The Junction the Folding of the Hairpin Ribozyme

Downloaded from www.rnajournal.org on February 14, 2006

The folding of the hairpin ribozyme: dependence on the loops and the junction

Z. Y. Zhao, T. J. Wilson, K. Maxwell and D. M. Lilley

RNA 2000 6: 1833-1846

References Article cited in: http://www.rnajournal.org/cgi/content/abstract/6/12/1833#otherarticles Email alerting Receive free email alerts when new articles cite this article - sign up in the box at the service top right corner of the article or click here

Notes

To subscribe to RNA go to: http://www.rnajournal.org/subscriptions/

The folding of the hairpin ribozyme: Dependence on the loops and the junction

ZHENG-YUN ZHAO, TIMOTHY J. WILSON, KAERA MAXWELL, and DAVID M.J. LILLEY CRC Nucleic Acid Structure Research Group, Department of Biochemistry, The University of Dundee, Dundee DD1 4HN, United Kingdom

ABSTRACT In its natural context, the hairpin ribozyme is constructed around a four-way helical junction. This presents the two loops that interact to form the active site on adjacent arms, requiring rotation into an antiparallel structure to bring them into proximity. In the present study we have compared the folding of this form of the ribozyme and subspecies lacking either the loops or the helical junction using fluorescence resonance energy transfer. The complete ribozyme as a four-way junction folds into an antiparallel structure by the cooperative binding of magnesium ions, requiring 21 20–40 mM for half-maximal extent of folding ([Mg ]1/2) and a Hill coefficient n 5 2. The isolated junction (lacking the loops) also folds into a corresponding antiparallel structure, but does so noncooperatively (n 5 1) at a higher 21 magnesium ion concentration ([Mg ]1/2 5 3 mM). Introduction of a G 1 1A mutation into loop A of the ribozyme results in a species with very similar folding to the simple junction, and complete loss of ribozyme activity. Removal of the junction from the ribozyme, replacing it either with a strand break (serving as a hinge) or a GC5 bulge, results in 21 greatly impaired folding, with [Mg ]1/2 . 20 mM. The results indicate that the natural form of the ribozyme undergoes ion-induced folding by the cooperative formation of an antiparallel junction and loop–loop interaction to generate the active form of the ribozyme. The four-way junction thus provides a scaffold in the natural RNA that facilitates the folding of the ribozyme into the active form. Keywords: FRET; RNA folding; RNA catalysis

INTRODUCTION ceeds with inversion of configuration at the phosphorus (van Tol et al+, 1990; Koizumi & Ohtsuka, 1991)+ This RNA conformation and function are tightly linked+ Cat- indicates that the cleavage reaction occurs by an at- alytic RNA molecules (ribozymes) must undergo fold- tack of the oxygen atom of the 29-hydroxyl group on the ing into their correct three-dimensional structure to be 39 phosphorus atom by an S 2 mechanism+ It is prob- catalytically active, and mutations that cause aberrant N able that a part of the origin of catalysis lies in a local folding lead to loss of activity+ There is a very important distortion of RNA structure to facilitate the correct jux- electrostatic component in the folding process of RNA, taposition of attacking nucleophile and leaving group in arising from the highly charged phosphodiester back- the transition state of the reaction+ In the context of the bone, and thus metal ions play a critical role in stabi- local environment of the ribozyme active site, this leads lizing the folded structures+ to accelerated cleavage+ The linkage between folding and function is well il- There are a number of nucleolytic ribozymes that lustrated in the small nucleolytic ribozymes (Lilley, 1999)+ appear to proceed via essentially the same chemical These are relatively small RNA species that catalyze mechanism+ These include the hammerhead (Hutchins site-specific cleavage of the RNA backbone+ The prod- et al+, 1986; Forster & Symons, 1987; Uhlenbeck, 1987; ucts of the cleavage reaction are 59-hydroxyl and 29,39- Hazeloff & Gerlach, 1988), hairpin (Buzayan et al+, 1986; cyclic phosphate termini (Buzayan et al+, 1986; Hutchins Feldstein et al+, 1989; Hampel & Tritz, 1989), hepatitis et al+, 1986; Uhlenbeck, 1987), and the reaction pro- delta virus (Sharmeen et al+, 1988; Wu et al+, 1989) and Neurospora VS (Saville & Collins, 1990) ribozymes+ Reprint requests to: David M+J+ Lilley, CRC Nucleic Acid Structure The hairpin ribozyme (Fedor, 2000) occurs in the neg- Research Group, Department of Biochemistry, The University of Dundee, Dundee DD1 4HN, United Kingdom; e-mail: dmjlilley@ ative strand of the satellite RNA of the tobacco ringspot bad+dundee+ac+uk+ virus (Buzayan et al+, 1986; Feldstein et al+, 1989; 1833 Downloaded from www.rnajournal.org on February 14, 2006

1834 Z.-Y. Zhao et al.

Hampel & Tritz, 1989) and similar plant viruses cleavage activity consists of the two duplexes contain- (DeYoung et al+, 1995), where it is required for the gen- ing the A- and B-loops, hinged at the continuous strand eration of the unit-sized 359-nt satellite RNA molecules that connects them+ Cleavage occurs in the A-loop following rolling circle replication+ The motif catalyzes (Fig+ 1A, arrow)+ Most of the bases and functional groups self-cleavage in the presence of magnesium ions, to- that are essential for catalytic activity lie in the two gether with the reverse ligation reaction (Buzayan et al+, loops (Berzal-Herranz et al+, 1993; Chowrira et al+, 1993; 1986), leading to an equilibrium between cleavage and Anderson et al+, 1994; Grasby et al+, 1995; Schmidt ligation (Hegg & Fedor, 1995)+ et al+, 1996; Siwkowski et al+, 1997; Shippy et al+, 1998; Figure 1A shows the proposed secondary structure Ryder & Strobel, 1999; Young et al+, 1999), and it was of the tobacco ringspot virus satellite RNA in the region therefore anticipated that these loops must interact to of the hairpin ribozyme+ The minimal form that retains generate the active form of the ribozyme+ This was

FIGURE 1. The hairpin ribozyme in its natural context as a four-way helical junction+ A: Schematic showing the local secondary structure of the tobacco ringspot virus satellite (Ϫ) RNA in the region of the hairpin ribozyme+ The essential elements for RNA catalysis are the two loops, A and B, and ribozyme cleavage occurs at the position indicated by the arrow+ B: The base sequence of and around the hairpin ribozyme (Hampel & Tritz, 1989)+ The four arms of the junction are labeled A through D in a circular manner, where arms A and B contain the A and B loops, respectively+ The strands are designated with lower case letters, taken from the name of the arm in which the 59-terminus of the strand is located+ C: The hairpin ribozyme drawn in an antiparallel orientation+ This conformer is formed by coaxial stacking of arms B on C and A on D, whereupon b and d are continuous strands whereas strands a and c exchange between helical axes+ D: An example of a fluorophore-labeled hairpin ribozyme species used in FRET analysis of global structure+ The vectors are labeled according to the arms carrying donor (fluorescein) and acceptor (Cy3) in that order+ The terminal helix of arm B is 2 bp longer than in our previous studies (Murchie et al+, 1998; Walter et al+, 1998c)+ E: The sequence of loop A, showing the numbering used in the text+ The 29 modifications are introduced at A Ϫ 1, and the sequence variation at G ϩ 1+ Downloaded from www.rnajournal.org on February 14, 2006

Folding of the hairpin ribozyme 1835 generally indicated by experiments in which the loop- cooperatively on binding divalent metal ions, and the containing duplexes were connected in a variety of dif- junction must be regarded as an integral functional com- ferent ways with retention of activity (Komatsu et al+, ponent of the ribozyme+ 1994, 1996, 1997a, 1997b, Butcher et al+, 1995; Shin et al+, 1996; Earnshaw et al+, 1997)+ Close physical proximity of the ends of the arms containing the loops RESULTS has been demonstrated by fluorescence resonance energy transfer (FRET) (Murchie et al+, 1998; Walter et al+, Analysis of the global folding of the hairpin 1998d)+ NMR structures have been derived for the A- ribozyme using FRET , +, (Cai & Tinoco 1996) and B- (Butcher et al 1999) loops We have used FRET for the analysis of the global struc- , in isolation and models have been proposed for the ture of the hairpin ribozyme in its four-way junction manner of the interaction between the two loops via form (Murchie et al+, 1998; Walter et al+, 1998c), and +, , backbone (Earnshaw et al 1997 2000) and base (Pi- the isolated junction derived from it by removal of the A +, + nard et al 1999) contacts and B loops (Walter et al+, 1998b)+ In this approach we Examination of the secondary structure shows that compare the relative lengths of the six possible end- , in the natural context in the satellite RNA the loop- to-end vectors by measuring the efficiency of energy containing arms are connected not by a flexible hinge transfer (E ) between donor–acceptor fluorophore + FRET but as four arms of a perfect four-way helical junction pairs attached at pairs of 59-termini; in these experi- + The sequence around the junction is shown in Figure 1B ments we have used fluorescein and cyanine-3 (Cy-3) Four-way RNA junctions fold by pairwise coaxial stack- as a donor–acceptor pair+ The fluorescent species are , ing under all conditions into one of two alternative stack- named according to the arms carrying the fluorescent +, ; +, + ing conformers (Duckett et al 1995 Walter et al 1998a) dyes, in the order donor–acceptor (e+g+, the species AB The axes tend to remain approximately perpendicular at has fluorescein attached to the end of the A arm, and , low salt concentrations or can even generate a slightly Cy-3 attached to the end of the B arm (Fig+ 1D))+ If the , parallel structure but rotate in the direction that gives an arms are of similar lengths, the global structure can be antiparallel structure upon the addition of divalent metal deduced from this+ The length of arm B was extended + ions The four-way junction of the hairpin ribozyme by 2 bp relative to our earlier constructs (Murchie et al+, naturally adopts the stacking conformer generated by 1998; Walter et al+, 1998b, 1998c)+ The efficiency of stacking arms A on D and B on C (Murchie et al+, 1998)+ FRET is measured using the (ratio)A method of nor- Rotation of this conformer of the junction into an anti- malization of the acceptor fluorescence (Clegg, 1992)+ parallel form would bring the A- and B-arms into prox- The efficiency is inversely related to the sixth power of ; imity thus the intrinsic conformational propensity of this the distance between the fluorophores (Förster, 1948), junction brings the loops into relatively close contact, where they might interact (Fig+ 1C)+ The hairpin ribo- ϭ ϩ 6 Ϫ1, zyme is active in this junction form (Murchie et al+, 1998), EFRET {1 (R/R0) } (1) and the activity can be modulated by changing the conformational preferences of the junction (Murchie et al+, where R is the distance between the two fluorophores+ ; 1998; Thomson & Lilley, 1999)+ Comparative gel elec- R0 is the Förster length for the fluorophores used it is + trophoresis and steady-state FRET studies have shown the distance at which EFRET is half-maximal We have that with addition of divalent metal ions, the junction form recently measured the R0 for this fluorophore pair as of the ribozyme folds to give close association between 55+7 Å (Norman et al+, 2000)+ Each of the helices ter- the two loops (Murchie et al+, 1998; Walter et al+, 1998c), minates with a 59-CpC sequence to provide a constant which was confirmed by time-resolved FRET measure- environment for the fluorophores (Murchie et al+, 1989; ments (Walter et al+, 1999)+ Clegg et al+, 1992, 1993)+ The measured fluorescence These studies have demonstrated that the junction anisotropy of the terminally attached fluorescein is typ- form of the ribozyme is very stable, and as a conse- ically r ϭ 0+10 Ϫ 0+12 in the presence of 90 mM Tris- quence it is probably the functional form of the ribo- borate (pH 8+3)+ This indicates that the fluorophore is zyme in the cell+ Fedor (1999) has shown that the mobile, allowing a relatively straightforward interpreta- product complex is more stable in this form, shifting the tion of the efficiencies in terms of length without com- internal equilibrium towards the ligation reaction+ In this plications arising from the orientation of the fluorophores+ work we have made a comparison between the magnesium ion-induced folding of the ribozyme in its junc- The global folding of the hairpin ribozyme tion and minimized forms+ We find that the junction is almost unaffected by the 29-hydroxyl stabilizes the folded form such that it requires a mag- at the cleavage site nesium concentration three orders of magnitude lower than the minimal hinged or bulged form of the ribo- To prevent ribozyme-induced cleavage occurring dur- zyme+ The natural junction form of the ribozyme folds ing our FRET experiments, we have previously used a Downloaded from www.rnajournal.org on February 14, 2006

1836 Z.-Y. Zhao et al. modification of the RNA in which the riboadenine at the EFRET (Fig+ 2A), consistent with an extended struc- A Ϫ 1 cleavage position (see Fig+ 1E) is replaced by ture+ On addition of 10 mM magnesium ions there is deoxyriboadenine+ This removes the 29-hydroxyl nu- a clear change in the structure, resulting in two vec- cleophile required to attack the 39-phosphate group, tors exhibiting FRET efficiencies in excess of 0+35 replacing it with a hydrogen atom+ However, it is con- (Fig+ 2B)+ The relative pattern of efficiencies of BA Ն ceivable that this change could affect the folding of the DC . DB . CB . DA . CA is very similar to that ribozyme if it participated in the interaction between the observed for the A Ϫ 1 deoxyribose form of the ribo- A- and B-loops+ We therefore reexamined the folding of zyme in corresponding concentrations of divalent cat- the ribozyme using a different variant, having a 29-O- ions (Murchie et al+, 1998; Walter et al+, 1998b, 1998c)+ methyl group at that ribose+ This retains the oxygen It is interpreted in terms of the global structure indi- atom at the 29 position, which can be regarded as a cated schematically in Figure 2B, and shows that the smaller change to the system+ Nevertheless, this mod- structure is closely similar for the two A Ϫ 1 variants ified ribozyme is inactive+ of ribozyme at this resolution+ The structure is gener- We prepared six fluorescein-Cy3-labeled vectors and ated by the coaxial stacking of arms A on D and B measured the FRET efficiencies as a function of mag- on C, followed by a rotation to generate an antipar- nesium ion concentration+ At low magnesium ion con- allel orientation of the continuous strands of the junc- centration the six vectors have similar, low values of tion (i+e+, strands d and b; refer to Fig+ 1C)+

FIGURE 2. Ion-induced folding of a hairpin ribozyme as a function to the 29-substituent at the cleavage site+ A: FRET analysis of the global structure of the AϪ 129-O-methylribose-modified hairpin ribozyme+ Histogram of the FRET efficiencies (EFRET) for six end-to-end vectors measured in the presence of 10 mM magnesium ions+ Under these conditions the efficiency of energy transfer is low for all species, indicating an extended structure+ B: Histogram of the EFRET values measured for the same end-to-end vectors in the presence of 10 mM magnesium ions+ Under these conditions the structure has clearly changed, with BA and DC vectors exhibiting significantly higher efficiencies of energy transfer+ The pattern is consistent with the formation of the folded structure illustrated on the right+ C: Folding of the hairpin ribozyme over the range 0–400 mM magnesium ions followed by the change of EFRET for the BA vector+ The experimental data (•) were fit by regression to a simple two-state binding model, where magnesium ion binding to the RNA induces a global structural change from the extended conformation to the folded conformation+ The line shows the fit to the model, from which the values of apparent association constant and Hill coefficient were calculated+ D: FRET analysis of the global structure of the A Ϫ 1 29-OH-containing hairpin ribozyme+ Histogram of the FRET efficiencies (EFRET) for six end-to-end vectors measured in the presence of 10 mM magnesium ions+ The overall efficiency values are reduced relative to the 29-deoxyribose and 29-O- methylribose-modified hairpin ribozymes, but the general pattern indicates the same global folding, with the shortest end-to-end distance being the BA vector+ Downloaded from www.rnajournal.org on February 14, 2006

Folding of the hairpin ribozyme 1837

Titration of the BA vector (i+e+, where the fluorophores comprising a transcribed ribozyme strand together with are attached to the loop-carrying arms that approach a chemically synthesized [59-32P]-labeled substrate most closely in the folded structure) of the A Ϫ 129-O- strand (Fig+ 3A)+ This differs from the species that we methylribose hairpin ribozyme over a finer range of have used previously (Walter et al+, 1998c; Thomson & magnesium ion concentration (Fig+ 2C) shows that the Lilley, 1999) in that the junction-distal helix of arm A can folding occurs in the 0–150 mM region+ We have fitted only form 3 bp+ Thus after cleavage, the 6-nt product to these data to a simple two-state transition, in which the the 39 side of the cleavage should readily diffuse away, FRET-observable transition between conformations is and reduce the probability of religation+ The reaction induced by the binding of metal ions with an apparent was carried out in the presence of 10 mM magnesium association constant KA and a Hill coefficient n+ The ions under single-turnover conditions at 25 8C, and the proportion of junction in the antiparallel form (a) will be products analyzed by gel electrophoresis+ The prod- given by: ucts of equivalent incubations of natural sequence and G ϩ 1A substrates with the junction-form ribozyme are 2ϩ n 2ϩ n + a ϭ KA{[Mg ] /(1 ϩ KA{[Mg ] )+ (2) compared in Figure 3B Although the natural sequence gives a clear product after 5 min of incubation, none is For the AϪ 129-O-methylribose ribozyme, we obtained visible with the G ϩ 1A variant+ The experiment was a good fit to the data with a Hill coefficient n ϭ 2+0 6 0+1 repeated as a time course, and the extent of product 8 Ϫ2 + and KA ϭ 6+6 ϫ 10 M + Once again, these properties formation was quantified by phosphorimaging The data are very similar to those of the A Ϫ 129-deoxyribose are presented as a semilogarithmic plot in Figure 3C+ ribozyme+ A small decrease in apparent affinity relative We calculate an observed rate of cleavage of kobs ϭ to the deoxy- form may indicate a slight destabilization 0+05 minϪ1 for the natural sequence+ As before, we of the folded form by the additional methyl group+ detect no cleavage in corresponding experiments using We have also examined the folding of the fully ribose- the G ϩ 1A hairpin ribozyme in the junction context+ substituted (i+e+, A Ϫ 129-OH ribose) hairpin ribozyme+ We have studied the global folding of the G ϩ 1A This is competent in cleavage (see below), but it has hairpin ribozyme (Fig+ 4A) as a function of magnesium been shown that in the junction form, the internal equi- ion concentration+ The FRET efficiencies for the six librium is strongly biased towards ligation (Fedor, 1999)+ end-to-end vectors are shown in Figure 4B,C,D+ At low Our constructs have relatively long arms, and thus the magnesium ion concentrations all six vectors are char- product of cleavage should be retained in the complex acterized by low values of energy transfer (EFRET , and thus readily religated+ We have therefore exam- 0+1) (Fig+ 4B)+ In the presence of 250 mM magnesium ined the FRET efficiencies of the six end-to-end spe- ions, where the wild-type ribozyme is essentially folded cies in the presence of magnesium ions, under which with short DC and BA vectors, the mutant sequence is conditions the ribozyme should be active during the extended (Fig+ 4C)+ However, in the presence of 10 mM measurement+ At low magnesium ion concentration the magnesium ions (Fig+ 4D), the RNA has clearly folded six vectors all exhibit low extents of energy transfer into a structure characterized by relatively short DC (data not shown) indicative of a relatively extended struc- and BA vectors+ This indicates that the junction is anti- ture+ On addition of 10 mM magnesium ions the con- parallel, formed by A on D and B on C coaxial stacking formation is altered (Fig+ 2D)+ The BA vector is the of arms+ The major distinction from the folding of the shortest interfluorophore vector, indicative of the asso- wild-type sequence lies in the dependence on magne- ciation between the A and B loops+ The overall level of sium ion concentration+ Measurement of EFRET for the energy transfer is reduced, possibly because of a frac- BA vector (Fig+ 4E) shows that folding occurs in the tion of more extended RNA that has undergone ribo- 1–10 mM range of magnesium ion concentration, com- zyme cleavage+ pared to 1–150 mM for the unmutated sequence+ Analy- sis of the data for the BA vector of the G ϩ 1A hairpin ribozyme shows that they fit to a binding with a Hill The G 1 1A mutation completely prevents coefficient of n ϭ 1+0 6 0+1, and an apparent associa- folding and cleavage activity of the hairpin tion constant of 2,600 MϪ1+ Corresponding analysis of ribozyme in its junction form the DC vector gave closely similar values of n ϭ 1+1 6 Ϫ1 Burke and colleagues (Chowrira et al+, 1991) have 0+1 and KA ϭ 3,000 M + These properties are close to shown that a G ϩ 1A mutant of the hairpin ribozyme in those observed for the isolated hairpin junction, where its minimized hinged form (i+e+, lacking the four-way the formally unpaired A and B loops have been com- junction) is inactive in cleavage and fails to undergo pletely removed by complementation (Walter et al+, folding in this form (Walter et al+, 1998d)+ We have 1998b), showing that the G ϩ 1A mutation interferes therefore characterized the effect of this mutation in the with loop-loop interaction in a major way+ This is in context of the complete-junction form of the ribozyme+ good agreement with the effect of this sequence vari- To study cleavage by the wild-type and mutant hair- ation of the folding of a hinged form of the hairpin ri- pin ribozyme we have used a two-stranded construct bozyme (Walter et al+, 1998d)+ Downloaded from www.rnajournal.org on February 14, 2006

1838 Z.-Y. Zhao et al.

FIGURE 3. Cleavage rates of natural and G ϩ 1A variant hairpin ribozymes in a junction context+ A: Schematic showing the species used for analysis of cleavage+ The ribozyme strand (black) was made by transcription, and the substrate strand (gray) by chemical synthesis+ In these constructs, the 39 end of the substrate strand was short- ened to destabilize the product complex and reduce the extent of the reverse ligation reaction+ B: Comparison of RNA-mediated cleavage of the natural sequence and G ϩ 1A variant substrate strands by the junction-containing hairpin ribozyme+ Ribozyme and radioactively [59-32P]-labeled substrate strands were incubated in the presence of 10 mM magnesium ions at 25 8C for 0, 5, and 10 min+ The reaction was terminated, the substrate and product separated by electrophoresis in polyacrylamide, and visualized by exposure to storage phosphor screens+ The resulting phosphorimage is shown+ A clear product band (arrow) is evident after 5 min of incubation for the natural sequence, whereas no cleavage can be seen with the G ϩ 1A variant+ C: Time course of substrate cleavage by the junction form of the hairpin ribozyme+ Ribozyme and radioactively [59-32P]-labeled substrate strands (natural sequence and G ϩ 1A variant) were incubated in the presence of 10 mM magnesium ions at 25 8C, and aliquots removed at various times+ Products were separated by polyacrylamide gel electrophoresis and quantified by phosphorimaging+ The data are plotted in semilogarithmic form, from which rate constants were calculated+

Folding of the hinged-duplex form of the the arm was duplex+ We therefore extended the d-strand hairpin ribozyme in the 59 direction by two or more nucleotides, to generate an overhang+ As expected, these hinged forms of The great majority of studies of the hairpin ribozyme the ribozyme are active in cleavage+ Using a substrate have focused on the minimized, hinged form that lacks strand with a 5-nt overhang hinged to create a corre- the C and D arms (Hampel & Tritz, 1989; Hampel et al+, sponding hinged ribozyme, we measured a rate of kobs ϭ 1990; Chowrira et al+, 1991)+ We have therefore made 0+035 minϪ1 under single turnover conditions (Fig+ 5A)+ a direct comparison of the folding and activity of the The folding was analyzed by studying the FRET ef- ribozyme in this form with that in the junction form+ We ficiency between a fluorescein-Cy3 pair corresponding found that with a terminal overhanging guanosine on to the BA vector as a function of magnesium ion con- the b strand, we could detect no ion-induced folding centration+ This was performed for a series of over- using FRET when the 59 end of the d-strand was lo- hang lengths of 2–16 nt, and representative data for cated at the terminal U-5 of arm A, that is, when the the 5-nt overhang are shown in Figure 5B+ We found junction-proximal end of arm A was fully base paired that all these species achieved a FRET efficiency of and flush ended+ This was not a result of lowered sta- 0+35, similar to the value for the junction form of the bility of the complex, because the anisotropy of Cy3 ribozyme (although the longer B-arm in these con- attached to the end of the A arm was 0+31, showing that structs prevents an exact comparison)+ However, this Downloaded from www.rnajournal.org on February 14, 2006

Folding of the hairpin ribozyme 1839

FIGURE 4. The hairpin ribozyme G ϩ 1A variant has the folding properties of an isolated four-way helical junction+ A: Central sequence of the hairpin ribozyme G ϩ 1A variant+ B: FRET analysis of the global structure of the G ϩ 1A variant hairpin ribozyme+ Histogram of the FRET efficiencies for six end-to-end vectors measured in the absence of magnesium ions+ Under these conditions the efficiency of energy transfer is low for all species, indicating an extended structure+ C: Histo- gram of the EFRET values measured the same end-to-end vectors in the presence of 250 mM magnesium ions+ Efficiencies of energy transfer remain low under these conditions, showing that the structure remains extended+ D: Histogram of the EFRET values measured in the presence of 10 mM magnesium ions+ The BA and DC vectors exhibit significantly higher efficiencies of energy transfer in the presence of this concentration of magnesium ions, indicating that folding into an antiparallel structure has occurred+ E: Folding of the hairpin ribozyme over the range 0–16 mM magnesium ions followed by the change of EFRET for the BA vector+ The experimental data (•) were fit by regression to the simple two-state binding model, shown by the line+

folding occurred at a very much higher magnesium ion overhang), 2+0 6 0+3 (5-nt overhang), 2+0 6 0+2 (10-nt concentration, in the 10–40 mM range (compared to overhang) and 2+1 6 0+3 (16-nt overhang)+ The FRET 1–150 mM for the junction form)+ Interestingly, fitting the results show that the folding of the hinged form is clearly data to the two-state ion-induced folding model gave quite different from that of the isolated junction, or the values for the Hill coefficient of n ϭ 2+4 6 0+5 (2-nt G ϩ 1A mutant ribozyme+ Downloaded from www.rnajournal.org on February 14, 2006

1840 Z.-Y. Zhao et al.

FIGURE 5. Folding and cleavage of the hairpin ribozyme in hinged-duplex form+ A: Substrate cleavage by the hinged form of the ribozyme+ The upper insert shows a schematic of the form of the ribozyme used in these experiments+ In the data shown, the 59-overhang of the substrate strand is 5 nt in length+ The transcribed ribozyme (black) and radioactively [59-32P]-labeled synthetic substrate (gray) strands were incubated in the presence of 5 mM magnesium ions at 25 8C, and aliquots removed at various times+ Products were separated by polyacrylamide gel electrophoresis, and quantified by phosphorimaging (shown as insert, right; arrow indicates the product)+ The data are plotted in semilogarithmic form, from which rate constants were calculated+ Lanes 1–6: 0, 2, 4, 6, 8, and 10 min of incubation, respectively+ B: Folding of the hinged hairpin ribozyme over the range 0–40 mM magnesium ions followed by the change of FRET efficiency for the BA vector+ The construct used for these experiments is shown in the insert+ It was constructed from three strands, such that the b9-strand was 59-terminally labeled with fluorescein, and the a-strand was 59-terminally labeled with Cy3+ EFRET was measured as a function of magnesium ion concentration+ The experimental data (•) were fit by regression to a simple two-state binding model, shown by the line+

Folding of a bulged-duplex form with a further kinking of the axis about the bulge posi- of the hairpin ribozyme tion due to ion-induced interaction between the loops+ In contrast to the simple hinged form, fitting the data for It has been demonstrated that the four-way junction or the bulge-containing ribozyme to the two-state folding hinge-point can be replaced by a multiple-base bulge model gives a value of n ϭ 1+0 6 0+3+ with retention of cleavage activity (Komatsu et al+, 1994)+ We therefore examined the ion-induced folding of this form+ We chose to use a bulge of 6 nt, with the se- DISCUSSION quence 59 GC5 39+ The cleavage activity of the bulged ribozyme is close to that of the hinged species (Fig+ 6A), The FRET data provide us with two kinds of infor- Ϫ1 mation+ First, we obtain relative distance information with a rate of kobs ϭ 0+023 min + Folding was analyzed by studying FRET between a between pairwise terminally attached fluorophores + fluorescein-Cy3 pair corresponding to the BA vector, as (Eq (1)) from which the global shape of the RNA mol- + above+ FRET efficiency was measured as a function of ecule can be deduced This tells us that the full junction- magnesium ion concentration (Fig+ 6B)+ Base bulges form of the hairpin ribozyme is an X-shaped species are known to introduce a significant kink into the axis of with close association between the A and B arms car- + double-stranded DNA or RNA (Lilley, 1995), and this rying the loops that are important in ribozyme function can be readily studied by examining FRET between The conformation of the junction is formed by pairwise , terminally attached fluorophores (Gohlke et al+, 1994)+ coaxial stacking of arms A on D and B on C with a + We would therefore expect the bulged hairpin species rotation of the helical axes into an antiparallel structure , to be kinked even in the absence of ion-induced loop Second we observe the magnesium concentration + interactions, and we see that the FRET efficiency is 0+2 range required to induce folding of the RNA By appli- even at low magnesium ion concentrations+ However, cation of a two-state model for the folding transition we addition of magnesium ions in the range up to 50 mM can calculate an apparent association constant for metal , + results in a further shortening of the end-to-end length, ion binding (KA) and a Hill coefficient (n) with a corresponding increase in EFRET to 0+38 (at which 2ϩ KA + RNA ϩ a Mg & + point it has not reached a plateau) This is consistent unfold ^ RNAfold Downloaded from www.rnajournal.org on February 14, 2006

Folding of the hairpin ribozyme 1841

FIGURE 6. Folding and cleavage of the hairpin ribozyme in bulged-duplex form+ A: Substrate cleavage by the bulged form of the ribozyme+ The upper insert shows a schematic of the form of the ribozyme used in these experiments+ The bulge 32 comprises the sequence GC5+ The ribozyme (black) and radioactively [59- P]-labeled synthetic substrate (gray) strands were incubated in the presence of 10 mM magnesium ions at 25 8C, and aliquots removed at various times+ Products were separated by polyacrylamide gel electrophoresis, and quantified by phosphorimaging (shown as insert, right; arrow indicates the product)+ The data are plotted in semilogarithmic form, from which rate constants were calculated+ Lanes 1–6: 0, 2, 4, 6, 8, and 10 min of incubation, respectively+ B: Folding of the bulged hairpin ribozyme over the range 0–40 mM magnesium ions followed by the change of FRET efficiency for the BA vector+ The construct used for these experiments is shown in the insert+ It was constructed from two strands, such that the b9/d9-strand was 59-terminally labeled with fluorescein, and the a-strand was 59-terminally labeled with Cy3+ EFRET was measured as a function of magnesium ion concentration+ The experimental data (•) were fit by regression to a simple two-state binding model, shown by the line+

2ϩ n Ϫ1 For all the species studied here we find that the two- tude of (KA{[Mg ] ) + Thus we see that the relative state model gives a good fit to the experimental data+ stabilities of the different forms are: The different hairpin-related species can be divided into three classes, depending on the magnesium con- complete ribozyme . isolated junction . hinged form+ centration range required to induce folding (Fig+ 7)+

1+ The complete junction-form of the ribozyme folds These results are broadly in agreement with conforma- + in the micromolar range, with half-maximal folding tional populations observed by Walter et al (1999) using + occurring at a magnesium ion concentration time-resolved FRET (trFRET) measurements Using a 2ϩ 1/n two-component fluorescence decay model, they could ([Mg ]1/2 ϭ (1/KA) )of20–40mM depending on the 29 substituent+ estimate the fractions of folded and unfolded forms in + + 2+ The isolated junction in which the loops have been the presence of 12 mM magnesium ions at 17 8 8C removed by base-pair complementation folds from The steady-state and time-resolved measurements both a908axial cross into an antiparallel form with a show that the complete junction form of the ribozyme is 2ϩ more stable than the other species+ We find that this [Mg ]1/2 ϭ 3mM+ 3+ The hinged and bulged forms of the ribozyme, which form is essentially totally folded at 1 mM magnesium , retain the loops but lack the four-way helical junc- ions under our conditions while the trFRET suggests tion, require the highest magnesium ion concentra- that 5% of the molecules remain unfolded in 12 mM 2ϩ magnesium ions+ The small discrepancy may be re- tion for folding, with a [Mg ]1/2 ϭ 20–30 mM+ lated to a difference in sequences used+ Our ribozyme In the FRET experiments, we observe the conforma- has the natural satellite RNA sequence (Hampel & Tritz, tional change induced by the binding of metal ions, and 1989) between the junction and loop A (59-UGAC-39), thus the apparent binding constant will depend on the whereas the construct used by Walter et al+ (1999) free energy of this transition (⌬G8fold ϭϪRT{ln KA)+ differs in 2 bp (59-UCGC-39)+ Nearest-neighbor (and Less stable forms of the RNA will therefore require a even next-nearest-neighbor) sequence effects have higher magnesium ion concentration to drive the equi- been observed on stacking conformer population dis- librium towards the folded conformation, because the tribution in four-way DNA junctions (Grainger et al+, fraction of folded RNA is dependent upon the magni- 1998)+ The hinged species are hard to compare di- Downloaded from www.rnajournal.org on February 14, 2006

1842 Z.-Y. Zhao et al.

FIGURE 7. Summary of the ion-induced folding of the hairpin ribozyme and related species+

rectly, because significant differences in both sequence ion, and such ion-binding sites have been observed in and construction exist between groups, but estimates four-way DNA junctions (Møllegaard et al+, 1994; Eich- in the same range emerge from the two laboratories+ man et al+, 2000; van Buuren et al+, 2000), a DNA–RNA The steady-state measurements indicate that our spe- four-way junction (Nowakowski et al+, 1999), and the cies with the 5-nt overhang are 21% folded in 12 mM hammerhead ribozyme (Scott et al+, 1996)+ The four- magnesium ions, whereas the trFRET measurements way DNA junction has a box of four phosphates on the give a value of 65% of the folded form in the same minor groove side (Eichman et al+, 2000), comprising magnesium ion concentration+ Exact correspondence the phosphates of the exchanging strands at the point would not be expected in these experiments, given sig- of strand exchange and those immediately to the 39 nificant differences in sequences and construction of side, that would be a candidate metal-ion-binding site+ the species and temperature and buffer composition, When the loop–loop interaction is disrupted in the full but there is generally good agreement in terms of the ribozyme by the G ϩ 1A mutation, the mutant ribozyme relative stabilities of the different forms+ folds in a manner that is similar to an isolated junction+ The different forms of the hairpin ribozyme can In this situation the loops have become effectively “pas- also be distinguished by the cooperativity of the ion- sengers” on the arms that are folded by the junction induced conformational transition+ Although the com- alone, to a first approximation+ However, the lower mag- plete junction-form of the ribozyme folds with a Hill nesium ion concentration required to fold this form 2ϩ coefficient of n ϭ 2, the isolated junction is markedly ([Mg ]1/2 ϭ 700 mM compared to 3 mM for the simple different, folding with n ϭ 1+ These values are constant junction) suggests that some loop–loop interaction is for a range of divalent metal ions and whichever end- still possible in the mutant ribozyme+ The hinged form to-end vector is studied (Murchie et al+, 1998; Walter of the hairpin ribozyme folds with a Hill coefficient of et al+, 1998c)+ Simple n ϭ 1 transitions have also been n ϭ 2, whereas the folding of the bulged form occurs observed for a number of other RNA four-way junc- with n ϭ 1+ The only difference between these two tions (Walter et al+, 1998a), for four-way DNA junctions species is the structure formed at the intersection (Clegg et al+, 1992), and for some three-way RNA junc- of the two loop-carrying helices, and thus it is likely tions, including the hammerhead ribozyme (Bassi et al+, that the n ϭ 1 folding of the bulged form represents 1997; D+A+ Lafontaine & D+M+J+ Lilley, unpubl+ data)+ the basal situation for isolated loop–loop interaction+ The simplest interpretation of the data for the isolated Candidate metal-ion-binding sites have been located hairpin junction would be that the transition is induced in loop B by NMR (Butcher et al+, 2000), and a binding by the noncooperative binding of a single critical metal site bridging the two phosphates flanking A20 on the Downloaded from www.rnajournal.org on February 14, 2006

Folding of the hairpin ribozyme 1843 junction-proximal side has been proposed to be impor- Applied Biosystems 394 DNA/RNA synthesizer+ RNA was tant in loop–loop interaction+ Burke and colleagues synthesized using ribonucleotide phosphoramidites with 29-t- (Walter et al+, 2000) have footprinted a terbium (III) ion butyldimethylsilyl (t-BDMS) protection (Hakimelahi et al+, 1981; bound at U37 in loop B+ Perreault et al+, 1990) (Glen Research)+ 29-O-methylribose nu- RNA molecules are polyelectrolyte species that will cleotides phosphoramidite (Glen Research) was coupled iden- + bind many ions in different ways, but it is likely that only tically to t-BDMS-protected nucleosides Fluorescein (PE-ABI) and indocarbocyanine (Cy3, Glen Research) were coupled to some of these binding events will affect the observed + + the 59-termini as phosphoramidites Oligoribonucleotides were conformational transitions The simplest interpretation deprotected in 25% ethanol/ammonia solution at 55 8Cfor6h of the titration data for the hairpin junction (the junction (dye labeled) or 12 h (unlabeled) and evaporated to dryness+ in the absence of the loops) and the bulged ribozyme Oligoribonucleotides were redissolved in 0+5 mL 1 M tetra- (the loop-carrying duplex free of the junction) is that butylammonium fluoride (TBAF; Aldrich) in tetrahydrofuran each folds in response to the noncooperative binding to remove t-BDMS groups, and agitated at 20 8C in the dark of a single metal ion+ If these two events occur coop- for 16 h prior to desalting by G25 Sephadex (NAP columns; eratively in the context of the full hairpin ribozyme with Pharmacia) and ethanol precipitation+ Fully deprotected oli- its four-way junction, this would account for the transi- gonucleotides were purified by gel electrophoresis in 20% poly- ; tion occurring with a Hill coefficient of 2+ There are acrylamide containing 7 M urea fluorescently labeled species + many more complex models that would be equally con- were significantly retarded in the gel system Bands were excised, and the oligonucleotides were electroeluted into 8 M sistent with the data, but this is the simplest+ ammonium acetate, and recovered by ethanol precipitation+ Clearly the most stable form of the ribozyme results Fluorescently labeled oligonucleotides were further purified by when the two loops interact in the context of the four- reversed-phase HPLC+ Samples were dissolved in 100 mM way junction+ Folding occurs at a magnesium ion con- ammonium acetate (pH 7+5) and applied to a C18 reversed- centration that is three orders of magnitude lower than phase column (m Bondapak, Waters)+ The sample was eluted that for the hinged form+ Fedor (1999) has shown that with a linear gradient of acetonitrile, 100 mM ammonium ac- the ligation reaction is strongly favored in the junction etate (pH 7+5) with a flow rate of 1 mL/min+ The peak fractions form of the hairpin ribozyme due to a stabilization of the were evaporated to dryness, redissolved in water, and etha- folded form in which the loops are in close interaction+ nol precipitated+ We have noted previously that changes that are known to perturb the structure of the junction affect the cleav- Transcription of RNA age activity of the ribozyme, whereas those that leave the junction unaffected have no effect on cleavage (Mur- RNA was transcribed from synthetic DNA templates using T7 + , chie et al+, 1998; Thomson & Lilley, 1999)+ The four- RNA polymerase according to Milligan et al (1987) and pu- + way junction is therefore a very important element in rified by polyacrylamide gel electrophoresis the structure of the ribozyme+ In conclusion, we have shown that the folding of the Analysis of ribozyme cleavage hairpin ribozyme in its natural context of a four-way helical junction is orders of magnitude more efficient Cleavage experiments were carried out under single-turnover conditions (Thomson et al+, 1996)+ Ribozyme and [5 -32P]- than the frequently studied form comprising two hinged 9 + labeled substrate were individually incubated in 50 mM Tris- duplexes This requires two elements—the loops and HCl (pH 7+5) to 90 C for 2 min, followed by 15 min at the + 8 the four-way junction When both are present the com- indicated temperature+ Magnesium chloride was added to a plete ribozyme undergoes a cooperative folding pro- final 10-mM concentration, and incubation continued for a cess induced by the binding of divalent metal ions in further 60 min+ The reaction was initiated by mixing ribo- the micromolar region, with a Hill coefficient n ϭ 2+ The zyme and substrate at 1 mM and 50 nM final concentra- junction provides a scaffold in the natural RNA that tions, respectively+ The cleavage reactions were stopped at facilitates the folding of the ribozyme into the active the indicated times, and product formation was analyzed form, without which the activity under cellular condi- by electrophoresis on sequencing gels containing 7 M urea+ tions should be rather low+ The important role played Product formation was quantified by exposure to storage , + by the four-way junction in the hairpin ribozyme sug- phosphor screens and phosphorimaging (BAS-1500 Fuji) Progress curves (fraction uncleaved substrate ( f ) as a func- gests that it is likely to be exploited as a critical archi- tion of time) were fitted to a single exponential function, tectural feature in other functional RNA species+

Ϫk t f ϭ e obs , (3) MATERIALS AND METHODS where t is the time of incubation and kobs the observed rate Chemical synthesis of RNA-containing constant+ Repetitive measurement of rates indicate an exper- + oligonucleotides imental error of 610% The following sequences were used (all written 59 to 39)+ Oligonucleotides were synthesized using phosphoramidite These were chemically synthesized except where indicated, chemistry (Beaucage & Caruthers, 1981) implemented on an with deoxyribonucleotides underscored: Downloaded from www.rnajournal.org on February 14, 2006

1844 Z.-Y. Zhao et al.

Junction form, ribozyme strand (transcribed): Bulged form, b9/d9 strand: GGCCACAGAGAAGUCAACCAGAGAAACACACGUUGUGGUAU CCGCGUCAUGGUAUAUUACCUGGUGCCCCCUGACAGUCCUG AUUACCUGGUACGCCGAAAGGCGUGGUGGCCGAA; UGCGG. Junction form, substrate strand (natural sequence): UUCGGCCACCUGACAGUCCUG; Junction form, substrate strand (G ϩ 1A): Fluorescence spectroscopy UUCGGCCACCUGACAAUCCUG; , : Fluorescence spectra were recorded at 5 8C using an SLM- Hinged form ribozyme strand , + , CCGCACAGAGAAGUCAACCAGAGAAACACACGUUGUGGUAU Aminco 8100 fluorimeter in 90 mM Tris-borate (pH 8 3) with + AUUACCUGGUG; an addition of 25 mM NaCl for the two-armed species only , : Spectra were corrected for lamp fluctuations and instrumen- Hinged form substrate strand (5-nt overhang) , + + CCACCUGACAGUCCUGUGCGG; tal variations as described in Bassi et al (1997) Polarization , : artifacts were avoided by setting excitation and emission po- Bulged form ribozyme strand + + CCGCACAGAGAAGUCAACCAGAGAAACACAUGACGCGG; larizers crossed at 54 748 Values of EFRET were measured using the acceptor normalization method (Murchie et al+, 1989; Bulged form, substrate strand: , + A , CCGCGUCAUGGUAUAUUACCUGGUGCCCCCUGACAGUCCUG Clegg 1992) An extracted acceptor spectrum F (n1 n9) (ex- ϭ , UGCGG. citation at n9 490 nm with emission at n1) is normalized to a second spectrum (F(n2,n0)) from the same sample excited at a wavelength (n0 ϭ 547 nm) at which only the acceptor is excited, with emission at n2+ We then obtain the acceptor Construction of hairpin ribozyme species ratio for FRET analysis

A ' '' Fluorescent hairpin species for FRET studies were con- (ratio)A ϭ F (n1,n )/F(n2,n ) structed by hybridization of one fluorescein-labeled strand, ϩ D ' A '' A ' A '' one Cy3-labeled strand, and two (junction form), one (hinged ϭ {EFRET{d {(E (n )/E (n )) ϩ (E (n )/E (n ))} form), or no (bulged form) unlabeled strands+ For the hinged ⌽A /⌽A and bulged species, arm B was extended to 8 bp to in- {( (n1) (n2 )). (4) crease stability+ The molecules were hybridized by incubat- ing stoichiometric amounts of the oligonucleotides in 90 mM Superscripts D and A refer to donor and acceptor, respec- Tris-borate (pH 8+3), 25 mM NaCl for 10 min at 80 8C, fol- tively+ eD and eA are the molar absorption coefficients at the lowed by slow cooling+ The hybridized species were puri- indicated frequency of donor and acceptor, respectively, and A fied by electrophoresis in a 10% polyacrylamide gel at 4 8C ⌽ is the fluorescent quantum yield the acceptor+ EFRET may + D A A for 20 h at 120 V The buffer system contained 90 mM be calculated from (ratio)A because e (n9)/e (n0) and e (n9)/ + , , A A Tris-borate (pH 8 3) 25 mM NaCl and was recirculated at e (n0) are measured from absorption spectra, and ⌽ (n1)/ / + A .1Lh The fluorescent junctions were visualized by illumi- ⌽ (n2) is unity when n1 ϭ n2+ nation using a Dark Reader transilluminator (Clare Chemi- Fluorescence anisotropy (r ) was determined from mea- cal Research)+ The bands were excised and the RNA surements of fluorescence intensities using vertical excita- electroeluted into 8 M ammonium acetate and recovered tion and emission polarizers (F5), and vertical excitation and + by ethanol precipitation FRET analysis of the various forms horizontal emission polarizers (F4, corrected for polarization of the hairpin ribozyme employed synthetic RNA species artifacts)+ Fluorescence anisotropy was calculated from (with 59 fluorophores where appropriate) of the following sequences (all written 59 to 39, with deoxyribonucleotides r ϭ (F5 Ϫ F4)/(F5 ϩ 2{F4)+ (5) underscored):

Junction form, b strand: ACKNOWLEDGMENTS CCGGUGGUAUAUUACCUGGUACGCCUUGACGUGGGG; + + Junction form, a strand: We thank Dr D Lafontaine for valuable discussion and sug- , + + , CCGCACAGAGAAGUCAACCAGAGAAACACACCGG; gestions Prof S Halford for commenting on the manuscript + Junction form, c strand: and the Cancer Research Campaign for financial support CCCCACGUCAAGGCGUGGUGGCCGAAGGUCGG; Junction form, d strand with riboadenine at A Ϫ 1: Received July 7, 2000; returned for revision CCGACCUUCGGCCACCUGACAGUCCUGUGCGG; August 16, 2000; revised manuscript received Junction form, d strand with 29-O-methylriboadenine at AϪ 1: September 1, 2000 CCGACCUUCGGCCACCUGAC[29-OMe-A]GUCCUGUGCGG; Junction form, d strand G ϩ 1A: CCGACCUUCGGCCACCUGACAAUCCUGUGCGG; REFERENCES Hinged form, b9 strand: Anderson P, Monforte J, Tritz R, Nesbitt S, Hearst J, Hampel A+ 1994+ CCGCGUCAUGGUAUAUUACCUGGUG; Mutagenesis of the hairpin ribozyme+ Nucleic Acids Res 22:1096– Hinged form, d strand (5-nt 5 -overhang): 1100+ 9 9 , , , , + + CCACCUGACAGUCCUGUGCGG; Bassi GS Murchie AIH Walter F Clegg RM Lilley DMJ 1997 Ion- induced folding of the hammerhead ribozyme: A fluorescence Hinged and bulged forms, a strand: resonance energy transfer study+ EMBO J 16:7481–7489+ CCGCACAGAGAAGUCAACCAGAGAAACACAUGACGCGG; Beaucage SL, Caruthers MH+ 1981+ Deoxynucleoside phosphor- Downloaded from www.rnajournal.org on February 14, 2006

Folding of the hairpin ribozyme 1845

amidites—a new class of key intermediates for deoxypolynucle- Hakimelahi GH, Proba ZA, Ogilvie KK+ 1981+ High yield selective otide synthesis+ Tetrahedron Lett 22:1859–1862+ 39-silylation of ribonucleosides+ Tetrahedron Lett 22:5243–5246+ Berzal-Herranz A, Simpson J, Chowrira BM, Butcher SE, Burke JM+ Hampel A, Tritz R+ 1989+ RNA catalytic properties of the minimum 1993+ Essential nucleotide sequences and secondary structure (Ϫ)sTRSV sequence+ Biochemistry 28:4929–4933+ elements of the hairpin ribozyme+ EMBO J 12:2567–2574+ Hampel A, Tritz R, Hicks M, Cruz P+ 1990+ “Hairpin” catalytic RNA Butcher SE, Allain FH, Feigon J+ 1999+ Solution structure of the loop model: Evidence for helices and sequence requirement for sub- B domain from the hairpin ribozyme+ Nature Struct Biol 6:212–216+ strate RNA+ Nucleic Acids Res 18:299–304+ Butcher SE, Allain FH, Feigon J+ 2000+ Determination of metal ion Hazeloff JP, Gerlach WL+ 1988+ Simple RNA enzymes with new and binding sites within the hairpin ribozyme domains by NMR+ Bio- highly specific endoribonuclease activities+ Nature 334:585–591+ chemistry 39:2174–2182+ Hegg LA, Fedor MJ+ 1995+ Kinetics and thermodynamics of inter- Butcher SE, Heckman JE, Burke JM+ 1995+ Reconstitution of hairpin molecular catalysis by hairpin ribozymes+ Biochemistry 34:15813– ribozyme activity following separation of functional domains+ J 15828+ Biol Chem 270:29648–29651+ Hutchins CJ, Rathjen PD, Forster AC, Symons RH+ 1986+ Self- Buzayan JM, Gerlach WL, Bruening G+ 1986+ Non-enzymatic cleav- cleavage of plus and minus RNA transcripts of avocado sun- age and ligation of RNAs complementary to a plant virus satellite blotch viroid+ Nucleic Acids Res 14:3627–3640+ RNA+ Nature 323:349–353+ Koizumi M, Ohtsuka E+ 1991+ Effects of phosphorothioate and 2-amino Cai ZP, Tinoco I+ 1996+ Solution structure of loop A from the hair- groups in hammerhead ribozymes on cleavage rates and Mg2ϩ pin ribozyme from tobacco ringspot virus satellite+ Biochemistry binding+ Biochemistry 30:5145–5150+ 35:6026–6036+ Komatsu Y, Kanzaki I, Ohtsuka E+ 1996+ Enhanced folding of hairpin Chowrira BM, Berzal-Herranz A, Burke JM+ 1991+ Novel guanosine ribozymes with replaced domains+ Biochemistry 35:9815–9820+ requirement for catalysis by the hairpin ribozyme+ Nature 354:320– Komatsu Y, Kanzaki I, Shirai M, Ohtsuka E+ 1997a+ A new type of 322+ hairpin ribozyme consisting of three domains+ Biochemistry Chowrira BM, Berzal-Herranz A, Keller CF, Burke JM+ 1993+ Four 36:9935–9940+ ribose 29-hydroxyl groups essential for catalytic function of the Komatsu Y, Koizumi M, Nakamura H, Ohtsuka E+ 1994+ Loop-size hairpin ribozyme+ J Biol Chem 268:19458–19462+ variation to probe a bent structure of a hairpin ribozyme+ JAm Clegg RM+ 1992+ Fluorescence resonance energy transfer and nu- Chem Soc 116:3692–3696+ cleic acids+ Methods Enzymol 211:353–388+ Komatsu Y, Shirai M, Yamashita S, Ohtsuka E+ 1997b+ Construction Clegg RM, Murchie AIH, Zechel A, Carlberg C, Diekmann S, Lilley of hairpin ribozymes with a three-way junction+ Bioorg Med Chem DMJ+ 1992+ Fluorescence resonance energy transfer analysis of 5:1063–1069+ the structure of the four-way DNA junction+ Biochemistry 31:4846– Lilley DMJ+ 1995+ Kinking of DNA and RNA by base bulges+ Proc Natl 4856+ Acad Sci USA 92:7140–7142+ Clegg RM, Murchie AIH, Zechel A, Lilley DMJ+ 1993+ Observing Lilley DMJ+ 1999+ Structure, folding and catalysis in the small nucle- the helical geometry of double-stranded DNA in solution by olytic ribozymes+ Curr Opin Struct Biol 9:330–338+ fluorescence resonance energy transfer+ Proc Natl Acad Sci Milligan JF, Groebe DR, Witherall GW, Uhlenbeck OC+ 1987+ Oligo- USA 90:2994–2998+ ribonucleotide synthesis using T7 RNA polymerase and synthetic DeYoung MB, Siwkowski AM, Lian Y, Hampel A+ 1995+ Catalytic DNA templates+ Nucleic Acids Res 15:8783–8798+ properties of hairpin ribozymes derived from Chicory Yellow Møllegaard NE, Murchie AIH, Lilley DMJ, Nielsen PE+ 1994+ Uranyl Mottle virus and Arabis Mosaic virus satellite RNAs+ Biochem- photoprobing of a four-way DNA junction: Evidence for specific istry 34:15785–15791+ metal ion binding+ EMBO J 13:1508–1513+ Duckett DR, Murchie AIH, Lilley DMJ+ 1995+ The global folding of Murchie AIH, Clegg RM, von Kitzing E, Duckett DR, Diekmann S, four-way helical junctions in RNA, including that in U1 snRNA+ Lilley DMJ+ 1989+ Fluorescence energy transfer shows that the Cell 83:1027–1036+ four-way DNA junction is a right-handed cross of antiparallel mol- Earnshaw DJ, Hamm ML, Piccirilli JA, Karpeisky A, Beigelman L, ecules+ Nature 341:763–766+ Ross BS, Manoharan M, Gait MJ+ 2000+ Investigation of the pro- Murchie AIH, Thomson JB, Walter F, Lilley DMJ+ 1998+ Folding of the posed interdomain ribose zipper in ribozyme cleavage using 29- hairpin ribozyme in its natural conformation achieves close phys- modified nucleosides+ Biochemistry 39:6410–6421+ ical proximity of the loops+ Mol Cell 1:873–881+ Earnshaw DJ, Masquida B, Müller S, Sigurdsson ST, Eckstein F, Norman DG, Grainger RJ, Uhrin D, Lilley DMJ+ 2000+ The location of Westhof E, Gait MJ+ 1997+ Inter-domain cross-linking and molec- Cyanine-3 on double-stranded DNA: Importance for fluorescence ular modelling of the hairpin ribozyme+ J Mol Biol 274:197–212+ resonance energy transfer studies+ Biochemistry 39:6317–6324+ Eichman BF, Vargason JM, Mooers BHM, Ho PS+ 2000+ The Holliday Nowakowski J, Shim PJ, Prasad GS, Stout CD, Joyce GF+ 1999+ junction in an inverted repeat DNA sequence: Sequence effects Crystal structure of an 82 nucleotide RNA-DNA complex formed on the structure of four-way junctions+ Proc Natl Acad Sci USA by the 10–23 DNA enzyme+ Nature Struct Biol 6:151–156+ 97:3971–3976+ Perreault J-P, Wu T, Cousineau B, Ogilvie KK, Cedergren R+ 1990+ Fedor MJ+ 1999+ Tertiary structure stabilization promotes hairpin ri- Mixed deoxyribo- and ribooligonucleotides with catalytic activity+ bozyme ligation+ Biochemistry 38:11040–11050+ Nature 344:565–567+ Fedor MJ+ 2000+ Structure and function of the hairpin ribozyme+ J Mol Pinard R, Lambert D, Walter NG, Heckman JE, Major F, Burke JM+ Biol 297:269–291+ 1999+ Structural basis for the guanosine requirement of the hair- Feldstein PA, Buzayan JM, Bruening G+ 1989+ Two sequences par- pin ribozyme+ Biochemistry 38:16035–16039+ ticipating in the autolytic processing of satellite tobacco ringspot Ryder SP, Strobel SA+ 1999+ Nucleotide analog interference map- virus complementary RNA+ Gene 82:53–61+ ping of the hairpin ribozyme: Implications for secondary and ter- Forster AC, Symons RH+ 1987+ Self-cleavage of plus and minus tiary structure formation+ J Molec Biol 291:295–311+ RNAs of a virusoid and a structural model for the active sites+ Cell Saville BJ, Collins RA+ 1990+ A site-specific self-cleavage reaction 49:211–220+ performed by a novel RNA in Neurospora mitochondria+ Cell Förster T+ 1948+ Zwischenmolekulare Energiewanderung und Fluo- 61:685–696+ reszenz+ Ann Phys 2:55–75+ Schmidt S, Beigelman L, Karpeisky A, Usman N, Sorensen US, Gait Gohlke C, Murchie AIH, Lilley DMJ, Clegg RM+ 1994+ The kinking of MJ+ 1996+ Base and sugar requirements for RNA cleavage of DNA and RNA helices by bulged nucleotides observed by fluo- essential nucleoside residues in internal loop B of the hairpin rescence resonance energy transfer+ Proc Natl Acad Sci USA ribozyme: Implications for secondary structure+ Nucleic Acids Res 91:11660–11664+ 24:573–581+ Grainger RJ, Murchie AIH, Lilley DMJ+ 1998+ Exchange between Scott WG, Murray JB, Arnold JRP, Stoddard BL, Klug A+ 1996+ Cap- stacking conformers in a four-way DNA junction+ Biochemistry turing the structure of a catalytic RNA intermediate: The ham- 37:23–32+ merhead ribozyme+ Science 274:2065–2069+ Grasby JA, Mersmann K, Singh M, Gait MJ+ 1995+ Purine functional Sharmeen L, Kuo MY, Dinter-Gottlieb G, Taylor J+ 1988+ Antigenomic groups in essential residues of the hairpin ribozyme required for RNA of human hepatitis delta virus can undergo self-cleavage+ catalytic cleavage of RNA+ Biochemistry 34:4068–4076+ J Virol 62:2674–2679+ Downloaded from www.rnajournal.org on February 14, 2006

1846 Z.-Y. Zhao et al.

Shin C, Choi JN, Sang SI, Song JT, Ahn JH, Lee JS, Choi YD+ 1996+ Walter F, Murchie AIH, Duckett DR, Lilley DMJ+ 1998a+ Global struc- The loop B domain is physically separable from the loop A do- ture of four-way RNA junctions studied using fluorescence reso- main in the hairpin ribozyme+ Nucleic Acids Res 24:2685–2689+ nance energy transfer+ RNA 4:719–728+ Shippy R, Siwkowski A, Hampel A+ 1998+ Mutational analysis of loops Walter F, Murchie AIH, Lilley DMJ+ 1998b+ The folding of the four-way 1 and 5 of the hairpin ribozyme+ Biochemistry 37:564–570+ RNA junction of the hairpin ribozyme+ Biochemistry 37:17629– Siwkowski A, Shippy R, Hampel A+ 1997+ Analysis of hairpin ribo- 17636+ zyme base mutations in loops 2 and 4 and their effects on cis- Walter F, Murchie AIH, Thomson JB, Lilley DMJ+ 1998c+ Structure cleavage in vitro+ Biochemistry 36:3930–3940+ and activity of the hairpin ribozyme in its natural junction confor- Thomson JB, Lilley DMJ+ 1999+ The influence of junction conforma- mation: Effect of metal ions+ Biochemistry 37:14195–14203+ tion on RNA cleavage by the hairpin ribozyme in its natural junc- Walter NG, Burke JM, Millar DP+ 1999+ Stability of hairpin ribozyme tion form+ RNA 5:180–187+ tertiary structure is governed by the interdomain junction+ Nature Thomson JB, Sigurdsson ST, Zeuch A, Eckstein F+ 1996+ In vitro Struct Biol 6:544–549+ selection of hammerhead ribozymes containing a bulged nucle- Walter NG, Hampel KJ, Brown KM, Burke JM+ 1998d+ Tertiary struc- otide in stem II+ Nucleic Acids Res 24:4401–4406+ ture formation in the hairpin ribozyme monitored by fluorescence Uhlenbeck UC+ 1987+ A small catalytic oligoribonucleotide+ Nature resonance energy transfer+ EMBO J 17:2378–2391+ 328:596–600+ Walter NG, Yang N, Burke JM+ 2000+ Probing non-selective cation van Buuren BNM, Schleucher J, Wijmenga SS+ 2000+ NMR structural binding in the hairpin ribozyme with Tb(III)+ J Mol Biol 298:539–555+ studies on a DNA four-way junction: Stacking preference and Wu H-N, Lin YJ, Lin FP, Makino S, Chang M-F, Lai MMC+ 1989+ localization of the metal-ion binding site+ J Biomol Struct Dynam Human hepatitis d virus RNA subfragments contain an autocleav- 11:237–243+ age activity+ Proc Natl Acad Sci USA 86:1831–1835+ van Tol H, Buzayan JM, Feldstein PA, Eckstein F, Bruening G+ 1990+ Young KJ, Vyle JS, Pickering TJ, Cohen MA, Holmes SC, Merkel O, Two autolytic processing reactions of a satellite RNA proceed Grasby JA+ 1999+ The role of essential pyrimidines in the hairpin with inversion of configuration+ Nucleic Acids Res 18:1971–1975+ ribozyme-catalyzed reaction+ J Mol Biol 288:853–866+