-hydroxyacid. Reduction of the ketone group Gene GI fi Accession No. Organism of 4-oxalocrotonate and 4-hydroxy-2-oxohexanedioate to hbd 18266893 PS2O41.2 Clostridium acetobutyllicum their corresponding hydroxyl group is also catalyzed by Hbd2 146348.271 EDK34807.1 Clostridium kluyveri enzymes in this family (FIG. 3, Steps C and E). Hbd1 14634.5976 EDK32S12.1 Clostridium kluyveri HSD17B10 3183024 OO2691.3 BoS tattrits 0082) Exemplary enzymes for converting beta-ketoad phaB Rhodobacter sphaeroides ipyl-CoA to 3-hydroxyadipyl-CoA (FIG. 2, Step K) include phbB Zoogloea ramigera 3-hydroxyacyl-CoA dehydrogenases. Such enzymes convert 3-oxoacyl-CoA molecules into 3-hydroxyacyl-CoA mol ecules and are often involved in fatty acid beta-oxidation or I0084. A number of similar enzymes have been found in phenylacetate catabolism. For example, subunits of two fatty other species of Clostridia and in Metallosphaera sedulla acid oxidation complexes in E. coli, encoded by fadB and (Berg et al., Science 318:1782-1786 (2007)) as shown in fad.J., function as 3-hydroxyacyl-CoA dehydrogenases (Bin Table 4. stock and Schultz, Methods Enzymol. 71 Pt C:403-411 TABLE 4 (1981)). Furthermore, the gene products encoded by phaC in Pseudomonas putida U (Olivera et al., Proc. Natl. Acad. Sci. Gene Gii Accession No. Organism U.S.A. 95:6419-6424 (1998)) and paaC in Pseudomonas fluo hbd 15895965 NP 3493.14.1 Cliostridium rescens ST (Diet al., Arch. Microbiol. 188: 117-125 (2007)) acetobiitvictim catalyze the reverse reaction of step B in FIG. 10, that is, the hbd 20162442 AAM14586.1 Clostridium beijerinckii oxidation of 3-hydroxyadipyl-CoA to form 3-oxoadipyl Msed 1423 146304189 YP OO1191.505 Metaliosphaera sedila Msed O399 146303184 YP OO1190500 Metaliosphaera sedila CoA, during the catabolism of phenylacetate or styrene. Note Msed 0389 146303174 YP OO1190490 Metaliosphaera sedila that the reactions catalyzed by such enzymes are reversible. In Msed 1993 146304741 YP OO1192057 Metaliosphaera sedila addition, given the proximity in E. coli of paaFI to other genes in the phenylacetate degradation operon (Nogales et al., US 2011/O124911 A1 May 26, 2011

0085. There are various alcohol dehydrogenases for con verting 2-maleylacetate to cis-3-hydroxy-4-hexenoate (FIG. TABLE 6 2, Step P), 2-fumarylacetate to trans-3-hydroxy-4-hexenoate (FIG. 2, Step D), 4-oxalocrotonate to 5-hydroxyhex-2-ene Gene GI fi Accession No. Organism dioate (FIG. 3, Step C) and 4-hydroxy-2-oxohexanedioate to ALDH-2 118504 POSO91.2 Homo sapiens ALDH-2 14192933 NP 115792.1 Ratti is norvegicus 2,4-dihydroxyadipate (FIG.3, Step E). Two enzymes capable astD 3913108 P76217.1 Escherichia coi of converting an oxoacid to a hydroxyacid are encoded by the malate dehydrogenase (mdh) and lactate dehydrogenase I0087. Two transformations in FIG. 4 require conversion of (ldha) genes in E. coli. In addition, lactate dehydrogenase a 2-ketoacid to an acyl-CoA (FIG. 4, Steps D and E) by an from Ralstonia eutropha has been shown to demonstrate high enzyme in the EC class 1.2.1. Such reactions are catalyzed by activities on Substrates of various chain lengths such as lac multi-enzyme complexes that catalyze a series of partial reac tate, 2-oxobutyrate, 2-oxopentanoate and 2-oxoglutarate tions which result in acylating oxidative decarboxylation of (Steinbuchel and Schlegel, Eur: J. Biochem. 130:329-334 2-keto-acids. Exemplary enzymes that can be used include 1) (1983)). Conversion of alpha-ketoadipate into alpha-hy branched-chain 2-keto-acid dehydrogenase, 2) alpha-keto droxyadipate can be catalyzed by 2-ketoadipate reductase, an glutarate dehydrogenase, and 3) the pyruvate dehydrogenase enzyme reported to be found in rat and in human placenta multienzyme complex (PDHC). Each of the 2-keto-acid dehydrogenase complexes occupies positions in intermediary (Suda et al., Arch. Biochem. Biophys. 176:610-620 (1976): metabolism, and enzyme activity is typically tightly regulated Suda et al., Biochem. Biophys. Res. Commun. 77:586-591 (Fries et al., Biochemistry 42:6996-7002 (2003)). The (1977)). An additional gene for these steps is the mitochon enzymes share a complex but commonstructure composed of drial 3-hydroxybutyrate dehydrogenase (bdh) from the multiple copies of three catalytic components: alpha-ketoacid human heart which has been cloned and characterized (Marks decarboxylase (E1), dihydrolipoamide acyltransferase (E2) et al., J. Biol. Chem. 267: 15459-15463 (1992)). This enzyme and dihydrolipoamide dehydrogenase (E3). The E3 compo is a dehydrogenase that operates on a 3-hydroxyacid. Another nent is shared among all 2-keto-acid dehydrogenase com exemplary alcohol dehydrogenase converts acetone to iso plexes in an organism, while the E1 and E2 components are propanol as was shown in C. beijerinckii (Ismail et al., Eur: J. encoded by different genes. The enzyme components are Biochem. 270:3047-3054 (2003)) and T. brockii (Lamed and present in numerous copies in the complex and utilize mul Zeikus, Biochem. J. 195:183-190 (1981); Peretz and Burst tiple cofactors to catalyze a directed sequence of reactions via ein, Biochemistry 28:6549-6555 (1989)). Genbank informa Substrate channeling. The overall size of these dehydrogenase tion related to these genes is summarized in Table 5 below. complexes is very large, with molecular masses between 4 and 10 million Da (i.e., larger than a ribosome). TABLE 5 I0088 Activity of enzymes in the 2-keto-acid dehydroge nase family is normally low or limited under anaerobic con Gene GI fi Accession No. Organism ditions in E. coli. Increased production of NADH (or mdh 1789632 AAC76268.1 Escherichia coi NADPH) could lead to a redox-imbalance, and NADH itself ldh A 16129341 NP 415898.1 Escherichia coi serves as an inhibitor to enzyme function. Engineering efforts bdh 1771.98 AAAS835.2.1 Homo sapiens have increased the anaerobic activity of the E. coli pyruvate adh 60592974 AAA231992 Clostridium beijerinckii dehydrogenase complex (Kim et al., Appl. Environ. Micro adh 113443 P1494.1.1 Thermoanaerobacter brockii biol. 73:1766-1771 (2001); Kim et al., J. Bacteriol. 190: 3851-3858 (2008); Zhou et al., Biotechnol. Lett. 30:335-342 I0086 Enzymes in the 1.2.1 family are NAD(P)+-depen (2008)). For example, the inhibitory effect of NADH can be dent oxidoreductases that convert aldehydes to acids. Reac overcome by engineering an H322Y mutation in the E3 com tions catalyzed by enzymes in this family include the oxida ponent (Kim et al., J. Bacteriol. 190:3851-3858 (2008)). tion of 6-OHE (FIG. 4, Step F), 2-aminoadipate Structural studies of individual components and how they semialdehyde (FIG. 5, Step B) and 3-aminoadipate semial work together in complex provide insight into the catalytic dehyde (FIG. 5, Step G) to their corresponding acids. An mechanisms and architecture of enzymes in this family (Ae exemplary enzyme is the NAD+-dependent aldehyde dehy varsson et al., Nat. Struct. Biol. 6:785-792 (1999); Zhou et al., Proc. Natl. Acad. Sci. U.S.A. 98:14802-14807 (2001)). The drogenases (EC 1.2.1.3). Two aldehyde dehydrogenases Substrate specificity of the dehydrogenase complexes varies found in human liver, ALDH-1 and ALDH-2, have broad in different organisms, but generally branched-chain keto Substrate ranges for a variety of aliphatic, aromatic and poly acid dehydrogenases have the broadest Substrate range. cyclic aldehydes (Klyosov, A. A., Biochemistry 35:4457 I0089 Alpha-ketoglutarate dehydrogenase (AKGD) con 4467 (1996)). Active ALDH-2 has been efficiently expressed verts alpha-ketoglutarate to Succinyl-CoA and is the primary in E. coli using the GroEL proteins as chaperonins (Lee et al., site of control of metabolic flux through the TCA cycle Biochem. Biophys. Res. Commun. 298:216-224 (2002)). The (Hansford, R. G., Curr. Top. Bioenerg. 10:217-278 (1980)). rat mitochondrial aldehyde dehydrogenase also has a broad Encoded by genes SucA, such3 and lpd in E. coli, AKGD gene Substrate range that includes the enoyl-aldehyde crotonalde expression is downregulated under anaerobic conditions and hyde (Siew et al., Arch. Biochem. Biophys. 176:638-649 during growth on glucose (Park et al., Mol. Microbiol. (1976)). The E. coli geneastD also encodes an NAD+-depen 15:473-482 (1993)). Although the substrate range of AKGD dent aldehyde dehydrogenase active on Succinic semialde is narrow, structural studies of the catalytic core of the E2 hyde (Kuznetsova et al., FEMS Microbiol. Rev. 29:263-279 component pinpoint specific residues responsible for Sub (2005)). Genbank information related to these genes is sum strate specificity (Knapp et al., J. Mol. Biol. 280:655-668 marized in Table 5 below. (1998)). The Bacillus subtilis AKGD, encoded by odh AB (E1 US 2011/O124911 A1 May 26, 2011

and E2) and pdhD (E3, shared domain), is regulated at the transcriptional level and is dependent on the carbon Source TABLE 8 and growth phase of the organism (Resnekov et al., Mol. Gen. Genet. 234:285-296 (1992)). In yeast, the LPD1 gene encod Gene GI fi Accession No. Organism ing the E3 component is regulated at the transcriptional level bfnBB 16O79459 NP 390283.1 Bacilius subtiis bfmBAA 16O79461 NP 390285.1 Bacilius subtiis by glucose (Roy and Dawes, J. Gen. Microbiol. 133:925-933 bfmBAB 16O7946O NP 390284.1 Bacilius subtiis (1987)). The E1 component, encoded by KGD1, is also regu pdhD 118672 P21880.1 Bacilius subtiis lated by glucose and activated by the products of HAP2 and lpdV 118677 PO9063.1 Pseudomonas puttida HAP3 (Repetto and Tzagoloff, Moll. Cell. Biol. 9:2695-2705 bkdB 129044 PO9062.1 Pseudomonas puttida bkdA1 2699,1090 NP 746515.1 Pseudomonas puttida (1989)). The AKGD enzyme complex, inhibited by products bkdA2 2699,1091 NP 746516.1 Pseudomonas puttida NADH and Succinyl-CoA, is known in mammalian systems, Bckdha 77736548 NP 036914.1 Ratti is norvegicus as impaired function of has been linked to several neurologi Bckdhb 1587.49538 NP 062140.1 Ratti is norvegicus cal diseases (Tretter and dam-Vizi, Philos. Trans. R. Soc. Dbt 15874.9632 NP 445764.1 Ratti is norvegicus Lond B Biol. Sci. 360:2335-2345 (2005)). Genbank informa Dld 4O786469 NP 95.5417.1 Ratti is norvegicus tion related to these genes is summarized in Table 7 below. 0091. The pyruvate dehydrogenase complex, catalyzing TABLE 7 the conversion of pyruvate to acetyl-CoA, has also been stud ied. In the E. coli enzyme, specific residues in the E1 com Gene GI fi Accession No. Organism ponent are responsible for Substrate specificity (Bisswanger, SucA 16128.701 NP 415254.1 Escherichia coi H. J. Biol. Chem. 256:815-822 (1981); Bremer, J., Eur: J. SucB 16128702 NP 415255.1 Escherichia coi Biochem. 8:535-540 (1969); Gong et al., J. Biol. Chem. 275: lpd 16128109 NP 414658.1 Escherichia coi odh A S170426S P23129.2 Bacilius subtiis 13645-13653 (2000)). As mentioned previously, enzyme OdhB 129041 P16263.1 Bacilius subtiis engineering efforts have improved the E. coli PDH enzyme pdhD 118672 P21880.1 Bacilius subtiis activity under anaerobic conditions (Kim et al., Appl. Envi KGD1 6322066 NP 012141.1 Saccharomyces cerevisiae ron. Microbiol. 73:1766-1771 (2007); Kim et al., J. Bacteriol. KGD2 632O352 NP 010432.1 Saccharomyces cerevisiae 190:3851-3858 (2008); Zhou et al., Biotechnol. Letter. LPD1 14318iSO1 NP 116635.1 Saccharomyces cerevisiae 30:335-342 (2008)). In contrast to the E. coli PDH, the B. subtilis complex is active and required for growth under 0090 Branched-chain 2-keto-acid dehydrogenase com anaerobic conditions (Nakano et al., J. Bacteriol. 179:6749 plex (BCKAD), also known as 2-oxoisovalerate dehydroge 6755 (1997)). The Klebsiella pneumoniae PDH, character nase, participates in branched-chain amino acid degradation ized during growth on glycerol, is also active under anaerobic pathways, converting 2-keto acids derivatives of valine, leu conditions (Menzel et al., J. Biotechnol. 56:135-142 (1997)). cine and isoleucine to their acyl-CoA derivatives and CO. Crystal structures of the enzyme complex from bovine kidney The complex has been studied in many organisms including (Zhou et al., Proc. Natl. Acad. Sci. U.S.A. 98: 14802-14807 Bacillus subtilis (Wang et al., Eur: J. Biochem. 213:1091 (2001)) and the E2 catalytic domain from Azotobacter vine 1099 (1993)), Rattus norvegicus (Namba et al., J. Biol. Chem. landii are available (Mattevi et al., Science 255:1544-1550 244:4437-4447 (1969)) and Pseudomonasputida (Sokatchet (1992)). Some mammalian PDH enzymes complexes can al., J. Bacteriol. 148:647-652 (1981)). In Bacillus subtilis the reaction alternate Substrates such as 2-oxobutanoate, although enzyme is encoded by genes pdhD (E3 component), bfmBB comparative kinetics of Rattus norvegicus PDH and BCKAD (E2 component), bfmBAA and bfmBAB (E1 component) indicate that BCKAD has higher activity on 2-oxobutanoate (Wang et al., Eur: J. Biochem. 213:1091-1099 (1993)). In as a substrate (Paxton et al., Biochem. J. 234:295-303 (1986)). mammals, the complex is regulated by phosphorylation by Genbank information related to these genes is Summarized in specific phosphatases and protein kinases. The complex has Table 9 below. been studied in rathepatocites (Chicco et al., J. Biol. Chem. 269:19427-19434 (1994)) and is encoded by genes Bckdha TABLE 9 (E1 alpha), Bckdhb (E1beta), Dbt (E2), and Dld (E3). The E1 and E3 components of the Pseudomonas putida BCKAD Gene GI fi Accession No. Organism complex have been crystallized (Aevarsson et al., Nat. Struct. aceE 161281.07 NP 414656.1 Escherichia coi Biol. 6:785-792 (1999); Mattevi et al., Science 255:1544 aceF 16128108 NP 414657.1 Escherichia coi lpd 16128109 NP 414658.1 Escherichia coi 1550 (1992)) and the enzyme complex has been studied pdh.A 3123238 P21881.1 Bacilius subtiis (Sokatch et al., J. Bacteriol. 148:647-652 (1981)). Transcrip pdhB 129068 P21882.1 Bacilius subtiis tion of the Pputida BCKAD genes is activated by the gene pdhC 1290S4 P21883.2 Bacilius subtiis product of bkdR (Hesslinger et al., Mol. Microbiol. 27:477 pdhD 118672 P21880.1 Bacilius subtiis aceE 1529.68699 YP OO1333808.1 Klebsiella pneumonia 492 (1998)). In some organisms including Rattus norvegicus aceF 1529687OO YP 001333809.1 Klebsiella pneumonia (Paxton et al., Biochem. J. 234:295-303 (1986)) and Saccha lpdA 152968.701 YP 0013338.10.1 Klebsiella pneumonia romyces cerevisiae (Sinclair et al., Biochem. Mol. Biol. Int. Poha1 124430510 NP OO1004072.2 Ratti is norvegicus 31:911-9122 (1993)), this complex has been shown to have a Poha2 16758900 NP 446446.1 Ratti is norvegicus broad Substrate range that includes linear oxo-acids such as Dlat 78.365255 NP 112287.1 Ratti is norvegicus 2-oxobutanoate and alpha-ketoglutarate, in addition to the Dld 4O786469 NP 95.5417.1 Ratti is norvegicus branched-chain amino acid precursors. The active site of the bovine BCKAD was engineered to favor alternate substrate 0092. As an alternative to the large multienzyme 2-keto acetyl-CoA (Meng and Chuang, Biochemistry 33:12879 acid dehydrogenase complexes described above, some 12885 (1994)). Genbank information related to these genes is anaerobic organisms utilize enzymes in the 2-ketoacid oxi summarized in Table 8 below. doreductase family (OFOR) to catalyze acylating oxidative US 2011/O124911 A1 May 26, 2011

decarboxylation of 2-keto-acids. Unlike the dehydrogenase similar to the dienoyl CoA reductase in E. coli (fadH) (Ro complexes, these enzymes contain iron-sulfur clusters, utilize hdich et al., J. Biol. Chem. 276:5779-5787 (2001)). The C. different cofactors, and use ferredoxin or flavodoxin as elec thermoaceticum enr gene has also been expressed in a cata tron acceptors in lieu of NAD(P)H. While most enzymes in lytically active form in E. coli (Rohdich et al., supra). Gen this family are specific to pyruvate as a substrate (POR) some bank information related to these genes is Summarized in 2-keto-acid:ferredoxin oxidoreductases have been shown to Table 11 below. accept a broad range of 2-ketoacids as Substrates including alpha-ketoglutarate and 2-oxobutanoate (Fukuda and TABLE 11 Wakagi, Biochim. Biophys. Acta. 1597 74-80 (2002); Zhang et al., J. Biochem. 120:587-599 (1996)). One such Gene GI fi Accession No. Organism enzyme is the OFOR from the thermoacidophilic archaeon el 169405742. ACAS4153.1 Cliostridium bointinum A3 str Sulfolobus tokodai 7, which contains an alpha and beta Sub el 276SO41 CAA71086.1 Clostridium tyrobutyricum unit encoded by gene ST2300 (Fukuda and Wakagi, supra; el 3402834 CAA76083.1 Clostridium kluyveri Zhang et al., Supra). A plasmid-based expression system has el 83590886 YP 43O895.1 Mooreia thermoacetica been developed for efficiently expressing this protein in E. fadH 16130976 NP 41755.2.1 Escherichia coi coli (Fukuda et al., Eur: J. Biochem. 268:5639-5646 (2001)) and residues involved in substrate specificity were deter 0.095 MAR is a 2-enoate oxidoreductase catalyzing the mined (Fukuda and Wakagi, supra). Two OFORs from Aero reversible reduction of 2-maleylacetate (cis-4-oxohex-2-ene pyrum permix str. K1 have also been recently cloned into E. dioate) to 3-oxoadipate (FIG. 2, Step O). MAR enzymes coli, characterized, and found to react with a broad range of naturally participate in aromatic degradation pathways (Ca 2-oxoacids (Nishizawa et al., FEBS Lett. 579 2319-2322 mara et al., J. Bacteriol. 191:4905-4915 (2009); Huanget al., (2005)). The gene sequences of these OFOR enzymes are Appl. Environ. Microbiol. 72:7238-7245 (2006); Kaschabek available, although they do not have GenBank identifiers and Reineke, J. Bacteriol. 177:320-325 (1995); Kaschabek assigned to date. There is bioinformatic evidence that similar and Reineke, J. Bacteriol. 175:6075-6081 (1993)). The enzymes are present in all archaea, some anaerobic bacteria enzyme activity was identified and characterized in and amitochondrial eukarya (Fukuda and Wakagi, Supra). Pseudomonas sp. strain B13 (Kaschabek and Reineke, (1995) This class of enzyme is also interesting from an energetic supra; Kaschabek and Reineke, (1993) supra), and the coding standpoint, as reduced ferredoxin could be used to generate gene was cloned and sequenced (Kasberg et al., J. Bacteriol. NADH by ferredoxin-NAD reductase (Petitclemange et al., 179:3801-3803 (1997)). Additional MAR genes include clcE Biochim. Biophys. Acta 421:334-337 (1976)). Also, since gene from Pseudomonas sp. Strain B13 (Kasberg et al., most of the enzymes are designed to operate under anaerobic Supra), macA gene from Rhodococcus opacus (Seibert et al., conditions, less enzyme engineering may be required relative J. Bacteriol. 175:6745-6754 (1993)), the macA gene from to enzymes in the 2-keto-acid dehydrogenase complex family Ralstonia eutropha (also known as Cupriavidus necator) for activity in an anaerobic environment. Genbank informa (Seibert et al., Microbiology 150:463-472 (2004)), t?idFII tion related to these genes is summarized in Table 10 below. from Ralstonia eutropha (Seibert et al., (1993) supra) and NCgll 112 in Corynebacterium glutamicum (Huang et al., TABLE 10 Appl. Environ Microbiol. 72:7238-7245 (2006)). A MAR in Pseudomonas reinekei MT1, encoded by cca D, was recently Gene GI fi Accession No. Organism identified and the nucleotide sequence is available under the ST2300 15922633 NP 378302.1 Sulfolobus tokodai 7 DBJ/EMBL GenBank accession number EF159980 (Camara et al., J. Bacteriol. 191:4905-4915 (2009). Genbank informa tion related to these genes is summarized in Table 12 below. 0093. Three transformations fall into the category of oxi doreductases that reduce an alkene to an alkane (EC 1.3.1.-). The conversion of beta-ketoadipate to 2-maleylacetate (FIG. TABLE 12 2, Step O) is also catalyzed by the 2-enoate oxidoreductase Gene GI fi Accession No. Organism maleylacetate reductase (MAR). A similar enzyme converts clcE 3913241 O3O847.1 Pseudomonas sp. strain B13 beta-ketoadipate to 2-fumarylacetate (FIG. 2, Step C). The macA 7387876 O84992.1 Rhodococci is opact is oxidization of 2,3-dehydroadipate to muconate (FIG. 2, Step macA S916089 AADSS886 Cupriavidits necator N) is catalyzed by a 2-enoate oxidoreductase with muconate tfFII 1747424 AC44727.1 Ralstonia eutropha JMP134 reductase functionality. NCgl1112 19552383 NP 600385 Corynebacterium glutamicum 0094 2-Enoate oxidoreductase enzymes are known to ccaD Pseudomonas reinekei MT1 catalyze the NAD(P)H-dependent reduction and oxidation of a wide variety of C, 3-unsaturated carboxylic acids and alde 0096. In Step R of FIG. 2, 2-maleylacetate is transami hydes (Rohdichet al., J. Biol. Chem. 276:5779-5787 (2001)). nated to form 3-amino-4-hexanoate. The conversion of 2-fu In the recently published genome sequence of C. kluyveri, 9 marylacetate to trans-3-amino-4-hexenedioate is a similar coding sequences for enoate reductases were reported, out of transformation (FIG. 2, Step F). These reactions are per which one has been characterized (Seedorf et al., Proc. Natl. formed by aminating oxidoreductases in the EC class 1.4.1. Acad. Sci. U.S.A. 105:2128-2133 (2008)). The enrgenes from Enzymes in this EC class catalyze the oxidative deamination both C. tyrobutyricum and M. thermoaceticum have been of alpha-amino acids with NAD+ or NADP+ as acceptor, and cloned and sequenced and show 59% identity to each other. the reactions are typically reversible. Exemplary enzymes The former gene is also found to have approximately 75% include glutamate dehydrogenase (deaminating), encoded by similarity to the characterized gene in C. kluyveri (Giesel and gdh A. leucine dehydrogenase (deaminating), encoded by lah, Simon, Arch. Microbiol. 135:51-57 (1983)). It has been and aspartate dehydrogenase (deaminating), encoded by reported based on these sequence results that enr is very nadX. The gdha gene product from Escherichia coli (Korber US 2011/O124911 A1 May 26, 2011

et al., J. Mol. Biol. 234:1270-1273 (1993); McPherson and Microbiology 153:357-365 (2007)) catalyze the conversion Wootton, Nucleic Acids Res. 11:5257-5266 (1983)), gdh from of 3-oxoadipyl-CoA into succinyl-CoA and acetyl-CoA dur Thermotoga maritime (Kort et al., Extremophiles 1:52-60 ing the degradation of aromatic compounds such as pheny 1997); Lebbinket al., J. Mol. Biol. 280:287-296 (1998); Leb lacetate or styrene. Since beta-ketothiolase enzymes catalyze bink et al., J. Mol. Biol. 289:357-369 (1999)), and gcdhA1 reversible transformations, these enzymes can also be from Halobacterium salinarum (Ingoldsby et al., Gene 349: employed for the synthesis of 3-oxoadipyl-CoA. Several 237-244 (2005)) catalyze the reversible conversion of glutamate to 2-oxoglutarate and ammonia, while favoring beta-ketothiolases were shown to have significant and selec NADP(H), NAD(H), or both, respectively. The ldh gene of tive activities in the oxoadipyl-CoA forming direction as Bacillus cereus encodes the LeuDH protein that has a wide of shown in Example I below including bkt from Pseudomonas range of Substrates including leucine, isoleucine, Valine, and putida, pcaF and bkt from Pseudomonas aeruginosa PAO1, 2-aminobutanoate (Ansorge and Kula, Biotechnol. Bioeng. bkt from Burkholderia ambifaria AMMD, paal from E. coli, 68:557-562 (2000); Stoyan et al., J. Biotechnol. 54:77-80 and phaD from P putida. Genbank information related to (1997)). The nadX gene from Thermotoga maritima encod these genes is summarized in Table 15 below. ing for the aspartate dehydrogenase is involved in the biosyn thesis of NAD (Yang et al., J. Biol. Chem. 278:8804-8808 TABLE 1.5 (2003)). Genbank information related to these genes is sum marized in Table 13 below. Gene GI fi Accession No. Organism paa 16129358 NP 415915.1 Escherichia coi TABLE 13 pcaF 17736947 AALO24O7 Pseudomonas knackmussii (B13) phaD 32S3200 AAC24332.1 Pseudomonas putida Gene GI fi Accession No. Organism pcaF SO6695 AAA85138.1 Pseudomonas putida paaE 1066.36097 ABF82237.1 Pseudomonas fittorescens gdh A 118547 POO370 Escherichia coi bkt Burkholderia ambifaria AMMD gdh 6226595 P96110.4 Thermotoga maritima bkt Pseudomonas aeruginosa PAO1 gdh A1 15789827 NP 27965.1.1 Haiobacterium sainarum pcaF Pseudomonas aeruginosa PAO1 ldh 61222614 POA393 Bacilius cereus nadX 1S644391 NP 22.9443.1 Thermotoga maritima (0099. The acylation of ketoacids HODH and OHED to 0097. The conversions of lysine to 2-aminoadipate semi their corresponding CoA derivatives (FIG. 4, Steps D and E) aldehyde (FIG. 5, Step A) and 3,6-diaminohexanoate to and concurrent release of formate, is catalyzed by formate 3-aminoadipate semialdehyde (FIG. 5, Step F) are catalyzed C-acyltransferase enzymes in the EC class 2.3.1. Enzymes in by aminating oxidoreductases that transform primary amines this class include pyruvate formate-lyase and ketoacid for to their corresponding aldehydes. The lysine 6-dehydroge mate-lyase. Pyruvate formate-lyase (PFL, EC 2.3.1.54), nase (deaminating), encoded by the lysIDH genes, catalyze encoded by pflB in E. coli, converts pyruvate into acetyl-CoA the oxidative deamination of the 6-amino group of L-lysine to and formate. The active site of PFL contains a catalytically form 2-aminoadipate-6-semialdehyde, which can spontane essential glycyl radical that is posttranslationally activated ously and reversibly cyclize to form A-piperideine-6-car under anaerobic conditions by PFL-activating enzyme (PFL boxylate (Misono and Nagasaki, J. Bacteriol. 150:398-401 (1982)). Exemplary enzymes are found in Geobacillus AE, EC 1.97.1.4) encoded by pflA (Knappe et al., Proc. Natl. Stearothermophilus (Heydarietal. Appl. Environ. Microbiol. Acad. Sci. U.S.A. 81:1332-1335 (1984); Wong et al., Bio 70:937-942 (2004)), Agrobacterium tumefaciens (Hashimoto chemistry 32: 14102-14110 (1993)). A pyruvate formate et al., J. Biochem. 106:76-80 (1989), Misono and Nagasaki, lyase from Archaeglubus fulgidus encoded by pflD has been Supra), and Achronobacter denitrificans (Ruldeekultham cloned, expressed in E. coli and characterized (Lehtio and rong et al., BMB. Rep. 41:790-795 (2008)). Such enzymes Goldman, Protein Eng Des Sel 17:545-552 (2004)). The crys can convert 3,6-diaminohexanoate to 3-aminoadipate semi tal structures of the A. fulgidus and E. coli enzymes have been aldehyde given the structural similarity between 3,6-diami resolved (Lehtio et al., J. Mol. Biol. 357:221-235 (2006): nohexanoate and lysine. Genbank information related to Leppanenet al., Structure 7:733-744 (1999)). Additional PFL these genes is summarized in Table 14 below. and PFL-AE enzymes are found in Clostridium pasteurianum (Weidner and Sawyers, J. Bacteriol. 178:2440-2444 (1996)) TABLE 1.4 and the eukaryotic alga Chlamydomonas reinhardtii (Hem Gene GI fi Accession No. Organism schemeier et al., Eukaryot. Cell 7:518 526 (2008)). Keto lysDH 1342.9872 BAB39707 Geobacilius Stearothermophilus acid formate-lyase (EC 2.3.1.-), also known as 2-ketobutyrate lysDH 1588.8285 NP 353966 Agrobacterium timefaciens formate-lyase (KFL) and pyruvate formate-lyase 4, is the lysDH 74O26644 AAZ94428 Achromobacter denitrificans gene product of tdcE in E. coli. This enzyme catalyzes the conversion of 2-ketobutyrate to propionyl-CoA and formate 0098 FIG. 2, step A uses a 3-oxoadipyl-CoA thiolase, or during anaerobic threonine degradation, and can also substi equivalently, Succinyl CoA:acetyl CoA acyl transferase tute for pyruvate formate-lyase in anaerobic catabolism (Si (B-ketothiolase). The gene products encoded by pcaF in manshu et al., J. Biosci. 32:1195-1206 (2007)). The enzyme is Pseudomonas strain B13 (Kaschabek et al., J. Bacteriol. 184: oxygen-sensitive and, like PflB, requires post-translational 207-215 (2002)), phaD in Pseudomonas putida U (Olivera et modification by PFL-AE to activate a glycyl radical in the al., Proc. Natl. Acad. Sci. U.S.A. 95:6419-6424 (1998)), paaE active site (Hesslinger et al., Mol. Microbiol. 27:477-492 in Pseudomonas fluorescens ST (Diet al., Arch. Micbrobiol. (1998)). Genbank information related to these genes is sum 188: 117-125 (2007)), and paal from E. coli (Nogales et al., marized in Table 16 below. US 2011/O124911 A1 May 26, 2011

TABLE 16 TABLE 1.8 Gene GI fi Accession No. Organism Gene GI fi Accession No. Organism pflB 16128870 NP 415423.1 Escherichia coi SkyPYD4 98.626772 ABFS8893.1 Lachancea kluyveri pflA 16128869 NP 415422.1 Escherichia coi SkUGA1 98.626792 ABFS8894.1 Lachancea kluyveri tdcE 48994926 AAT4817.0.1 Escherichia coi UGA1 6321456 NP 011533.1 Saccharomyces cerevisiae pflD 11499044 NP 070278.1 Archaegli ibits filgidus Abat 12206S191. PSOSS43 Rattus norvegicus pf 2SOOOS8 Q46266.1 Clost ridium pasteuriant in Abat 120968 P8O147.2 SiS scrofa act 1072362 CAA63749.1 Clost ridium pasteuriant in pf1 159462978 XP OO1689719.1 Chlamydomonas reinhardtii pflA1 159485246 XP OO1700657.1 Chlamydomonas reinhardtii 0102) Another enzyme that can catalyze the aminotrans ferase reactions in FIGS. 2 and 5 is gamma-aminobutyrate transaminase (GABA transaminase), which naturally inter 0100 Several reactions in FIGS. 2 and 5 are catalyzed by converts succinic semialdehyde and glutamate to 4-aminobu aminotransferases in the EC class 2.6.1 (FIG. 2, Steps F and tyrate and alpha-ketoglutarate and is known to have a broad R and FIG. 5, Steps A and F). Such enzymes reversibly substrate range (Liu et al., Biochemistry 43:10896-10905 transfer amino groups from aminated donors to acceptors (2004); Shigeoka and Nakano, Arch. Biochem. Biophys. 288: Such as pyruvate and alpha-ketoglutarate. The conversion of 22-28 (1991); Schulz et al., Appl. Environ. Microbiol. 56:1-6 lysine to 2-aminoadipate (FIG. 5, Step A) is naturally cata (1990)). E. coli has two GABA transaminases, encoded by lyzed by lysine-6-aminotransferase (EC 2.6.1.3.6). This gabT (Bartsch and Schulz, J. Bacteriol. 172:7035-7042 enzyme function has been demonstrated in yeast and bacteria. (1990)) and puuE (Kurihara et al., J. Biol. Chem. 280:4602 Enzymes from Candida wills (Hammer et al J. Basic Micro 4608 (2005)). GABA transaminases in Mus musculus, biol. 32:21-27 (1992)). Flavobacterium lutescens (Fuji et al. Pseudomonas fluorescens, and Sus scrofa have been shown to J. Biochem. 128:391-397 (2000)) and Streptomyces clavuli react with alternate substrates (Cooper, A.J., Methods Enzy genus (Romero et al. J. Ind. Microbiol. Biotechnol. 18:241 mol. 113:80-82 (1985); Scott and Jakoby, J. Biol. Chem. 246 (1997)) have been characterized. A recombinant lysine 234:932-936 (1959). Genbank information related to these 6-aminotransferase from S. clavuligenus was functionally genes is summarized in Table 19 below. expressed in E. coli (Tobinet al.J. Bacteriol. 173:6223-6229 (1991)). The Flutescens enzyme is specific to alpha-ketoglu TABLE 19 tarate as the amino acceptor (Soda et al. Biochemistry 7:4110 4119 (1968)). Lysine-6-aminotransferase is also an enzyme Gene GI fi Accession No. Organism gabT 16130576 NP 41.7148.1 Escherichia coi that can catalyze the transamination of 3,6-diaminohexanoate puuE 16129263 P 415818.1 Escherichia coi (FIG. 5, Step F), as this substrate is structurally similar to aba 372021.21 NP 766549.2 Mits musculus lysine. Genbank information related to these genes is sum gabT 70733692 YP 257332.1 Pseudomonas fittorescens marized in Table 17 below. aba 475236OO NP 999428.1 SiS scrofa

TABLE 17 0103 CoA transferases catalyze the reversible transfer of a CoA moiety from one molecule to another. Conversion of Gene GI fi Accession No. Organism beta-ketoadipyl-CoA to beta-ketoadipate (FIG. 2, Step B) is lat 10336SO2 BAB13756.1 Flavobacterium iuiescens accompanied by the acylation of Succinate by beta-ketoad lat 153343 AAA26777.1 Streptomyces clavliligentis ipyl-CoA transferase. The de-acylation of 2,3-dehydroad ipyl-CoA (FIG. 2, Step M and FIG. 4, Step H) can also be 0101. In Steps R and F of FIG. 2 the beta-ketones of catalyzed by an enzyme in the 2.8.3 family. 2-maleylacetate and 2-fumarylacetate, respectively, are con 0104 Beta-ketoadipyl-CoA transferase (EC 2.8.3.6), also Verted to secondary amines. Beta-alanine/alpha-ketoglut known as Succinyl-CoA:3:oxoacid-CoA transferase, is arate aminotransferase (WO08027742) reacts with beta-ala encoded by pca and pca in Pseudomonas putida (Kascha nine to form malonic semialdehyde, a 3-oxoacid similar in bek et al., J. Bacteriol. 184:207-215 (2002)). Similar structure to 2-maleylacetate. The gene product of SkPYD4 in enzymes based on homology existin Acinetobacter sp. ADP1 (Kowalchuk et al., Gene 146:23-30 (1994)). Additional Saccharomyces kluyveri was shown to preferentially use exemplary Succinyl-CoA:3:oxoacid-CoA transferases are beta-alanine as the amino group donor (Andersen and present in Helicobacter pylori (Corthesy-Theulaz et al., J. Hansen, Gene 124:105-109 (1993)). SkUGA1 encodes a Biol. Chem. 272:25659-25667 (1997)) and Bacillus subtilis homologue of Saccharomyces cerevisiae GABA aminotrans (Stols et al., Protein Expr: Purif 53:396–403 (2007)). Gen ferase, UGA1 (Ramos et al., Eur: J. Biochem. 149:401–404 bank information related to these genes is Summarized in (1985)), whereas SkPYD4 encodes an enzyme involved in Table 20 below. both -alanine and GABA transamination (Andersen and Hansen, Supra). 3-Amino-2-methylpropionate transaminase catalyzes the transformation from methylmalonate semialde TABLE 20 hyde to 3-amino-2-methylpropionate. The enzyme has been Gene GI fi Accession No. Organism characterized in Rattus norvegicus and Sus scrofa and is pca 24985644 AAN69545.1 Pseudomonas putida encoded by Abat (Kakimoto et al., Biochim. Biophys. Acta pca 2699.0657 NP 746082.1 Pseudomonas putida 156:374-380 (1968); Tamaki et al., Methods Enzymol. 324: pca SOO84858 YP 046368.1 Acinetobacter sp. ADP1 376-389 (2000)). Genbank information related to these genes pca 141776 AAC37.147.1 Acinetobacter sp. ADP1 is summarized in Table 18 below. US 2011/O124911 A1 May 26, 2011

al, Supra). This enzyme is induced at the transcriptional level TABLE 20-continued by acetoacetate, so modification of regulatory control may be necessary for engineering this enzyme into a pathway (Pauli Gene GI fi Accession No. Organism and Overath, Eur: J. Biochem. 29:553-562 (1972)). Similar pca 21224997 NP 630776.1 Streptomyces coelicolor enzymes exist in Corynebacterium glutamicum ATCC 13032 pca 21224996 NP 630775.1 Streptomyces coelicolor HPAG1 0676 1085631.01 YP 627417 Helicobacter pylori (Duncan et al., Appl. Environ. Microbiol. 68:5186-5190 HPAG1 O677 108563102 YP 627418 Helicobacter pylori (2002)). Clostridium acetobutylicum (Cary et al., Appl. Envi ScoA 160809SO NP 391778 Bacilius subtilis ron. Microbiol. 56:1576-1583 (1990); Weisenborn et al., ScoB 16080949 NP 391777 Bacilius subtilis Appl. Environ. Microbiol. 55:323-329 (1989)), and Clostridium saccharoperbutylacetonicum (Kosaka et al., 0105. The glutaconyl-CoA-transferase (EC 2.8.3.12) Biosci. Biotechnol. Biochem. 71:58-58 (2007)). Genbank enzyme from anaerobic bacterium Acidaminococcus fermen information related to these genes is summarized in Table 23 tans reacts with glutaconyl-CoA and 3-butenoyl-CoA (Mack below. et al., Eur: J. Biochem. 226:41-51 (1994)), substrates similar in structure to 2.3-dehydroadipyl-CoA. The genes encoding TABLE 23 this enzyme are gctA and gctB. This enzyme has reduced but Gene GI fi Accession No. Organism detectable activity with other CoA derivatives including glu taryl-CoA, 2-hydroxyglutaryl-CoA, adipyl-CoA and acrylyl atoA 2492994 P76459.1 Escherichia coi ato) 2492990 P76458.1 Escherichia coi CoA (Buckel et al., Eur: J. Biochem. 118:315-321 (1981)). actA 62391407 YP 2268.09.1 Corynebacterium glutamicum The enzyme has been cloned and expressed in E. coli (Mack, cg0592 62389399 YP 224801.1 Corynebacterium glutamicum Supra). Genbank information related to these genes is sum ctfA 15004.866 NP 149326.1 Clostridium acetobutyllicum marized in Table 21 below. ctfB 15004867 NP 1493.27.1 Clostridium acetobutyllicum ctfA 31075384 AAP42S64.1 Cliostridium Saccharoperbutylacetonictim TABLE 21 ctfB 3107S385 AAP42S65.1 Cliostridium Saccharoperbutylacetonictim Gene GI fi Accession No. Organism gctA 559392 CAAS7199.1 Acidaminococcits fermenians 0108. In Step H of FIG. 2, the lactonization of beta-ketoa gctB 5593.93 CAAS72OO.1 Acidaminococcits fermenians dipate to form B-ketoadipate-enol-lactone is be catalyzed by the beta-ketoadipate enol-lactonase (EC-3.1.1.24). Beta-ke 0106 Other exemplary CoA transferases are catalyzed by toadipate enol-lactonase also participates in the catechol the gene products of catl, cat2, and cat3 of Clostridium branch of the beta-ketoadipate pathway to degrade aromatic Kluyveri which have been shown to exhibit succinyl-CoA, compounds, in the reverse direction of that required in Step H 4-hydroxybutyryl-CoA, and butyryl-CoA transferase activ of FIG. 2. This enzyme is encoded by the pcal D gene in ity, respectively (Seedorf et al., Proc. Natl. Acad. Sci. U.S.A. Pseudomonas putida (Hughes et al., J. Gen Microbiol. 134: 105:2128-2133 (2008); Sohling and Gottschalk, J. Bacteriol. 2877-2887 (1988)), Rhodococcus opacus (Eulberg et al., J. 178:871-880 (1996)). Similar CoA transferase activities are Bacteriol. 180:1072-1081 (1998)) and Ralstonia eutropha. In also present in Trichomonas vaginalis (van Grinsven et al., J. Acinetobacter calcoaceticus, genes encoding two B-ketoadi Biol. Chem. 283: 141 1-1418 (2008)) and Trypanosoma brucei pate enol-lactone hydrolases were identified (Patel et al., J. (Riviere et al., J. Biol. Chem. 279:45337-45346 (2004)). Gen Biol. Chem. 250:6567 (1975)). Genbank information related bank information related to these genes is Summarized in to these genes is summarized in Table 24 below. Table 22 below. TABLE 24 TABLE 22 Gene GI fi Accession No. Organism Gene GI fi Accession No. Organism ELH 6015088 Q59093 Acinetobacter catl 729.048 P38946.1 Clostridium kluyveri Caicoaceticus cat2 172046066 P38942.2 Clostridium kluyveri ELH2 6166146 POO632 Acinetobacter cats 146349050 EDK35586.1 Clostridium kluyveri Caicoaceticus TVAG 395550 123975034 XP, OO1330176 Trichomonas pcaD 2498.2842 AAN67OO3 Pseudomonas puttida vaginalis G3 pcaD 75426718 O67982 Rhodococci is opact is Tb11.02.O290 71754875 XP 828352 Trypanosoma brucei pcaD 75411823 javascript: Ralstonia eutropha Blast2(Q9EV41)Q9EV45 0107 ACoA transferase that can utilize acetyl-CoA as the CoA donor is acetoacetyl-CoA transferase, encoded by the E. 0109 The hydrolysis of acyl-CoA molecules to their cor coli atoA (alpha Subunit) and ato) (beta Subunit) genes (Ko responding acids is carried out by acyl CoA hydrolase rolev et al., Acta Crystallagr. D. Biol. Crystallagr. 58:21 16 enzymes in the 3.1.2 family, also called thioesterases. Several 2121 (2002); Vanderwinkel et al., Biochem. Biophys. Res. eukaryotic acetyl-CoA hydrolases (EC 3.1.2.1) have broad Commun. 33:902-908 (1968)). This enzyme has a broad sub Substrate specificity and thus represent Suitable enzymes for strate range (Sramek and Frerman, Arch. Biochem. Biophys. hydrolyzing beta-ketoadipyl-CoA and 2,3-dehydroadipyl 171:14-26 (1975)) and has been shown to transfer the CoA CoA (FIG. 2, Steps B and M and FIG. 4, Step H). For moiety to acetate from a variety of branched and linear acyl example, the enzyme from Rattus norvegicus brain (Robin CoA substrates, including isobutyrate (Matthies and Schink, son et al., Biochem. Biophys. Res. Commun. 71:959-965 Appl. Environ. Microbiol. 58:1435-1439 (1992)), valerate (1976)) can react with butyryl-CoA, hexanoyl-CoA and (Vanderwinkel et al. Supra) and butanoate (Vanderwinkel et malonyl-CoA. The enzyme from the mitochondrion of the US 2011/O124911 A1 May 26, 2011

pea leaf also has a broad Substrate specificity, with demon strated activity on acetyl-CoA, propionyl-CoA, butyryl-CoA, TABLE 28 palmitoyl-CoA, oleoyl-CoA, succinyl-CoA, and crotonyl CoA (Zeiher and Randall, Plant Physiol. 94:20-27 (1990)). Gene GI fi Accession No. Organism The acetyl-CoA hydrolase, ACH1, from S. cerevisiae repre getA 559392 CAAS71.99 Acidaminococcits fermenians sents another hydrolase (Buu et al., J. Biol. Chem. 278:17203 gctB 5593.93 CAAS72OO Acidaminococcits fermenians 17209 (2003)). Genbank information related to these genes is summarized in Table 25 below. 0113 Step C of FIG. 4 is catalyzed by a 2-ketoacid decar boxylase that generates 6-oxo-2,3-dehydrohexanoate TABLE 25 (6-OHE) from 2-oxohept-4-ene-1,7-dioate (OHED). The decarboxylation of keto-acids is catalyzed by a variety of Gene GI fi Accession No. Organism enzymes with varied Substrate specificities, including pyru acot12 18543355 NP 570 103.1 Raitt is norvegicus vate decarboxylase (EC 4.1.1.1), benzoylformate decarboxy ACH1 6319456 NP OO9538 Saccharomyces cerevisiae lase (EC 4.1.1.7), alpha-ketoglutarate decarboxylase and branched-chain alpha-ketoacid decarboxylase. Pyruvate decarboxylase (PDC), also termed keto-acid decarboxylase, 0110. Another hydrolase is the human dicarboxylic acid is a key enzyme in alcoholic fermentation, catalyzing the thioesterase, acot:8, which exhibits activity on glutaryl-CoA, decarboxylation of pyruvate to acetaldehyde. The enzyme adipyl-CoA, suberyl-CoA, sebacyl-CoA, and dode from Saccharomyces cerevisiae has a broad Substrate range canedioyl-CoA (Westin et al., J. Biol. Chem. 280:38125 for aliphatic 2-keto acids including 2-ketobutyrate, 2-ketov 28132 (2005)) and the closest E. coli homolog, tesB, which alerate, 3-hydroxypyruvate and 2-phenylpyruvate (22). This can also hydrolyze a broad range of CoA thioesters (Naggert enzyme has been extensively studied, engineered for altered et al., J. Biol. Chem. 266:11044-11050 (1991)). A similar activity, and functionally expressed in E. coli (Killenberg enzyme has also been characterized in the rat liver (Deana, R., Jabs et al., Eur: J. Biochem. 268:1698-1704 (2001): Li and Biochem. Int. 26:767-773 (1992)). Genbank information Jordan, Biochemistry 38:10004-10012 (1999); ter Schure et related to these genes is summarized in Table 26 below. al., Appl. Environ. Microbiol. 64: 1303-1307 (1998)). The PDC from Zymomonas mobilus, encoded by pdc, also has a TABLE 26 broad Substrate range and has been a Subject of directed engineering studies to alter the affinity for different substrates Gene GI fi Accession No. Organism (Siegert et al., Protein Eng Des Sel 18:345-357 (2005)). The tesB 16128437 NP 41.4986 Escherichia coi crystal structure of this enzyme is available (Killenberg-Jabs, acot& 3191970 CAA1SSO2 Homo sapiens et al., supra). Other well-characterized PDC enzymes include acot& 51036669 NP 5701 12 Ratti is norvegicus the enzymes from Acetobacter pasteurians (Chandra et al., Arch. Microbiol. 176:443-451 (2001)) and Kluyveromyces 0111. Other potential E. colithioester hydrolases include lactis (Krieger et al., Eur: J. Biochem. 269:3256-3263 the gene products of tes.A (Bonner and Bloch, J. Biol. Chem. (2002)). Genbank information related to these genes is sum 247:3123-3133 (1972)), ybgC (Kuznetsova et al., FEBS marized in Table 29 below. Microbiol. Rev. 29:263-279 (2005); Zhuanget al., FEBS Lett. 516:161-163 (2002)), paal (Song et al., J. Biol. Chem. 281: TABLE 29 11028-11038 (2006)), and ybdB (Leduc et al., J. Bacteriol. Gene GI fi Accession No. Organism 1889:7112-7126 (2007)). Genbank information related to pdc 118391 PO6672.1 Zymomonas mobilus these genes is summarized in Table 27 below. pdc1 30923.172 PO6169 Saccharomyces cerevisiae pdc 2O385.191 AM21208 Acetobacter pasteurians TABLE 27 pdc1 52788279 Q12629 Kluyveromyces lactis Gene GI fi Accession No. Organism 0114. Like PDC, benzoylformate decarboxylase (EC 4.1. teaS 16128478 NP 415027 Escherichia coi 1.7) has a broad Substrate range and has been the target of ybgC 16128711 NP 415264 Escherichia coi paa 16129357 NP 415914 Escherichia coi enzyme engineering studies. The enzyme from Pseudomonas ybdB 16128580 NP 415129 Escherichia coi putida has been extensively studied and crystal structures of this enzyme are available (Hasson et al., Biochemistry 37:9918-9930 (1998); Polovnikova et al., Biochemistry 0112 Yet another hydrolase is the glutaconate CoA-trans 42:1820-1830 (2003)). Site-directed mutagenesis of two resi ferase from Acidaminococcus fermentans. This enzyme was dues in the active site of the Pseudomonas putida enzyme transformed by site-directed mutagenesis into an acyl-CoA altered the affinity (Kim) of naturally and non-naturally occur hydrolase with activity on glutaryl-CoA, acetyl-CoA and ring substrates (Siegertet al., Protein Eng Des Sel 18:345-357 3-butenoyl-CoA (Mack and Buckel, FEBS Lett. 405:209-212 (2005)). The properties of this enzyme have been further (1997)), compounds similar in structure to 2,3-dehydroad modified by directed engineering (Lingen et al., Protein Eng. ipyl-CoA. This indicates that the enzymes encoding Succinyl 15:585-593 (2002); Lingen et al., Chembiochem, 4:721-726 CoA:3-ketoacid-CoA transferases and acetoacetyl-CoA: (2003)). The enzyme from Pseudomonas aeruginosa, acetyl-CoA transferases can also serve as enzymes for this encoded by mdlC, has also been characterized experimentally reaction step but would require certain mutations to change (Barrowman et al., FEMS Microbiology Letters 34:57-60 their function. Genbank information related to these genes is (1986)). Additional genes from Pseudomonas Stutzeri, summarized in Table 28 below. Pseudomonas fluorescens and other organisms can be US 2011/O124911 A1 May 26, 2011 inferred by sequence homology or identified using a growth (Oku and Kaneda, Supra) and the gene encoding this enzyme selection system developed in Pseudomonasputida (Henning has not been identified to date. Additional BCKA genes can et al., Appl. Environ. Microbiol. 72:7510-7517 (2006)). Gen be identified by homology to the Lactococcus lactis protein bank information related to these genes is Summarized in sequence. Many of the high-scoring BLASTp hits to this Table 30 below. enzyme are annotated as indolepyruvate decarboxylases (EC 4.1.1.74). Indolepyruvate decarboxylase (IPDA) is an TABLE 30 enzyme that catalyzes the decarboxylation of indolepyruvate Gene GI fi Accession No. Organism to indoleacetaldehyde in plants and plant bacteria. Genbank information related to these genes is summarized in Table 32 mdC 3915757 P20906.2 Pseudomonas puttida below. mdC 81539678 Q9HUR2.1 Pseudomonas aeruginosa dpg|B 1262O21.87 ABN804231 Pseudomonas Stutzeri ilwB-1 7073O840 YP 260581.1 Pseudomonas fittorescens TABLE 32 Gene GI fi Accession No. Organism 0115 A third enzyme capable of decarboxylating 2-oxoacids is alpha-ketoglutarate decarboxylase (KGD). The kdcA 44921617 AAS49166.1 Lactococci is lactis Substrate range of this class of enzymes has not been studied to date. The KDC from Mycobacterium tuberculosis (Tianet 0117 Recombinant branched chain alpha-keto acid decar al., Proc. Natl. Acad. Sci. U.S.A. 102: 10670-10675 (2005)) boxylase enzymes derived from the E1 subunits of the mito has been cloned and functionally expressed, although it is chondrial branched-chain keto acid dehydrogenase complex large (-130 kD) and GC-rich. KDC enzyme activity has been from Homo sapiens and Bos taurus have been cloned and detected in several species of rhizobia including Bradyrhizo functionally expressed in E. coli (Davie et al., J. Biol. Chem. bium japonicum and Mesorhizobium loti (Green et al., J. 267:16601-16606 (1992); Wynn et al., J. Biol. Chem. 267: Bacteriol. 182:2838-2844 (2000)). Although the KDC-en coding gene(s) have not been isolated in these organisms, the 1881-1887 (1992); Wynn et al., J. Biol. Chem. 267:12400 genome sequences are available and several genes in each 12403 (1992)). It was indicated that co-expression of chap genome are annotated as putative KDCs. A KDC from eronins GroEL and GroES enhanced the specific activity of Euglena gracilis has also been characterized but the gene the decarboxylase by 500-fold (Wynn (1992) supra). These associated with this activity has not been identified to date enzymes are composed of two alpha and two beta Subunits. (Shigeoka and Nakano, Arch. Biochem. Biophys. 288:22-28 Genbank information related to these genes is Summarized in (1991)). The first twenty amino acids starting from the N-ter Table 33 below. minus were sequenced MTYKAPVKDVKFLLDKVFKV (Shigeoka and Nakano, Supra). The gene could be identified TABLE 33 by testing genes containing this N-terminal sequence for KDC activity. Genbank information related to these genes is Gene GI fi Accession No. Organism summarized in Table 31 below. BCKDHB 341O1272 NP 898871.1 Homo sapiens BCKDHA 11386.13S NP OOO700.1 Homo sapiens BCKDHB 11SSO2434 P21839 BoStatiris TABLE 31 BCKDHA 129030 P11178 BoStatiris Gene GI fi Accession No. Organism kgd 160395583 OSO463.4 Mycobacterium tuberculosis 0118 Aldehyde lyases in EC class 4.1.2 catalyze two key kgd 27375.563 NP 767092.1 Bradyrhizobium japonicum reactions in the disclosed pathways to muconate (FIG.3, Step kgd 13473636 NP 105204.1 Mesorhizobium ioti A and FIG. 4, Step A). HOHDaldolase, also known as HHED aldolase, catalyzes the conversion of 4-hydroxy-2-oxo-hep 0116. A fourth enzyme for catalyzing this reaction is tane-1,7-dioate (HOHD) into pyruvate and succinic semial branched chain alpha-ketoacid decarboxylase (BCKA). This dehyde (FIG. 4, Step A). HODH aldolase is a divalent metal class of enzyme has been shown to act on a variety of com ion-dependent class II aldolase, catalyzing the final step of pounds varying in chain length from 3 to 6 carbons (Oku and 4-hydroxyphenylacetic acid degradation in E. coli C. E. coli Kaneda, J. Bio. Chem. 263:18386-18396 (1988); Smit et al., W. and other organisms. In the native context, the enzyme App. Environ. Microbiol. 71:303-311 (2005)). The enzyme in functions in the degradative direction. The reverse (conden Lactococcus lactis has been characterized on a variety of sation) reaction is thermodynamically unfavorable; however branched and linear Substrates including 2-oxobutanoate, the equilibrium can be shifted through coupling HOHDaldo 2-oxohexanoate, 2-oxopentanoate, 3-methyl-2-oxobu lase with downstream pathway enzymes that work efficiently tanoate, 4-methyl-2-oxobutanoate and isocaproate (Smit et on reaction products. Such strategies have been effective for al., Supra). The enzyme has been structurally characterized shifting the equilibrium of otheraldolases in the condensation (Berget al., Science 318:1782-1786 (2007)). Sequence align direction (Nagata et al., Appl. Microbiol. Biotechnol. 44:432 ments between the Lactococcus lactis enzyme and the pyru 438 (1995); Pollard et al., App. Environ. Microbiol. 64:4093 vate decarboxylase of Zymomonas mobilus indicate that the 4094 (1998)). The E. coli Cenzyme, encoded by hpch, has catalytic and Substrate recognition residues are nearly iden been extensively studied and has recently been crystallized tical (Siegert et al., Protein Eng Des Sel 18:345-357 (2005)), (Rea et al., J. Mol. Biol. 373:866-876 (2007); Stringfellow et so this enzyme can be subjected to directed engineering. al., Gene 166:73-76 (1995)). The E. coli W enzyme is Decarboxylation of alpha-ketoglutarate by a BCKA was encoded by hpaI (Prieto et al., J. Bacteriol. 178:111-120 detected in Bacillus subtilis; however, this activity was low (1996)). Genbank information related to these genes is sum (5%) relative to activity on other branched-chain substrates marized in Table 34 below. US 2011/O124911 A1 May 26, 2011 17

jejuni (Smith and Gray, Catalysis Letters 6:195-199 (1990)), TABLE 34 Therms thermophilus (Mizobata et al., Arch. Biochem. Bio phys. 355:49-55 (1998)), and Rattus norvegicus (Kobayashi Gene GI fi Accession No. Organism et al., J. Biochem. 89:1923-1931 (1981)). Genbank informa hpch 6331.97 CAA87759.1 Escherichia coi C tion related to these genes is summarized in Table 36 below. hpaI 38112625 AAR11360.1 Escherichia Coi W TABLE 36 0119. In Step A of FIG. 3, pyruvate and malonate semial Gene GI fi Accession No. Organism dehyde are joined by an aldehyde lyase to form 4-hydroxy fumC 12O6O1 POSO42.1 Escherichia coli K12 2-oxohexanedioate. An enzyme catalyzing this exact reaction finC 399.31596 Q8NRN8.1 Corynebacterium glutamicum has not been characterized to date. A similar reaction is cata finC 9789756 O69294.1 Campylobacterieitini lyzed by 2-dehydro-3-deoxyglucarate aldolase (DDGA, EC finC 75427690 P841.27 Thermus thermophilus 4.1.2.20), a type II aldolase that participates in the catabolic fumEH 12O605 P14408.1 Rattus norvegicus pathway for D-glucarate/galactarate utilization in E. coli. Tartronate semialdehyde, the natural substrate of DDGA, is I0121 Another enzyme for catalyzing these reactions is similar in size and structure to malonate semialdehyde. This citramalate hydrolyase (EC 4.2.1.34), an enzyme that natu enzyme has a broad Substrate specificity and has been shown rally dehydrates 2-methylmalate to mesaconate. This enzyme to reversibly condense a wide range of aldehydes with pyru has been studied in Methanocaldococcus jannaschii in the vate (Fish and Blumenthal, Methods Enzymol. 9:529-534 context of the pyruvate pathway to 2-oxobutanoate, where it (1966)). The crystal structure of this enzyme has been deter has been shown to have a broad substrate specificity (Drev mined and a catalytic mechanism indicated (Izard and Black landet al., J. Bacteriol. 189:4391-4400 (2007)). This enzyme well, EMBO.J. 19:3849-3856 (2000)). Other DDGA enzymes activity was also detected in Clostridium tetanomorphum, are found in Leptospira interrogans (Li et al., Acta Crystal Morganella morganii, Citrobacter amalonaticus where it is logr: Sect. F. Struct. Biol. Cryst. Commun. 62:1269-1270 thought to participate in glutamate degradation (Kato and (2006)) and Sulfolobus solfataricus (Buchanan et al., Bio Asano Arch. Microbiol. 168:457-463 (1997)). The M. jann chem. J. 343 Pt 3:563-570 (1999)). The S. solfataricus aschii protein sequence does not bear significant homology to enzyme is highly thermostable and was cloned and expressed genes in these organisms. Genbank information related to in E. coli (Buchanan et al., Supra). Genbank information these genes is summarized in Table 37 below. related to these genes is summarized in Table 35 below. TABLE 37 TABLE 35 Gene GI fi Accession No. Organism Gene GI fi Accession No. Organism leu) 3122345 Q58673.1 Methanocaldococcus jannaschii garL 1176153 P23522.2 Escherichia coi LA 1624 24195249 AAN48823.1 Leptospira interrogans I0122) The enzyme OHED hydratase (FIG. 4, Step B) par AJ224174.1:1.885 2879782 CAA11866.1 Sulfolobus ticipates in 4-hydroxyphenylacetic acid degradation, where it Solfataricits converts 2-oxo-hept-4-ene-1,7-dioate (OHED) to 2-oxo-4- hydroxy-hepta-1,7-dioate (HODH) using magnesium as a 0120. The pathways in FIGS. 2-4 employ numerous cofactor (Burks et al., J. Am. Chem. Soc. 120 (1998). OHED enzymes in the dehydratase class of enzymes (EC 4.1.2). hydratase enzymes have been identified and characterized in Several reactions in FIGS. 2 and 3 undergo dehydration reac E. coli C (Izumi et al., J. Mol. Biol. 370:899-911 (2007): tions similar to the dehydration of malate to fumarate, cata Roper et al., Gene 156:47-51 (1995)) and E. coli W (Prieto et lyzed by fumarate hydratase (EC 4.2.1.2). These transforma al., J. Bacteriol. 178:111-120 (1996)). Sequence comparison tions include the dehydration of 3-hydroxy-4-hexenedioate reveals homologs in a range of bacteria, plants and animals. (FIG. 2, Steps E and Q and FIG. 3, Step H), 4-hydroxy-2- Enzymes with highly similar sequences are contained in oxohexanedioate (FIG. 3, Step B), 2-hydroxy-4-hexenedio Klebsiella pneumonia (91% identity, evalue=2e-138) and ate (FIG. 3, Step D) and 2,4-dihydroxyadipate (FIG. 3, Steps Salmonella enterica (91% identity, evalue=4e-138), among F and G). Fumarate hydratase enzymes are exemplary others. Genbank information related to these genes is sum enzymes for catalyzing these reactions. The E. coli fumarase marized in Table 38 below. encoded by fumC dehydrates a variety of alternate substrates including tartrate and threo-hydroxyaspartate (Teipel et al., J. TABLE 38 Biol. Chem. 243:5684-5694 (1968)). A wealth of structural information is available for the E. coli enzyme and research Gene GI fi Accession No. Organism ers have Successfully engineered the enzyme to alteractivity, hpcG SS6840 CAAS72O2.1 Escherichia coi C inhibition and localization (Weaver, T., Acta Crystallogr. D hpaH757830 CAA86044.1 Escherichia coli W Biol. Crystallagr: 61:1395-1401 (2005)). Exemplary fuma hpaH 1SO9581OO ABR8O130.1 Klebsiella pneumoniae rate hydratase enzymes are found in Escherichia coli (Estevez Sari O1896 160865.156 ABX21779.1 Saimoneia enterica et al., Protein Sci. 11:1552-1557 (2002); Hong and Lee, Bio technol. Bioprocess Eng. 9:252-255 (2006); Rose and I0123 Dehydration of 3-hydroxyadipyl-CoA to 2,3-dehy Weaver, Proc. Natl. Acad. Sci. U.S.A. 101:3393-3397 droadipyl-CoA (FIG. 2, Step L and FIG. 4, Step G) is cata (2004)); Agnihotri and Liu, Bioorg. Med. Chem. 11:9-20 lyzed by an enzyme with enoyl-CoA hydratase activity. (2003)). Corynebacterium glutamicum (Genda et al., Biosci. 3-Hydroxybutyryl-CoA dehydratase (EC 4.2.1.55), also Biotechnol. Biochem. 71:1102-1109 (2006)), Campylobacter called crotonase, is an enoyl-CoA hydratase that dehydrates US 2011/O124911 A1 May 26, 2011

3-hydroxyisobutyryl-CoA to form crotonyl-CoA (FIG. 3, tive regulator encoded by fadR can be utilized to activate the step 2). Crotonase enzymes are required for n-butanol forma fadB gene product (Sato et al., J. Biosci. Bioeng. 103:38-44 tion in Some organisms, particularly Clostridial species, and (2007)). The fadI and fad.Jgenes encode similar functions and also comprise one step of the 3-hydroxypropionate/4-hy are naturally expressed under anaerobic conditions (Camp droxybutyrate cycle in thermoacidophilic Archaea of the gen bell et al., Mol. Microbiol. 47:793-805 (2003)). Genbank era Sulfolobus, Acidianus, and Metallosphaera. Exemplary information related to these genes is Summarized in Table 41 genes encoding crotonase enzymes can be found in C. aceto below. butyllicum (Atsumi et al., Metab. Eng. 10:305-211 (2008); Boynton et al., J. Bacteriol. 178:3015-3024 (1996)), C. TABLE 41 kluyveri (Hillmer and Gottschalk, FEBS Lett. 21:351-354 (1972)), and Metallosphaera sedula (Berg et al., Science Gene GI fi Accession No. Organism 318:1782-1786 (2007)) though the sequence of the latter gene fadA 49176430 YP O26272.1 Escherichia coi is not known. Genbank information related to these genes is fadB 16131692 NP 418288.1 Escherichia coi summarized in Table 39 below. fadI 16130275 NP 416844.1 Escherichia coi fad 16130274 NP 416843.1 Escherichia coi fadR 161291SO NP 415705.1 Escherichia coi TABLE 39 Gene GI fi Accession No. Organism 0.126 An enzyme in the ammonia-lyase family is required crit 15895969 NP 349318.1 Clostridium acetobutyllicum to deaminate 3-amino-4-hexenedioate (FIG. 2, Steps G and crt1 153953091 YP 001393856.1 Clostridium kluyveri S), 2-aminoadipate (FIG. 5, Step C) and 3-aminoadipate (FIG. 5, Step H). Enzymes catalyzing this exact transforma tion has not been identified. However the three substrates bear 0.124. Additional enoyl-CoA hydratases (EC 4.2.1.17) structural similarity to aspartate, the native Substrate of aspar catalyze the dehydration of a range of 3-hydroxyacyl-CoA tase (EC 4.3.1.1.). Aspartase is a widespread enzyme in substrates (Agnihotri and Liu, Bioorg. Med. Chem. 11:9-20 microorganisms, and has been characterized extensively (2003); Conradet al., J. Bacteriol. 118: 103-111 (1974); Rob (Wakil et al., J. Biol. Chem. 207:631-638 (1954)). The E. coli erts et al., Arch. Microbiol. 1 17:99-108 (1978)). The enoyl enzyme has been shown to react with a variety of alternate CoA hydratase of Pseudomonas putida, encoded by ech, Substrates including aspartatephenylmethylester, asparagine, catalyzes the conversion of 3-hydroxybutyryl-CoA to croto benzyl-aspartate and malate (Ma et al., Ann N.Y. Acad. Sci. nyl-CoA (Roberts et al., Supra). Additional enoyl-CoA 672:60-65 (1992)). In addition, directed evolution was been hydratase enzymes are phaA and phaB, of Pputida, and paaA employed on this enzyme to alter Substrate specificity (Asano and paaB from P. fluorescens (Olivera et al., Proc. Natl. Acad. et al., Biomol. Eng. 22:95-101 (2005)). The crystal structure Sci. U.S.A. 95:6419-6424 (1998)). The gene product of pimF of the E. coli aspartase, encoded by asp.A, has been solved in Rhodopseudomonas palustris is predicted to encode an (Shi et al., Biochemistry 36:9136-9144 (1997)). Enzymes enoyl-CoA hydratase that participates in pimeloyl-CoA deg with aspartase functionality have also been characterized in radation (Harrison and Harwood, Microbiology 151:727-736 Haemophilus influenzae (Sostrom et al., Biochim. Biophys. (2005)). Lastly, a number of Escherichia coli genes have been Acta 1324:182-190 (1997)), Pseudomonas fluorescens shown to demonstrate enoyl-CoA hydratase functionality (Takagi and Kisumi, J. Bacteriol. 161:1-6 (1985)), Bacillus including maoC (Park and Lee, Appl. Biochem. Biotechnol. subtilis (Sostrom et al., Supra) and Serratia marcescens 113-116:335-346 (2004)), paaF (Ismail et al., Eur: J. Bio (Takagi and Kisumi Supra). Genbank information related to chem. 270:3047-3054 (2003); Park and Lee, supra; Park and these genes is summarized in Table 42 below. Yup, Biotechnol. Bioeg 86:681-686 (2004)) and paaG (Ismail et al., Eur: J. Biochem. 270:3047-3054 (2003); Park and Lee, TABLE 42 supra; Park and Yup, Biotechnol. Bioeg 86:681-686 (2004)). Genbank information related to these genes is Summarized in Gene GI fi Accession No. Organism Table 40 below. asp A 901 11690 NP 418562 Escherichia coi asp A 1168534 P44324.1 Haemophilus influenzae TABLE 40 asp A 114273 PO7346.1 Pseudomonas fittorescens ansB 251757243 P26899.1 Bacilius subtiis Gene GI fi Accession No. Organism asp A 416661 P33109.1 Serraia marcescens ech 26990073 NP 745498.1 Pseudomonas puttida paa A 269900O2 NP 745427.1 Pseudomonas puttida I0127. Another deaminase enzyme is 3-methylaspartase paaB 26990001 NP 745426.1 Pseudomonas puttida phaA 1066.36093 ABF82233.1 Pseudomonas fittorescens (EC 4.3.1.2). This enzyme, also known as beta-methylaspar phaB 1066.36094 ABF82234.1 Pseudomonas fittorescens tase and 3-methylaspartate ammonia-lyase, naturally cata pimF 3965.0635 CAE29158 Rhodopseudomonas palustris lyzes the deamination of threo-3-methylasparatate to mesa maoC 16129348 NP 415905.1 Escherichia coi conate. The 3-methylaspartase from Clostridium paaF 16129354 NP 41591.1.1 Escherichia coi tetanomorphum has been cloned, functionally expressed in E. paaG 16129355 NP 41591.2.1 Escherichia coi coli, and crystallized (Asuncion et al., Acta Crystallogr. D. Biol Crystallogr. 57.731-733 (2001); Asuncion et al., J. Biol. 0.125. Alternatively, the E. coli gene products of fadA and Chem. 277:8306-8311 (2002); Botting et al. Biochemistry fadB encode a multienzyme complex involved in fatty acid 27:2953-2955 (1988); Goda et al., Biochemistry 31:10747 oxidation that exhibits enoyl-CoA hydratase activity (Naka 10756 (1992)). In Citrobacter amalonaticus, this enzyme is higashi and Inokuchi, Nucleic Acids Res. 18:4937 (1990); encoded by BAA28709 (Kato and Asano, Arch. Microbiol. Yang, S.Y.J. Bacteriol. 173:7405-7406 (1991); Yang et al., 168:457-463 (1997)). 3-methylaspartase has also been crys Biochemistry 30:6788-6795 (1991)). Knocking out a nega tallized from E. coli YG1002 (Asano and Kato, FEBS Micro US 2011/O124911 A1 May 26, 2011 biol. Lett. 118:255-258 (1994)) although the protein sequence I0131 The cti gene product catalyzes the conversion of is not listed in public databases such as GenBank. Sequence cis-unsaturated fatty acids (UFA) to trans-UFA. The enzyme homology can be used to identify additional genes, including has been characterized in P. putida (Junker and Ramos, J. CTC O2563 in C. tetani and ECSO761 in Escherichia coli Bacteriol. 181:5693-5700 (1999)). Similar enzymes are O157:H7. Genbank information related to these genes is sum found in Shewanella sp. MR-4 and Vibrio cholerae. Genbank marized in Table 43 below. information related to these genes is Summarized in Table 46 below. TABLE 43 TABLE 46 Gene GI fi Accession No. Organism Gene GI fi Accession No. Organism mal 259429 AAB240701 Clostridium tetanomorphium BAA28.709 3184397 BAA28.709.1 Citrobacter amationaicus ct 52571.78 AAD41252 Pseudomonas puttida CTC O2563 28.212141 NP 783085.1 Cliostridium tetani cti 113968844 YP 732637 Shewanella sp. MR-4 ECSO761 1336O220 BAB34.1841 Escherichia coli O157:H7 cti 2295.06.276 ZP 04395785 Vibrio choierae

0128. In FIG. 2 Step J, muconolactone is converted to 0.132. The endocyclic migration of the double bond in the muconate by muconate cycloisomerase. However, muconate structure of B-ketoadipate-enol-lactone to form muconolac cycloisomerase usually results in the formation of cis,cis tone (FIG. 2, Step 1) is catalyzed by muconolactone muconate, which may be difficult for the subsequent Diels isomerase (EC 5.3.3.4). Muconolactone isomerase also par Alder chemistry. The cis, trans- or trans, trans-isomers are ticipates in the catechol branch of the B-ketoadipate pathway preferred. Therefore, the addition of a cis, trans isomerase to degrade aromatic compounds, at the reverse direction of may help to improve the yield of terepthalic acid. Enzymes Step G. Muconolactone isomerase is encoded by the catC for similar isomeric conversions include maleate cis, trans gene. The Pseudomonas putida muconolactone isomerase isomerase (EC 5.2.1.1), maleylacetone cis-trans-isomerase was purified and partial amino acid sequences of cyanogen (EC 5.2.1.2), and cis, trans-isomerase of unsaturated fatty bromide fragments were determined (Meagher, R. B., Bio acids (Cti). chim. Biophys. Acta 494:33-47 (1997)). A DNA fragment 0129 Maleate cis, trans-isomerase (EC 5.2.1.1) catalyzes carrying the catECDE genes from Acinetobacter calcoaceti the conversion of maleic acid in cis formation to fumarate in cus was isolated by complementing Pputida mutants and the trans formation (Scher and Jakoby, J. Biol. Chem. 244:1878 complemented activities were expressed constitutively in the 1882 (1969)). The Alcalidgenes faecalis maiA gene product recombinant P. putida Strains (Shanley et, al., J. Bacteriol. has been cloned and characterized (Hatakeyeama et al., Bio 165:557-563 (1986). The A. calcoaceticus catBCDE genes chem. Biophys. Res. Commun. 239:74-79 (1997)). Other were also expressed at high levels in Escherichia coli under maleate cis, trans-isomerases are available in Serratia marce the control of a lac promoter (Shanley et al., Supra). The scens (Hatakeyama et al., Biosci. Biotechnol. Biochem. aniline-assimilating bacterium Rhodococcus sp. AN-22 CatC 64: 1477-1485 (2000)), Ralstonia eutropha and Geobacillus was purified to homogeneity and characterized as a homo Stearothermophilus. Genbank information related to these octamer with a molecular mass of 100 kDa (Matsumura et al., genes is Summarized in Table 44 below. Biochem. J. 393:219-226 (2006)). The crystal structure of P putida muconolactone isomerase was solved (Kattie et al., J. TABLE 44 Mol. Biol. 205:557-571 (1989)). Genbank information related to these genes is summarized in Table 47 below. Gene GI fi Accession No. Organism maiA 2575787 BAA23002 Alcaligenes faecalis TABLE 47 maiA 113866948 YP 725437 Ralstonia eutropha H16 maiA 4760466 BAA77296 Geobacilius Stearothermophilus Gene GI fi Accession No. Organism maiA 85.70038 BAA96747.1 Serraia marcescens Q3LHT1 122612792 catC Rhodococcus sp. AN-22 Q43932 S915883 catC Acinetobacter Caicoaceticus Q9EV41 754.64174 catC Ralstonia eutropha 0130 Maleylacetone cis, trans-isomerase (EC 5.2.1.2) POO948 S921,199 catC Pseudomonas puttida catalyzes the conversion of 4-maleyl-acetoacetate to 4-fu Q979Y5 75475O19 catC Frateuria species ANA-18 maryl-acetyacetate, a cis to trans conversion. This enzyme is encoded by maiA in Pseudomonas aeruginosa Fernandez Canon and Penalva, J. Biol. Chem. 273:329-337 (1998)) and I0133) Lysine 2,3-aminomutase (EC 5.4.3.2) converts Vibrio cholera (Seltzer, S., J. Biol. Chem. 248:215-222 lysine to (3S)-3,6-diaminohexanoate (FIG. 5, Step E), shift (1973)). A similar enzyme was identified by sequence homol ing an amine group from the 2- to the 3-position. The enzyme ogy in E. coli O157. Genbank information related to these is found in bacteria that ferment lysine to acetate and butyrate, genes is summarized in Table 45 below. including as Fusobacterium nuleatum (kamA) (Barker et al., J. Bacteriol. 152:201-207 (1982)) and Clostridium subtermi male (kamA) (Chirpich et al., J. Biol. Chem. 245:1778-1789 TABLE 45 (1970)). The enzyme from Clostridium subterminale has Gene GI fi Accession No. Organism been crystallized (Lepore et al., Proc. Natl. Acad. Sci. U.S.A. 102: 13819-13824 (2005)). An enzyme encoding this function maiA 155972O3 NP 250697 Pseudomonas aeruginosa maiA 1S641359 NP 230991 Vibrio choierae is also encoded by yodO in Bacillus subtilus (Chen et al., maiA 189355.347 EDUT3766 Escherichia coli O157 Biochem. J. 348 Pt 3:539-549 (2000)). The enzyme utilizes pyridoxal 5'-phosphate as a cofactor, requires activation by S-Adenosylmethoionine, and is stereoselective, reacting with US 2011/O124911 A1 May 26, 2011 20 the only with L-lysine. Genbank information related to these globus fulgidus, encoded by AF1211, was shown to operate genes is summarized in Table 48 below. on a variety of linear and branched-chain Substrates including isobutyrate, isopentanoate, and fumarate (Musfeldt and TABLE 48 Schonheit, J. Bacteriol. 184:636-644 (2002)). A second reversible ACD in Archaeoglobus fiulgidus, encoded by Gene GI fi Accession No. Organism AF1983, was also shown to have a broad substrate range with yodO 4033499 O34676.1 Bacilius Subiiius high activity on cyclic compounds phenylacetate and kamA 75423266 Q9XBQ8.1 Cliostridium subterminaie indoleacetate (Musfeldt and Shonheit, supra). The enzyme kamA 81485301 Q8RHX4 Fusobacterium nuleatin Subsp. from Haloarcula marismortui (annotated as a Succinyl-CoA nuleatin synthetase) accepts propionate, butyrate, and branched-chain acids (isovalerate and isobutyrate) as Substrates, and was 0134. In Step H of FIG. 2, the ring opening reaction of shown to operate in the forward and reverse directions (Bra muconolactone to form muconate is catalyzed by muconate sen and Schonheit, Arch. Microbiol. 182:277-287 (2004)). cycloisomerase (EC 5.5.1.1). Muconate cycloisomerase The ACD encoded by PAE3250 from hyperthermophilic cre narchaeon Pyrobaculum aerophilum showed the broadest naturally converts cis,cis-muconate to muconolactone in the Substrate range of all characterized ACDS, reacting with catechol branch of the B-ketoadipate pathway to degrade acetyl-CoA, isobutyryl-CoA (preferred substrate) and pheny aromatic compounds. This enzyme has not been shown to lacetyl-CoA (Brasen and Schonheit, supra). Directed evolu react with the trans,trans isomer. The muconate cycloi tion or engineering can be used to modify this enzyme to somerase reaction is reversible and is encoded by the cat3 operate at the physiological temperature of the host organism. gene. The Pseudomonas putida catE gene was cloned and The enzymes from A. fulgidus, H. marismortui and P. aero sequenced (Aldrich et al., Gene 52:185-195 (1987)), the catb philum have all been cloned, functionally expressed, and gene product was studied (Neidhart et al., Nature 347:692 characterized in E. coli (Brasen and Shonheit, supra; Mus 694 (1990)) and its crystal structures were resolved (Helinet feldt and Schonheit, Supra). An additional enzyme is encoded al., J. Mol. Biol. 254:918-941 (1995)). A DNA fragment by sucCD in E. coli, which naturally catalyzes the formation carrying the cat3CDE genes from Acinetobacter calcoaceti of Succinyl-CoA from Succinate with the concomitant con cus was isolated by complementing Pputida mutants and the sumption of one ATP, a reaction which is reversible in vivo complemented activities were expressed constitutively in the (Bucket al., Biochemistry 24:6245-6252 (1985)). Genbank recombinant P. putida strains (Shanley et al., J. Bacteriol. information related to these genes is summarized in Table 50 165:557-563 (1986)). The A. calcoaceticus catbCDE genes below. were also expressed at high levels in Escherichia coli under the control of a lac promoter (Shanley et al., Supra). The Rhodococcus sp. AN-22 CatB was purified to homogeneity TABLE 50 and characterized as a monomer with a molecular mass of 44 Gene GI fi Accession No. Organism kDa. The enzyme was activated by Mn", Co" and Mg." AF1211 11498.810 NP 070039.1 Archaeoglobits filgidus (Matsumura et al., Biochem.J. 393:219-226 (2006)). Mucon DSM 4304 ate cycloisomerases from other species. Such as Rhodococcus AF1983 1149956S NP 070807.1 Archaeoglobits filgidus rhodochrous N75, Frateuria species ANA-18, and Trichos DSM 4304 SCS 5537-7722 YP 135572.1 Haioarctia marismortui poron cutaneum were also purified and studied (Cha and PAE32SO 18313937 NP 560604.1 Pyrobaculum aerophilum Bruce, FEMS Microbiol. Lett. 224:29-34 2003); Mazuret al., Str. IM2 Biochemistry 33:1961-1970 (1994); Murakami et al., Biosci SucC 16128.703 NP 415256.1 Escherichia coi Biotechnol. Biochem. 62:1129-1133 (1998)). Genbank infor SucD 1786,949 AAC738231 Escherichia coi mation related to these genes is summarized in Table 49 below. 0.136 Another enzyme for this step is 6-carboxyhex anoate-CoA ligase, also known as pimeloyl-CoA ligase (EC TABLE 49 6.2.1.14), which naturally activates pimelate to pimeloyl Gene GI fi Accession No. Organism CoA during biotin biosynthesis in gram-positive bacteria. The enzyme from Pseudomonas mendocina, cloned into E. catB P08310 115713 Pseudomonas puttida catB Q43931 51704317 Acinetobacter Caicoaceticus coli, was shown to accept the alternate Substrates hexanedio catB Q3LHT2 122612793 Rhodococcus sp. AN-22 ate and nonanedioate (Binieda etal, Biochem.J. 340 Pt3:793 catB Q979Y1 75424O20 Frateuria species ANA-18 801 (1999)). Other enzymes are found in Bacillus subtilis catB P46057 1170967 Trichosporon cutaneum (Bower et al., J. Bacteriol. 178:4122-4130 (1996)) and Lysinibacillus sphaericus (formerly Bacillus sphaericus) 0135 The conversion of beta-ketoadipyl-CoA to beta-ke (Ploux et al., Biochem. J. 287 Pt3:685-690 (1992)). Genbank toadipate (FIG. 2, Step B) and 2,3-dehydroadipyl-CoA to information related to these genes is summarized in Table 51 2,3-dehydroadipate (FIG. 2, Step M and FIG. 4, Step H) can below. be catalyzed by a CoA acid-thiol ligase or CoA synthetase in the 6.2.1 family of enzymes. Enzymes catalyzing these exact TABLE 51 transformations have not been characterized to date; however, Gene GI fi Accession No. Organism several enzymes with broad substrate specificities have been pauA 15596.214 NP 249708.1 Pseudomonas mendocina described in the literature. ADP-forming acetyl-CoA syn bioW SO812281 NP 390902.2 Bacilius subtiis thetase (ACD, EC 6.2.1.13) is an enzyme that couples the bioW 115O12 P22822.1 Lysinibacilius sphaericits conversion of acyl-CoA esters to their corresponding acids with the concomitant synthesis of ATP ACDI from Archaeo US 2011/O124911 A1 May 26, 2011

0.137 Additional CoA-ligases include the rat dicarboxy cisoid conformation for the reaction to proceed. A wide vari late-CoA ligase for which the sequence is yet uncharacterized ety of Substituted conjugated dienes and dienophiles are able (Vamecq et al., Biochem. J. 230:683-693 (1985)), either of the to undergo this chemistry. two characterized phenylacetate-CoA ligases from P 0.141. In the disclosed reaction of FIG. 1, muconate is the chrysogenium (Lamas-Maceiras et al., Biochem. J. 395:147 conjugated diene, and is beneficially in the trans,trans or 155 (2006); Wang et al., Biochem. Biophys. Res. Commun. cis, trans isomeric configuration for the reaction to proceed. 360:453-458 (2007)) and the phenylacetate-CoA ligase from The cis, cis isomer of muconate, prevalent in biological sys Pseudomonas putida (Martinez-Blanco et al., J. Biol. Chem. tems as a degradation product of catechol, is unlikely to adopt 265:7084-7090 (1990)). Acetoacetyl-CoA synthetases from the required cisoid conformation due to steric hindrance of Mus musculus (Hasegawa et al., Biochim. Biophys. Acta the carboxylic acid groups. The trans,trans isomer of mucon 1779:414-419 (2008)) and Homo sapiens (Ohgami et al., ate (shown in FIG. 1) is able to react in Diels-Alder reactions with a variety of dienes (Deno, N. C. J. Am. Chem. Soc. Biochem. Pharmacol. 65:989-994 (2003)) naturally catalyze 72:4057-4059 (1950); Sauer, J., Angewandte Chemie 6:16-33 the ATP-dependant conversion of acetoacetate into (1967)). acetoacetyl-CoA. Genbank information related to these 0142. Acetylene serves as the dienophile in the production genes is summarized in Table 52 below. of PTA. Acetylene and substituted acetylene derivatives are well-known dienophiles ((Carruthers, W. Some Modern TABLE 52 Methods of Organic Synthesis, Cambridge University Press Gene GI fi Accession No. Organism (1986); U.S. Pat. No. 3.513,209, Clement, R. A.; Dai et al., J. Am. Chem. Soc. 129:645-657 (2007)). The addition of elec phl 77O19264 CAT15517.1 Penicilium chrysogenium phlB 1520O2983 ABS19624.1 Penicilium chrysogenium tron-withdrawing Substituents increases reactivity in normal paaF 22711873 AAC24333.2 Pseudomonas puttida mode Diels Alder reactions; likewise, in the inverse electron AACS 21313520 NP 084486.1 Mits musculus demand, electron donating groups are employed to increase AACS 3.198.2927 NP O76417.2 Homo sapiens reactivity. At elevated temperatures, unsubstituted acetylene has been shown to react with butadiene and other substituted linear and cyclic dienes (U.S. Pat. No. 3.513,209, Clement, R. 0.138. In some embodiments, the present invention pro A.; Norton, J., Chem. Review 31:319-523 (1942); Vijaya et vides a semi-synthetic method for synthesizing terephthalate al., J. Mol. Struct. 589-590:291-299 (2002)). (PTA) that includes preparing muconic acid by culturing the 0.143 Increased temperature can be used to perform the above-described organisms, reacting the resultant muconic Diels-Alder reaction in FIG. 1. For example, the Diels-Alder acid with acetylene to form a cyclohexadiene adduct (P1, reaction of acetylene with 1,3-butadiene to form 1,4-cyclo FIG. 1), and oxidizing the cyclohexadiene adduct to form hexadiene is performed in the range of 80-300° C. (U.S. Pat. PTA. Semi-synthetic methods combine the biosynthetic No. 3.513,209, Clement, R. A. supra). preparation of advanced intermediates with conventional 0144. Other reaction conditions that have been shown to organic chemical reactions. enhance the rate of Diels-Alder reactions include elevated 0139 While the culturing of muconic acid is discussed pressure, the addition of a Lewis acid, and stoichiometric further below, the Diels-Alder reaction conditions are excess of acetylene. Elevated pressure up to 1000 atmo detailed here. Diels-Alder reactions are widespread in the spheres was shown to enhance the rate of 1,4-cyclohexadiene chemical industry and are known to those skilled in the art formation from butadiene and acetylene (U.S. Pat. No. 3.513, (Carruthers, W., Some Modern Methods of Organic Synthe 209, Clement, R. A.). Catalytic amounts of Lewis acids can sis, Cambridge University Press (1986); Norton, J., Chem. also improve reaction rate (Nicolaou et al., Angewandte Che Review 31:319-523 (1942); Sauer, J., Angewandte Chemie mie 41:1668-1698 (2002)). Some suitable Lewis acids 6:16-33 (1967)). This class of pericyclic reactions is well include magnesium halides such as magnesium chloride, studied for its ability to generate cyclic compounds at low magnesium bromide or magnesium iodide or Zinc halides energetic cost. Diels-Alder reactions are thus an attractive and such as zinc chloride, zinc bromide or zinc iodide. Stoichio low-cost way of making a variety of pharmaceuticals and metric excess of acetylene will aid in reducing formation of natural products. homopolymerization byproducts. 0140. In a Diels-Alder reaction, a conjugated diene or 0145. Oxidation of the Diels-Alder product, cyclohexa-2, heterodiene reacts with an alkene, alkyne, or other unsatur 5-diene-1,4-dicarboxylate (P1), to PTA can be accomplished ated functional group, known as a dienophile, to form a six in the presence or absence of catalyst under mild reaction membered ring. One aspect of the Diels-Alder reaction is that conditions. The driving force for P1 oxidation is the forma the two components usually have complementary electronic tion of the aromatic ring of PTA. Precedence for the conver character, as determined by the energies of the highest occu sion of P1 to PTA in the absence of catalyst is the conversion pied molecular orbital (HOMO) and lowest unoccupied of 1,4-cyclohexadiene to benzene in air (U.S. Pat. No. 3.513, molecular orbital (LUMO) of the diene and dienophile (Car 209, Clement, R.A.). 1,4-Cyclohexadiene is also converted to ruthers, W., Some Modern Methods of Organic Synthesis, benzene by catalysis, for example using transition metalcom Cambridge University Press (1986). In normal mode, the plexes such as bis(arene)molybdenum(0) and bis(arene)chro diene is electron-rich and the dienophile is electron-poor, mium(0) (Fochi, G., Organometallics 7:225-2256 (1988)) or although this is not always the case. The method of the present electroactive binuclear rhodium complexes (Smith and Gray, invention provides the opposite electronic configuration with Catalysis Letters 6:195-199 (1990)). an electron poor diene and a relatively electron rich dieno 0146 In some embodiments, the method for synthesizing phile, in what is termed an inverse electron demand Diels PTA includes isolating muconic acid from the culture broth Alder reaction. The main physical constraint for this type of prior to reacting with acetylene in the Diels-Alder reaction. reaction is that the conjugated diene must be able to adopt a This is particularly helpful since the Diels-Alder reaction, is US 2011/O124911 A1 May 26, 2011 22 frequently done in the absence of a solvent, especially under the selected host microbial organism. Therefore, a non-natu thermal conditions. Isolation of muconic acid can involve rally occurring microbial organism of the invention can have various filtration and centrifugation techniques. Cells of the one, two, three, four, six, etc. up to all nucleic acids encoding culture and other insoluble materials can be filtered via ultra the enzymes or proteins constituting a muconate biosynthetic filtration and certain salts can be removed by nanofiltration. pathway disclosed herein. In some embodiments, the non Because muconic acid is a diacid, standard extraction tech naturally occurring microbial organisms also can include niques can be employed that involve adjusting the pH. After other genetic modifications that facilitate or optimize mucon removal of Substantially all solids and salts, the muconic acid ate biosynthesis or that confer other useful functions onto the can be separated from water by removal of water with heating host microbial organism. One such other functionality can in vacuo, or by extraction at low pH. For example, following include, for example, augmentation of the synthesis of one or the addition of sulfuric acid orphosphoric acid to the fermen more of the muconate pathway precursors such as Succinyl tation broth in sufficient amounts (pH 3 or lower), the free CoA carboxylate acid form of muconic acid precipitates out of 0151. Generally, a host microbial organism is selected solution (U.S. Pat. No. 4,608.338). In this form, muconic acid Such that it produces the precursor of a muconate pathway, is readily separated from the aqueous solution by filtration or either as a naturally produced molecule or as an engineered other conventional means. product that either provides de novo production of a desired 0147 In some embodiments, the muconic acid need not be precursor or increased production of a precursor naturally isolated. Instead, the Diels-Alder reaction between muconic produced by the host microbial organism. For example, Suc acid and acetylene can be performed in the culture broth. In cinyl-CoA is produced naturally in a host organism such as E. such a case, the culture broth can be optionally filtered prior coli. A host organism can be engineered to increase produc to adding acetylene. tion of a precursor, as disclosed herein. In addition, a micro 0148. The non-naturally occurring microbial organisms of bial organism that has been engineered to produce a desired the invention can be produced by introducing expressible precursor can be used as a host organism and further engi nucleic acids encoding one or more of the enzymes or pro neered to express enzymes or proteins of a muconate path teins participating in one or more muconate biosynthetic way. pathways. Depending on the host microbial organism chosen 0152. In some embodiments, a non-naturally occurring for biosynthesis, nucleic acids for some or all of a particular microbial organism of the invention is generated from a host muconate biosynthetic pathway can be expressed. For that contains the enzymatic capability to synthesize mucon example, if a chosen host is deficient in one or more enzymes ate. In this specific embodiment it can be useful to increase the or proteins for a desired biosynthetic pathway, then express synthesis or accumulation of a muconate pathway product to, ible nucleic acids for the deficient enzyme(s) or protein(s) are for example, drive muconate pathway reactions toward introduced into the host for Subsequent exogenous expres muconate production. Increased synthesis or accumulation Sion. Alternatively, if the chosen host exhibits endogenous can be accomplished by, for example, overexpression of expression of Some pathway genes, but is deficient in others, nucleic acids encoding one or more of the above-described then an encoding nucleic acid is needed for the deficient muconate pathway enzymes or proteins. Overexpression of enzyme(s) or protein(s) to achieve muconate biosynthesis. the enzyme or enzymes and/or protein or proteins of the Thus, a non-naturally occurring microbial organism of the muconate pathway can occur, for example, through exog invention can be produced by introducing exogenous enzyme enous expression of the endogenous gene or genes, or through or protein activities to obtain a desired biosynthetic pathway exogenous expression of the heterologous gene or genes. or a desired biosynthetic pathway can be obtained by intro Therefore, naturally occurring organisms can be readily gen ducing one or more exogenous enzyme or protein activities erated to be non-naturally occurring microbial organisms of that, together with one or more endogenous enzymes or pro the invention, for example, producing muconate, through teins, produces a desired product such as muconate. overexpression of one, two, three, four, five, six, that is, up to 0149. Depending on the muconate biosynthetic pathway all nucleic acids encoding muconate biosynthetic pathway constituents of a selected host microbial organism, the non enzymes or proteins. In addition, a non-naturally occurring naturally occurring microbial organisms of the invention will organism can be generated by mutagenesis of an endogenous include at least one exogenously expressed muconate path gene that results in an increase in activity of an enzyme in the way-encoding nucleic acid and up to all encoding nucleic muconate biosynthetic pathway. acids for one or more muconate biosynthetic pathways. For 0153. In particularly useful embodiments, exogenous example, muconate biosynthesis can be established in a host expression of the encoding nucleic acids is employed. Exog deficient in a pathway enzyme or protein through exogenous enous expression confers the ability to custom tailor the expression of the corresponding encoding nucleic acid. In a expression and/or regulatory elements to the host and appli host deficient in all enzymes or proteins of a muconate path cation to achieve a desired expression level that is controlled way, exogenous expression of all enzyme or proteins in the by the user. However, endogenous expression also can be pathway can be included, although it is understood that all utilized in other embodiments such as by removing a negative enzymes or proteins of a pathway can be expressed even if the regulatory effector or induction of the gene's promoter when host contains at least one of the pathway enzymes or proteins. linked to an inducible promoter or other regulatory element. For example, exogenous expression of all enzymes or pro Thus, an endogenous gene having a naturally occurring teins in a pathway for production of muconate can be inducible promoter can be up-regulated by providing the included, such as those shown in FIGS. 2-5. appropriate inducing agent, or the regulatory region of an 0150. Given the teachings and guidance provided herein, endogenous gene can be engineered to incorporate an induc those skilled in the art will understand that the number of ible regulatory element, thereby allowing the regulation of encoding nucleic acids to introduce in an expressible form increased expression of an endogenous gene at a desired time. will, at least, parallel the muconate pathway deficiencies of Similarly, an inducible promoter can be included as a regula US 2011/O124911 A1 May 26, 2011 tory element for an exogenous gene introduced into a non thetic pathways for conversion of one pathway intermediate naturally occurring microbial organism. to another pathway intermediate or the product. Alternatively, 0154 It is understood that, in methods of the invention, muconate also can be biosynthetically produced from micro any of the one or more exogenous nucleic acids can be intro bial organisms through co-culture or co-fermentation using duced into a microbial organism to produce a non-naturally two organisms in the same vessel, where the first microbial occurring microbial organism of the invention. The nucleic organism produces a muconate intermediate and the second acids can be introduced so as to confer, for example, a mucon microbial organism converts the intermediate to muconate. ate biosynthetic pathway onto the microbial organism. Alter 0157 Given the teachings and guidance provided herein, natively, encoding nucleic acids can be introduced to produce those skilled in the art will understand that a wide variety of an intermediate microbial organism having the biosynthetic combinations and permutations exist for the non-naturally capability to catalyze some of the required reactions to confer occurring microbial organisms and methods of the invention muconate biosynthetic capability. For example, a non-natu together with other microbial organisms, with the co-culture rally occurring microbial organism having a muconate bio of other non-naturally occurring microbial organisms having synthetic pathway can comprise at least two exogenous Subpathways and with combinations of other chemical and/or nucleic acids encoding desired enzymes or proteins. Thus, it biochemical procedures well known in the art to produce is understood that any combination of two or more enzymes muCOnate. or proteins of a biosynthetic pathway can be included in a 0158 Sources of encoding nucleic acids for a muconate non-naturally occurring microbial organism of the invention. pathway enzyme or protein can include, for example, any Similarly, it is understood that any combination of three or species where the encoded gene product is capable of cata more enzymes or proteins of a biosynthetic pathway can be lyzing the referenced reaction. Such species include both included in a non-naturally occurring microbial organism of prokaryotic and eukaryotic organisms including, but not lim the invention and so forth, as desired. So long as the combi ited to, bacteria, including archaea and eubacteria, and nation of enzymes and/or proteins of the desired biosynthetic eukaryotes, including yeast, plant, insect, animal, and mam pathway results in production of the corresponding desired mal, including human. Exemplary species for Such sources product. Similarly, any combination of four, or more enzymes include, for example, Escherichia coli, as well as other exem or proteins of a biosynthetic pathway as disclosed herein can plary species disclosed herein or available as source organ be included in a non-naturally occurring microbial organism isms for corresponding genes. However, with the complete of the invention, as desired, so long as the combination of genome sequence available for now more than 550 species enzymes and/or proteins of the desired biosynthetic pathway (with more than half of these available on public databases results in production of the corresponding desired product. Such as the NCBI), including 395 microorganism genomes 0155. In addition to the biosynthesis of muconate as and a variety of yeast, fungi, plant, and mammalian genomes, described herein, the non-naturally occurring microbial the identification of genes encoding the requisite muconate organisms and methods of the invention also can be utilized in biosynthetic activity for one or more genes in related or various combinations with each other and with other micro distant species, including for example, homologues, bial organisms and methods well known in the art to achieve orthologs, paralogs and nonorthologous gene displacements product biosynthesis by other routes. For example, one alter of known genes, and the interchange of genetic alterations native to produce muconate other than use of the muconate between organisms is routine and well known in the art. producers is through addition of another microbial organism Accordingly, the metabolic alterations enabling biosynthesis capable of converting a muconate pathway intermediate to of muconate described herein with reference to a particular muconate. One Such procedure includes, for example, the organism Such as E. coli can be readily applied to other fermentation of a microbial organism that produces a mucon microorganisms, including prokaryotic and eukaryotic ate pathway intermediate. The muconate pathway intermedi organisms alike. Given the teachings and guidance provided ate can then be used as a Substrate for a second microbial herein, those skilled in the art will know that a metabolic organism that converts the muconate pathway intermediate to alteration exemplified in one organism can be applied equally muconate. The muconate pathway intermediate can be added to other organisms. directly to another culture of the second organism or the 0159. In some instances, such as when an alternative original culture of the muconate pathway intermediate pro muconate biosynthetic pathway exists in an unrelated spe ducers can be depleted of these microbial organisms by, for cies, muconate biosynthesis can be conferred onto the host example, cell separation, and then Subsequent addition of the species by, for example, exogenous expression of aparalog or second organism to the fermentation broth can be utilized to paralogs from the unrelated species that catalyzes a similar, produce the final product without intermediate purification yet non-identical metabolic reaction to replace the referenced steps. reaction. Because certain differences among metabolic net 0156. In other embodiments, the non-naturally occurring works exist between different organisms, those skilled in the microbial organisms and methods of the invention can be art will understand that the actual gene usage between differ assembled in a wide variety of subpathways to achieve bio ent organisms may differ. However, given the teachings and synthesis of for example, muconate. In these embodiments, guidance provided herein, those skilled in the art also will biosynthetic pathways for a desired product of the invention understand that the teachings and methods of the invention can be segregated into different microbial organisms, and the can be applied to all microbial organisms using the cognate different microbial organisms can be co-cultured to produce metabolic alterations to those exemplified herein to construct the final product. In Such a biosynthetic scheme, the product a microbial organism in a species of interest that will synthe of one microbial organism is the Substrate for a second micro size muconate. bial organism until the final product is synthesized. For 0160 Host microbial organisms can be selected from, and example, the biosynthesis of muconate can be accomplished the non-naturally occurring microbial organisms generated by constructing a microbial organism that contains biosyn in, for example, bacteria, yeast, fungus or any of a variety of US 2011/O124911 A1 May 26, 2011 24 other microorganisms applicable to fermentation processes. included that, for example, provide resistance to antibiotics or Exemplary bacteria include species selected from Escheri toxins, complement auxotrophic deficiencies, or Supply criti chia coli, Klebsiella Oxytoca, Anaerobiospirillum suc cal nutrients not in the culture media. Expression control ciniciproducens, Actinobacillus succinogenes, Mannheimia sequences can include constitutive and inducible promoters, succiniciproducens, Rhizobium etli, Bacillus subtilis, transcription enhancers, transcription terminators, and the Corynebacterium glutamicum, Gluconobacter Oxydans, like which are well known in the art. When two or more Zymomonas mobilis, Lactococcus lactis, Lactobacillus plan exogenous encoding nucleic acids are to be co-expressed, tarum, Streptomyces coelicolor, Clostridium acetobutylicum, both nucleic acids can be inserted, for example, into a single Pseudomonas fluorescens, and Pseudomonas putida. Exem expression vector or in separate expression vectors. For single plary yeasts or fungi include species selected from Saccha romyces cerevisiae, Schizosaccharomyces pombe, Kluyvero vector expression, the encoding nucleic acids can be opera myces lactis, Kluyveromyces marxianus, Aspergillus terreus, tionally linked to one common expression control sequence Aspergillus niger and Pichia pastoris. E. coli is a particularly or linked to different expression control sequences, such as useful host organisms since it is a well characterized micro one inducible promoter and one constitutive promoter. The bial organism Suitable for genetic engineering. Other particu transformation of exogenous nucleic acid sequences involved larly useful host organisms include yeast Such as Saccharo in a metabolic or synthetic pathway can be confirmed using myces cerevisiae. methods well known in the art. Such methods include, for 0161 Methods for constructing and testing the expression example, nucleic acid analysis Such as Northern blots or levels of a non-naturally occurring muconate-producing host polymerase chain reaction (PCR) amplification of mRNA, or can be performed, for example, by recombinant and detection immunoblotting for expression of gene products, or other methods well known in the art. Such methods can be found Suitable analytical methods to test the expression of an intro described in, for example, Sambrook et al., Molecular Clon duced nucleic acid sequence or its corresponding gene prod ing: A Laboratory Manual. Third Ed., Cold Spring Harbor uct. It is understood by those skilled in the art that the exog Laboratory, New York (2001); and Ausubel et al., Current enous nucleic acid is expressed in a Sufficient amount to Protocols in Molecular Biology, John Wiley and Sons, Bal produce the desired product, and it is further understood that timore, Md. (1999). expression levels can be optimized to obtain Sufficient expres 0162 Exogenous nucleic acid sequences involved in a sion using methods well known in the art and as disclosed pathway for production of muconate can be introduced stably herein. or transiently into a host cell using techniques well known in (0164 Directed evolution is a powerful approach that the art including, but not limited to, conjugation, electropo involves the introduction of mutations targeted to a specific ration, chemical transformation, transduction, transfection, gene in order to improve and/or alter the properties of an and ultrasound transformation. For exogenous expression in enzyme. Improved and/or altered enzymes can be identified E. coli or other prokaryotic cells, some nucleic acid through the development and implementation of sensitive sequences in the genes or cDNAs of eukaryotic nucleic acids high-throughput Screening assays that allow the automated can encode targeting signals such as an N-terminal mitochon screening of many enzyme variants (e.g., >10). Iterative drial or other targeting signal, which can be removed before rounds of mutagenesis and Screening typically are performed transformation into prokaryotic host cells, if desired. For to afford an enzyme with optimized properties. Computa example, removal of a mitochondrial leader sequence led to tional algorithms that can help to identify areas of the gene for increased expression in E. coli (Hoffmeister et al., J. Biol. mutagenesis also have been developed and can significantly Chem. 280:4329-4338 (2005)). For exogenous expression in reduce the number of enzyme variants that need to be gener yeast or other eukaryotic cells, genes can be expressed in the ated and screened. cytosol without the addition of leader sequence, or can be 0.165 Numerous directed evolution technologies have targeted to mitochondrion or other organelles, or targeted for been developed (for reviews, see Hibbert et al., Biomol. Eng secretion, by the addition of a Suitable targeting sequence 22:11-19 (2005); Huisman and Lalonde. In Biocatalysis in Such as a mitochondrial targeting or secretion signal Suitable the pharmaceutical and biotechnology industries pg.S. 717 for the host cells. Thus, it is understood that appropriate 742 (2007), Patel (ed.), CRC Press: Otten and Quax, Biomol. modifications to a nucleic acid sequence to remove or include Eng 22:1-9 (2005); and Sen et al., Appl Biochem. Biotechnol a targeting sequence can be incorporated into an exogenous 143:212-223 (2007)) to be effective at creating diverse vari nucleic acid sequence to impart desirable properties. Further ant libraries and these methods have been successfully more, genes can be subjected to codon optimization with applied to the improvement of a wide range of properties techniques well known in the art to achieve optimized expres across many enzyme classes. sion of the proteins. 0166 Enzyme characteristics that have been improved 0163 An expression vector or vectors can be constructed and/or altered by directed evolution technologies include, for to include one or more muconate biosynthetic pathway example, selectivity/specificity—for conversion of non-natu encoding nucleic acids as exemplified herein operably linked ral substrates; temperature stability—for robust high tem to expression control sequences functional in the host organ perature processing; pH stability—for bioprocessing under ism. Expression vectors applicable for use in the microbial lower or higher pH conditions; substrate or product toler host organisms of the invention include, for example, plas ance—so that high product titers can be achieved; binding mids, phage vectors, viral vectors, episomes and artificial (K)—broadens Substrate binding to include non-natural chromosomes, including vectors and selection sequences or substrates; inhibition(K) to remove inhibition by products, markers operable for stable integration into a host chromo Substrates, or key intermediates; activity (kcat)—increases some. Additionally, the expression vectors can include one or enzymatic reaction rates to achieve desired flux; expression more selectable marker genes and appropriate expression levels—increases protein yields and overall pathway flux: control sequences. Selectable marker genes also can be oxygen Stability—for operation of air sensitive enzymes US 2011/O124911 A1 May 26, 2011

under aerobic conditions; and anaerobic activity—for opera (Shao et al., Nucleic Acids Res 26:681-683 (1998)) Base tion of an aerobic enzyme in the absence of oxygen. misincorporation and mispriming via epPCR give point 0167. The following exemplary methods have been devel mutations. Short DNA fragments prime one another based on oped for the mutagenesis and diversification of genes to target homology and are recombined and reassembled into full desired properties of specific enzymes. Any of these can be length by repeated thermocycling. Removal of templates used to alter/optimize activity of a decarboxylase enzyme. prior to this step assures low parental recombinants. This (0168 EpPCR (Pritchard et al., J Theor: Biol 234:497-509 method, like most others, can be performed over multiple (2005)) introduces random point mutations by reducing the iterations to evolve distinct properties. This technology fidelity of DNA polymerase in PCR reactions by the addition avoids sequence bias, is independent of gene length, and of Mn" ions, by biasing dNTP concentrations, or by other requires very little parent DNA for the application. conditional variations. The five step cloning process to con 0173. In Heteroduplex Recombination linearized plasmid fine the mutagenesis to the target gene of interest involves: 1) DNA is used to form heteroduplexes that are repaired by error-prone PCR amplification of the gene of interest; 2) mismatch repair. (Volkov et al. Nucleic Acids Res 27:e 18 restriction enzyme digestion; 3) gel purification of the desired (1999); and Volkov et al., Methods Enzymol. 328:456-463 DNA fragment; 4) ligation into a vector; 5) transformation of (2000)) The mismatch repair step is at least somewhat the gene variants into a suitable host and Screening of the mutagenic. Heteroduplexes transform more efficiently than library for improved performance. This method can generate linear homoduplexes. This method is Suitable for large genes multiple mutations in a single gene simultaneously, which and whole operons. can be useful. A high number of mutants can be generated by 0.174 Random Chimeragenesis on Transient Templates EpPCR, so a high-throughput screening assay or a selection (RACHITT) (Coco et al., Nat. Biotechnol 19:354-359 method (especially using robotics) is useful to identify those (2001)) employs Dnase I fragmentation and size fractionation with desirable characteristics. of ssDNA. Homologous fragments are hybridized in the 0169 Error-prone Rolling Circle Amplification (epRCA) absence of polymerase to a complementary ssDNA scaffold. (Fujii et al., Nucleic Acids Res 32:e 145 (2004); and Fujii et al., Any overlapping unhybridized fragment ends are trimmed Nat. Protoc. 1:2493-2497 (2006)) has many of the same ele down by an exonuclease. Gaps between fragments are filled ments as epPCR excepta whole circular plasmid is used as the in, and then ligated to give a pool of full-length diverse Strands template and random 6-mers with exonuclease resistant thio hybridized to the scaffold (that contains U to preclude ampli phosphate linkages on the last 2 nucleotides are used to fication). The scaffold then is destroyed and is replaced by a amplify the plasmid followed by transformation into cells in new strand complementary to the diverse strand by PCR which the plasmid is re-circularized at tandem repeats. amplification. The method involves one strand (scaffold) that Adjusting the Mn" concentration can vary the mutation rate is from only one parent while the priming fragments derive Somewhat. This technique uses a simple error-prone, single from other genes; the parent Scaffold is selected against. step method to create a full copy of the plasmid with 3-4 Thus, no reannealing with parental fragments occurs. Over mutations/kbp. No restriction enzyme digestion or specific lapping fragments are trimmed with an exonuclease. Other primers are required. Additionally, this method is typically wise, this is conceptually similar to DNA shuffling and StEP. available as a kit. Therefore, there should be no siblings, few inactives, and no (0170 DNA or Family Shuffling (Stemmer, Proc. Natl. unshuffled parentals. This technique has advantages in that Acad. Sci. U.S.A. 91:10747-10751 (1994); and Stemmer, few or no parental genes are created and many more cross Nature 370:389-391 (1994)) typically involves digestion of overs can result relative to standard DNA shuffling. two or more variant genes with nucleases such as Dnase I or 0.175 Recombined Extension on Truncated templates EndoW to generate a pool of random fragments that are reas (RETT) entails template switching of unidirectionally grow sembled by cycles of annealing and extension in the presence ing Strands from primers in the presence of unidirectional of DNA polymerase to create a library of chimeric genes. SSDNA fragments used as a pool of templates. (Lee et al., J. Fragments prime each other and recombination occurs when Molec. Catalysis 26:119-129 (2003)) No DNA endonu one copy primes another copy (template Switch). This method cleases are used. Unidirectional ssDNA is made by DNA can be used with > 1 kbp DNA sequences. In addition to polymerase with random primers or serial deletion with exo mutational recombinants created by fragment reassembly, nuclease. Unidirectional ssDNA are only templates and not this method introduces point mutations in the extension steps primers. Random priming and exonucleases don't introduce at a rate similar to error-prone PCR. The method can be used sequence bias as true of enzymatic cleavage of DNA shuf to remove deleterious, random and neutral mutations that fling/RACHITT. RETT can be easier to optimize than StEP might confer antigenicity. because it uses normal PCR conditions instead of very short 0171 Staggered Extension (StEP) (Zhao et al., Nat. Bio extensions. Recombination occurs as a component of the technol 16:258-261 (1998)) entails template priming fol PCR steps—no direct shuffling. This method can also be lowed by repeated cycles of 2 step PCR with denaturation and more random than StEP due to the absence of pauses. very short duration of annealing/extension (as short as 5 sec). 0176). In Degenerate Oligonucleotide Gene Shuffling Growing fragments anneal to different templates and extend (DOGS) degenerate primers are used to control recombina further, which is repeated until full-length sequences are tion between molecules; (Bergquist and Gibbs, Methods Mol. made. Template Switching means most resulting fragments Biol. 352:191-204 (2007); Bergquist et al., Biomol. Eng have multiple parents. Combinations of low-fidelity poly 22:63-72 (2005); Gibbs et al., Gene 271:13-20 (2001)) this merases (Taq and Mutazyme) reduce error-prone biases can be used to control the tendency of other methods such as because of opposite mutational spectra. DNA shuffling to regenerate parental genes. This method can 0172. In Random Priming Recombination (RPR) random be combined with random mutagenesis (epPCR) of selected sequence primers are used to generate many short DNA frag gene segments. This can be a good method to block the ments complementary to different segments of the template. reformation of parental sequences. No endonucleases are US 2011/O124911 A1 May 26, 2011 26 needed. By adjusting input concentrations of segments made, it can be possible to generate a large library of mutants within one can bias towards a desired backbone. This method allows 2-3 days using simple methods. This technique is non-di DNA shuffling from unrelated parents without restriction rected in comparison to the mutational bias of DNA poly enzyme digests and allows a choice of random mutagenesis merases. Differences in this approach makes this technique methods. complementary (or an alternative) to epPCR. (0177 Incremental Truncation for the Creation of Hybrid 0182. In Synthetic Shuffling, overlapping oligonucle Enzymes (ITCHY) creates a combinatorial library with 1 otides are designed to encode "all genetic diversity in targets' base pair deletions of a gene or gene fragment of interest. and allow a very high diversity for the shuffled progeny. (Ness (Ostermeier et al., Proc. Natl. Acad. Sci. U.S.A. 96:3562-3567 et al., Nat. Biotechnol 20:1251-1255 (2002)) In this tech (1999); and Ostermeier et al., Nat. Biotechnol 17:1205-1209 nique, one can design the fragments to be shuffled. This aids (1999)) Truncations are introduced in opposite direction on in increasing the resulting diversity of the progeny. One can pieces of 2 different genes. These are ligated together and the design sequence?codon biases to make more distantly related fusions are cloned. This technique does not require homology sequences recombine at rates approaching those observed between the 2 parental genes. When ITCHY is combined with with more closely related sequences. Additionally, the tech DNA shuffling, the system is called SCRATCHY (see below). nique does not require physically possessing the template A major advantage of both is no need for homology between genes. parental genes; for example, functional fusions between an E. 0183 Nucleotide Exchange and Excision Technology coli and a human gene were created via ITCHY. When NexT exploits a combination of dUTP incorporation fol ITCHY libraries are made, all possible crossovers are cap lowed by treatment with uracil DNA glycosylase and then tured. piperidine to perform endpoint DNA fragmentation. (Muller 0178. Thio-Incremental Truncation for the Creation of et al., Nucleic Acids Res 33:e 117 (2005)) The gene is reas Hybrid Enzymes (THIO-ITCHY) is similar to ITCHY except sembled using internal PCR primer extension with proofread that phosphothioate dNTPs are used to generate truncations. ing polymerase. The sizes for shuffling are directly control (Lutz et al., Nucleic Acids Res 29:E16 (2001)) Relative to lable using varying dUPT::dTTP ratios. This is an end point ITCHY THIO-ITCHY can be easier to optimize, provide reaction using simple methods for uracil incorporation and more reproducibility, and adjustability. cleavage. Other nucleotide analogs, such as 8-oxo-guanine, 0179 SCRATCHY combines two methods for recombin can be used with this method. Additionally, the technique ing genes, ITCHY and DNA shuffling. (Lutz et al., Proc. Natl. works well with very short fragments (86 bp) and has a low Acad. Sci. U.S.A. 98: 11248-11253 (2001)) SCRATCHY error rate. The chemical cleavage of DNA used in this tech combines the best features of ITCHY and DNA shuffling. nique results in very few unshuffled clones. First, ITCHY is used to create a comprehensive set of fusions 0184. In Sequence Homology-Independent Protein between fragments of genes in a DNA homology-indepen Recombination (SHIPREC) a linker is used to facilitate dent fashion. This artificial family is then subjected to a fusion between two distantly/unrelated genes. Nuclease treat DNA-shuffling step to augment the number of crossovers. ment is used to generate a range of chimeras between the two Computational predictions can be used in optimization. genes. These fusions result in libraries of single-crossover SCRATCHY is more effective than DNA shuffling when hybrids. (Sieber et al., Nat. Biotechnol 19:456-460 (2001)) sequence identity is below 80%. This produces a limited type of shuffling and a separate pro 0180. In Random Drift Mutagenesis (RNDM) mutations cess is required for mutagenesis. In addition, since no homol made via epPCR followed by screening/selection for those ogy is needed this technique can create a library of chimeras retaining usable activity. (Bergquist et al., Biomol. Eng 22:63 with varying fractions of each of the two unrelated parent 72 (2005)) Then, these are used in DOGS to generate recom genes. SHIPREC was tested with a heme-binding domain of binants with fusions between multiple active mutants or a bacterial CP450 fused to N-terminal regions of a mamma between active mutants and some other desirable parent. lian CP450; this produced mammalian activity in a more Designed to promote isolation of neutral mutations; its pur soluble enzyme. pose is to screen for retained catalytic activity whether or not 0185. In Gene Site Saturation MutagenesisTM (GSSMTM) this activity is higher or lower than in the original gene. the starting materials are a Supercoiled dsDNA plasmid con RNDM is usable in high throughput assays when screening is taining an insert and two primers which are degenerate at the capable of detecting activity above background. RNDM has desired site of mutations. (Kretz et al., Methods Enzymol. been used as a front end to DOGS in generating diversity. The 388:3-11 (2004)) Primers carrying the mutation of interest, technique imposes a requirement for activity prior to shuf anneal to the same sequence on opposite strands of DNA. The fling or other subsequent steps; neutral drift libraries are mutation is typically in the middle of the primer and flanked indicated to result in higher/quicker improvements in activity on each side by ~20 nucleotides of correct sequence. The from smaller libraries. Though published using epPCR, this sequence in the primer is NNN or NNK (coding) and MNN could be applied to other large-scale mutagenesis methods. (noncoding) (N=all 4, K=G, T, MA, C). After extension, 0181 Sequence Saturation Mutagenesis (SeSaM) is a ran DpnI is used to digest dam-methylated DNA to eliminate the dom mutagenesis method that: 1) generates pool of random wild-type template. This technique explores all possible length fragments using random incorporation of a phospho amino acid substitutions at a given locus (i.e., one codon). The thioate nucleotide and cleavage; this pool is used as a template technique facilitates the generation of all possible replace to 2) extend in the presence of “universal bases such as ments at a single-site with no nonsense codons and results in inosine; 3) replication of a inosine-containing complement equal to near-equal representation of most possible alleles. gives random base incorporation and, consequently, This technique does not require prior knowledge of the struc mutagenesis. (Wong et al., Biotechnol J. 3:74-82 (2008); ture, mechanism, or domains of the target enzyme. If fol Wong et al., Nucleic Acids Res 32:e26 (2004); and Wong et lowed by shuffling or Gene Reassembly, this technology cre al., Anal. Biochem. 341:187-189 (2005)) Using this technique ates a diverse library of recombinants containing all possible US 2011/O124911 A1 May 26, 2011 27 combinations of single-site up-mutations. The utility of this specifically to increase the binding affinity and/or reduce technology combination has been demonstrated for the Suc dissociation. The technique can be combined with either cessful evolution of over 50 different enzymes, and also for screens or selections. more than one property in a given enzyme. 0.190 Gene Reassembly is a DNA shuffling method that 0186 Combinatorial Cassette Mutagenesis (CCM) can be applied to multiple genes at one time or to creating a large library of chimeras (multiple mutations) of a single involves the use of short oligonucleotide cassettes to replace gene. (Tunable GeneReassembly TM (TGRTM) Technology limited regions with a large number of possible amino acid supplied by Verenium Corporation) Typically this technology sequence alterations. (Reidhaar-Olson et al. Methods Enzy is used in combination with ultra-high-throughput Screening mol. 208:564-586 (1991); and Reidhaar-Olson et al. Science to query the represented sequence space for desired improve 241:53-57 (1988)) Simultaneous substitutions at two or three ments. This technique allows multiple gene recombination sites are possible using this technique. Additionally, the independent of homology. The exact number and position of method tests a large multiplicity of possible sequence cross-over events can be pre-determined using fragments changes at a limited range of sites. This technique has been designed via bioinformatic analysis. This technology leads to used to explore the information content of the lambda repres a very high level of diversity with virtually no parental gene sor DNA-binding domain. reformation and a low level of inactive genes. Combined with 0187 Combinatorial Multiple Cassette Mutagenesis GSSMTM, a large range of mutations can be tested for (CMCM) is essentially similar to CCM except it is employed improved activity. The method allows “blending and “fine as part of a larger program: 1) Use of epPCR at high mutation tuning of DNA shuffling, e.g. codon usage can be optimized. rate to 2) ID hotspots and hot regions and then 3) extension by 0191 In Silico Protein Design Automation (PDA) is an CMCM to cover a defined region of protein sequence space. optimization algorithm that anchors the structurally defined (Reetz et al., Angew. Chem. Int. Ed Engl. 40:3589-3591 protein backbone possessing a particular fold, and searches (2001).) As with CCM, this method can test virtually all sequence space for amino acid substitutions that can stabilize possible alterations over a target region. If used along with the fold and overall protein energetics. (Hayes et al., Proc methods to create random mutations and shuffled genes, it Natl AcadSci U.S.A. 99:15926-15931 (2002)) This technol provides an excellent means of generating diverse, shuffled ogy uses in silico structure-based entropy predictions in order proteins. This approach was successful in increasing, by to search for structural tolerance toward protein amino acid 51-fold, the enantioselectivity of an enzyme. variations. Statistical mechanics is applied to calculate cou 0188 In the Mutator Strains technique conditional ts pling interactions at each position. Structural tolerance mutator plasmids allow increases of 20- to 4000-X in random toward amino acid substitution is a measure of coupling. and natural mutation frequency during selection and block Ultimately, this technology is designed to yield desired modi accumulation of deleterious mutations when selection is not fications of protein properties while maintaining the integrity required. (Selifonova et al., Appl Environ Microbiol 67:3645 of structural characteristics. The method computationally 3649 (2001)) This technology is based on a plasmid-derived assesses and allows filtering of a very large number of pos mutD5 gene, which encodes a mutant subunit of DNA poly sible sequence variants (10). The choice of sequence vari merase III. This subunit binds to endogenous DNA poly ants to test is related to predictions based on the most favor merase III and compromises the proofreading ability of poly able thermodynamics. Ostensibly only stability or properties merase III in any strain that harbors the plasmid. A broad that are linked to stability can be effectively addressed with spectrum of base substitutions and frameshift mutations this technology. The method has been successfully used in occur. In order for effective use, the mutator plasmid should Some therapeutic proteins, especially in engineering immu be removed once the desired phenotype is achieved; this is noglobulins. In silico predictions avoid testing extraordinar accomplished through a temperature sensitive origin of rep ily large numbers of potential variants. Predictions based on lication, which allows for plasmid curing at 41°C. It should existing three-dimensional structures are more likely to Suc be noted that mutator strains have been explored for quite ceed than predictions based on hypothetical structures. This some time (e.g., see Low et al., J. Mol. Biol. 260:359-3680 technology can readily predict and allow targeted Screening (1996)). In this technique very high spontaneous mutation of multiple simultaneous mutations, something not possible rates are observed. The conditional property minimizes non with purely experimental technologies due to exponential desired background mutations. This technology could be increases in numbers. combined with adaptive evolution to enhance mutagenesis 0.192 Iterative Saturation Mutagenesis (ISM) involves: 1) rates and more rapidly achieve desired phenotypes. use knowledge of structure/function to choose a likely site for 0189 “Look-Through Mutagenesis (LTM) is a multidi enzyme improvement; 2) Saturation mutagenesis at chosen mensional mutagenesis method that assesses and optimizes site using Stratagene QuikChange (or other Suitable means); combinatorial mutations of selected amino acids (Rajpal et 3) screen/select for desired properties; and 4) with improved al., Proc Natl AcadSci U.S.A. 102:8466-8471 (2005)) Rather clone(s), start over at another site and continue repeating. than Saturating each site with all possible amino acid changes, (Reetz et al., Nat. Protoc. 2:891-903 (2007); and Reetz et al., a set of nine is chosen to cover the range of amino acid Angew. Chem. Int. Ed Engl. 45:7745-7751 (2006)) This is a R-group chemistry. Fewer changes per site allows multiple proven methodology, which assures all possible replacements sites to be subjected to this type of mutagenesis. A >800-fold at a given position are made for Screening/selection. increase in binding affinity for an antibody from low nano 0193 Any of the aforementioned methods for mutagen molar to picomolar has been achieved through this method. esis can be used alone or in any combination. Additionally, This is a rational approach to minimize the number of random any one or combination of the directed evolution methods can combinations and can increase the ability to find improved be used in conjunction with adaptive evolution techniques. traits by greatly decreasing the numbers of clones to be 0194 The present invention provides a method for pro screened. This has been applied to antibody engineering, ducing muconate that includes culturing a non-naturally US 2011/O124911 A1 May 26, 2011 28 occurring microbial organism having a muconate pathway. ing a non-naturally occurring microbial organism having a The pathway includes at least one exogenous nucleic acid muconate pathway. The pathway comprising at least one encoding a muconate pathway enzyme expressed in a suffi exogenous nucleic acid encoding a muconate pathway cient amount to produce muconate, under conditions and for enzyme expressed in a sufficient amount to produce mucon a Sufficient period of time to produce muconate. The mucon ate, under conditions and for a Sufficient period of time to ate pathway includes an enzyme selected from the group produce muconate. The muconate pathway includes a 4-hy consisting of a beta-ketothiolase, a beta-ketoadipyl-CoA droxy-2-ketovalerate aldolase, a 2-oxopentenoate hydratase, hydrolase, a beta-ketoadipyl-CoA transferase, a beta-ketoa a 4-oxalocrotonate dehydrogenase, a 2-hydroxy-4-hexene dipyl-CoA ligase, a 2-fumarylacetate reductase, a 2-fumary dioate dehydratase, a 4-hydroxy-2-oxohexanedioate oxi lacetate dehydrogenase, a trans-3-hydroxy-4-hexendioate doreductase, a 2,4-dihydroxyadipate dehydratase (acting on dehydratase, a 2-fumarylacetate aminotransferase, a 2-fu 2-hydroxy), a 2,4-dihydroxyadipate dehydratase (acting on marylacetate aminating oxidoreductase, a trans-3-amino-4- 4-hydroxyl group) and a 3-hydroxy-4-hexenedioate dehy hexenoate deaminase, a beta-ketoadipate enol-lactone hydro dratase. lase, a muconolactone isomerase, a muconate 0203. In some embodiments, the muconate pathway cycloisomerase, a beta-ketoadipyl-CoA dehydrogenase, a includes, a set of muconate pathway enzymes Such as those 3-hydroxyadipyl-CoA dehydratase, a 2.3-dehydroadipyl exemplified in FIG. 3; the set of muconate pathway enzymes CoA transferase, a 2.3-dehydroadipyl-CoA hydrolase, a 2.3- are selected from the group consisting of: dehydroadipyl-CoA ligase, a muconate reductase, a 2-maley 0204 A) (1) 4-hydroxy-2-ketovalerate aldolase, (2) lacetate reductase, a 2-maleylacetate dehydrogenase, a cis-3- 2-oxopentenoate hydratase, (3) 4-oxalocrotonate dehydroge hydroxy-4-hexendioate dehydratase, a 2-maleylacetate nase, (4) 2-hydroxy-4-hexenedioate dehydratase; aminoatransferase, a 2-maleylacetate aminating oxidoreduc 0205 B) (1) 4-hydroxy-2-ketovalerate aldolase, (2) 4-hy tase, a cis-3-amino-4-hexendioate deaminase, and a mucon droxy-2-oxohexanedioate oxidoreductase, (3) 2,4-dihy ate cis/trans isomerase. droxyadipate dehydratase (acting on 2-hydroxy), (4) 3-hy 0.195. In some embodiments, the muconate pathway droxy-4-hexenedioate dehydratase; and includes, a set of muconate pathway enzymes Such as those 0206 C) (1) 4-hydroxy-2-ketovalerate aldolase, (2) 4-hy exemplified in FIG. 2; the set of muconate pathway enzymes droxy-2-oxohexanedioate oxidoreductase, (3) 2,4-dihy are selected from the group consisting of: droxyadipate dehydratase (acting on 4-hydroxyl group), (4) 0.196 A) (1) beta-ketothiolase, (2) an enzyme selected 2-hydroxy-4-hexenedioate dehydratase. from beta-ketoadipyl-CoA hydrolase, beta-ketoadipyl-CoA 0207. In some embodiments, the present invention pro transferase, and beta-ketoadipyl-CoA ligase, (3) beta-ketoa vides a method for producing muconate that includes cultur dipate enol-lactone hydrolase, (4) muconolactone isomerase, ing a non-naturally occurring microbial organism having a (5) muconate cycloisomerase, and (6) muconate cis/trans muconate pathway. The pathway includes at least one exog isomerase: enous nucleic acid encoding a muconate pathway enzyme 0.197 B) (1) beta-ketothiolase, (2) an enzyme selected expressed in a sufficient amount to produce muconate, under from beta-ketoadipyl-CoA hydrolase, beta-ketoadipyl-CoA conditions and for a sufficient period of time to produce transferase and beta-ketoadipyl-CoA ligase, (3) 2-maleylac muconate. The muconate pathway includes an enzyme etate reductase, (4) 2-maleylacetate dehydrogenase, (5) cis selected from the group consisting of an HODHaldolase, an 3-hydroxy-4-hexendioate dehydratase, and (6) muconate cis/ OHED hydratase, an OHED decarboxylase, an HODH for trans isomerase; mate-lyase, an HODH dehydrogenase, an OHED formate 0198 C) (1) beta-ketothiolase, (2) an enzyme selected lyase, an OHED dehydrogenase, a 6-OHE dehydrogenase, a from beta-ketoadipyl-CoA hydrolase, beta-ketoadipyl-CoA 3-hydroxyadipyl-CoA dehydratase, a 2.3-dehydroadipyl transferase and beta-ketoadipyl-CoA ligase, (3) 2-maleylac CoA hydrolase, a 2,3-dehydroadipyl-CoA transferase, a 2.3- etate reductase, (4) an enzyme selected from 2-maleylacetate dehydroadipyl-CoA ligase, and a muconate reductase. aminotransferase and 2-maleylacetate aminating oxi 0208. In some embodiments, the muconate pathway doreductase, (5) cis-3-amino-4-hexenoate deaminase, and (6) includes, a set of muconate pathway enzymes Such as those muconate cis/trans isomerase; exemplified in FIG. 4; the set of muconate pathway enzymes 0199 D) (1) beta-ketothiolase, (2) beta-ketoadipyl-CoA are selected from the group consisting of: dehydrogenase, (3) 3-hydroxyadipyl-CoA dehydratase, (4) (0209 A) (1) HODH aldolase, (2) OHED hydratase, (3) an enzyme selected from 2,3-dehydroadipyl-CoA trans OHED decarboxylase, (4) 6-OHE dehydrogenase, and (5) ferase, 2,3-dehydroadipyl-CoA hydrolase and 2,3-dehydroa muconate reductase; dipyl-CoA ligase, and (5) muconate reductase; 0210 B) (1) HODHaldolase, (2) OHED hydratase, (3) an 0200 E) (1) beta-ketothiolase, (2) an enzyme selected enzyme selected from OHED formate-lyase and OHED from beta-ketoadipyl-CoA hydrolase, beta-ketoadipyl-CoA dehydrogenase, (4) an enzyme selected from 2,3-dehydroa transferase and beta-ketoadipyl-CoA ligase, (3)2-fumarylac dipyl-CoA hydrolase, 2,3-dehydroadipyl-CoA transferase etate reductase, (4) 2-fumarylacetate dehydrogenase, and (5) and 2,3-dehydroadipyl-CoA ligase, and (5) muconate reduc trans-3-hydroxy-4-hexendioate dehydratase; tase; and 0201 F) (1) beta-ketothiolase, (2) an enzyme selected 0211 C) (1) HODHaldolase, (2) an enzyme selected from from beta-ketoadipyl-CoA hydrolase, beta-ketoadipyl-CoA HODH formate-lyase and HODH dehydrogenase, (3) 3-hy transferase and beta-ketoadipyl-CoA ligase, (3)2-fumarylac droxyadipyl-CoA dehydratase, (4) an enzyme selected from etate reductase, (4) an enzyme selected from 2-fumarylac 2,3-dehydroadipyl-CoA hydrolase, 2,3-dehydroadipyl-CoA etate aminotransferase and 2-fumarylacetate aminating oxi transferase and 2.3-dehydroadipyl-CoA ligase, and (5) doreductase, and (5) trans-3-amino-4-hexenoate deaminase. muconate reductase. 0202 In some embodiments, the present invention pro 0212. In some embodiments, the present invention pro vides a method for producing muconate that includes cultur vides a method for producing muconate that includes cultur US 2011/O124911 A1 May 26, 2011 29 ing a non-naturally occurring microbial organism having a 273:309-318 (1989)). In this assay, the substrates muconate muconate pathway. The pathway includes at least one exog and NADH are added to cell extracts in a buffered solution, enous nucleic acid encoding a muconate pathway enzyme and the oxidation of NADH is followed by reading absor expressed in a sufficient amount to produce muconate, under bance at 340 nM at regular intervals. The resulting slope of the conditions and for a sufficient period of time to produce reduction in absorbance at 340 nM per minute, along with the muconate. The muconate pathway includes an enzyme molar extinction coefficient of NADH at 340 nM (6000) and selected from the group consisting of a lysine aminotrans the protein concentration of the extract, can be used to deter ferase, a lysine aminating oxidoreductase, a 2-aminoadipate mine the specific activity of muconate reducatse. semialdehyde dehydrogenase, a 2-aminoadipate deaminase, 0218. The muconate can be separated from other compo a muconate reductase, a lysine-2,3-aminomutase, a 3,6-di nents in the culture using a variety of methods well known in aminohexanoate aminotransferase, a 3,6-diaminohexanoate the art, as briefly described above Such separation methods aminating oxidoreductase, a 3-aminoadipate semialdehyde include, for example, extraction procedures as well as meth dehydrogenase, and a 3-aminoadipate deaminase. ods that include continuous liquid-liquid extraction, pervapo 0213. In some embodiments, the muconate pathway ration, membrane filtration, membrane separation, reverse includes, a set of muconate pathway enzymes Such as those osmosis, electrodialysis, distillation, crystallization, centrifu exemplified in FIG. 5; the set of muconate pathway enzymes gation, extractive filtration, ion exchange chromatography, are selected from the group consisting of: size exclusion chromatography, adsorption chromatography, 0214 A) (1) lysine aminotransferase, (2) lysine aminating and ultrafiltration. All of the above methods are well known in oxidoreductase, (3) 2-aminoadipate semialdehyde dehydro the art. genase, (4) 2-aminoadipate deaminase, and (5) muconate 0219. Any of the non-naturally occurring microbial organ reductase isms described herein can be cultured to produce and/or 0215 B) (1) lysine-2,3-aminomutase, (2) 3,6-diamino secrete the biosynthetic products of the invention. For hexanoate aminotransferase, (3) 3,6-diaminohexanoate ami example, the muconate producers can be cultured for the nating oxidoreductase, (4) 3-aminoadipate semialdehyde biosynthetic production of muconate. dehydrogenase, (5) 3-aminoadipate deaminase, and (6) 0220. For the production of muconate, the recombinant muconate reductase. strains are cultured in a medium with carbon Source and other 0216. In some embodiments, the foregoing non-naturally essential nutrients. It is highly desirable to maintain anaerobic occurring microbial organism can be cultured in a Substan conditions in the fermenter to reduce the cost of the overall tially anaerobic culture medium. process. Such conditions can be obtained, for example, by 0217 Suitable purification and/or assays to test for the first sparging the medium with nitrogen and then sealing the production of muconate can be performed using well known flasks with a septum and crimp-cap. For strains where growth methods. Suitable replicates such as triplicate cultures can be is not observed anaerobically, microaerobic conditions can be grown for each engineered strain to be tested. For example, applied by perforating the septum with a small hole for lim product and byproduct formation in the engineered produc ited aeration. Exemplary anaerobic conditions have been tion host can be monitored. The final product and intermedi described previously and are well-known in the art. Exem ates, and other organic compounds, can be analyzed by meth plary aerobic and anaerobic conditions are described, for ods such as HPLC (High Performance Liquid example, in U.S. patent application Ser. No. 1 1/891,602, filed Chromatography), GC-MS (Gas Chromatography-Mass Aug. 10, 2007. Fermentations can be performed in a batch, Spectroscopy) and LC-MS (Liquid Chromatography-Mass fed-batch or continuous manner, as disclosed herein. Spectroscopy) or other Suitable analytical methods using rou 0221) If desired, the pH of the medium can be maintained tine procedures well known in the art. The release of product at a desired pH, in particular neutral pH, such as a pH of in the fermentation broth can also be tested with the culture around 7 by addition of a base, such as NaOH or other bases, Supernatant. Byproducts and residual glucose can be quanti or acid, as needed to maintain the culture medium at a desir fied by HPLC using, for example, a refractive index detector able pH. The growth rate can be determined by measuring for glucose and alcohols, and a UV detector for organic acids optical density using a spectrophotometer (600 nm), and the (Lin et al., Biotechnol. Bioeng. 90:775-779 (2005)), or other glucose uptake rate by monitoring carbon Source depletion Suitable assay and detection methods well known in the art. over time. NOTE: Ideally this process would operate at low The individual enzyme or protein activities from the exog pH using an organisms that tolerates pH levels in the range enous DNA sequences can also be assayed using methods 2-4. well known in the art. For example, a spectrophotometric 0222. The growth medium can include, for example, any assay for succinyl-CoA:3-ketoacid-CoA transferase (FIG. 2, carbohydrate Source which can Supply a source of carbon to Step B) entails measuring the change in the absorbance cor the non-naturally occurring microorganism. Such sources responding to the product CoA molecule (i.e., Succinyl-CoA) include, for example, Sugars such as glucose, Xylose, arabi in the presence of the enzyme extract when supplied with nose, galactose, mannose, fructose, Sucrose and starch. Other succinate and B-ketoadipyl-CoA (Corthesy-Theulaz et al., J. sources of carbohydrate include, for example, renewable Biol. Chem., 272(41) (1997)). Succinyl-CoA can alterna feedstocks and biomass. Exemplary types of biomasses that tively be measured in the presence of excess hydroxylamine can be used as feedstocks in the methods of the invention by complexing the Succinohydroxamic acid formed to ferric include cellulosic biomass, hemicellulosic biomass and lig salts as referred to in (Corthesy-Theulaz et al., J. Biol. Chem. nin feedstocks or portions offeedstocks. Such biomass feed 272(41) (1997)). The specific activity of muconate reductase stocks contain, for example, carbohydrate Substrates useful as can be assayed in the reductive direction using a colorimetric carbon sources such as glucose, Xylose, arabinose, galactose, assay adapted from the literature (Durre et al., FEMS Micro mannose, fructose and Starch. Given the teachings and guid biol. Rev 17:251-262 (1995); Palosaari et al., J. Bacteriol. ance provided herein, those skilled in the art will understand 170:2971-2976 (1988); Welchet al., Arch. Biochem. Biophys. that renewable feedstocks and biomass other than those US 2011/O124911 A1 May 26, 2011 30 exemplified above also can be used for culturing the micro can be performed with respect to introducing at least the bial organisms of the invention for the production of mucon nucleic acids encoding the Wood-Ljungdahl enzymes or pro ate. teins absent in the host organism. Therefore, introduction of 0223. In addition to renewable feedstocks such as those one or more encoding nucleic acids into the microbial organ exemplified above, the muconate microbial organisms of the isms of the invention Such that the modified organism con invention also can be modified for growth on syngas as its tains the complete Wood-Ljungdahl pathway will confer syn Source of carbon. In this specific embodiment, one or more gas utilization ability. proteins or enzymes are expressed in the muconate producing 0228. Accordingly, given the teachings and guidance pro organisms to provide a metabolic pathway for utilization of vided herein, those skilled in the art will understand that a syngas or other gaseous carbon Source. non-naturally occurring microbial organism can be produced 0224 Synthesis gas, also known as Syngas or producer that secretes the biosynthesized compounds of the invention gas, is the major product of gasification of coal and of car when grown on a carbon source Such as a carbohydrate. Such bonaceous materials such as biomass materials, including compounds include, for example, muconate and any of the agricultural crops and residues. Syngas is a mixture primarily intermediate metabolites in the muconate pathway. All that is of H and CO and can be obtained from the gasification of any required is to engineer in one or more of the required enzyme organic feedstock, including but not limited to coal, coal oil, or protein activities to achieve biosynthesis of the desired natural gas, biomass, and waste organic matter. Gasification compound or intermediate including, for example, inclusion is generally carried out under a high fuel to oxygen ratio. of Some or all of the muconate biosynthetic pathways. Although largely H and CO, syngas can also include CO Accordingly, the invention provides a non-naturally occur and other gases in Smaller quantities. Thus, synthesis gas ring microbial organism that produces and/or secretes provides a cost effective source of gaseous carbon Such as CO muconate when grown on a carbohydrate or other carbon and, additionally, CO. Source and produces and/or secretes any of the intermediate 0225. The Wood-Ljungdahl pathway catalyzes the conver metabolites shown in the muconate pathway when grown on sion of CO and H to acetyl-CoA and other products such as a carbohydrate or other carbon Source. The muconate produc acetate. Organisms capable of utilizing CO and syngas also ing microbial organisms of the invention can initiate synthe generally have the capability of utilizing CO and CO/H. sis from an intermediate, such as any of the intermediates mixtures through the same basic set of enzymes and transfor shown in FIGS. 2-5. mations encompassed by the Wood-Ljungdahl pathway. 0229. The non-naturally occurring microbial organisms of H-dependent conversion of CO, to acetate by microorgan the invention are constructed using methods well known in isms was recognized long before it was revealed that CO also the art as exemplified herein to exogenously express at least could be used by the same organisms and that the same one nucleic acid encoding a muconate pathway enzyme or pathways were involved. Many acetogens have been shownto protein in Sufficient amounts to produce muconate. It is grow in the presence of CO and produce compounds such as understood that the microbial organisms of the invention are acetate as long as hydrogen is present to supply the necessary cultured under conditions Sufficient to produce muconate. reducing equivalents (see for example, Drake, Acetogenesis, Following the teachings and guidance provided herein, the pp. 3-60 Chapman and Hall, New York, (1994)). This can be non-naturally occurring microbial organisms of the invention Summarized by the following equation: can achieve biosynthesis of muconate resulting in intracellu lar concentrations between about 0.1-200 mM or more. Gen erally, the intracellular concentration of muconate is between 0226 Hence, non-naturally occurring microorganisms about 3-150 mM, particularly between about 5-200 mM and possessing the Wood-Ljungdahl pathway can utilize CO and more particularly between about 8-150 mM, including about H mixtures as well for the production of acetyl-CoA and 10 mM, 50 mM, 75 mM, 100 mM, or more. Intracellular other desired products. concentrations between and above each of these exemplary 0227. The Wood-Ljungdahl pathway is well known in the ranges also can be achieved from the non-naturally occurring art and consists of 12 reactions which can be separated into microbial organisms of the invention. two branches: (1) methyl branch and (2) carbonyl branch. The 0230. In some embodiments, culture conditions include methyl branch converts syngas to methyl-tetrahydrofolate anaerobic or Substantially anaerobic growth or maintenance (methyl-THF) whereas the carbonyl branch converts methyl conditions. Exemplary anaerobic conditions have been THF to acetyl-CoA. The reactions in the methyl branch are described previously and are well known in the art. Exem catalyzed in order by the following enzymes or proteins: plary anaerobic conditions for fermentation processes are ferredoxin oxidoreductase, formate dehydrogenase, described herein and are described, for example, in U.S. formyltetrahydrofolate synthetase, methenyltetrahydrofolate patent application Ser. No. 1 1/891,602, filed Aug. 10, 2007. cyclodehydratase, methylenetetrahydrofolate dehydroge Any of these conditions can be employed with the non-natu nase and methylenetetrahydrofolate reductase. The reactions rally occurring microbial organisms as well as other anaero in the carbonyl branch are catalyzed in order by the following bic conditions well known in the art. Under such anaerobic enzymes or proteins: methyltetrahydrofolate:corrinoid pro conditions, the muconate producers can synthesize muconate tein methyltransferase (for example, AcSE), corrinoid iron at intracellular concentrations of 5-10 mM or more as well as Sulfur protein, nickel-protein assembly protein (for example, all other concentrations exemplified herein. It is understood AcsF), ferredoxin, acetyl-CoA synthase, carbon monoxide that, even though the above description refers to intracellular dehydrogenase and nickel-protein assembly protein (for concentrations, muconate producing microbial organisms example, CooC). Following the teachings and guidance pro can produce muconate intracellularly and/or secrete the prod vided herein for introducing a sufficient number of encoding uct into the culture medium. nucleic acids to generate a muconate pathway, those skilled in 0231. The culture conditions can include, for example, the art will understand that the same engineering design also liquid culture procedures as well as fermentation and other US 2011/O124911 A1 May 26, 2011 large scale culture procedures. As described herein, particu addition of an osmoprotectant to the culturing conditions. In larly useful yields of the biosynthetic products of the inven certain embodiments, the non-naturally occurring microbial tion can be obtained under anaerobic or substantially anaero organisms of the invention can be Sustained, cultured or fer bic culture conditions. mented as described above in the presence of an osmopro 0232. As described herein, one exemplary growth condi tectant. Briefly, an osmoprotectant means a compound that tion for achieving biosynthesis of muconate includes anaero acts as an osmolyte and helps a microbial organism as bic culture or fermentation conditions. In certain embodi described herein survive osmotic stress. Osmoprotectants ments, the non-naturally occurring microbial organisms of include, but are not limited to, betaines, amino acids, and the the invention can be sustained, cultured or fermented under Sugar trehalose. Non-limiting examples of Such are glycine anaerobic or substantially anaerobic conditions. Briefly, betaine, praline betaine, dimethylthetin, dimethylslfonio anaerobic conditions refers to an environment devoid of oxy proprionate, 3-dimethylsulfonio-2-methylproprionate, pipe gen. Substantially anaerobic conditions include, for example, colic acid, dimethylsulfonioacetate, choline, L-carnitine and a culture, batch fermentation or continuous fermentation Such ectoine. In one aspect, the osmoprotectant is glycine betaine. that the dissolved oxygen concentration in the medium It is understood to one of ordinary skill in the art that the remains between 0 and 10% of saturation. Substantially amount and type of osmoprotectant Suitable for protecting a anaerobic conditions also includes growing or resting cells in microbial organism described herein from osmotic stress will liquid medium or on Solidagar inside a sealed chamber main depend on the microbial organism used. The amount of osmo tained with an atmosphere of less than 1% oxygen. The per protectant in the culturing conditions can be, for example, no cent of oxygen can be maintained by, for example, sparging more than about 0.1 mM, no more than about 0.5 mM, no the culture with an N/CO mixture or other suitable non more than about 1.0 mM, no more than about 1.5 mM, no OXygen gas or gases. more than about 2.0 mM, no more than about 2.5 mM, no 0233. The culture conditions described herein can be more than about 3.0 mM, no more than about 5.0 mM, no scaled up and grown continuously for manufacturing of more than about 7.0 mM, no more thanabout 10 mM, no more muconate. Exemplary growth procedures include, for than about 50 mM, no more than about 100 mM or no more example, fed-batch fermentation and batch separation; fed than about 500 mM. batch fermentation and continuous separation, or continuous 0237 To generate better producers, metabolic modeling fermentation and continuous separation. All of these pro can be utilized to optimize growth conditions. Modeling can cesses are well known in the art. Fermentation procedures are also be used to design gene knockouts that additionally opti particularly useful for the biosynthetic production of com mize utilization of the pathway (see, for example, U.S. patent mercial quantities of muconate. Generally, and as with non publications US 2002/0012939, US 2003/0224363, US 2004/ continuous culture procedures, the continuous and/or near 0029149, US 2004/0072723, US 2003/0059792, US 2002/ continuous production of muconate will include culturing a O168654 and US 2004/000.9466, and U.S. Pat. No. 7,127, non-naturally occurring muconate producing organism of the 379). Modeling analysis allows reliable predictions of the invention in Sufficient nutrients and medium to Sustain and/or effects on cell growth of shifting the metabolism towards nearly Sustain growth in an exponential phase. Continuous more efficient production of muconate. culture under Such conditions can be include, for example, 1 0238. One computational method for identifying and day, 2, 3, 4, 5, 6 or 7 days or more. Additionally, continuous designing metabolic alterations favoring biosynthesis of a culture can include 1 week, 2, 3, 4 or 5 or more weeks and up desired product is the OptKnock computational framework to several months. Alternatively, organisms of the invention (Burgardet al., Biotechnol. Bioeng. 84:647-657 (2003)). Opt can be cultured for hours, if suitable for a particular applica Knock is a metabolic modeling and simulation program that tion. It is to be understood that the continuous and/or near Suggests gene deletion or disruption strategies that result in continuous culture conditions also can include all time inter genetically stable microorganisms which overproduce the vals in between these exemplary periods. It is further target product. Specifically, the framework examines the understood that the time of culturing the microbial organism complete metabolic and/or biochemical network of a micro of the invention is for a sufficient period of time to produce a organism in order to Suggest genetic manipulations that force Sufficient amount of product for a desired purpose. the desired biochemical to become an obligatory byproduct 0234. Fermentation procedures are well known in the art. of cell growth. By coupling biochemical production with cell Briefly, fermentation for the biosynthetic production of growth through strategically placed gene deletions or other muconate can be utilized in, for example, fed-batch fermen functional gene disruption, the growth selection pressures tation and batch separation; fed-batch fermentation and con imposed on the engineered Strains after long periods of time tinuous separation, or continuous fermentation and continu in a bioreactor lead to improvements in performance as a ous separation. Examples of batch and continuous result of the compulsory growth-coupled biochemical pro fermentation procedures are well known in the art. duction. Lastly, when gene deletions are constructed there is 0235. In addition to the above fermentation procedures a negligible possibility of the designed strains reverting to using the muconate producers of the invention for continuous their wild-type states because the genes selected by Opt production of Substantial quantities of muconate, the mucon Knock are to be completely removed from the genome. ate producers also can be, for example, simultaneously Sub Therefore, this computational methodology can be used to jected to chemical synthesis procedures to convert the prod either identify alternative pathways that lead to biosynthesis uct to other compounds or the product can be separated from of a desired product or used in connection with the non the fermentation culture and sequentially subjected to chemi naturally occurring microbial organisms for further optimi cal conversion to convert the product to other compounds, if zation of biosynthesis of a desired product. desired. 0239 Briefly, OptKnock is a term used herein to refer to a 0236. In addition to the above procedures, growth condi computational method and system for modeling cellular tion for achieving biosynthesis of muconate can include the metabolism. The Optiknock program relates to a framework US 2011/O124911 A1 May 26, 2011 32 of models and methods that incorporate particular constraints of Such other metabolic modeling and simulation computa into flux balance analysis (FBA) models. These constraints tional frameworks and methods well known in the art. include, for example, qualitative kinetic information, quali 0243 The methods described above will provide one set of tative regulatory information, and/or DNA microarray metabolic reactions to disrupt. Elimination of each reaction experimental data. OptKnock also computes solutions to within the set or metabolic modification can resultina desired various metabolic problems by, for example, tightening the product as an obligatory product during the growth phase of flux boundaries derived through flux balance models and the organism. Because the reactions are known, a solution to Subsequently probing the performance limits of metabolic the bilevel OptKnock problem also will provide the associ networks in the presence of gene additions or deletions. Opt ated gene or genes encoding one or more enzymes that cata Knock computational framework allows the construction of lyze each reaction within the set of reactions. Identification of model formulations that enable an effective query of the a set of reactions and their corresponding genes encoding the performance limits of metabolic networks and provides enzymes participating in each reaction is generally an auto methods for Solving the resulting mixed-integer linear pro mated process, accomplished through correlation of the reac gramming problems. The metabolic modeling and simulation tions with a reaction database having a relationship between methods referred to herein as OptKnock are described in, for enzymes and encoding genes. example, U.S. publication 2002/0168654, filed Jan. 10, 2002, 0244. Once identified, the set of reactions that are to be in International Patent No. PCT/US02/00660, filed Jan. 10, disrupted in order to achieve production of a desired product 2002, and U.S. publication 2009/0047719, filed Aug. 10, are implemented in the target cell or organism by functional 2007. disruption of at least one gene encoding each metabolic reac 0240 Another computational method for identifying and tion within the set. One particularly useful means to achieve designing metabolic alterations favoring biosynthetic pro functional disruption of the reaction set is by deletion of each duction of a product is a metabolic modeling and simulation encoding gene. However, in Some instances, it can be benefi system termed SimPheny(R). This computational method and cial to disrupt the reaction by other genetic aberrations system is described in, for example, U.S. publication 2003/ including, for example, mutation, deletion of regulatory 0233218, filed Jun. 14, 2002, and in International Patent regions such as promoters or cis binding sites for regulatory Application No. PCT/US03/18838, filed Jun. 13, 2003. Sim factors, or by truncation of the coding sequence at any of a Pheny(R) is a computational system that can be used to pro number of locations. These latter aberrations, resulting in less duce a network model in silico and to simulate the flux of than total deletion of the gene set can be useful, for example, mass, energy or charge through the chemical reactions of a when rapid assessments of the coupling of a product are biological system to define a solution space that contains any desired or when genetic reversion is less likely to occur. and all possible functionalities of the chemical reactions in 0245. To identify additional productive solutions to the the system, thereby determining a range of allowed activities above described bilevel Optiknock problem which lead to for the biological system. This approach is referred to as further sets of reactions to disrupt or metabolic modifications constraints-based modeling because the Solution space is that can result in the biosynthesis, including growth-coupled defined by constraints such as the known stoichiometry of the biosynthesis of a desired product, an optimization method, included reactions as well as reaction thermodynamic and termed integer cuts, can be implemented. This method pro capacity constraints associated with maximum fluxes through ceeds by iteratively solving the OptKnock problem exempli reactions. The space defined by these constraints can be inter fied above with the incorporation of an additional constraint rogated to determine the phenotypic capabilities and behavior referred to as an integer cut at each iteration. Integer cut of the biological system or of its biochemical components. constraints effectively prevent the solution procedure from 0241 These computational approaches are consistent choosing the exact same set of reactions identified in any with biological realities because biological systems are flex previous iteration that obligatorily couples product biosyn ible and can reach the same result in many different ways. thesis to growth. For example, if a previously identified Biological systems are designed through evolutionary growth-coupled metabolic modification specifies reactions 1, mechanisms that have been restricted by fundamental con 2, and 3 for disruption, then the following constraint prevents straints that all living systems must face. Therefore, con the same reactions from being simultaneously considered in straints-based modeling strategy embraces these general Subsequent solutions. The integer cut method is well known realities. Further, the ability to continuously impose further in the art and can be found described in, for example, Burgard restrictions on a network model via the tightening of con et al., Biotechnol. Prog. 17:791-797 (2001). As with all meth straints results in a reduction in the size of the Solution space, ods described herein with reference to their use in combina thereby enhancing the precision with which physiological tion with the OptKnock computational framework for meta performance or phenotype can be predicted. bolic modeling and simulation, the integer cut method of 0242 Given the teachings and guidance provided herein, reducing redundancy in iterative computational analysis also those skilled in the art will be able to apply various compu can be applied with other computational frameworks well tational frameworks for metabolic modeling and simulation known in the art including, for example, SimPheny(R). to design and implement biosynthesis of a desired compound 0246 The methods exemplified herein allow the construc in host microbial organisms. Such metabolic modeling and tion of cells and organisms that biosynthetically produce a simulation methods include, for example, the computational desired product, including the obligatory coupling of produc systems exemplified above as SimPheny(R) and OptKnock. tion of a target biochemical product to growth of the cell or For illustration of the invention, some methods are described organism engineered to harbor the identified genetic alter herein with reference to the Optiknock computation frame ations. Therefore, the computational methods described work for modeling and simulation. Those skilled in the art herein allow the identification and implementation of meta will know how to apply the identification, design and imple bolic modifications that are identified by an in silico method mentation of the metabolic alterations using OptKnock to any selected from OptKnock or SimPheny(R). The set of metabolic US 2011/O124911 A1 May 26, 2011

modifications can include, for example, addition of one or lem with the incorporation of an additional constraint referred more biosynthetic pathway enzymes and/or functional dis to as an integer cut at each iteration, as discussed above. ruption of one or more metabolic reactions including, for 0249. It is understood that modifications which do not example, disruption by gene deletion. substantially affect the activity of the various embodiments of 0247. As discussed above, the OptKnock methodology this invention are also provided within the definition of the was developed on the premise that mutant microbial networks invention provided herein. Accordingly, the following can be evolved towards their computationally predicted maxi examples are intended to illustrate but not limit the present mum-growth phenotypes when Subjected to long periods of invention. growth selection. In other words, the approach leverages an organism's ability to self-optimize under selective pressures. Example I The Optiknock framework allows for the exhaustive enu Demonstration of Enzyme Activity for Condensing meration of gene deletion combinations that force a coupling Succinyl-CoA and Acetyl-CoA to Form B-ketoad between biochemical production and cell growth based on ipyl-CoA network stoichiometry. The identification of optimal gene/ reaction knockouts requires the Solution of a bilevel optimi 0250. This Example shows the identification of enzymes Zation problem that chooses the set of active reactions such for the formation of beta-ketoadipyl-CoA from succinyl-CoA that an optimal growth solution for the resulting network and acetyl-CoA. overproduces the biochemical of interest (Burgard et al., Bio 0251. Several B-ketothiolase enzymes have been shown to technol. Bioeng. 84:647-657 (2003)). break f-ketoadipyl-CoA into acetyl-CoA and succinyl-CoA. 0248. An in silico stoichiometric model of E. coli metabo For example, the gene products encoded by pcaF in lism can be employed to identify essential genes for meta Pseudomonas strain B13 (Kaschabek et al., J. Bacteriol. 184 bolic pathways as exemplified previously and described in, (1): 207-15 (2002)), phaD in Pseudomonasputida U (Olivera for example, U.S. patent publications US 2002/0012939, US et al., Proc Natl AcadSci USA,95(11), 6419-24 (1998)), paaE 2003/0224363, US 2004/0029149, US 2004/0072723, US in Pseudomonas fluorescens ST (Di Gennaro et al., Arch 2003/0059792, US 2002/0168654 and US 2004/000.9466, Microbiol, 188(2), 117-25 (2007)), and paal from E. coli and in U.S. Pat. No. 7,127,379. As disclosed herein, the (Nogales et al., Microbiology 153(Pt 2), 357-65 (2007)) cata OptKnock mathematical framework can be applied to pin lyze the conversion of 3-oxoadipyl-CoA into succinyl-CoA point gene deletions leading to the growth-coupled produc and acetyl-CoA during the degradation of aromatic com tion of a desired product. Further, the solution of the bilevel pounds Such as phenylacetate or styrene. To confirm that OptKnock problem provides only one set of deletions. To B-ketothiolase enzymes exhibit condensation activity, several enumerate all meaningful solutions, that is, all sets of knock thiolases (Table 53) were cloned into a derivative of pZE13 outs leading to growth-coupled production formation, an (Lutz et al., Nucleic Acids Res, 29(18), 3873-81 (2001)), optimization technique, termed integer cuts, can be imple which results in the clones having a carboxy-terminal 6xHis mented. This entails iteratively solving the Optiknock prob tag.

TABL E 53

Cloned T hiolases Species Enzyme template Gene Length 5' PRIMER 3 PRIMER ORF SEO beta- Ralstonia ktB 1.185 ATGACGCGTG GATACGCTCGA atgacgc.gtgaagtgg tagtgg talagcggtgtc.cg ketothiolase eutropha AAGTGGTAGT AGATGGCGG taccgcgat.cgggacct ttggcggcagoctgaagg H16 GGTAAG atgttggCaccggcggagctggg.cgcactggtggtg Cg.cgagg.cgctgg.cgc.gc.gc.gcaggtgtcgggcga cgatgtcggcc acgtgg tatt cqgcaacgtgat CC agaccgagcc.gc.gcgacatgitatctgggcc.gcgtc gcggc.cgtcaacggcggggtgacgat caacgc.ccc cgc.gctgaccgtgaaccgc.ctgtgcggctcgggcc tgcaggc cattgtcagcgcc.gc.gcagac catcCt9 Ctgggcgat accgacgt.cgc.catcggcggcggcgc ggaaagcatgagcc.gc.gcaccgtacctggcgc.cgg Cagcgc.gctgggg.cgcacgcatgggcgacgc.cggc Ctggtcgacatgatgctgggtgcgctgcacgat CC Cttic catcgcatcCacatgggcgtgaccgcc.gaga atgtc.gc.caaggaatacgaCatct cqcgc.gc.gcag Caggacgaggcc.gc.gctggaatcgcaccgc.cgc.gc ttctgcagcgatcaaggc.cggctact tcaaggacc agat.cgtc.ccggtggtgagcaagggcc.gcaagggc gacgtgacctt.cgacaccgacgag cacgtgcgc.ca tgacgc.cac catcgacgacatgaccalagct caggc cggit Ctt cqtcaaggaaaacggcacggit cacggcc ggcaatgcct cqggcctgaacgacgc.cgcc.gc.cgc ggtggtgatgatggagcgc.gc.gaa.gc.cgagcgc.cg cggcctgaa.gc.cgctggc.ccgc.ctggtgtcgtacg gccatgc.cggcgtggacccgaaggcc atgggcatc ggc.ccggtgc.cgg.cgacgaagat.cgc.gctggagcg cgc.cggcctgcaggtgtcggacctggacgtgat cq

US 2011/O124911 A1 May 26, 2011 42

Example II coli strain MG 1655 to express the proteins and enzymes required for muconate synthesis from Succinyl-CoA. Preparation of Terepthalate from Acetylene and 0259. The resulting genetically engineered organism is Muconate cultured in glucose containing medium following procedures well known in the art (see, for example, Sambrook et al., 0253) This Example provides conditions for the thermal Supra, 2001). The expression of muconate pathway genes is inverse electron demand Diels-Alder reaction for the prepa corroborated using methods well known in the art for deter ration of PTA from acetylene and muconate. mining polypeptide expression or enzymatic activity, includ 0254 Alab-scale Parr reactor is flushed with nitrogen gas, evacuated and charged with (1 equivalent) trans, trans-mu ing for example, Northern blots, PCR amplification of mRNA conic acid and (10 equivalents) acetylene. The reactor is then and immunoblotting. Enzymatic activities of the expressed heated to 200° C. and held at this temperature for 12 hours. An enzymes are confirmed using assays specific for the individu initial pressure of 500 p.s.i.g. is applied. The reactor is then ally activities. The ability of the engineered E. coli strain to vented, exposed to air and cooled. The contents of the reactor produce muconate through this pathway is confirmed using are distilled at room temperature and pressure to yield volatile HPLC, gas chromatography-mass spectrometry (GCMS) or and nonvolatile fractions. The contents of each fraction are liquid chromatography-mass spectrometry (LCMS). evaluated qualitatively by gas chromatographic analysis 0260 Microbial strains engineered to have a functional (GC-MS). muconate synthesis pathway from Succinyl-CoA are further 0255 For quantitative analysis, standards of the starting augmented by optimization for efficient utilization of the materials and the expected products, cyclohexa-2,5-diene-1, pathway. Briefly, the engineered strain is assessed to deter 4-dicarboxylate and terepthalate, are prepared. A known mine whether any of the exogenous genes are expressed at a amount of cyclohexane is mixed with a known amount of the rate limiting level. Expression is increased for any enzymes Volatile fraction and the mixture is subjected to gas chroma expressed at low levels that can limit the flux through the tography. The cyclohexane and terepthalate components are pathway by, for example, introduction of additional gene condensed from the effluent of the chromatogram into a copy numbers. single trap, the contents of which are diluted with carbon 0261. After successful demonstration of enhanced tetrachloride or CDC1 and then examined by NMR spectros muconate production via the activities of the exogenous copy. Comparison of the appropriate areas of the NMR spec enzymes, the genes encoding these enzymes are inserted into trum permits calculation of yields. the chromosome of a wild type E. coli host using methods known in the art. Such methods include, for example, sequen tial single crossover (Gay et al., J. Bacteriol. 153:1424-1431 Example III (1983)) and Red/ET methods from GeneBridges (Zhang et Preparation of a Muconate Producing Microbial al., Improved RecT or RecET cloning and subcloning method Organism, in which the Muconate is Derived from (WO/2003/010322)). Chromosomal insertion provides sev Succinyl-CoA eral advantages over a plasmid-based system, including greater stability and the ability to co-localize expression of 0256 This example describes the generation of a micro pathway genes. bial organism that has been engineered to produce muconate 0262 To generate better producers, metabolic modeling is from Succinyl-CoA and acetyl-CoA via beta-ketoadipate, as utilized to optimize growth conditions. Modeling is also used shown in FIG. 2. This example also provides a method for to design gene knockouts that additionally optimize utiliza engineering a strain that overproduces muconate. tion of the pathway (see, for example, U.S. patent publica 0257 Escherichia coli is used as a target organism to tions US 2002/0012939, US 2003/0224363, US 2004/ engineer a muconate-producing pathway as shown in FIG. 5. 0029149, US 2004/0072723, US 2003/0059792, US 2002/ E. coli provides a good host for generating a non-naturally O168654 and US 2004/0009466, and in U.S. Pat. No. 7,127, occurring microorganism capable of producing muconate. E. 379). Modeling analysis allows reliable predictions of the coli is amenable to genetic manipulation and is known to be effects on cell growth of shifting the metabolism towards capable of producing various products, like ethanol, acetic more efficient production of muconate. One modeling acid, formic acid, lactic acid, and Succinic acid, effectively method is the bilevel optimization approach, OptKnock (Bur under anaerobic, microaerobic or aerobic conditions. gard et al., Biotechnol. Bioengineer: 84:647-657 (2003)), 0258 First, an E. coli strain is engineered to produce which is applied to select gene knockouts that collectively muconate from succinyl-CoA via the route outlined in FIG.2. result in better production of muconate. Adaptive evolution For the first stage of pathway construction, genes encoding also can be used to generate better producers of, for example, enzymes to transform central metabolites Succinyl-CoA and the 4-acetylbutyrate intermediate or the muconate product. acetyl-CoA to 2-maleylacetate (FIG. 2, Step A) is assembled Adaptive evolution is performed to improve both growth and onto vectors. In particular, the genes pcaF (AAA85138), production characteristics (Fong and Palsson, Nat. Genet. pcalf (AAN69545 and NP 746082) and clcE (O30847) 36:1056-1058 (2004); Alper et al., Science 314:1565-1568 genes encoding beta-ketothiolase, beta-ketoadipyl-CoA (2006)). Based on the results, subsequent rounds of modeling, transferase and 2-maleylacetate reductase, respectively, are genetic engineering and adaptive evolution can be applied to cloned into the pZE13 vector (Expressys, Ruelzheim, Ger the muconate producer to further increase production. many), under the control of the PA1/lacO promoter. The 0263 For large-scale production of muconate, the above genes bdh (AAA58352.1) and fumC (P05042.1), encoding muconate pathway-containing organism is cultured in a fer 2-maleylacetate dehydrogenase and 3-hydroxy-4-hexenedio menter using a medium known in the art to Support growth of ate dehydratase, respectively, are cloned into the pZA33 vec the organism under anaerobic conditions. Fermentations are tor (Expressys, Ruelzheim, Germany) under the PA1/lacO performed in either a batch, fed-batch or continuous manner. promoter. The two sets of plasmids are transformed into E. Anaerobic conditions are maintained by first sparging the US 2011/O124911 A1 May 26, 2011 43 medium with nitrogen and then sealing culture vessel (e.g., tor for glucose and alcohols, and a UV detector for organic flasks can be sealed with a septum and crimp-cap). acids, Lin et al., Biotechnol. Bioeng, 775-779 (2005). Microaerobic conditions also can be utilized by providing a 0264. Throughout this application various publications small hole for limited aeration. The pH of the medium is maintained at a pH of 7 by addition of an acid, such as HSO. have been referenced. The disclosures of these publications in The growth rate is determined by measuring optical density their entireties are hereby incorporated by reference in this using a spectrophotometer (600 nm), and the glucose uptake application in order to more fully describe the state of the art rate by monitoring carbon Source depletion over time. to which this invention pertains. Although the invention has Byproducts such as undesirable alcohols, organic acids, and been described with reference to the examples provided residual glucose can be quantified by HPLC (Shimadzu) with above, it should be understood that various modifications can an HPX-087 column (BioRad), using a refractive index detec be made without departing from the spirit of the invention.

SEQUENCE LISTING

<16 Os NUMBER OF SEO ID NOS: 5 O

<21 Os SEQ ID NO 1 &211s LENGTH: 2O 212s. TYPE: PRT <213> ORGANISM: Euglena gracilis

<4 OOs SEQUENCE: 1 Met Thr Tyr Lys Ala Pro Wall Lys Asp Wall Lys Phe Lieu. Lieu. Asp 1. 5 1O 15 Val Phe Llys Val 2O

SEO ID NO 2 LENGTH: 6 TYPE PRT ORGANISM: Artificial Sequence FEATURE; OTHER INFORMATION: Description of Artificial Sequence: Synthetic 6xHis tag <4 OOs SEQUENCE: 2

His His His His His His 1. 5

SEO ID NO 3 LENGTH: 26 TYPE: DNA ORGANISM: Artificial Sequence FEATURE; OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer

<4 OOs SEQUENCE: 3

atgacgc.gtg aagtgg tagt ggtaag 26

SEO ID NO 4 LENGTH: 2O TYPE: DNA ORGANISM: Artificial Sequence FEATURE; OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer

<4 OOs SEQUENCE: 4 gatacgctcg aagatggcgg

<21 Os SEQ ID NO 5 &211s LENGTH: 1185 &212s. TYPE: DNA

US 2011/O124911 A1 May 26, 2011 50

- Continued Cttaaggatg taccagcagt agatttagga gct acagcta taaaggaagc agittaaaaaa 12 O gCaggaataa alaccagagga tigittaatgaa gtcattt tag galaatgttct tcaag Caggit 18O ttaggacaga atccagdaag acaggcatct tittaaag cag gattaccagt tdaaatticca 24 O gctatgacta ttaataaggit ttgttggttca ggact tagaa cagttagctt agcagcacala 3OO attataaaag Caggagatgc tigacgtaata at agc aggtg gtatggaaaa tatgtct aga 360 gctic ct tact tagcgaataa cqctagatgg ggatatagaa tdggaaacgc taaatttgtt 42O gatgaaatga t cactgacgg attgttgggat gcatttaatg attaccacat gggaataa.ca 48O gCagaaaa.ca tagctgagag atggalacatt toaa.gagaag aacaagatga gtttgct Ctt 54 O gcatcacaaa aaaaagctga agaagctata aaatcagg to aatttaaaga tigaaatagitt 6OO Cctgtag taa ttalaaggcag aaagggagaa actgtagttg atacagatga gcaccct aga 660 tittggat caa citatagaagg acttgcaaaa ttaaaacct g c ctitcaaaaa agatggalaca 72 O gttacagctg gtaatgcatc aggattaaat gactgtgcag cagtacttgt aat catgagt 78O gCagaaaaag Ctaaagagct tagtaaaa C cacttgcta agatagttt C titatggttca 84 O gCaggagttg acc cagcaat aatgggat at ggacctttct atgcaacaaa agcagctatt 9 OO gaaaaagcag gttgga cagt tatgaatta gatttaatag aatcaaatga agcttittgca 96.O gctcaaagtt tag cagtagc aaaagattta aaatttgata tdaataaagt aaatgtaaat 1 O2O ggaggagcta ttgccCttgg to atc caatt ggagcatcag gtgcaagaat act cqttact 108 O Cttgtacacg caatgcaaaa aagagatgca aaaaaaggct tagcaactitt atgtataggit 114 O ggcggacaag galacagcaat attgctagala aagtgctag 1179

<210s, SEQ ID NO 24 &211s LENGTH: 37 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic prlmer

<4 OOs, SEQUENCE: 24 atgagagatg tagtaatagt aagtgctgta agaactg 37

<210s, SEQ ID NO 25 &211s LENGTH: 28 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer

<4 OOs, SEQUENCE: 25 gtct ctitt ca actacgagag ctgttc.cc 28

<210s, SEQ ID NO 26 &211s LENGTH: 1179 &212s. TYPE: DNA <213> ORGANISM: Clostridium acetobutyllicum

<4 OOs, SEQUENCE: 26 atgagagatg tagtaatagt aagtgctgta agaactgcaa taggagcata tigaaaaa.ca 6 O ttaaaggatg tacctgcaac agagttagga gct at agtaa taaaggaagc tigtaagaaga 12 O US 2011/O124911 A1 May 26, 2011 51

- Continued gctaatataa atccaaatga gattaatgaa gttatttittg gaaatgtact tcaagctgga 18O ttaggc.calaa accCagdaag acaag cagca gtaaaag cag gattacctitt agaalacacct 24 O gcqtttacaa totaataaggit ttgtggttca ggtttaagat citataagttt agcagct caa 3OO attataaaag Ctggagatgc tigataccatt gtag taggtg gtatggaaaa tatgtct aga 360 t caccatatt tattaacaa t cagagatgg ggtcaaagaa tiggagatag taattagtt 42O gatgaaatga taaaggatgg tttgttgggat gcatttaatg gat at catat gggagta act 48O gCagaaaata ttgcagaa.ca atggaatata acaagagaag agcaagatga attitt cactt 54 O atgtcacaac aaaaagctga aaaagccatt aaaaatggag aatttaagga tigaaatagitt 6OO cctg tattaa taaagacitaa aaaaggtgaa atagt ctittg atcaagatga atttic ct aga 660 titcggaaa.ca citattgaagc attaagaaaa cittaa accta ttittcaagga aaatgg tact 72 O gttacagcag gtaatgcatc. c99attaaat gatggagctg. Cagcact agt aataatgagc 78O gctgataaag ctaacgct ct cqgaataaaa ccacttgcta agattacttic titacggat.ca 84 O tatggggtag atc.cat caat aatgggat at ggagctttitt atgcaactaa agctgcctta 9 OO gataaaatta atttaaaacc tdaag actta gatttaattig aagctaacga goggatatgct 96.O t citcaaagta tag cagtaac tagagattta aatttagata tdagtaaagt taatgttaat 1 O2O ggtggagcta tag cacttgg acatccalata ggtgcatctg gtgcacgitat tittagta aca 108 O ttactatacg ctatogcaaaa aagagattica aaaaaagg to ttgctactict atgtattggit 114 O ggaggit cagg galacagct ct cqtagttgaa agagactaa 1179

<210s, SEQ ID NO 27 &211s LENGTH: 31 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer

<4 OOs, SEQUENCE: 27 atgttcaaga aat cagotaa tdatattgtt g 31

<210s, SEQ ID NO 28 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer

<4 OOs, SEQUENCE: 28 Ctcgittagca aacaaggcag cq 22

<210s, SEQ ID NO 29 &211s LENGTH: 1182 &212s. TYPE: DNA <213> ORGANISM: Candida albicans

<4 OOs, SEQUENCE: 29 atgttcaaga aat cagotaa tdatattgtt gttattgcag caaagagaac tocaat cacc 6 O aagttcaatta aaggtgggitt gagtagatta titt Cotgagg aaat attata t caagtggitt 12 O aaggg tactg. t at Cagattic acaagttgat ttaaacttga ttgatgatgt gttagt cq9t 18O US 2011/O124911 A1 May 26, 2011 52

- Continued acggtcttgc aaactittagg gggacagaaa got agtgcct tcc attaa aaagattgga 24 O titcc caatta agaccacggit taatacggtc. aatcgtcaat gtgctagttctgct caag.cg 3OO attactitatic aag Cagg tag tittgcgtagt ggggagaatc aatttgct at totgctgga 360 gtagaaagta tact catga ttattitt.cct catcgtggga titc.ccacaag aatttctgaa 42O t catttittag citgatgcatc cqatgaagct aaaaacgt.ct tdatgccaat ggggata acc 48O agtgaaaatgttgccactaa atatggaatt tot cqtaaac aacaagatga gtttgcc citt 54 O aattct catt togaaag caga caaggctaca aaactggg to attittgcaaa agaaatcatt 6OO cctatt caaa caacggatga aaacaaccaa cacgtttcaa taaccaaaga tigatggtata 660 aggggaagtt Caacaattga aaagttgggt ggcttaaaac Ctgttgttcaa ggatgatggg 72 O actact actg ctggtaattic ct cqcaaatt toagatggag gigtctgctgt gattittaact 78O acticgtcaaa atgctgagaa atcgggagta aagcc-aatag ctagattitat tdgttcgt.ca 84 O gtagctggtg titcctt.cggg act tatggga attggtc.cat C9gctgctat tcct caattg 9 OO ttgtc.gagat taaatgttga cacgaaagac attgatattt ttgaattgaa cdaggcattt 96.O gcatcc caac tdatttattg tattgaaaaa ttgggtc.ttg attatgataa agt caatcca 1 O2O tatggtggag ctatagcctt gggacatcca ttaggagcca Ctggcgcaag agttacggca 108 O acgttgctta atggattaaa agat Cagaat aaagagttgg gtgtcatct C aatgtgcaca 114 O tcca Cagg to aaggatacgc tigc Cttgttt gctaacgagt ag 1182

<210s, SEQ ID NO 3 O &211s LENGTH: 38 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic prlmer

<4 OOs, SEQUENCE: 30 atggatagat taaatcaatt aagtggtcaa ttaaaacc 38

<210s, SEQ ID NO 31 &211s LENGTH: 26 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic prlmer

<4 OOs, SEQUENCE: 31 titcc ttaatc aatatggagg cagcac 26

<210s, SEQ ID NO 32 &211s LENGTH: 1227 &212s. TYPE: DNA <213> ORGANISM: Candida albicans

<4 OOs, SEQUENCE: 32 atggatagat taaatcaatt aagtggtcaa ttaaaac caa cittcaaaa.ca atc cct tact 6 O caaaagaacc Cagacgatgt tt catcgtt gcagcataca gaactgc.cat cqgtaaaggt 12 O ttcaaagggit ctittcaaatc tdtgcaatct gaatt catct tdactgaatt cittgaaagaa 18O tittattaaaa agactggagt cqatgcatct ttgattgaag atgttgctat tdgtaacgtt 24 O

US 2011/O124911 A1 May 26, 2011 59

- Continued tgtgtcgttc catcCaactg tdgacaagtt cct gcc.cgt.c aag.cgacact tdgagctgga 3OO tgcgatcc tt cqacaatcgt tacaact citc aataaattgt gcgcct cqgg aatgaagttcg 360 attgcttgttg cc.gc.ct cact tttgcaactt ggit cittcaag aggttaccgt. tggtggcggit 42O atggaga.gca tagottagt gcc.gtact at Cttgaacgtg gtgaaactac titatggtgga 48O atgaagct catcgacggitat cccaa.gagat ggtc.cgactg atgcatatag taatcaactt. 54 O atgggtgcat gcgctgataa ttggctaaa cattcaa.ca to accc.gtga ggaac aggat 6OO aaatt.cgcta ttgaaagcta taaacgatct gctgctgcat gggagagtgg agcatgcaaa 660 gctgaagtag titcct attga agtgacaaag ggcaagaaaa Catacattgt Caacaaggat 72 O gaggaataca toaaagt caa citt cq agaag ctitcc caaac toga aaccc.gc cittcttgaaa 78O gacggalacca t cacggctgg caatgctt.ca acactgaacg atggtgctgc ggcagttgttg 84 O atgacgactg. tcgaaggagc gaaaaaatac ggtgttgaaac cattggc.ccg attgct citca 9 OO tatggtgatg cqgcaacaaa to cagt cqat tittgctattg cac catcaat ggittatcc.ca 96.O alagg tactta aattggctaa t ct cagat.c aaggatattg atttgttggga aat caacgag 1 O2O gctitt.cgc.cg ttgttc.ccct t cattcaatgaagacact cq gitat catca Ctcgaaagtg 108 O alacatt catg gtggtggcgt at Ctcttgga catcc tattg gaatgtctgg agct cqaatt 114 O atcgttcatc tatto atgc gttgaaacct ggc.ca.gaaag gctg.cgctgc aatctgcaat 12 OO ggtggcggtg gcgctggtgg aatggtcatC gagaaattgt aa 1242

1. A non-naturally occurring microbial organism, compris B) (1) beta-ketothiolase, (2) an enzyme selected from beta ing a microbial organism having a muconate pathway com ketoadipyl-CoA hydrolase, beta-ketoadipyl-CoA trans prising at least one exogenous nucleic acid encoding a ferase and beta-ketoadipyl-CoA ligase, (3) 2-maleylac muconate pathway enzyme expressed in a sufficient amount etate reductase, (4) 2-maleylacetate dehydrogenase, (5) to produce muconate, said muconate pathway comprising an cis-3-hydroxy-4-hexendioate dehydratase, and (6) muconate cis/trans isomerase; enzyme selected from the group consisting of a beta-ketothio C) (1) beta-ketothiolase, (2) an enzyme selected from beta lase, a beta-ketoadipyl-CoA hydrolase, a beta-ketoadipyl ketoadipyl-CoA hydrolase, beta-ketoadipyl-CoA trans CoA transferase, a beta-ketoadipyl-CoA ligase, a 2-fumary ferase and beta-ketoadipyl-CoA ligase, (3) 2-maleylac lacetate reductase, a 2-fumarylacetate dehydrogenase, a etate reductase, (4) an enzyme selected from trans-3-hydroxy-4-hexendioate dehydratase, a 2-fumarylac 2-maleylacetate aminotransferase and 2-maleylacetate etate aminotransferase, a 2-fumarylacetate aminating oxi aminating oxidoreductase, (5) cis-3-amino-4-hexenoate doreductase, a trans-3-amino-4-hexenoate deaminase, a beta deaminase, and (6) muconate cis/trans isomerase; D) (1) beta-ketothiolase, (2) beta-ketoadipyl-CoA dehy ketoadipate enol-lactone hydrolase, a muconolactone drogenase, (3) 3-hydroxyadipyl-CoA dehydratase, (4) isomerase, a muconate cycloisomerase, a beta-ketoadipyl an enzyme selected from 2,3-dehydroadipyl-CoA trans CoA dehydrogenase, a 3-hydroxyadipyl-CoA dehydratase, a ferase, 2,3-dehydroadipyl-CoA hydrolase and 2,3-dehy 2,3-dehydroadipyl-CoA transferase, a 2.3-dehydroadipyl droadipyl-CoA ligase, and (5) muconate reductase; CoA hydrolase, a 2.3-dehydroadipyl-CoA ligase, a muconate E) (1) beta-ketothiolase, (2) an enzyme selected from beta reductase, a 2-maleylacetate reductase, a 2-maleylacetate ketoadipyl-CoA hydrolase, beta-ketoadipyl-CoA trans dehydrogenase, a cis-3-hydroxy-4-hexendioate dehydratase, ferase and beta-ketoadipyl-CoA ligase, (3)2-fumarylac a 2-maleylacetate aminoatransferase, a 2-maleylacetate ami etate reductase, (4) 2-fumarylacetate dehydrogenase, nating oxidoreductase, a cis-3-amino-4-hexendioate deami and (5) trans-3-hydroxy-4-hexendioate dehydratase; nase, and a muconate cis/trans isomerase. F) (1) beta-ketothiolase, (2) an enzyme selected from beta 2. The non-naturally occurring microbial organism of ketoadipyl-CoA hydrolase, beta-ketoadipyl-CoA trans claim 1, wherein said muconate pathway comprises a set of ferase and beta-ketoadipyl-CoA ligase, (3)2-fumarylac muconate pathway enzymes, said set of muconate pathway etate reductase, (4) an enzyme selected from enzymes selected from the group consisting of 2-fumarylacetate aminotransferase and 2-fumarylac A)(1) beta-ketothiolase, (2) an enzyme selected from beta etate aminating oxidoreductase, and (5) trans-3-amino ketoadipyl-CoA hydrolase, beta-ketoadipyl-CoA trans 4-hexenoate deaminase. ferase, and beta-ketoadipyl-CoA ligase, (3) beta-ketoa 3. The non-naturally occurring microbial organism of dipate enol-lactone hydrolase, (4) muconolactone claim 2, wherein said microbial organism comprises two isomerase, (5) muconate cycloisomerase, and (6) a exogenous nucleic acids each encoding a muconate pathway muconate cis/trans isomerase; enzyme. US 2011/O124911 A1 May 26, 2011 60

4. The non-naturally occurring microbial organism of 23. The non-naturally occurring microbial organism of claim 2, wherein said microbial organism comprises three claim 20, wherein said microbial organism comprises four exogenous nucleic acids each encoding a muconate pathway exogenous nucleic acids each encoding a muconate pathway enzyme. enzyme. 5. The non-naturally occurring microbial organism of 24. The non-naturally occurring microbial organism of claim 2, wherein said microbial organism comprises four claim 19, wherein said at least one exogenous nucleic acid is exogenous nucleic acids each encoding a muconate pathway a heterologous nucleic acid. enzyme. 25. The non-naturally occurring microbial organism of 6. The non-naturally occurring microbial organism of claim 19, wherein said non-naturally occurring microbial claim 2, wherein said microbial organism comprises five organism is in a Substantially anaerobic culture medium. exogenous nucleic acids each encoding a muconate pathway 26. A method for producing muconate, comprising cultur enzyme. ing the non-naturally occurring microbial organism accord 7. The non-naturally occurring microbial organism of ing to claim 19, under conditions and for a sufficient period of claim 2, wherein said microbial organism comprises six time to produce muconate. exogenous nucleic acids each encoding a muconate pathway 27.-32. (canceled) enzyme. 33. A non-naturally occurring microbial organism, com 8. The non-naturally occurring microbial organism of prising a microbial organism having a muconate pathway claim 1, wherein said at least one exogenous nucleic acid is a comprising at least one exogenous nucleic acid encoding a heterologous nucleic acid. muconate pathway enzyme expressed in a sufficient amount 9. The non-naturally occurring microbial organism of to produce muconate, said muconate pathway comprising an claim 1, wherein said non-naturally occurring microbial enzyme selected from the group consisting of an HODH organism is in a Substantially anaerobic culture medium. aldolase, an OHED hydratase, an OHED decarboxylase, an HODH formate-lyase, an HODH dehydrogenase, an OHED 10. A method for producing muconate, comprising cultur formate-lyase, an OHED dehydrogenase, a 6-OHE dehydro ing the non-naturally occurring microbial organism accord genase, a 3-hydroxyadipyl-CoA dehydratase, a 2.3-dehy ing to claim 1, under conditions and for a sufficient period of droadipyl-CoA hydrolase, a 2,3-dehydroadipyl-CoA trans time to produce muconate according to claim 1. ferase, a 2.3-dehydroadipyl-CoA ligase, and a muconate 11.-18. (canceled) reductase. 19. A non-naturally occurring microbial organism, com 34. The non-naturally occurring microbial organism of prising a microbial organism having a muconate pathway claim 33, wherein said muconate pathway comprises a set of comprising at least one exogenous nucleic acid encoding a muconate pathway enzymes, set of muconate pathway muconate pathway enzyme expressed in a sufficient amount enzymes selected from the group consisting of to produce muconate, said muconate pathway comprising an A) (1) HODH aldolase, (2) OHED hydratase, (3) OHED enzyme selected from the group consisting of a 4-hydroxy decarboxylase, (4) 6-OHE dehydrogenase, and (5) 2-ketovalerate aldolase, a 2-oxopentenoate hydratase, a 4-OX muconate reductase; alocrotonate dehydrogenase, a 2-hydroxy-4-hexenedioate B) (1) HODH aldolase, (2) OHED hydratase, (3) an dehydratase, a 4-hydroxy-2-oxohexanedioate oxidoreduc enzyme selected from OHED formate-lyase and OHED tase, a 2,4-dihydroxyadipate dehydratase (acting on 2-hy dehydrogenase, (4) an enzyme selected from 2,3-dehy droxy), a 2,4-dihydroxyadipate dehydratase (acting on 4-hy droadipyl-CoA hydrolase, 2,3-dehydroadipyl-CoA droxyl group) and a 3-hydroxy-4-hexenedioate dehydratase. transferase and 2,3-dehydroadipyl-CoA ligase, and (5) 20. The non-naturally occurring microbial organism of muconate reductase; and claim 19, wherein said muconate pathway comprises a set of C) (1) HODH aldolase, (2) an enzyme selected from muconate pathway enzymes, said set of muconate pathway HODH formate-lyase and HODH dehydrogenase, (3) enzymes selected from the group consisting of 3-hydroxyadipyl-CoA dehydratase, (4) an enzyme A) (1) 4-hydroxy-2-ketovalerate aldolase, (2) 2-oxopen selected from 2,3-dehydroadipyl-CoA hydrolase, 2,3- tenoate hydratase, (3) 4-oxalocrotonate dehydrogenase, dehydroadipyl-CoA transferase and 2,3-dehydroadipyl (4) 2-hydroxy-4-hexenedioate dehydratase; CoA ligase, and (5) muconate reductase B) (1) 4-hydroxy-2-ketovalerate aldolase, (2) 4-hydroxy 35. The non-naturally occurring microbial organism of 2-oxohexanedioate oxidoreductase, (3)2,4-dihydroxya claim 34, wherein said microbial organism comprises two dipate dehydratase (acting on 2-hydroxy), (4) 3-hy exogenous nucleic acids each encoding a muconate pathway droxy-4-hexenedioate dehydratase; and enzyme. C) (1) 4-hydroxy-2-ketovalerate aldolase, (2) 4-hydroxy 36. The non-naturally occurring microbial organism of 2-oxohexanedioate oxidoreductase, (3)2,4-dihydroxya claim 34, wherein said microbial organism comprises three dipate dehydratase (acting on 4-hydroxyl group), (4) exogenous nucleic acids each encoding a muconate pathway 2-hydroxy-4-hexenedioate dehydratase. enzyme. 21. The non-naturally occurring microbial organism of 37. The non-naturally occurring microbial organism of claim 20, wherein said microbial organism comprises two claim 34, wherein said microbial organism comprises four exogenous nucleic acids each encoding a muconate pathway exogenous nucleic acids each encoding a muconate pathway enzyme. enzyme. 22. The non-naturally occurring microbial organism of 38. The non-naturally occurring microbial organism of claim 20, wherein said microbial organism comprises three claim 34, wherein said microbial organism comprises five exogenous nucleic acids each encoding a muconate pathway exogenous nucleic acids each encoding a muconate pathway enzyme. enzyme. US 2011/O124911 A1 May 26, 2011

39. The non-naturally occurring microbial organism of 52. The non-naturally occurring microbial organism of claim 33, wherein said at least one exogenous nucleic acid is claim 49, wherein said microbial organism comprises four a heterologous nucleic acid. exogenous nucleic acids each encoding a muconate pathway 40. The non-naturally occurring microbial organism of enzyme. claim 33, wherein said non-naturally occurring microbial organism is in a Substantially anaerobic culture medium. 53. The non-naturally occurring microbial organism of 41. A method for producing muconate, comprising cultur claim 49, wherein said microbial organism comprises five ing the non-naturally occurring microbial organism accord exogenous nucleic acids each encoding a muconate pathway ing to claim 33, underconditions and for a sufficient period of enzyme. time to produce muconate. 54. The non-naturally occurring microbial organism of 42.-47. (canceled) claim 49, wherein said microbial organism comprises six 48. A non-naturally occurring microbial organism, com exogenous nucleic acids each encoding a muconate pathway prising a microbial organism having a muconate pathway enzyme. comprising at least one exogenous nucleic acid encoding a 55. The non-naturally occurring microbial organism of muconate pathway enzyme expressed in a sufficient amount claim 48, wherein said at least one exogenous nucleic acid is to produce muconate, said muconate pathway comprising an a heterologous nucleic acid. enzyme selected from the group consisting of a lysine ami notransferase, a lysine aminating oxidoreductase, a 2-ami 56. The non-naturally occurring microbial organism of noadipate semialdehyde dehydrogenase, a 2-aminoadipate claim 48, wherein said non-naturally occurring microbial deaminase, a muconate reductase, alysine-2,3-aminomutase, organism is in a Substantially anaerobic culture medium. a 3,6-diaminohexanoate aminotransferase, a 3,6-diamino 57. A method for producing muconate, comprising cultur hexanoateaminating oxidoreductase, a 3-aminoadipate semi ing the non-naturally occurring microbial organism accord aldehyde dehydrogenase, and a 3-aminoadipate deaminase. ing to claim 48, under conditions and for a sufficient period of 49. The non-naturally occurring microbial organism of time to produce muconate. claim 48, wherein said muconate pathway comprises a set of 58-65. (canceled) muconate pathway enzymes, set of muconate pathway 66. A semi-synthetic method for synthesizing terephthalate enzymes selected from the group consisting of (PTA) comprising preparing muconic acid by culturing an A) (1) lysine aminotransferase, (2) lysine aminating oxi organism of any one of claims, 2, 20, 34, or 49, reacting said doreductase, (3) 2-aminoadipate semialdehyde dehy muconic acid with acetylene to form a cyclohexadiene drogenase, (4) 2-aminoadipate deaminase, and (5) adduct, and oxidizing said cyclohexadiene adduct to form muconate reductase PTA. B) (1) lysine-2,3-aminomutase, (2)3,6-diaminohexanoate aminotransferase, (3) 3,6-diaminohexanoate aminating 67. The method of claim 66, further comprising isolating oxidoreductase, (4) 3-aminoadipate semialdehyde muconic acid prior to reacting with acetylene. dehydrogenase, (5) 3-aminoadipate deaminase, and (6) 68. The method of claim 66, wherein the step of reacting muconate reductase. said muconic acid with acetylene comprises adding acetylene 50. The non-naturally occurring microbial organism of to the culture broth. claim 49, wherein said microbial organism comprises two 69. The method of claim 68, wherein the culture broth is exogenous nucleic acids each encoding a muconate pathway filtered prior to adding acetylene. enzyme. 70. The method of claim 68, wherein said step of oxidizing 51. The non-naturally occurring microbial organism of said cyclohexadiene adduct comprises adding air or oxygen claim 49, wherein said microbial organism comprises three to the culture broth. exogenous nucleic acids each encoding a muconate pathway enzyme.