A combination of Chinese herb Hedyotis diffusa and
Scutellaria barbata impairs mitotic entry of prostate cancer
cells without eliciting DNA damage
By Su Su Thae Hnit
A thesis submitted in satisfaction of the requirements for the degree of
Doctor of Philosophy
School of Science and Health
Western Sydney University
Oct 2017
Primary Supervisor: Associate Professor Qihan Dong
Co-supervisors: Professor Paul De Souza, Professor Alan Bensoussan, Dr Mu Yao
1 Statement of Authentication
This thesis is submitted in fulfillment of the requirements of the degree of
Doctor of Philosophy in the School of Science and Health at Western Sydney
University. The work presented in this thesis is, to the best of my knowledge, original except as acknowledged in the text. I hereby declare that I have not previously submitted this material, either in whole or in part, for a degree or a diploma in any other institution.
Su Su Thae Hnit
Oct 2017
2 Acknowledgments
This thesis would not have been possible without the help of a number of people. These people offered me so much that I could ever imagine and made me who I am now.
First and foremost, my deepest gratitude goes to my primary supervisor, Associate Professor
Qihan Dong. I would like to say thank you very much from the bottom of my heart for generously lavishing me with abundant guidance, mentorship, knowledge, expert advice, attention, care and support. I will never forget your advice on fundamental thinking and paying attention in details. I can’t even express how much I appreciate for all of your help. I greatly appreciate all the time and patience you have dedicated to take me on science world. It has been a privilege to be part of your research team and really grateful for the useful comments, remarks and engagement through the learning process of this thesis. Also, your constant mentoring and encouragement is highly valued not only in this project but also for my future carrier. You are absolutely respectable and admirable supervisor.
My special thanks go to Dr Mu Yao for his expert advice on experimental support, constructive criticism and encouragement throughout the years. Your help has been enormous in the process of my PhD, especially in the hard time of problem solving, and experimental method improvement. Your advice and support in various immunolabelling techniques have been priceless. You enlightened my understanding of science into whole new level.
I would also like to thank to Professor Paul De Souza and Professor Alan Bensoussan for advice in thesis structure, assistance in proofreading and examining my thesis. Thank you very much Professor Li Zhong for providing DR recipe and Dr Cheng Khoo for chemical
3 profiling of DR. I also thank Associate Professor Natalka Suchowerska for providing the facility of radiation treatment for my experiments.
I also thank my lab fellows Dr Amber Xie, fellow PhD student Ling Bi and Honours student
Sally Hanna Rie for their great assistance and advice on my work. Thanks must also go to
Honours student William Wei for providing the RT-PCR data and his enthusiastic questions. I must mention ‘Ladies who lunch together’ for their encouragement throughout my PhD experience. To those in the School of Science and Health, University of Western Sydney and
Charles Perkin Centre who have assisted me in my PhD journey, I am truly appreciated for their contributions.
Last not the least, I would like to thank my Dad and Mum for their love and support in helping me to get through my PhD years. My words can’t express how grateful I am and it would have been absolutely impossible for me to get this far if it wasn’t for the support and encouragement from my family.
4 Table of Contents
Statement of Authentication ...... 2
Acknowledgments ...... 3
Table of Contents ...... 5
List of Figures ...... 11
List of Tables ...... 14
List of abbreviations ...... 15
Publication ...... 19
Conference Abstracts ...... 19
List of Presentations ...... 20
Abstract ...... 21
1 Chapter 1 - Introduction ...... 25 1.1 Prevalence of PCa ...... 26 1.2 Treatment options ...... 27 1.2.1 Surgery ...... 27 1.2.2 Radiation therapy ...... 27 1.2.3 Androgen Deprivation Therapy (ADT) ...... 28 1.2.4 Chemotherapy ...... 29 1.2.5 Active Surveillance (AS) ...... 29 1.3 Cell Cycle and Key regulators ...... 31 1.3.1 The importance of Cyclins and CDKs in cell cycle ...... 31 1.3.2 Cell cycle checkpoints ...... 34
1.3.2.1 G1-S checkpoint ...... 35
1.3.2.2 G2-M checkpoint ...... 36 1.3.2.3 Mitosis checkpoint or spindle assembly checkpoint (SAC) ...... 38 1.4 Signalling pathways and proteins involved in DNA damage response ...... 41 1.4.1 Activation of ATM and ATR ...... 42 1.4.2 Activation of CHK2 and CHK1 ...... 44
5 1.4.3 ATM-CHK2, ATR-CHK1 Signal transduction ...... 45 1.4.4 Aberrant regulation of ATM and ATR ...... 50 1.4.5 Aberrant regulation of CHK2 and CHK1 ...... 50
1.4.6 γH2AX...... 51 1.4.7 53BP1 ...... 54
1.5 M phase promoting complex and regulators at G2 to M phase transition ...... 56 1.5.1 Cyclin B1-CDK1 complex ...... 56
1.5.1.1 Role of Cyclin B1 and CDK1 at G2/M phase ...... 56 1.5.1.2 Regulation of Cyclin B1-CDK1 ...... 57 1.5.1.2.1 Regulation by Cyclin B1 ...... 57 1.5.1.2.2 Regulation by CAK ...... 58 1.5.1.2.3 Regulation by Myt1 and Wee1 ...... 58 1.5.1.2.4 Regulation by CDC25C ...... 59 1.5.1.2.5 Regulation by intracellular localization ...... 60 1.5.2 PLK1 ...... 62
1.5.2.1 Role of PLK1 in G2-M transition ...... 63 1.5.2.2 Role of PLK1 in DNA damage response ...... 64 1.5.2.3 Role of PLK1 in Mitosis ...... 66 1.5.3 Aurora A ...... 68
1.5.3.1 Role of Aurora A in G2-M transition ...... 68 1.5.3.2 Role of Aurora A in DNA damage response ...... 69 1.5.3.3 Role of Aurora A in Mitosis ...... 70 1.6 The use of Traditional Chinese Medicine (TCM) in Cancer ...... 71 1.7 Detoxification Recipe (DR) ...... 71 1.7.1 HD, Hedyotis diffusa (Bai Hua She She Cao) ...... 72 1.7.1.1 Chemical profiles and properties ...... 73 1.7.1.2 Anti-proliferative effect of HD in PCa ...... 73 1.7.1.3 Anti-proliferative effect of HD in other cancers ...... 74 1.7.2 SB, Scutellaria barbata (Ban Zhi Lian) ...... 76 1.7.2.1 Chemical profiles and properties ...... 77 1.7.2.2 Anti-proliferative effect of SB in PCa ...... 77 1.7.2.3 Anti-proliferative effect of SB in other cancers ...... 78
6 2 Chapter 2 - Hypothesis and Aims ...... 81 2.1 Targeting cell cycle progression could be a strategy to impede PCa progression82 2.2 Hypothesis and Aims ...... 84 2.2.1 Hypotheses ...... 84 2.2.2 Aims ...... 84 2.2.2.1 To determine the anti-proliferative and cytostatic action of DR in PCa cells 85 2.2.2.2 To examine the effect of DR on cell cycle progression of PCa cells ...... 85 2.2.2.3 To establish the molecular mechanism underlying cytostatic action of DR in PCa cells ...... 85
3 Chapter 3 - Materials and Methods ...... 88 3.1 Cell lines and Cell Cultures ...... 89 3.1.1 PCa cell lines ...... 89 3.1.2 Cell Passaging ...... 89 3.2 Treatment ...... 90 3.2.1 DR Treatment ...... 90 3.2.2 Nocodazole treatment ...... 91 3.2.3 Radiation treatment ...... 92 3.3 SYBR Green Assay ...... 92 3.4 Colony formation assay ...... 94 3.5 Flow cytometric cell cycle analysis ...... 96 3.5.1 Propidium Iodide (PI) staining ...... 96 3.5.2 Co-staining of PI and phospho-Histone H3 for cell cycle analysis ...... 96 3.6 Immunocytochemistry ...... 97 3.6.1 Ki-67 Staining ...... 97 3.6.2 BrdU Incorporation ...... 98 3.7 Immunofluorescence ...... 99 3.8 Immunoblotting ...... 100 3.8.1 Protein extraction and quantification ...... 100 3.8.2 SDS-polyacrylamide gel electrophoresis ...... 101 3.8.3 Sample preparation for SDS-PAGE ...... 103 3.8.4 Protein Transfer ...... 103 3.8.5 Blocking and Immunodetection ...... 104 3.9 Reverse transcription and quantitative real-time polymerase chain reaction .. 106
7 3.9.1 RNA extraction and quantification ...... 106 3.9.2 Reverse transcription (RT) ...... 108 3.9.3 Designing the primers ...... 109 3.9.4 Polymerase chain reaction (PCR) ...... 111 3.9.5 Dilution curve and amplification efficiency ...... 111 3.9.6 Data analysis ...... 112 3.10 Animal study ...... 113 3.11 Quantification ...... 113 3.11.1 Immunocytochemistry ...... 113 3.11.2 Immunofluorescence ...... 113 3.11.3 Immunoblotting ...... 114 3.12 Statistical Analysis ...... 114
4 Chapter 4 - The effect of DR on proliferation of PCa cells ...... 116 4.1 Introduction ...... 117 4.2 Materials and Methods ...... 118 4.2.1 PCa cell lines ...... 118 4.2.2 DR treatment ...... 118 4.2.3 SYBR Green assay ...... 118 4.2.4 Immunocytochemistry ...... 118 4.2.5 Colony formation assay ...... 118 4.2.6 Animal study ...... 118 4.2.7 Statistical analysis ...... 119 4.3 Results ...... 119 4.3.1 DR inhibited the proliferation of PCa cells ...... 119 4.3.1.1 Treatment with DR decreased DNA synthesis in PCa cells ...... 119 4.3.1.2 Treatment with DR decreased BrdU incorporation in PCa cells ...... 123 4.3.1.3 Treatment with DR decreased Ki-67 protein level in PCa cells ...... 126 4.3.1.4 Microscopic verification of cytostatic action of DR ...... 129 4.3.1.5 Treatment with DR reduced the number of colony formation ...... 132 4.3.2 DR did not modulate pH and osmolality of media bathing PCa cells ...... 135 4.3.3 Treatment of normal mice with DR did not change animal body weight ...... 136 4.4 Discussion ...... 137 4.4.1 Selection of SYBR green assay for DNA analysis ...... 137
8 4.4.2 Cytostatic action of DR ...... 138
5 Chapter 5 - The effect of DR on cell cycle progression ...... 141 5.1 Introduction ...... 142 5.2 Materials and Methods ...... 143 5.2.1 PCa cell lines ...... 143 5.2.2 DR treatment ...... 143 5.2.3 Nocodazole treatment ...... 143 5.2.4 Flow cytometric analysis of cell cycle using PI staining ...... 144 5.2.5 Flow cytometric analysis using co-staining of PI and phospho-Histone H3 ...... 144 5.2.6 Immunoblotting ...... 144 5.2.7 Statistical analysis ...... 144 5.3 Result ...... 145
5.3.1 DR accrued PCa cells at G2/M phase ...... 145
5.3.1.1 DR treatment enriched the LNCaP cells at G2/M phase ...... 145
5.3.1.2 DR treatment enriched the PC-3 cells at G2/M phase...... 148
5.3.2 DR enriched PCa cells at G2 phase ...... 150 5.3.2.1 Establish flow cytometric analysis of PCa cells by co-staining...... 150
5.3.2.2 DR accrued PCa cells at G2 phase by co-staining and immunoblotting...... 153 5.4 Discussion ...... 157
5.4.1 Differentiation of G2 phase and M phase ...... 157 5.4.2 Diversity of cell cycle arrests induced by HD and SB ...... 158
6 Chapter 6 - Molecular Mechanism of DR induced G2 arrest in PCa cells ...... 161 6.1 Introduction ...... 162 6.2 Materials and Methods ...... 164 6.2.1 PCa cell lines ...... 164 6.2.2 DR treatment ...... 164 6.2.3 Radiation treatment ...... 164 6.2.4 Immunofluorescence...... 164 6.2.5 Immunoblotting ...... 164 6.2.6 RT-PCR ...... 165 6.2.7 Database analysis ...... 165 6.2.8 Statistical analysis ...... 165 6.3 Results ...... 166
9 6.3.1 DR solicited no DNA damage in PCa cells ...... 166 6.3.1.1 DR did not initiate phospho-H2AX and 53BP1 foci ...... 166 6.3.1.2 DR had no effect on DNA damage response transducer proteins ...... 171 6.3.2 DR impaired the expression of mitosis promoting complex and regulators .... 177 6.3.2.1 DR reduced the protein levels of M phase promoting complex and regulators ...... 177 6.3.2.2 Establish RT-PCR analysis of M phase promoting complex and regulators 180 6.3.2.3 DR reduced the mRNA level of M phase promoting complex and regulators ...... 187 6.3.3 mRNA levels of Cyclin B1, CDK1, PLK1 and Aurora A were increased in human PCa tissue and correlated with disease progression...... 189 6.3.3.1 mRNA levels of Cyclin B1, CDK1, PLK1 and Aurora A were increased in PCa ...... 189 6.3.3.2 mRNA levels of Cyclin B1, CDK1, PLK1 and Aurora A were increased in metastatic PCa tissues ...... 190 6.3.3.3 mRNA levels of Cyclin B1, CDK1, PLK1 and Aurora A were correlated with Ki-67 expression level ...... 192 6.3.3.4 Genomic alterations of Cyclin B1, CDK1, PLK1 and Aurora A in PCa tissues ...... 193 6.4 Discussion ...... 197 6.4.1 Cytostatic dose of DR caused no DNA damage ...... 198
6.4.2 Enrichment of PCa cells at G2 phase is associated with impairment in M phase promoting complex and regulators ...... 199 6.4.3 Clinical relevance of M phase promoting complex and regulators ...... 201
7 Chapter 7 - Final Discussion ...... 205 7.1 Discussion ...... 206 7.1.1 Major findings ...... 207 7.1.2 Validity and significance of the major finding ...... 208 7.2 Limitations and Future Directions ...... 210 7.3 References ...... 212
10 List of Figures
Figure 1.1 Cyclin-CDKs regulation of the cell cycle and its association with cell cycle checkpoints ...... 34
Figure 1.2 Schematic representation of G1-S checkpoint...... 36
Figure 1.3 Regulators responsible for G2-M checkpoints...... 38
Figure 1.4 Molecular view of the spindle assembly checkpoint (SAC) Pathway...... 40
Figure 1.5 The framework of the DDR signalling pathway...... 42
Figure 1.6 DNA damage response signalling in the various stages of the cell cycle...... 49
Figure 1.7 Flow chart represent G2 phase arrest on DNA damage response...... 53
Figure 1.8 Schematic diagram represents the regulation of Cyclin B1-CDK1 complex (MPF)...... 61
Figure 1.9 Localisation of PLK1 in G2 phase and M phase of cell cycle by immunofluorescence...... 63
Figure 1.10 The role of PLK1 in (a) G2 phase, (b) Mitotic entry and (c) G2-M DNA damage checkpoint...... 65
Figure 1.11 Hedyotis diffusa ...... 72
Figure 1.12 Scutellaria barbata...... 76
Figure 3.1 Example of sample arrangement in 96 well plate for SYBR Green assay ...... 94
Figure 3.2 Morphology of cancer cell colonies originated from PC-3 cells ...... 95
Figure 3.3 The layers arrangement of acrylamide gradient gel...... 102
Figure 3.4 The flow chart illustrating the steps of isolating total RNA using the PureLink RNA Mini Kit ...... 107
Figure 4.1 DR inhibited the DNA synthesis of LNCaP cells in a dose-dependent manner. .. 121
Figure 4.2 DR inhibited the DNA synthesis in PC-3 cells in a dose-dependent manner...... 122
Figure 4.3 DR decreased the BrdU incorporation in LNCaP cells...... 124
Figure 4.4 DR decreased the BrdU incorporation in PC-3 cells...... 125
Figure 4.5 DR decreased the Ki-67 positivity in LNCaP cells...... 127
11 Figure 4.6 DR decreased the Ki-67 positivity in PC-3 cells...... 128
Figure 4.7 DR decreased the confluence of LNCaP cells...... 130
Figure 4.8 DR decreased the confluence of PC-3 cells...... 131
Figure 4.9 DR reduced the colonies formation of LNCaP cells...... 133
Figure 4.10 DR reduced the colonies formation of PC-3 cells...... 134
Figure 4.11 DR did not modulate the pH and osmolality of culture media...... 135
Figure 4.12 Treatment of normal mice with DR did not change animal body weight...... 136
Figure 5.1 DR increased LNCaP cells at G2/M phase...... 147
Figure 5.2 DR increased PC-3 cells at G2/M phase...... 149
Figure 5.3 Nocodazole treatment increased phospho-Histone H3 positive cells...... 152
Figure 5.4 DR decreased phospho-Histone H3 positive cells by flow cytometric analysis in LNCaP cells...... 154
Figure 5.5 DR decreased phospho-Histone H3 positive cells by flow cytometry analysis in PC-3 cells...... 155
Figure 5.6 DR decreased phospho-Histone H3 protein level in PCa cells...... 156
Figure 6.1 DR did not increase the phospho-H2AX in LNCaP cells by immunofluorescence...... 167
Figure 6.2 DR did not increase the phospho-H2AX in PC-3 cells by immunofluorescence. 168
Figure 6.3 DR did not increase the 53BP1 in LNCaP cells by immunofluorescence...... 169
Figure 6.4 DR did not increase the 53BP1 in PC-3 cells by immunofluorescence...... 170
Figure 6.5 Quantification of phospho-H2AX and 53BP1 immunofluorescence staining in PCa cells...... 171
Figure 6.6 DR did not increase DNA damage response proteins in LNCaP cells by immunoblotting...... 173
Figure 6.7 Quantification of immunoblotting in DNA damage response proteins in LNCaP cells...... 174
Figure 6.8 DR did not increase DNA damage response proteins in PC-3 cells by immunoblotting...... 175
Figure 6.9 Quantification of immunoblotting in DNA damage response proteins in PC-3 cells...... 176
12 Figure 6.10 DR decreased the protein level of M phase promoting complex and regulators.178
Figure 6.11 Quantification of immunoblotting in M phase promoting complex and regulators in PCa cells...... 179
Figure 6.12 DR had no effect on the amplification efficiency of 36B4 by RT-PCR in LNCaP cells...... 182
Figure 6.13 DR had no effect on the amplification efficiency of CDK1 by RT-PCR in LNCaP cells...... 183
Figure 6.14 DR had no effect on the amplification efficiency of 36B4 by RT-PCR in PC-3 cells...... 185
Figure 6.15 DR had no effect on the amplification efficiency of CDK1 by RT-PCR in PC-3 cells...... 186
Figure 6.16 DR decreased the mRNA levels of Cyclin B1, CDK1, PLK1 and Aurora A...... 188
Figure 6.17 mRNA levels of M phase promoting complex and regulators in BPH and cancer tissue of prostate...... 190
Figure 6.18 mRNA levels of M phase promoting complex and regulators in metastasis and primary tumour...... 191
Figure 6.19 M phase promoting complex and regulators were correlated with proliferative marker Ki-67 in PCa tissues...... 192
Figure 6.20 Gene alterations of Cyclin B1, CDK1, PLK1 and Aurora A associated with PCa...... 196
13 List of Tables
Table 3-1 Chemical profiling in DR measured by LC-MS ...... 91
Table 3-2 SDS-PAGE gel formulation ...... 102
Table 3-3 List of antibodies...... 105
Table 3-4 Formulation of reverse transcription reaction ...... 109
Table 3-5 List of primers ...... 110
Table 3-6 Reagents involved in PCR reaction...... 111
Table 3-7 Cycling conditions (Rotor-Gene RG-6000 Corbett Research) ...... 112
Table 6-1 Alteration summary for Cyclin B1 gene in 13 PCa datasets...... 193
Table 6-2 Alteration summary for CDK1 gene in 13 PCa datasets...... 194
Table 6-3 Alteration summary for PLK1 gene in 13 PCa datasets...... 194
Table 6-4 Alteration summary for Aurora A gene in 13 PCa datasets...... 195
14 List of abbreviations
2N Diploid
4N Tetraploid
53BP1 Tumour suppressor p53-binding protein 1
Ab Antibody
ADT Androgen deprivation therapy
AKT Protein kinase B
ANOVA Analysis of variances
APC/C Anaphase promoting complex/cyclosome
AR Androgen receptor
ATM Ataxia-telangiectasia mutated
ATP Adenosine triphosphate
ATR Ataxia telangiectasia and Rad3 related
ATRIP ATR interacting protein
BPH Benign prostatic hyperplasia
BRCA1 Breast cancer type 1 susceptibility protein,
Bub3 Budding uninhibited by benzimidazoles 3
BubR Bub receptor
BubR1 Budding uninhibited by benzimidazoles 1
CAK CDK-activating kinase
CDC20 Cell-division cycle protein 20
CDC25A Cell division cycle 25A
CDC25B Cell division cycle 25B
15 CDC25C Cell division cycle 25C
CDH1 Cadherin-1
CDK Cyclin dependent kinase cDNA Complementary DNA
CENP Centromere protein
CHK1 Checkpoint kinase 1
CHK2 Checkpoint kinase 2
Cip/Kip CDK interacting protein/Kinase inhibitory protein
CRS Cytoplasmic retention signal
CT Cycle Threshold
DAB 3,3′-Diaminobenzidine
DDR DNA damage response
DNA Deoxyribonucleic acid
DSBs Double-strand breaks
E2F Elongation 2 transcription factor
EMI1 Early mitotic inhibitor 1
FBS Foetal bovine serum
G0 Gap 0 phase
G1 Gap 1 phase of mitosis
G2 Gap 2 phase of mitosis
GAPDH Glyceraldehydes-3-phosphate dehydrogenase
GFP Green fluorescence protein
HCL Hydrochloric acid
HR Homologus recombination
INK4 Inhibitors of CDK4
16 IR Ionizing radiation
LNCaP Lymph node metastasis prostate cancer cells
M Mitosis
Mad 2 Mitotic arrest deficient 2
MAPK Mitogen-activated protein kinase
MCC Mitotic checkpoint complex
MDC1 Mediator of DNA damage checkpoint protein 1
Med1 Mediator-1
Mre 11 Meiotic recombination 11-like protein A
MRN Mre11, Rad50 and Nbs1 protein complex mRNA Messenger RNA
Myt1 Myelin transcription factor 1
NaCl Sodium Chloride
Nbs1 Nibrin protein
NHEJ Non homologus end joining
NHS Normal horse serum
PBS Phosphate-buffered saline
PC-3 Bone metastasised prostate cancer cells
PCa Prostate Cancer
PCR Polymerase chain reaction
PI Propidium iodide
PI3K Phosphatidylinositol 3-kinase
PLK1 Polo like kinase 1
PSA Prostate-specific antigen
PTEN Phosphatase and tensin homolog
17 Rad50 Double strand break repair protein
Ras Rat sarcoma viral oncogene homolog
Rb Retinoblastoma
RNA Ribonucleic acid
RNF8 Ring Finger Protein 8
RPMI Roswell park memorial institute medium
RT-PCR Real Time polymerase chain reaction
S Synthesis phase of mitosis
SAC Spindle assembly checkpoint
SCF SKP1-cullin-F-box
SDS Sodium dodecyl sulphate secs Seconds
Ser Serine siRNA Small interference RNA
SKP2 S-phase kinase-associated protein 2
SSBs Single-strand breaks ssDNA Single stranded DNA
TBST Tris-buffered saline containing TWEEN-20
TCM Traditional chinese medicine
Thr Threonine
Tyr Tyrosine
Wee1 WEE1 like protein kinase
18 Publication
Hnit, SST, Xie, C, Yao, M, Holst, J, Bensoussan, A, De Souza, P, Li, Z & Dong, Q 2015,
'p27 Kip1 signaling: Transcriptional and post-translational regulation', The international journal of biochemistry & cell biology, vol. 68, pp. 9-14.
Conference Abstracts
1. Hnit, S., Xie, C., Yao, M., Chan, C., Youhana, C., and Dong, Q. (2016). The role of Zeste
White 10 interactor-1 in cell cycle exit and re-entry in prostate cancer cells. The Cell
Cycle Meeting, Cold Spring Harbor Laboratory, New York.
2. Hnit.S., Yao, M., Rie, S.,Chan, C., Suchowerska, N., Bensoussan, A., De Souza, P., Li, Z.
and Dong, Q. (2017). Chinese herb recipe DR impairs mitotic entry of prostate cancer
cells without eliciting DNA damage. Australian Cell Cycle Meeting, Powerhouse
Museum, Sydney.
19 List of Presentations
1. Hnit, S. and Dong, Q., Develop a Strategy to Prevent Cancer Recurrence using
Chinese Herbal Medicine. Oral Presentation. University of Western Sydney conjoint
School of Science and Health and School of Medicine, 3 Minutes Thesis Presentation,
Penrith, 2014.
2. Hnit, S. and Dong, Q., Cytostatic Action and Mechanism of Chinese Herbal Medicine
DR and ATR in Prostate Cancer Cells. Oral Presentation. Ingham Institute, Liverpool,
2014.
3. Hnit, S., Xie, C., Yao, M., Chan, C., Youhana, C., and Dong, Q., The role of Zeste
White 10 interactor-1 in cell cycle exit and re-entry in prostate cancer cells. Poster
presentation. The Cell Cycle Meeting, Cold Spring Harbor Laboratory, New York,
2016.
4. Hnit, S. and Dong, Q, Cytostatic Action and Mechanism of Chinese Herbal Medicine
DR in Prostate Cancer Cells. Oral Presentation. Western Sydney University, School of
Science and Health, Paramatta, 2016.
5. Hnit, S. and Dong, Q, Chinese herb recipe DR impairs mitotic entry of prostate cancer
cells without eliciting DNA damage. Oral presentation. Department of endocrinology
annual meeting, Charles Perkins Centre, University of Sydney, 2017.
6. Hnit.S., Yao, M., Rie, S.,Chan, C., Suchowerska, N., Bensoussan, A., De Souza, P.,
Li, Z. and Dong, Q. Chinese herb recipe DR impairs mitotic entry of prostate cancer
cells without eliciting DNA damage. Poster presentation. Australian Cell Cycle
Meeting, Powerhouse Museum, Sydney, 2017.
20 Abstract
Prostate cancer (PCa) is one of the most frequently diagnosed malignancies and second leading causes of cancer related death in men worldwide. PCa is remarkably heterogeneous, with a range of manifestations from asymptomatic to widespread metastatic disease. Active surveillance (AS) is one of the options for men with low grade and low volume early PCa. AS involves regular PSA testing, digital examination, and biopsy without providing any medical intervention. Although AS decreases unnecessary overtreatment for some men, it may cause anxiety over disease progression in others. The number of men under AS is increasing as concern about over-treatment has developed in recent decades. Hence, in those men undertaking AS, who are otherwise on no specific treatment, there is an urgent need to develop an approach to prevent or impede PCa progression with no adverse effects that is cost effective for long-term use.
Traditional Chinese Medicine has been used for centuries in treating and improving the symptoms experienced by cancer patients in China. Detoxification recipe (DR) is an anti- cancer Chinese Medicine formula and consists of two herbs, namely Hedyotis diffusa (HD) and Scutellaria barbata (SB). In a recent survey in Taiwan, the combination of HD and SB was shown to be the most commonly described herbal medicine in the treatment of cancer.
However, how HD and SB in combination exerts its anti-cancer action is elusive. The aims of this project were to determine the anti-proliferative and its modes of action of DR.
Specifically, this study aimed to firstly establish the cytostatic action of DR and its impact on the cell cycle phase distribution and secondly to determine the underlying molecular mechanism contributing to the DR induced cell cycle alteration.
21 Our study revealed that DR has anti-proliferative activity in PCa cells, evidenced by a reduction in DNA synthesis by SYBR Green DNA analysis assay and BrdU incorporation.
This is also supported by the reduction in proliferative cells by Ki-67 immunocytochemical staining. The colony formation assay also revealed the long-term inhibitory anti- proliferative effect of DR. The pH and osmolality test of DR-containing culture medium showed that the anti-proliferative activity of DR is intrinsic. Studies in normal mice demonstrated that DR did not have any apparent adverse effects at least in the short-term.
In order to verify the effect of DR on cell cycle progression, flow cytometric cell cycle analysis was performed using propidium iodide (PI) staining. PI-stained PCa cells indicated that DR accumulates cells in the G2/M phase. Subsequent flow cytometric analysis of PI and phospho-Histone H3 co-staining revealed that treatment with DR resulted in no increase in M phase cells compared to control cells, suggesting that DR arrests the PCa cells at G2 phase.
To examine the mechanism causing the G2 phase arrest by DR, a DNA damage scenario leading to G2 arrest was examined. With irradiated cells as a positive control, we found no equivalent foci of phospho-H2AX and 53BP1 in DR-treated cells by immunofluorescence.
For further verification, immunoblotting of DNA damage response proteins, including total and phosphorylated form of ATM, ATR, CHK1 and CHK2, was performed. No activation of DNA damage signalling pathways was observed in the presence of DR treatment comparing to irradiated cells.
Cell cycle transition from G2 to M phase is controlled by M phase promoting complex
Cyclin B1-CDK1 and their positive regulators PLK1 and Aurora A kinases. DR reduced all four at both protein and mRNA levels. Since Cyclin B1 and CDK1 confer the G2-M
22 transition, the reduction indicates that DR-induced G2 phase cell cycle arrest is associated with the impairment in M phase promoting complex and regulators.
Lastly, to determine the clinical significance of M phase promoting complex and regulators in PCa progression, an online database for genomic analysis and mRNA expression was analysed. mRNA expression levels of all four were highly correlated with PCa disease progression. We found a deletion of Cyclin B1 and amplification of CDK1, PLK1 and
Aurora A genes in PCa tissue.
In summary, the commonly prescribed Chinese herb medicine combination DR has significant anti-proliferative activity. DR can diminish the transition from G2 to M phase in
PCa cells. DR-induced reduction of key proteins essential for mitotic entry is likely responsible for the observed impact of DR on the G2-M transition. The potential to use DR as a method to suppress PCa progression for men under AS warrants further investigation.
23
Chapter 1
24
1 Introduction
25 1.1 Prevalence of PCa
Prostate cancer (PCa) is one of the most frequently diagnosed malignancies in men
worldwide (Ferlay et al. 2010; Siegel et al. 2017), and in Australia, the second most
common cause of cancer-related deaths after lung cancer. It is reported that one in five
men will develop PCa during their lifetime and the risk of developing PCa increases with
age (Klotz et al. 2014). In 2017, it is estimated that 16,665 new cases of PCa will be
diagnosed and approximately 3,500 men may die of PCa in Australia (Australia Institute of
Health and Welfare (AIHW), 2017). It is also suggested that this increasing figure is due to
increase in both PCa incidence and the aging population (Yu et al. 2015).
PCa is clinically diagnosed by detection of rising serum PSA in combination with digital
rectal examination. Low sensitivity of rectal examination and lack of symptoms at earlier
stages of the disease may lead to delayed diagnosis and treatment, which may result in
advanced stage at presentation (Schröder et al. 2012). Early detection of PCa through PSA
screening contributes to decrease in mortality rate; however, there is a concern that PSA
testing may contribute to overtreatment for low risk PCa (Schröder et al. 2012; Siegel et al.
2017).
26 1.2 Treatment options
The choice for treatment of early PCa depends on various factors such as age, PSA level,
tumour stage, Gleason score and International Society of Urological Pathology (ISUP)
score.
1.2.1 Surgery
One of the most common management of early PCa is surgery. There are several ways of
performing prostatectomy namely open radical prostatectomy, laparoscopic radical
prostatectomy and nerve sparing prostatectomy. It is believed that surgery is one of the
effective treatments for men with localized PCa, with PSA level greater than 10 ng/mL and
palpable nodules on digital rectal examination (Litwin et al. 2017; Wilt et al. 2012).
However, regardless of its effectiveness, complications and side effects are common after
surgery including impotence, urinary incontinence, sexual dysfunction, infertility and risk
of infection associated with incision (McCullough 2005).
1.2.2 Radiation therapy
Radiation therapy is another conventional treatment for early PCa and may also be used
after surgery for locally advanced and more aggressive cancer. Radiotherapy is delivered
mainly by two different methods, external beam radiotherapy, which uses external source
of high X-ray energy to target the cancer cells, and brachytherapy or internal radiotherapy
where the radiation source is implanted directly within the prostate gland (American
Cancer Society, 2016). Similar to surgery, radiotherapy may benefit patients with PSA
level greater than 10 ng/mL (Litwin et al. 2017). Due to advance in technology, high-
27 modulated radiotherapy and stereotactic body radiation therapy seem to deliver higher
doses of radiation to cancer cells resulting in improvement of cancer control. Moreover,
low dose brachytherapy can be used for men with small tumours and PSA level less than
10 ng/mL and a low/intermediate Gleason or ISUP score. Ten-year outcomes after surgery
or radiation therapy showed that, although men who received radiotherapy had better
urinary and sexual function, they experienced more nocturia and bowel dysfunction
compared to those who undertook surgery. This study also suggested that surgery and
radiotherapy were associated with lower incidences of disease progression and metastases
than men under active monitoring. However, subsequent urinary and bowel side effects
can be significant after radiotherapy (Hamdy et al. 2016).
1.2.3 Androgen Deprivation Therapy (ADT)
ADT is the primary treatment option for metastatic PCa. It is also known as hormonal
therapy. Two main forms of ADT have been used in management of metastatic PCa. One
is through surgical removal of testes where androgen is synthesised. The other is using
medication to inhibit the production of androgen. As 90% of PCas are dependent on
androgen (Roy et al. 1998), androgen removal or blockage can prevent the binding of
androgen to androgen receptors and thereby suppresses cancer growth. (Tan et al. 2015).
However patients who have received ADT may progress to castration-resistant PCa despite
initial positive responses (Saad 2012). Besides, ADT treatment may result in sexual
dysfunction, decrease in bone density, metabolic changes, decreased libido, depression,
gynecomastia, anemia and fatigue (Nguyen et al. 2015). In addition, increased risks of
diabetes and cardiovascular events may also occur following ADT (Litwin et al. 2017).
28 1.2.4 Chemotherapy
Chemotherapy is an effective modality in the treatment of advanced PCa. It is well
accepted that chemotherapy drugs such as docetaxel and cabazitaxel have contributed to
the increase in survival rate (Oudard et al. 2017). Both of these chemo drugs were given as
first line therapy in patients with metastasis castration-resistant PCa (Oudard et al. 2017). It
is recently reported that combined treatment of docetaxel and ADT is beneficial for men
with hormone sensitive advanced PCa (García et al. 2017). However, adverse side effects
of chemotherapy include nausea, vomiting, diarrhoea, hair loss, loss of appetite, changes in
blood counts, increasing the risk of bleeding or infections, peripheral neuropathy, fatigue
and allergic reaction.
1.2.5 Active Surveillance (AS)
The number of new PCa cases diagnosed by PSA screening has increased since 1980 and
approximately 50% of cases are classified as low risk (Garisto et al. 2017). Over-diagnosis
and over-treatment for low risk PCa has been a common concern (Tosoian et al. 2016). As
a result AS has become a front line option for men with low risk PCa.
According to the Johns Hopkins University guidelines, low risk features are as follows:
PSA level of < 10 ng/mL, PSA density (PSA level divided by prostate volume) < 0.15
ng/mL/cm3, Gleason score ≤ 6, ≤ 50% involvement of any biopsy core, and ≤ 2 positive
biopsy cores involved with PCa (Garisto et al. 2017). AS involves digital rectal
examination annually, PSA test at 3-6 month intervals, a transrectal ultrasound directed
confirmatory biopsy within 12 month of diagnosis, and serial prostate biopsies at 2-5 year
intervals (Carter 2016). The purpose of having these regular examinations is to initiate
29 aggressive treatment in those men who have significant disease progression (Litwin et al.
2017).
Studies have shown that men with low risk PCa will benefit from AS. A study in men with low grade tumours indicated that the mortality rate is the same in men undergoing AS compared to those with immediate aggressive interventions (Wilt et al. 2012; Yaxley et al.
2013). Similarly, a comparison study of the Prostate Testing for Cancer and Treatment
(ProtecT) trial in UK has shown a 1.5% death from patients on AS compared to 0.9% with surgery, and 0.7% with radiation treatment (Hamdy et al. 2016). There was no statistically significant difference in the mortality between the mentioned treatment options from this study. However, some data suggest that about 24–40% of men need surgical or medical treatment after 5 years on surveillance (Carter 2016). During AS, patients and families often live with fear and anxiety (Klotz 2013). Also, uncertainty about the future and fear over missing the optimal window of opportunity for a cure has made some men seeking intervention. In fact, eagerness for active treatment has contributed to overtreatment in men with indolent disease (Dall’Era et al. 2012).
30 1.3 Cell Cycle and Key regulators
The basic cell cycle is divided into two fundamental phases- interphase and mitosis. The
interphase can be subdivided into G1, S and G2 phase. In G1 (Gap1) phase, the cells decide
to enter the cell cycle and prepare for DNA synthesis. Synthetic phase (S) is where DNA
replication takes place. In G2 (Gap2) phase, the cell prepares for the process of division. M
(Mitosis) phase is the stage in which the replicated chromosomes are segregated into
separate nuclei and cytokinesis occurs to form two daughter cells. When the cells lack
specific mitogen signalling after M phase, they exit the cycle and enter into non-dividing,
quiescent state known as G0 phase. Most adult human tissues consist of cells arrested at G0
phase. Upon the growth factor or mitogenic stimulation, these G0 cells may enter into cell
cycle through signalling pathways regulating cyclins and CDKs (Zetterberg et al. 1995).
1.3.1 The importance of Cyclins and CDKs in cell cycle
The up and down-regulation of cyclins and CDKs play a crucial role in cell cycle
progression. A total of 18 cyclins and 13 CDKs have been found in mammalian cells:
Cyclin A1, A2, B1, B2, C, D1, D2, D3, E1, E2, F, G1, G2, H, I, K, T1, T2 and CDK1-13
(Malumbres et al. 2001). All cyclins share a region known as the Cyclin box, which can
bind and activate CDKs (Santo et al. 2015).
CDKs are serine/threonine kinases and activation of CDKs requires cyclins and activating
phosphorylation by CDK-activating kinase (CAK). The negative regulation of CDKs is
accomplished by inhibitory phosphorylation, and binding of CDK inhibitors (CDKIs) such
as INK4 family and Cip/Kip family (Pajalunga et al. 2008). The structural study of human
CDK2, as an example, revealed that CDKs have a modified ATP-binding site between the
31 small amino-terminal lobe and the larger carboxy-terminal lobe. When inactive, ATP binding site of CDKs is closed by carboxy-terminal lobe. Binding of cyclins to their paired
CDKs allows CAK to phosphorylate on carboxy terminal of CDKs. The stimulatory phosphorylation by CAK opens the ATP binding site and activates kinase activities of
CDKs (Holt et al. 2009). CDKs level remains relatively constant throughout the cell cycle and most regulation is post-translational. As illustrated in Figure 1.1, the sequential activation and subsequent inactivation of these cyclin–CDK complexes govern the progression of eukaryotic cells through the cell cycle (Santo et al. 2015; Sgambato et al.
2000).
Cyclin D1, D2, D3 are known for their association with CDK4/6 and regulate the G1 phase of the cell cycle. The level of D type cyclins usually relies on growth factor stimulation such as RAS/RAF/MAPK pathway. The primary substrate for Cyclin D-CDK4/6 is the retinoblastoma tumour suppressor protein (Rb). The phosphorylation of Rb protein by
Cyclin D-CDK complexes leads to the activation of E2F protein which in turn induces transcription of Cyclin E, Cyclin A and CDKs (Santo et al. 2015). Cyclin E paired with
CDK2 enhance the phosphorylation of Rb and thus further activate E2F in a positive feedback loop (Ohtsubo et al. 1995). Another function of Cyclin E-CDK2 is phosphorylating of histone H1 for remodelling chromosome during replication (Johnson et al. 1999; Santo et al. 2015).
During G1-S transition, Cyclin A paired with CDK2 is required for S phase entry. Cyclin A may also bind to CDK1 in late S phase to complete S phase and entry into G2/M phase
(Schulze et al. 1995). Cyclin A, which is found to be colocalised with DNA, is not only involved in initiation and completion of DNA synthesis but may also play a role in preventing multiple DNA replications within one cycle (Bendris et al. 2011; Girard et al.
32 1991). Cyclins responsible for the G2/M phase are Cyclin A and Cyclin B. The importance of Cyclin B1 and CDK1 will be described in more details in the section 1.7.
Although the function of Cyclin D-CDK4/6, Cyclin A/E-CDK2, Cyclin B1-CDK1 have been studied extensively, the exact role of the rest of Cyclins and CDKs remain elusive.
Some studies indicate that, through phosphorylation of the carboxy-terminal domain of the largest subunit of RNA polymerase II, Cyclin C-CDK8, Cyclin T-CDK9 and Cyclin H-
CDK7 (also known as CDK activating kinase, CAK) are also involved in transcription machinery (Johnson et al. 1999; Rickert et al. 1999). Cyclin T-CDK9 is also thought to be involved in activation and differentiation of normal lymphoid B cells (De Falco et al.
2008). Cyclin K-CDK13 also bind and phosphorylate RNA polymerase II at Ser5 and Ser2 at carboxy-terminal domain (Greifenberg et al. 2016).
33 1.3.2 Cell cycle checkpoints
Cyclin-CDK complex activity is strictly controlled in cell cycle progression. DNA damage
or other negative regulation of the complexes before the cells reach restriction point may
result in activation of the cell cycle checkpoints to arrest cells for DNA repair or apoptosis.
These checkpoints prevent the cell from leaving the phase without completing and entering
into new phase prematurely (DiPaola 2002; Malumbres et al. 2001). However, overriding
the cell cycle checkpoints is very common in cancer cells. There are three main
checkpoints in cell cycle: G1-S checkpoint, G2 checkpoint, and mitosis spindle assembly
checkpoint (SAC) as shown in figure 1.1 (Pietenpol et al. 2002).
Figure 1.1 Cyclin-CDKs regulation of the cell cycle and its association with cell cycle checkpoints
34 1.3.2.1 G1-S checkpoint
A series of mechanisms govern the G1-S phase checkpoint. CDK4 and CDK6 are involved
in early G1. The activity of CDK4 and CDK6 is positively controlled by association with
D-type Cyclins (D1, D2 and D3), and negatively regulated by binding to CDK inhibitors of
INK4 and the Cip/Kip family. The family of INK4 inhibitors includes p16INK4A, p15INKB,
INK4C INK4D p18 and p19 and the inhibitory activity occur mainly in G1 phase. Cip/ Kip
Waf1/Cip1 Kip1 Kip2 inhibitors involve p21 , p27 , and p57 , and their activities are not limited to G1
phase of cell cycle (Malumbres et al. 2001).
The main function of Cyclin D-CDK4/6 complexes is to activate retinoblastoma (Rb)
proteins through phosphorylation (Sherr et al. 2004). pRb together with DP1 form a
complex with E2F and thereby repress the transcription activity of E2F (Eagle et al. 1967).
As shown in figure 1.2, hyper-phosphorylation of pRb by Cyclin-CDK complexes releases
the pRb protein from E2F-DP1-pRb complex, thus indirectly activating E2F transcription
factors, leading to G1-S progression (Dyson 1998). The list of genes positively regulated
by E2F includes Cyclin D and E for G1-S transition, Cyclin A and mini-chromosome
maintenance proteins (MCM) for DNA polymerase, and thymidine-kinase for DNA
replication of S phase, chromatin structure, chromosome segregation and mitotic spindle
assembly checkpoint (Malumbres et al. 2009). The elevated Cyclin D-CDK4/6 complexes
can sequester Cip/Kip inhibitors resulting in the reduction of the inhibitors for Cyclin E-
CDK2 complexes (Agarwal 2000). Hence, defects in the G1 arrest checkpoint may lead to
enhanced proliferation through inhibiting INK4 and Cip/Kip inhibitors (Engström et al.
2015), whereas an elevation of INK4 and Cip/Kip inhibitors would trigger the G1/S
checkpoints, causing the cell cycle arrest via mechanisms involving in Cyclin-CDK
complexes.
35
Figure 1.2 Schematic representation of G1-S checkpoint. (1) Cyclin D-CDK4/6 complexes phosphorylate pRb, causing (2) partial release of E2F transcription factors, which (3) transcribe and stabilize Cyclin E; the latter (4) heterodimerizes with CDK2 and (5) the active kinase complex further phosphorylates pRb, and thus further release of more E2F. INK4 family proteins prevent CDK4/6 from the association with the D-type Cyclins. Cip/Kip family proteins directly add the inhibitory phosphate on the CDKs and thereby inhibiting CDKs activity.
1.3.2.2 G2-M checkpoint
The function of the G2-M checkpoint is to prevent cells entering into M phase to serve the
purpose of DNA repair and maintaining genomic stability. Similar to G1-S checkpoint, G2-
M checkpoint activation is mediated by activity of Cyclin-CDK complexes, mainly Cyclin
B1 and CDK1 (also named as cdc2 in yeast). Even though the rise and fall of Cyclin-CDK
activity govern the checkpoints activity, mechanisms regulating Cyclin B1 and CDK1 are
important in triggering the checkpoint activation (DiPaola 2002; Visconti et al. 2016).
During G2-M transition, Cyclin B1-CDK1 complexes are activated by CAK through
phosphorylation. The activity of this complex is further controlled by inhibitory
36 phosphorylations of CDK1 at Tyr15 by Wee1 (Do et al. 2013; Parker et al. 1992) and at
Thr14 by Myt1 (Liu et al. 1997). As described in figure 1.3, the removal of this inhibitory phosphates is accomplished by phosphatase CDC25C leading to activation of Cyclin B1-
CDK1 complex and increase the activity of CDK1. Once DNA damage is detected, p53 and two interconnected pathways ataxia-telangectasia mutated (ATM) protein kinase and ataxia-telangiectasia-related (ATR) protein kinase are activated in G1, S and G2/M phase
(Pietenpol et al. 2002; Visconti et al. 2016). This ATM induced signalling in turn activates check point kinase 1 (CHK1) (Furnari et al. 1997) and check point kinase 2 (CHK2)
(Matsuoka et al. 1998). Active CHK1 and CHK2 inhibit the activity of CDC25C through phosphorylation at Ser216 upon the activation of ATM. Also this inactive phosphorylation by CHK1 and CHK2 creates the favourable binding site for 14-3-3 protein on CDC25C
(Peng et al. 1997). After binding to 14-3-3 protein, CDC25C is localised in the cytoplasm and thus becomes dysfunctional leaving Cyclin B1-CDK1 in inactive stage (Lopez-Girona et al. 1999).
Studies reported that introducing a cytotoxic DNA damaging agent could arrest G2 checkpoint (Nomura et al. 2007; Zhu et al. 2009). If cancer cells with a defective G1 checkpoint received DNA damage, these cancer cells are prone to be arrested at G2-M phase (DiPaola 2002). The defect in G2-M checkpoint may allow the entry of damaged cells to mitosis, which subsequently results in apoptosis or serious consequence if the damage is carried to the next cell cycle (Hirose et al. 2001; Jackson et al. 2000; Visconti et al. 2016). More detail information of G2-M checkpoint proteins will be discussed in section
1.7.
37
Figure 1.3 Regulators responsible for G2-M checkpoints. During G2 to M transition, Cyclin B1-CDK1 (cdc2) complex needs to be activated. Negative regulation by Wee1 involves adding the two phosphates on CDK1 activity site. Dephosphorylation of two inhibitory sites by the phosphatase Cdc25C increases the activity of CDK1. DNA damage activates CHK1, which inactivates Cdc25C through phosphorylation of cdc25C, resulting
in the phosphorylation and inactivity of Cyclin B1-CDK1 and G2-M arrest (DiPaola 2002).
1.3.2.3 Mitosis checkpoint or spindle assembly checkpoint (SAC)
In a normal dividing cell, genomic stability relies on a safeguard mechanism called spindle
assembly checkpoint (SAC). SAC prevents errors in chromosome segregation by delaying
the transition of metaphase to anaphase until the correct mitotic spindle assembly is
completed. This process assures a proper bipolar attachment of all chromosomes to spindle
microtubule and to align the metaphase plate before entering into anaphase (Diogo et al.
2017). The sensitivity of SAC to errors in chromosome attachment is accomplished
38 through kinetochore proteins, which are assembled on centromeric region of chromatin. As shown in figure 1.4.A, upon the unattached kinetochore, mitotic arrest deficient 2 (Mad 2) from mitotic checkpoint complex (MCC) is activated. MCC contains Mad 2, budding uninhibited by benzimidazole (Bub) 3, and budding uninhibited by benzimidazole related 1
(BubR1) (Logarinho et al. 2008). The activated MCC consequently sequesters and inhibits cell division cycle 20 (CDC20). CDC20 is the cofactor and activator of anaphase- promoting complex/ cyclosome (APC/C) and its inhibition by MCC leads to inactivation of APC/C. Consequently, the inhibition of APC/C by SAC response prevents the degradation of both Cyclin B1 and the anaphase inhibitor securin, leading to mitotic arrest and inhibition of sister chromatid separation (Diogo et al. 2017).
SAC is turned off when the chromosome completes proper bipolar attachment to the mitotic spindle and alignment at the mitotic plate. The release of CDC20 activates APC/C, allowing APC/C to target and ubiquitinate Cyclin B1 and securin for degradation by the
26S proteasome. Proteolysis of securin allows protein Separase for cleaving of Cohesin to promote sister chromatid separation (Diogo et al. 2017). During mitosis, active Cyclin B1-
CDK1 is required for several mitotic events such as phosphorylation, activation of microtubule-associated proteins, nuclear lamins, and centrosomal proteins to initiate chromosome condensation, assembly and nuclear envelope breakdown. Cyclin B1 degradation by APC/C quenches CDK1 activity and results in chromosome separation and completion of mitosis and cytokinesis (Figure 1.4 B). Several protein kinases such as protein kinases Bub1 (Tang et al. 2004), Polo Like Kinase 1(PLK1) (Lane et al. 1996;
Strebhardt 2010), monopolar spindle (Mps) 1 (Santaguida et al. 2010) and Aurora B (Hauf et al. 2003; Lampson et al. 2011), also play a vital role in SAC.
Several genes involved in SAC pathway have been reported to be deregulated in different
39 types of cancer including PCa. It has been found that overexpression of SAC member proteins, such as Mad2 (Wang et al. 2002), CDC20 (Wu et al. 2013), BubR1 (Fu et al.
2016), PLK1, Aurora B (Chieffi et al. 2006), Bub1 (Ricke et al. 2011) contributes to cancer progression with poor survival in PCa.
Figure 1.4 Molecular view of the spindle assembly checkpoint (SAC) Pathway. (A) Immunofluorescence Image of a prometaphase cell, stained for microtubules (green), kinetochores (red), and for DNA (blue), showing the presence of unaligned chromosome. SAC is on when the chromosomes are not aligned and attached to microtubules correctly, leading to activating of inactive Mad2 (o-Mad2) to active (c-Mad2). Active Mad2 recruits the MCC complex: Bub3, BubR1, and Cdc20, resulting in inhibition of APC/C. Inactive APC/C loose its ability to degrade Cyclin B1 and Cyclin B1 remains associated with CDK1 as does securin with serparase, resulting in mitotic arrest. (B) Immunofluorescence image of a metaphase cell, stained as in (A), showing all chromosomes aligned at the metaphase plate. In this condition, SAC is turned off. MCC is not activated, leading to releasing of CDC20 to activate APC/C. This mechanism allows the degradation of Cyclin B1 and securin by APC/C, letting the Separase to cleave Cohesins to start the separation of sister chromosome, while inactive CDK1 promotes the mitosis exit (Diogo et al. 2017).
40 1.4 Signalling pathways and proteins involved in DNA damage response
DNA damage in human may arise from either physiological processes or environmental
DNA-damaging agents (Jackson et al. 2009; Valko et al. 2006). Some radioactive
compounds such as uranium decays contribute to cancer incidence (Jackson et al. 2009).
DNA damage by these chemicals leads to impairment in base pairing during DNA
replication and transcription, base loss or DNA single strand breaks (SSBs) and double-
strand breaks (DSBs) (Jackson et al. 2009). In order to repair DNA damage caused by
either exogenous or endogenous source, cell machinery evolves a mechanism called DNA-
damage response (DDR). DDR detects and signals the DNA lesions, pauses the cell cycle
transition, and activates the DNA repair system. Hence, DDR entails not only the
activation of cell cycle checkpoint but also the initiation of apoptosis, transcription and
DNA repair. Failure in DNA repair system may lead to genomic instability and
carcinogenesis (Shaltiel et al. 2015)
The framework signalling of DDR can be divided into three layers: 1) Sensors, 2)
Transducers and 3) Effectors as depicted in figure 1.5 (Maréchal et al. 2013). Once DNA is
damaged, free DSBs ends are recognised by sensors such as MRN complex (Mre11, Rad50
and NBS1), which is recruited to the DNA damage site. NBS1 directly interacts with DSBs
and initiates the formation of MRN protein complex. MRN complex subsequently recruits
and activates transducer kinases including ATM, ATR, DNA-dependent protein kinase
(DNA-PK) and their downstream kinases such as CHK1 and CHK2 (Maréchal et al. 2013).
Transducers kinases further activate the effectors proteins such as breast cancer
susceptibility associated protein 1 (BRCA1), p53, CDC25 phosphatase family etc.
41
Figure 1.5 The framework of the DDR signalling pathway. DDR signalling pathway consists of signal sensors, transducers, and effectors. The sensors of DDR are proteins that recognize DSBs or SSBs. The transducers are kinases, including ATM, ATR, and their downstream kinases. The effectors of this pathway are substrates of transducers kinases involved in a broad spectrum of cellular processes that are important for maintenance of genomic stability of organisms (Maréchal et al. 2013).
1.4.1 Activation of ATM and ATR
As the transducer kinase, ATM and ATR are key components of DDR signalling
pathways. ATM was first discovered in radiation treatment of Ataxia-telangiectasia (AT), a
neurodegenerative disorder. Hypersensitivity of AT cells to IR leads to identification of
AT mutated (ATM) gene. The predicted ATM gene share the homology of
phosphatidylinositol-3 kinase related proteins which play a role in cell cycle control, DNA
repair, and DNA recombination (Canman et al. 1998; Zakian 1995). ATR was discovered
42 later than ATM, and also belongs to the phosphatidylinositol 3-kinase family (Maréchal et al. 2013). In undamaged cells, ATM exists as dimers or oligomers and is altered into monomers on activation by DNA damage, whereas ATR forms a complex with ATRIP
(ATR interacting protein) in the presence or absence of DNA damage (Maréchal et al.
2013).
The activation and recruitment of ATM and ATR are different. ATM activation is associated with DSBs and ATR is related to SSBs (Jackson et al. 2009). Emerging evidence suggests that DSBs not only activate ATM, but also turn on the ATR kinase
(Shaltiel et al. 2015). The main sensor responsible for ATM activation and recruitment is
MRN complex (Canman et al. 1998). MDC1 from MRN complex assists ATM to not only recognize DSBs but also locates the nucleosomes containing phospho-H2AX thus facilitates ATM to recognize the chromatin flanking DSBs and to enhance phospho-H2AX foci formation along chromatin (Maréchal et al. 2013). Different from ATM, the recruitment of ATR-ATRIP to DNA damage site is facilitated by RPA-coated single stranded DNA (ssDNA), which plays an important role in homologous recombination
(HR) damage repair mechanism (Maréchal et al. 2013).
A switch in the activating pathway of ATM to ATR has been well documented associated with DNA damage repair mechanism (Maréchal et al. 2013; Shiotani et al. 2009). When
DSBs occur, the cell cycle stage has a major influence on the choice of the repair pathway employed. Specifically, DNA damage can trigger either Non-homologous end joining
(NHEJ) or HR depending on phase of cell cycle. NHEJ is a fast response but error prone to re-join DNA ends throughout the cell cycle and ATM activation is involved (Riballo et al.
2004). In contrast, ATR is associated with HR. HR responds to DSBs occurred during the
S phase and G2 phase using homologue sequences and errors free. HR initiates repair
43 mechanism using ssDNA ends to search for homologous sequences. A conversion from
DSBs to ssDNA was carried out by nucleases such as MRN complex and this process is
called resection (Takeda et al. 2007). This ssDNA can be recognised by ATR and leads to
ATR activation during S phase (Jackson et al. 2009; Maréchal et al. 2013; Shiotani et al.
2009). ATM dependent phosphorylation of ATR has also been reported as these two
kinases share a domain called the putative leucine zipper domain (Canman et al. 1998).
Activation of ATM and ATR are critical for DSBs induced checkpoint responses as their
activation lead to activation of DNA damage checkpoints protein to either stop the cell
cycle progression or apoptosis.
1.4.2 Activation of CHK2 and CHK1
There are other transducers of DDR signalling pathway, CHK2 and CHK1. The activation
of CHK2 and CHK1 by ATM and ATR reduces CDK activity by various mechanisms in
order to slow down or arrest cell-cycle progression. Although it has long been reported
dependency of CHK1 on ATR, and CHK2 on ATM, emerging evidence of these kinases
showed various “crosstalks” among these kinases (Bartek et al. 2003; Do et al. 2013;
Shaltiel et al. 2015). Following IR induced DNA damage; ATM can phosphorylate both
CHK2 and CHK1 (Figure 1.5) (Ahn et al. 2004; Liu et al. 2000). Several studies reported
that DNA damage checkpoint mediators such as p53 binding protein 1 (53BP1), NBS1,
together with ATM, induce the activation of CHK2 and CHK1 (Bartek et al. 2003).
In response to DNA damage, ATM phosphorylates CHK2 at Thr68 on N-terminal SQ/TQ-
rich regulatory domain, and it is also suggested that ATR may phosphorylate and activate
CHK2 in the same manner. Alanine mutation of this phosphorylation site prevents
activation of CHK2 in vivo (Ahn et al. 2004). Due to its rapid mobility, Thr68
44 phosphorylation by CHK2 is defined as the checkpoint signal spreader (Ahn et al. 2004).
CHK2 protein is found to be stable as a monomer throughout the cell cycle at its inactive
stage in the absence of DNA damage (Bartek et al. 2003). Following the DNA damage,
dimerization of CHK2 monomers followed by multiple inter-molecule phosphorylation
events at Thr383 and Thr387 within the auto inhibitory loop lead to kinase activation (Ahn et
al. 2004). Besides, additional auto-phosphorylation at Ser516 on CHK2 induces its full
kinase activity (Wu et al. 2003).
In human cells, CHK1 can be phosphorylated at Ser 345 by ATR (Liu et al. 2000). In
contrast to CHK2 protein, which is stable and expressed throughout the cell cycle, CHK1
protein is restricted to S and G2 phases. The activation of CHK1 has been found even in
the normal cell cycle progression and CHK1 is further activated in DNA damage response
(Bartek et al. 2003). Dimerization and auto-phosphorylation are not necessary in activation
of CHK1 (Ahn et al. 2004).
1.4.3 ATM-CHK2, ATR-CHK1 Signal transduction
The main function of DNA damage checkpoint protein is to delay the cell cycle
progression and to allow DNA repair before replication or mitosis exit. In response to IR in
15 G1 phase, ATM has been found to regulate and phosphorylate p53 at Ser in vitro. A study
also suggests that phosphorylation of p53 resulted from active CHK2 induced by ATM.
CHK2 phosphorylates p53 at Ser20 after DSBs. As a result, ATM-CHK2 weakens the
ability of p53 binding to Mouse double minute 2 (MDM2), an E3 ligase. In the absence of
DNA damage, MDM2 down regulates the stability of p53 facilitating its degradation
(Canman et al. 1998). So the stable p53 induced by ATM turns on a variety of
transcriptions such as p21 in order to inhibit the activity of CDKs in G1 phase (Canman et
45 al. 1998; Shaltiel et al. 2015).
Among the downstream effector substrates of ATM-CHK2, cell division cycle 25 family phosphatases, CDC25A (Falck et al. 2001) and CDC25C (Blasina et al. 1999) are well known in DNA damage checkpoint signalling. CDC25A and CDC25C function in activation of CDK2 and CDK1 by dephosphorylation of inhibitory phosphate from CDKs resulting in progression of G2 phase to M phase. The phosphorylation on CDC25A at
Ser123 by CHK2 leads to degradation of CDC25A via SKP1-cullin-F-box (SCF) proteins in
216 G1 phase. Similarly, phosphorylation of CDC25C at Ser by CHK2 destabilises this phosphatase creating a motif for 14-3-3 proteins for nuclear export (Peng et al. 1997). It is followed by degradation of CDC25C and leads to inactivating of Cyclin B1 and CDK1 for
G2-M transition. CHK2 also phosphorylates and activates Wee1 to inhibit the CDK1 activity at G2-M transition (Figure 1.6) (Jackson et al. 2009).
Furthermore, the activation of p38 MAPK family by ATM prevents S phase entry through stabilisation of p21 mRNA transiently and promoting the degradation of Cyclin D and the
CDC25A phosphatase that increases the activity of CDK in G1 phase (Shaltiel et al. 2015).
It is also reported that active CHK2 phosphorylates E2F1 at Ser364 after DNA damage induced by agent etoposide negatively affecting the stability and transcription activity and may result in apoptosis (Ahn et al. 2004; Lin et al. 2001).
Despite the difference in biological role between ATM and ATR, CHK2 and CHK1, these two kinases possess overlapping roles in checkpoint signalling. CHK1 is also defined as analogue of CHK2 and therefore may have similar effect on p53, CDC25A and CDC25C upon DSBs (Liu et al. 2000). CHK1 alone targets Cdc25A even in the absence of DNA damage and revealing another function of CHK1 in normal cell cycle transition via
46 Cdc25A (Bartek et al. 2003). CHK1 is also able to phosphorylate on Wee1, which add inhibitory phosphates on Cyclin B1-CDK1 complex (Shaltiel et al. 2015). When the DNA damage occurs in G2 phase, ATM and CHK2 signalling pathway initiates cell cycle arrest at G2 and is later maintained by signal induced by ATR-CHK1. Furthermore, similar to G1 phase arrest caused by DDR, G2 arrest is likely achieved through inhibition of CDC25 family phosphatase resulting from p38 activation by ATM and ATR kinases. However,
ATR induced activation of CHK1 is disabled in G1 phase. Claspin is a positive regulator of
CDH1 CHK1 and its degradation by APC/C prevents the activation of CHK1 in G0 and G1 phase (Shaltiel et al. 2015). Therefore, ATM-CHK2 signalling control of G1 checkpoint in response to DNA damage (Figure 1.6).
When the replication forks create ssDNA during S phase, DDR from ssDNA triggers the activation of ATR (Jackson et al. 2009; Shaltiel et al. 2015). Both ATM and ATR are responsible for signalling events during S phase. In spite of p53 stabilisation induced by both ATR and ATM, the effector p21 expression is inhibited during DNA replication by the PCNA associated cullin4A RING E3 ubiquitin ligase complex containing Cdt2 (Abbas et al. 2008; Shaltiel et al. 2015).
Unlike the other phases of cell cycle, DDR and DNA repair mechanisms are absent during
M phase regardless that DSBs (Figure 1.6). PLK1 and CHK2 are co-localised in centrosome (Tsvetkov et al. 2003). In order to support the mitotic exit, PLK1 inhibits the
CHK1 and CHK2 from being activated by ATR and ATM. First, PLK1 phosphorylates
CHK2 to prevent dimerization. PLK1 also introduces the degradation of Claspin, which bridges between ATR and CHK1 for CHK1 activation, via SCF protein. Second, CDK1 is found to phosphorylate RNF8 at Ser198 to prevent the formation of polyubiquitin damage site. Third, during mitosis, PLK1, together with unidentified kinase, diminish the
47 recruitment of 53BP1 protein to DNA damage site by adding phosphate at Thr1609 and
Ser1618 on 53BP1. Phosphorylation of RNF8 and 53BP1 consequently prevent DNA damage repair. Together, these mechanisms eliminate most checkpoint signals and DNA repair in mitosis (Ahn et al. 2004; Shaltiel et al. 2015). More detail information of the role of PLK1 will be discussed in section (1.8).
48
Figure 1.6 DNA damage response signalling in the various stages of the cell cycle. Damaged DNA activates the ATM kinase in all phases of the cell cycle. CDK2 forces HR activity in S phase and G2 to activate ATR. CDK2 dependent phosphorylation of ATRIP and Chk1 further restrict full activation of ATR and CHK1 to S and G2 phase. Finally, DNA damage signalling is potently inhibited in mitosis due to combined action of Cdk1 and Plk1 (Shaltiel et al. 2015).
49 1.4.4 Aberrant regulation of ATM and ATR
It has been well accepted that a defect in ATM has severe consequences as ATM is
involved in DNA repair, gene regulation, translation initiation and telomere
maintenance. Since there is a strong relation between ATM and BRCA1 protein, AT
patients have increased risk for breast cancer (Friedenson 2007). ATM deficient mice
are viable with slow growth (Canman et al. 1998). Strong association between
epigenetic modification (methylation) in ATM and several carcinomas including lung
cancer and brain tumour has been recorded (Safar et al. 2005). Although ATM and
ATR share the homology, the mutation in ATR protein is not prone to tumour risk.
1.4.5 Aberrant regulation of CHK2 and CHK1
Knock down studies of CHK2 and CHK1 reported that CHK1 is essential for
embryonic development, and viability (Liu et al. 2000) and is indispensible for
checkpoints response, while CHK2 may work as a tumour suppressor. A frameshift
mutation in CHK1 protein has been implicated in colon and endometrial carcinomas
with microsatellite instability. In small lung carcinomas, a shorter isoform of CHK1
mRNA, which is thought to encode CHK1 protein lacking catalytic domain has been
identified (Bartek et al. 2003). Likewise, somatic mutations of CHK2 have been found
in breast, lung, ovary, colon cancers, osteosarcoma and lymphoma. Down-regulation
of CHK2 protein level is also common in oncogenesis. Moreover, Thr68 phospho-
CHK2 has been found in primary breast and colon carcinomas with mutant p53 (Ahn
et al. 2004).
50 1.4.6 γH2AX
γH2AX or phospho-H2AX is a well-known sensitive biomarker for monitoring DNA
damage initiation and resolution due to its biological features, or phospho-H2AX foci,
in response to DNA damage. H2AX belongs to the H2A histone family (H2A, H2B,
H3 and H4), which forms octamer of core histone protein in the nucleosomes. In
mammalian cells, the C terminus of H2AX at Ser139 (γH2AX) is phosphorylated by
DNA damage response kinases such as ATM, ATR and DNAPK (Burma et al. 2001)
and this C terminal extension region of H2AX is highly conserved among eukaryotes.
H2AX phosphorylation is a key step in DDR to initiate the DNA repair mechanism.
Once DSBs occurs, the ability of chromatin modification of H2AX allows increased
DNA accessibility, recruitment and accumulation of DDR proteins at DNA ends. It
also helps to re-join the DSBs by anchoring broken ends together through nucleosome
repositioning, and decreases the density of chromatin (Mah et al. 2010). A study has
shown that H2AX null mice are sensitive to IR with genomic instability causing
tumours, and restoration of wild type (WT) H2AX allele causes radiation resistance
with conserved genome (Celeste et al. 2003).
ATM is the most potent activator of H2AX and its phosphorylation on H2AX occur on
DNA adjacent to a DSB as shown in Figure 1.7 (Shaltiel et al. 2015), but others
indicate that ATR is more important for H2AX phosphorylation in response to DNA
damage. In order to create a signal amplification loop of phospho-H2AX at the DNA
damage site, several mediators such as NBS1 (Kobayashi 2004), MDC1 (Lou et al.
2006) and phospho-H2AX itself (Stucki et al. 2006) facilitate phosphorylation of
H2AX induced by ATM. The bonds between NBS1 and MDC1 to phospho-H2AX
51 also serve as assembly sites for other DDR proteins including E3 ubiquitin protein ligase RNF8, RNF168 (RING finger protein 168), MRN complex, BRCA1 and p53- binding protein 1 (53BP1), which are essential recognizers and mediators of DDR
(Palla et al. 2017). This phosphorylation event of H2AX occurs within minutes after
DNA damage, and rapidly spreads over large chromatin domains (Maréchal et al.
2013). Distinct nuclear foci formation as a result of H2AX phosphorylation induced by
ATM and ATR is now widely used as a quantitative marker of individual DSBs (Mah et al. 2010).
Using immunofluorescence microscopy, phospho-H2AX foci can be detected a range of quantities from low events just minutes after DSBs until 4hr post radiation with a linear relationship between foci formation and dose of IR in human fibroblasts
(Markova et al. 2007). It has also been suggested that the quantity of phospho-H2AX may be used for detection of precancerous lesion as it reflects the genomic instability associated with cancer. Additionally, phosphorylated H2AX is applicable for observing radiation sensitivity of individual clinical setting in cancer treatment (Mah et al. 2010; Olive et al. 2004).
The presence of phospho-H2AX in normal cells have been reported without being affected by external DNA damage revealing multiple function of H2AX in various parts of cellular events starting from acetylation, phosphorylation and ubiquitination,
DNA repair, cell growth etc. In addition, mutations or deletions are very common on the chromosome where H2AX is located, leading to variety of human cancers
(Pouliliou et al. 2014). The expression level of phospho-H2AX is implicated with disease progression in different types of cancer. For example, epithelial ovarian cancer tissues express significantly higher level of phospho-H2AX than in normal tissue. In
52 breast cancer patients, the increase in phospho-H2AX foci correlates with poor prognosis. Similar result has also been found in hepatocellular carcinoma, colon carcinomas, fibrosarcoma, osteosarcoma, glioma, and neuroblastoma cells (Palla et al.
2017). Taken together, phospho-H2AX behaves as a sensitive marker for DSBs, which implies genomic instability and may contribute to cancer initiation and progression.
Figure 1.7 Flow chart represent G2 phase arrest on DNA damage response. The DNA double strand breaks triggered by IR and other genotoxic events phosphorylate H2AX by ATM. γH2AX (phospho-H2AX) is required for phosphorylation of 53BP1 by ATM and localize 53BP1 into nuclear foci. In turn, ATM together with 53BP1 phosphorylate of its downstream target p53. 53BP1 is not necessary to couple ATM in activation of CHK1 and CHK2.
53 1.4.7 53BP1
Another important protein that responds to DSBs is 53BP1. 53BP1 was firstly
described as the binding partner of tumour suppressor protein p53, although the
significance of the interaction with p53 is still unclear. It has been reported that 53BP1
functions as a mediator and effector of the DSBs response (Panier et al. 2014). 53BP1
has been used as clinical prognostic marker because 53BP1 form large foci near DNA
lesions (Djuzenova et al. 2015) and it also acts as an indicator of where ATM or ATR
mediated DNA damage signalling is induced (Figure 1.7).
The mechanism involved in the recruitment of 53BP1 to the site of DNA breaks is
complicated and still in debate. According to nuclear magnetic resonance and X-ray
crystallography spectroscopy studies, chromatin binding domain of 53BP1 specifically
binds to histone H4 dimethylated lysine-20, for its localization to damage sites (Gupta
et al. 2013; Kim et al. 2006). It has also been reported that phospho-H2AX is necessary
in recruiting 53BP1 to the DNA damage site and thereby promotes phosphorylation
events by ATM (Gupta et al. 2013). This recruitment of 53BP1 to the DNA damage
site by numerous proteins has been reported. ATM, MDC1, the MRN complex, and
the RING finger E3 ubiquitin ligases RNF8 and RNF168 are upstream mediators
found in DNA damage foci (Daley et al. 2014). RNF8 is joined at the DNA damage
site though MDC1 and its subsequent recruitment of 53BP1 is dependent on the
interaction between RNF8 and its partner E2 enzyme UBC13. The ubiquitination of
phospho-H2AX and H2A by RNF 8 is recognised by RNF168. RNF168 together with
UBC13 further transmit the ubiquitination of histone of phospho-H2AX and lysine 13
and lysine 15 of histone H2A. This sequential ubiquitination event facilitates the
54 docking site for 53BP1in access to the DNA damage sites (Daley et al. 2014).
53BP1 is a large protein with no significant enzymatic activity, but it holds interacting sites of several proteins related to DSBs response. 53BP1 includes three main sites, which can be phosphorylated by ATM upon DNA breaks. Evidence had been found to describe the role of 53BP1 on DNA damage site. Firstly, 53BP1 serves as the scaffold protein for DSBs repair and signalling proteins such as the chromatin modulator
EXPAND1 (Huen et al. 2010), RAP1-interacting factor 1, and PAX transactivation activation domain interacting protein which subsequently recruits RNF8 and RNF168 to the damage chromatin site (Daley et al. 2014; Panier et al. 2014). Secondly, 53BP1 promote DNA damage checkpoint signalling through amplification of ATM activity like phospho-H2AX, in response to low levels of DNA damage (DiTullio et al. 2002).
Thirdly, it is involved as a key player in preserving genome integrity by choosing the relevant DNA repair pathways regarding the different cell cycle phases (Gupta et al.
2013). 53BP1 functions to promote NHEJ and inhibiting HR. Inhibiting of recruitment the HR factor BRCA1 by 53BP1 to DSBs has been reported.
Genomic instability with G2-M check point defect has been reported in both human and mouse, in the absent of 53BP1 as a consequence of failure to indicate the damage site on chromatin through consequent reduction in phosphorylation of ATM targets such as p53, CHK2 and BRCA1 (DiTullio et al. 2002; Panier et al. 2014). 53BP1 is under expressed in triple negative breast cancer (Bouwman et al. 2010)
55 1.5 M phase promoting complex and regulators at G2 to M phase transition
Cell cycle progression from G2 to M phase requires the activation of M phase
promoting complex, which is Cyclin B1-CDK1 and its regulators such as PLK1 and
Aurora A (Otto et al. 2017).
1.5.1 Cyclin B1-CDK1 complex
During cell cycle progression, entry to mitosis is controlled by activation of Maturation
promoting factor or Mitosis promoting factor (MPF) (Murray et al. 1989). MPF is
composed of two different regulatory proteins, CDK1 and its activating partner, Cyclin
B1 (Murray et al. 1989). Unlike other interphase CDKs, such as CDK2 and CDK4/6,
CDK1 is the only CDK that is essential for cell cycle progression as the mouse
embryos failed to develop in the absence of CDK1 (Santamaria et al. 2007).
Inactivation of CDK1 also prevents tumour formation and dissemination suggesting a
critical role of CDK1 in cell cycle progression (Diril et al. 2012). The activity of
CDK1 involved in many cell cycle events such as gene transcriptions, DNA
replication, chromosome segregation and cell morphogenesis. Emerging evidence
showed that approximately 75 targets of CDK1 have been identified (Enserink et al.
2010).
1.5.1.1 Role of Cyclin B1 and CDK1 at G2/M phase
Like other CDKs, CDK1 is expressed throughout the cell cycle, although it is activated
only at G2-M transition (Glotzer et al. 1991). The activity of CDK1 is regulated
through its phosphorylation mode. The protein level of Cyclin B1 begins to rise at late
56 S phase and reaches its peak level in G2-M transition, followed by its fall in anaphase
onset (Clute et al. 1999). Once Cyclin B1-CDK1 complex is activated, this complex in
turn activates numerous proteins from M phase such as microtubule-associated
proteins, nuclear lamins, histone H1, centrosomal proteins to initiate chromosome
condensation, assembly and nuclear envelope breakdown (Johnson et al. 1999). In late
mitosis, Cyclin B1 is degraded by APC/CCDC20 and APC/CCDH1 extinguishing CDK1
activity and thus consequently allows chromosome segregation and cytokinesis. The
impairment of Cyclin B1-CDK1 activity at G2-M transition will cause G2 checkpoint
activation and cell cycle arrest (Otto et al. 2017).
A correlation has been reported between overexpression of Cyclin B family and human
cancers including prostate, breast and lung cancers. The high level of Cyclin B1 is also
associated with tumour grade and poor prognosis. Therefore, the regulation of Cyclin
B1 and CDK1 at mRNA level, protein level by post translational modification and
localization are essential in progression of cells from G2 phase to M phase (Porter et al.
2003; Takizawa et al. 2000).
1.5.1.2 Regulation of Cyclin B1-CDK1
There are several mechanisms that are involved in the regulation of Cyclin B1-CDK1
complex.
1.5.1.2.1 Regulation by Cyclin B1
Activity of CDK1 can be regulated fundamentally through synthesis and degradation
of its binding partner Cyclin B1 as shown in figure 1.8. According to the study in vitro
and in vivo of xenopus cells, Cyclin B1 level is 20-30 fold higher in late G2 than in G1
phase as the protein needs to get to peak level for activation of CDK1 (Murray et al.
57 1989). A similar pattern has also been found in mRNA level of Cyclin B1 (Morgan
1995). The transcription factors that bind to promote region of Cyclin B1 include p53,
p21, Activator protein 1, c-Myc. Therefore, regulation of the mRNA level of Cyclin
B1 by these transcription factors may indirectly influence on the CDK1 activity
(Bretones et al. 2015). Cyclin B1 degradation by APC/C is necessary for driving
mitotic exit and cytokinesis (Van Zon et al. 2010).
Interaction between Cyclin B1 and CDK1 through Cyclin motif activates the
serine/threonine protein kinase activity of the CDK1. Cyclin B1 binding through this
functional domain allows opening of kinase domain of CDK, which is blocked by T
loop before interaction. Therefore, mutation on this Cyclin motif may keep CDK1 in
its inactive stage (Morgan 1995; Porter et al. 2003).
1.5.1.2.2 Regulation by CAK
Similar to other CDKs, phosphorylation at the catalytic domain, ie ATP binding site,
of CDK1 determines the active or inactive form of CDK1. Catalytic cleft of ATP
binding site needs to be opened by phosphorylation for kinase activation. To achieve
161 this activation, CDK1 is phosphorylated on Thr by CAK at G2 phase and remains in
active stage until late M phase (Figure 1.8) (Morgan 1995).
1.5.1.2.3 Regulation by Myt1 and Wee1
On the other hand, phosphorylations on Thr14 and/or Tyr15 by Myt1 and Wee1 in the
nucleus inhibit CDK1 activity by blocking the ATP binding sites respectively (Figure
1.8) (Do et al. 2013). The increase in activity and protein level of Wee1 during S and
G2 phases inhibit Cyclin B1-CDK1 activity before G2 phase and upon mitotic entry,
and its degradation induced by PLK1 enhances the activity of Cyclin B1-CDK1
58 (Matheson et al. 2016). Consistently, following DNA damage, Wee1 is stimulatory
phosphorylated by CHK1, which inhibits the Cyclin B1-CDK1 activity causing G2
arrest (Do et al. 2013; Pietenpol et al. 2002; Shaltiel et al. 2015).
1.5.1.2.4 Regulation by CDC25C
During G2-M transition, the inhibitory phosphates formed Cyclin B1-CDK1 complex
is removed by phosphatase CDC25C. CDC25C belongs to CDC25 protein tyrosine
phosphatases (PTPs) family, which includes three isoforms: CDC25A, CDC25B and
CDC25C (Figure 1.8). Among them, CDC25A mainly functions in G1 and S phase,
while CDC25B and CDC25C are involved in G2 phase (Lammer et al. 1998).
Activity of this phosphatase is regulated by phosphorylation in a cell cycle-dependent
manner. PLK1 is a well-known positive regulator of CDC25C. The phosphorylation on
Ser198 at nuclear localization signal of CDC25C by PLK1 locates CDC25C to the
nucleus and activates its activity (Toyoshima‐Morimoto et al. 2002). Once activated,
CDC25C removes the inhibitory phosphates from Cyclin B1-CDK1 and enhances cell
cycle progression.
CDC25C is phosphorylated at Ser216 by CDC25C associated protein kinase 1 in
interphase and this phosphorylation site is important for binding to 14-3-3 protein
(Lopez-Girona et al. 1999; Peng et al. 1998). This interaction enhances cytoplasmic
localisation of CDC25C and interferes the interaction with Cyclin B1-CDK1 (DiPaola
2002; Peng et al. 1998). In contrast to Wee1 activity, inhibition of CDC25C by CHK1
and CHK2 is found after DNA damage. As aforementioned in G2-M checkpoints,
CDC25C is inhibited via phosphorylation on Ser216 by both CHK1 and CHK2, and
thus creates the binding site for 14-3-3 in order to prevent the activation of Cyclin B1-
59 CDK1 complex (Pietenpol et al. 2002; Shaltiel et al. 2015).
Studies have shown that mutations inhibiting the activity of CDC25B and CDC25C
arrest the cells at G2 phase. Although aberrant expression of CDC25C is not found,
CDC25A and CDC25B are over expressed in many tumours including: breast, colon,
gastric, ovarian, thyroid, esophageal, squamous-cell and colorectal carcinomas,
lymphoma and neuroblastoma and is associated with tumour grade and poor prognosis.
Structural analysis of CDC25 family suggested that the difference in amino acid
residues affect the catalysis activity of these three isoforms and thereby affecting
different substrates (Lavecchia et al. 2010).
1.5.1.2.5 Regulation by intracellular localization
Cyclin B1-CDK1 complex is also known to be regulated through its localization.
Cyclin B1 lacks nuclear localization signal and only presents cytoplasmic retention
signal (CRS). As a result, it remains in cytoplasm throughout interphase and needs the
aid of nuclear localization signal from other proteins to be transported into nucleus for
activation of CDK1 (Porter et al. 2003). The deletion of CRS region allows Cyclin B1
in the nucleus. It is reported that during the onset of M phase, Cyclin B1 is
phosphorylated on Ser126 and Ser128 by CDK1 (Borgne et al. 1999) and Ser147 by PLK1
(Toyoshima-Morimoti et al. 2001). As these phosphorylation sites are on its CRS,
phosphorylations by PLK1 and CDK1 inhibit CRS leading to localization of Cyclin B1
in the nucleus (Porter et al. 2003).
60
Figure 1.8 Schematic diagram represents the regulation of Cyclin B1-CDK1 complex (MPF). Cyclin B1-CDK1 complex is positively regulated by CAK, Cyclin B1 synthesis and phosphatase CDC25C and negative regulated by Wee1 and Myt1. PLK1 activates CDC25C and inhibits Wee1 in order to activate Cyclin B1-CDK1.
Activation of Cyclin B1-CDK1 complex leads to cell cycle progression from G2 phase to M phase.
61 1.5.2 PLK1
Polo like kinase 1 (PLK1) belongs to a family of serine/threonine kinases, which
contains a unique polo-box domain and plays a vital role in cell cycle progression. It is
commonly accepted that the importance of PLK1 is no less than CDKs as the cells fail
to complete bipolar spindle attachment in the absence of PLK1 in yeast and animal
cells (Sumara et al. 2004). The catalytic activity of PLK1 is activated by stimulatory
210 phosphorylation at Thr by Aurora A and Bora at G2 phase (Macurek et al. 2008;
Seki et al. 2008) and phosphatase 1 C is thought to dephosphorylate at centrosome.
PLK1 is targeted for degradation by anaphase-promoting complex/cyclosome,
APC/CCDH1 through ubiquitination in anaphase and DNA damage (Floyd et al. 2008).
According to localisation studies of PLK1, the presence of PLK1 in both nucleus and
cytoplasm indicates its versatile functions and crucial role in cell cycle progression as
shown in figure 1.9 (Van Vugt et al. 2005). Studies have also uncovered that PLK1 has
multiple functions in regulating cell cycle such as supporting the entry into mitosis,
centrosome maturation, spindle assembly, sister chromatid splitting, activation of the
APC/C and exit from mitosis with the initiation of cytokinesis (Strebhardt 2010).
Since overexpression of PLK1 in human is strongly correlated with tumour
progression, inhibitors targeting PLK1 have been identified and developed for clinical
trial (Strebhardt 2010). Interestingly, although down-regulation of PLK1 causes
apoptosis in cancer cells, viability of normal cells is not affected by its down-
regulation. Therefore, PLK1 has become one of the most promising targets for cancer
treatment.
62
Figure 1.9 Localisation of PLK1 in G2 phase and M phase of cell cycle by immunofluorescence.
1.5.2.1 Role of PLK1 in G2-M transition
Studies of the protein and mRNA level of PLK1 in both Drosophila melanogaster and
Saccharomyces cerevisiae showed that the activity of PLK1 is low in G0, G1 and S
phases, and begins to increase in G2 and reached the peak level during M phase
(Golsteyn et al. 1994) indicating the importance of PLK1 in G2 and M phase. During
210 G2 phase, PLK1 is phosphorylated on Thr in the activation loop of the kinase
domain by Aurora A and Bora (Aurora kinase A activator) causing its activation
(Macurek et al. 2008; Seki et al. 2008). Active PLK1 controls the G2-M transition via
regulation of the activity of MPF. There are three significant mechanisms that control
activity of MPF, Cyclin B1-CDK1, by PLK1. Firstly, PLK1 activates CDC25C
through phosphorylation at Ser198 and that in turn removes the inhibitory
phosphorylation on CDK1. Phosphorylation by PLK1 not only activates CDC25C, but
also translocates CDC25C into the nucleus (Toyoshima‐Morimoto et al. 2002).
Secondly, PLK1 inhibits Wee1(Watanabe et al. 2004) and Myt1 (Nakajima et al.
2003), which are the inhibitors of CDK1. Phosphorylated Wee1 is targeted to undergo
63 proteasome-dependent degradation after ubiquitination by the E3 ubiquitin ligase
SCFβ-TrCP (Watanabe et al. 2004). Thirdly, PLK1 phosphorylates Cyclin B1 on its
CRS in order to localize Cyclin B1-CDK1 to the nucleus (Figure 1.10) (Toyoshima-
Morimoti et al. 2001). Therefore, the role of PLK1 in G2-M transition is indispensible
(Strebhardt 2010).
1.5.2.2 Role of PLK1 in DNA damage response
Among the many of PLK1 functions, PLK1 is also involved in the G2 checkpoint
activation after DNA damage. One investigation had shown that the PLK1 is inhibited
by DNA damage in G2 phase and Mitosis phase in human osteosarcoma cells (Smits et
al. 2000). This group also reported the association of PLK1 with DDR checkpoint
protein kinase CHK2 after treating the cells with IR. Furthermore, PLK1 is
catalytically inactivated and this inactivation is dependent on activity of ATM
and ATR, which in turn contributes to G2 arrest due to the ability of PLK1 in locating
Cyclin B1 to the nucleus (Figure 1.10). Consistently, expression of active form of
PLK1 overrides the DNA damage induced G2 phase arrest (Smits et al. 2000; Van
Vugt et al. 2005).
The regulation of PLK1 in checkpoint recovery after DNA damage has been studied in
yeast, but its function in mammalian cells is very limited. One study had shown that
although depletion of PLK1 did not have a significant effect on mitotic entry in cells
with unperturbed cell cycle, PLK1 is essential in damaged cells for mitotic entry after
checkpoint silencing (Van Vugt et al. 2005).
64 a) Premature mitotic entry is prevented
in G2 phase through inhibitory phosphorylation on Cdk1 and blocking nuclear export of Cyclin B.
b) During mitotic entry, the activation of Plk1 results in multiple processes including the activated phosphorylation of Cyclin B and Cdc25C, inhibitory phosphorylation of Wee1 and Myt1. Phosphorylation of Cyclin B and Cdc25C, promotes Cyclin B–Cdk1 activation at the centrosome and a feedback loop may involve for signal amplification. In contrast inhibitory phosphorylation of Wee1 results in its degradation.
c) Upon DNA damage, the G2 DNA damage checkpoint prevents mitotic entry through activation of checkpoint kinases ATM, ATR, Chk1, Chk2 and p38 mediate nuclear export of Cdc25B and Cdc25C, degradation of Cdc25A, activation of Wee1 and inhibition of Plk1, resulting in inactivation of Cyclin B-Cdk1 with inhibitory phosphorylation at Tyr15.
? indicates unclear mechanism.
(Van Vugt et al. 2005)
Figure 1.10 The role of PLK1 in (a) G2 phase, (b) Mitotic entry and (c) G2-M DNA damage checkpoint.
65 1.5.2.3 Role of PLK1 in Mitosis
The most remarkable feature of PLK1 is its presence in various subcellular structures
during mitotic progression. The association of PLK1 and centrosomes is found in
prophase, followed by the accumulation of PLK1 in kinetochore during prometaphase
and metaphase. During anaphase, it is recruited to spindle attachment and move to
mid-body in telophase (Petronczki et al. 2008).
Firstly, PLK1 regulates the maturation of centrosome in prophase. PLK1 recruits the γ-
Tubulin ring complex, which nucleates new microtubules to centrosomes. Another
component of centrosome regulated by PLK1 is Ninein-like protein whose functions
are in recruitment of γ-Tubulin ring complex and regulation of microtubule nucleation
(Petronczki et al. 2008; Strebhardt 2010). During prophase, PLK1 contributes to the
activation of APC/C, which is an E3 ubiquitin ligase, through multiple events in the
control of sister-chromatid separation and mitotic exit. Early mitotic inhibitor 1 (EMI1)
is an inhibitor of APC/C during S and G2 phases. The inhibitory phosphorylation of
EMI1 by PLK1 leads to SCF dependent degradation of EMI1 activating APC/C for
chromosome separation. After sudden degradation of EMI1, PLK1 can directly
phosphorylate the subunits of APC/C and enhances the activity of APC/C beyond the
prometaphase (Golan et al. 2002). After its full activation, APC/C activates the
Separase and then active Separase cleves Cohesin allowing the separation of sister
chromatin (Strebhardt 2010).
Inactivation of PLK1 induced by siRNA before and after assembly of bipolar spindles
shows that PLK1 is essential in bipolar spindle attachment and also necessary to
maintain the proper attachment. In addition, electron microscopy observation of PLK1
66 with abnormal polo box domain shows mislocalisation of PLK1 and consequently causes error in microtubule-kinetochore attachment (Sumara et al. 2004). PLK1 is also a major player in SAC. Recruitment of the main components of SAC: Mad1/Mad2 and Bub3/BubR1 and CENP-E; is increased by the activity of PLK1 through phosphorylation and destruction of PLK1 by RNAi or other pharmacological reagents arrests the mammalian cells in prometaphase due to failure kinetochore and microtubule attachment (Petronczki et al. 2008; Sumara et al. 2004).
In order to generate two physical distinct daughter cells, the formation of cleavage furrow is necessary before cytokinesis. A protein complex called centralspindlin is located on spindle midzone between the parallel alignment of two sets of separated sister chromosomes. This complex contains Rho GTPase-activating protein HsCYK4 and the mitosis kinesin like protein 1. PLK1 is localized on the midzone and phosphorylates HsCYK4 and thus creates docking site for Rho GTP exchange factor
ECT2. This event by PLK1 is pre-requisites for assembly of actinomyosin ring formation and activation of the small GTPase RhoA, causing cleavage furrow formation (Strebhardt 2010; Strebhardt et al. 2006).
67 1.5.3 Aurora A
Aurora A kinase, a centrosome-localized protein, belongs to serine threonine kinase
Aurora kinase family (Marumoto et al. 2002). Like PLK1, overexpression of Aurora A
kinase is associated with a broad range of human malignancies and has been targeted
for anti-cancer therapy. A number of Aurora A kinase inhibitors have been
characterised and clinically assessed (Wang et al. 2014). As an oncogene, Aurora A
regulates cell cycle progression at multiple levels. It is reported that, among the three
Aurora kinases: Aurora A, Aurora B and Aurora C, Aurora kinase A and B play crucial
roles in mitosis of human cells Aurora A has a short amino-acid peptide motif entitled
the “destruction box” (D-box). This D box is recognised by APC/C for degradation
through the ubiquitin/proteasome pathway (Yan et al. 2016).
1.5.3.1 Role of Aurora A in G2-M transition
One of the most important functions of Aurora in cell cycle regulation is activating
PLK1 and CDC25C in order to promote cell cycle progression from G2 phase to M
phase. PLK1 is phosphorylated at Thr210 by Aurora A (Macurek et al. 2008). Aurora A
together with its partner Bora induce phosphorylation of PLK1 at Thr210 and activate
PLK1 to initiate entry to M phase (Seki et al. 2008). This study collectively indicated
PLK1 activation induced by Aurora A on the activation of CDK1 by CDC25C (Seki et
al. 2008). A positive feedback loop has been found in Aurora A activation mediated by
Ajuba, one of LIM proteins (Hirota et al. 2003).
Silencing Aurora A by miRNAs or VX680 reduces the expression of CDC25C in renal
carcinoma cells (Li et al. 2012). Furthermore, overexpression of Aurora A increases
68 Cyclin B1expression and interrupts the degradation of Cyclin B1 (Qin et al. 2009). It is
also reported that Aurora A kinase phosphorylates CDC25B at Ser353 leading to its
activation and may enhance the de phosphorylation of CDK1 inhibitory phosphate and
localizes the Cyclin B1-CDK1 complex in the nucleus at G2-M transition in Hela cells
(Dutertre et al. 2004). Consistently, inhibiting Aurora A activity delays M phase entry
of the cells (Marumoto et al. 2002).
Emerging evidence shows that Aurora A inhibits tumour suppressor proteins such as
pRb, p53, p21, p27. Down-regulation of Aurora A in multiple myeloma by Aurora
kinase inhibitor MLN8237 induces G2/M arrest with the increase of p53, p21 and p27
protein levels both in vitro and in vivo (Görgün et al. 2010). Similar result has been
found by using another Aurora A kinase inhibitor MK8745 in HCT cells (Nair et al.
2012). When Aurora A is transiently down regulated by shRNA osteosarcoma cells,
the cells viability is inhibited with a significant apoptosis and G2/M arrest (Jiang et al.
2014).
1.5.3.2 Role of Aurora A in DNA damage response
The role of Aurora A in DNA damage response is also documented. The kinase
activity of Aurora A is inhibited upon DNA damage and arrests the cells at G2 phase
with dependence on CHK2 and CHK1 kinases (Krystyniak et al. 2006). Up-regulation
of Aurora A after DNA damage abolishes G2-M arrest. Aurora A also phosphorylates
p53 at Ser315 disrupting the DNA binding ability of p53 and facilitates the degradation
of p53 mediated through MDM2. It has been shown that phosphorylation of p53 at
Ser315 by Aurora A decreases the sensitivity of H1299 cells to Cisplatin and IR (Liu et
al. 2004; Wang et al. 2014).
69 1.5.3.3 Role of Aurora A in Mitosis
In mammalian cells, Aurora A level was low in G1 and S phase and accumulated at
centrosomes during G2 phase. Aurora A kinase activity is highest at G2-M transition in
human cells. Aurora A undergoes subcellular location throughout the mitosis phase
indicating its involvement in multiple mitotic events (Wang et al. 2014; Yan et al.
2016). Firstly, Aurora is involved in centrosome maturation since its accumulation was
observed in G2 phase. Aurora A depleted cells lack γ-Tubulin recruitment and
nucleated mitotic microtubules compared to control cells revealing immature
chromosome (Bai et al. 2014; Hirota et al. 2003). Aurora A depletion at late G2 in
HeLa cells prevents centriole separation with disrupted spindles after nuclear envelope
breakdown (NEBD) (Marumoto et al. 2003).
Aurora A is directly involved in metaphase chromosome alignment through
centromere protein A (CENP-A). Aurora A phosphorylates CENP-A at Ser7 which is
prerequisite for Aurora B dependent phosphorylation of CENP-A for proper
microtubule attachment to kinetochore followed by chromosome alignment and
segregation (Zeitlin et al. 2001). Besides, Aurora A phosphorylates CENP-E to
transport protein phosphatase 1 to the outer kinetochore, which weakens the CENP-E's
affinity for individual microtubules resulting in stable microtubule capture by
chromosomes (Kim et al. 2010). Deregulation of Aurora A at metaphase by either
depletion or overexpression leads to impairment in cytokinesis with multi nucleated
cells. Therefore, sequential timing of activation and inactivation of Aurora A kinase is
required for cytokinesis. At the end of mitosis, degradation of Aurora A by the
APC/CCDH1 complex is required for proper cytokinesis and mitotic exit (Yan et al.
2016).
70 1.6 The use of Traditional Chinese Medicine (TCM) in Cancer
At present, there is a lack of treatment options for men undergoing AS. Since men
undergoing AS are healthy otherwise, any medical intervention to impede disease
progression must be efficient, and affordable with minimal side effects. To this end,
our research team has tuned our attention to TCM.
TCM has been used for cancer treatment in China for centuries (Liu et al. 2015; Mao et
al. 2014; McCulloch et al. 2006). Mainly, it is a botanical extract through decoction.
Unlike a single molecule-based drug, the characteristic of TCM is a mixture of several
herbs. The philosophy behind this ‘cocktail’ approach is to enhance efficacy and
minimize adverse effects (Yeh et al. 2014).
1.7 Detoxification Recipe (DR)
Described originally as Detoxification Recipe, DR consists of two herbs, namely
Hedyotis diffusa (HD) and Scutellaria barbata (SB), and remains one of the most
prescribed herbal medicines for cancer patients today in mainland China and Taiwan
with minimal reported side effects (Chao et al. 2014; Yeh et al. 2014). Fewer than 5
English articles have been published in peer-reviewed journals in relation of HD or SB
to PCa (Marconett et al. 2010; Shoemaker et al. 2005; Wong et al. 2009). None of
these studies has detailed description about cytostatic action of HD and SB in PCa
cells. A total of 41 studies on HD and 99 studies on SB in relation to cancer have been
reported and there has been only one study on the combined effect of HD-SB pair. The
anti-cancer effect of HD-SB pair was tested in bladder cancer cells, but the mechanism
of action is still poorly understood (Pan et al. 2016).
71 1.7.1 HD, Hedyotis diffusa (Bai Hua She She Cao)
Hedyotis diffusa (Bai hua she she cao) is a herb derived from the whole plant of
Hedyotis diffusa Willd. HD belongs to the family Rubiaceae and also called
Oldenlandia diffusa Roxb (Stuenæs et al. 2010). In traditional Chinese Medicine, HD
is commonly used for detoxification, and has long been used as an anti-cancer agent in
oriental medicine. A number of pharmacological studies have shown that HD has anti-
cancer, anti-inflammatory, anti-oxidative, neuroprotective, hepatoprotective, anti-
mutagenesis and immunomodulating activities (Chen et al. 2016; Niu et al. 2013).
Figure 1.11 Hedyotis diffusa Left: Magnified view of HD flower, leaf, stem and dried HD, Right: whole plant of HD with flowers (photo courtesy to Real Natural, Inc.)
72 1.7.1.1 Chemical profiles and properties
A total of 171 compounds have been discovered in HD including 32 iridoids, 26
flavonoids, 24 anthraquinones, 26 phenolics and their derivatives, 50 volatile oils and
13 miscellaneous compounds (Chen et al. 2016). Anthraquinones are well known as
abundant constituents of the family Rubiaceae and are reputed to have biological
activities such as antimicrobial, laxative, diuretic, and antineoplastic. The flavonoids
from HD are mainly glycosides of kaempferol and quercetin and also apparently have
a wide variety of biological activities including anti-oxidant, anti-inflammatory, anti-
cancer, anti-viral, anti-bacterial, and also cytoprotective effect on coronary and
vascular systems, the pancreas, and the liver. Terpenoid extracts from HD are mainly
iridoids and triterpenes. It has been found that iridoids possess anti-inflammatory, anti-
proliferative, neuroprotective, and antioxidant properties. Triterpenes from HD such as
ursolic acid and oleanolic acid have hepatoprotective, anti-tumour, anti-inflammatory,
and anti-hyperlipidemic effects (Niu et al. 2013).
1.7.1.2 Anti-proliferative effect of HD in PCa
Two studies have reported the anti-proliferative effect of HD extracts in PCa. The first
study used water extract of HD to test against PCa cell lines (LNCaP and DU145) in
vitro. The anti-proliferative activity of aqueous extract was shown with growth
inhibition at 50% (IC50) at 7 mg and 24 mg of raw material/mL after 48 hr treatment in
LNCaP and DU145 cells, respectively (Gupta et al. 2004). The second study showed
that cyclotides extracted from the root of HD (1 mg/kg dose) inhibited the
development of the xenografts PCa cells tumour in weight by 40% and size by 50%
73 (Hu et al. 2015). But the mechanism of how HD inhibits the proliferation of PCa cells
has not yet been studied.
1.7.1.3 Anti-proliferative effect of HD in other cancers
Several studies have tested a variety of HD extracts like methanolic, ethanolic and
water extract on anti-proliferative effects in different types of cancer such as pancreatic
cancer (Gupta et al. 2004), lung cancer (Gupta et al. 2004), colorectal cancer (Lin et al.
2015), leukemia (Niu et al. 2013), cervical cancer (Zhang et al. 2015), ovarian cancer
(Zhang et al. 2016) and human liver cancer (Li et al. 2016).
A water extract of HD has anti-proliferative activity in pancreatic cancer cells at 24
mg/mL and interestingly, the extract has a very limited cytotoxicity with only 10%
growth inhibition on the normal pancreatic cells even at the concentration of 50
mg/mL (Gupta et al. 2004). This research group also reported that the oral
administration of this extract reduced the metastasis of lung up to 70% in vivo study
(Gupta et al. 2004).
Lin’s research group demonstrated that an ethanol extract of HD inhibited the growth
of human colon carcinoma (HT-29) cells in a dose and time dependent manner. This
research group has also shown that the ethanol extract induces apoptosis with
activation of caspase-9, caspase-3 and also increased the level of Bax (Lin et al. 2010).
In addition, the ethanol extract prevented G1 to S transition of HT-29 cells with the
reduced mRNA expression of Cyclin D1 and CDK4, and increased p21 expression
(Lin et al. 2012). An animal study using this extract showed that intra-gastric
administration of HD ethanol extract reduced tumour volume and tumour weight of
74 mouse xenograft model by approximately 50% at the dose of 6 g/kg in colorectal cancer (Cai et al. 2012).
An ethanol extract of HD has anti proliferative activity with the G0/G1 phase arrest and also stimulates apoptosis in human leukemia cells (Kuo et al. 2015). Moreover, a methanol extract of HD inhibits the growth of human lymphoid leukemia HL-60 cells with an induction of p53, down-regulation of p21 and up-regulation of p27 (Niu et al.
2013).
A study in cervical cancer found that intra-gastric administration of HD decreased the tumour weight by 36% in Hela cell xenograft mice with the reduction in Ki-67 protein expression (Zhang et al. 2015). Zhang’s research team has also shown that the crude extract of HD inhibits the growth of ovarian cancer cells and induces apoptosis via mitochondria associated apoptotic pathway (Zhang et al. 2016).
Moreover, it has also been reported that a water extract of HD arrests the hepatocarcinoma cells at G0/G1 with down-regulation of CDK2, Cyclin E and E2F level (Chen et al. 2012). Together, these various extracts of HD appear to have important anti-cancer properties.
75 1.7.2 SB, Scutellaria barbata (Ban Zhi Lian)
Scutellaria barbata (Ban Zhi Lian) is a species of flowering plant in the mint family,
Lamiaceae. In traditional Chinese medicine, SB is used to treat a variety of illnesses
such as appendicitis, hepatitis, snake bites and various types of cancer such as lung,
liver, and rectum (Huang 1998). SB has also been used as anti-inflammatory and anti-
tumour agent in traditional Korean medicine. Extracts from SB have growth inhibitory
effects on a number of human cancers including leukemia, colon cancer, liver cancer
and skin cancer, in vitro (Goh et al. 2005) .
Figure 1.12 Scutellaria barbata. Left: Magnified view of SB flowers, leaf, stem and dried HD, Right: whole plant of HD with flowers (photo courtesy to Plants with a purpose)
76 1.7.2.1 Chemical profiles and properties
Using an ultrahigh performance liquid chromatography coupled with hybrid
quadrupole-orbitrap mass spectrometry (UHPLC-quadrupole-orbitrap MS) method, a
total of 56 compounds, including 20 free flavonoids, 20 flavonoid O-glycosides, 2
flavonoid C-glycosides, 4 phenylethanoid glycosides, and 10 phenolic compounds
have been found in an ethanol extract of SB (Ru Li 2015). Among them, flavonoids are
well known for their anti-proliferative, anti-inflammatory, anti-cancer, anti-viral, and
anti-bacterial activities.
1.7.2.2 Anti-proliferative effect of SB in PCa
The anti-proliferative study of SB on PCa has been reported in the literature. An early
study of SB in PCa cells showed that aqueous extract of SB inhibited the growth of
PC-3 cells and LNCaP cells and IC75 values were 1 mg/mL and 1.5 mg/mL,
respectively (Shoemaker et al. 2005). A study in LNCaP cells treated with SB showed
anti-proliferative effect and apoptosis effect with the increased expression of Bax, p53,
Akt, and JNK in vitro. This group also reported that the feeding of SB 32 mg/day
delayed the tumour development in the respective TRansgenic Adenocarcinoma
Mouse Prostate (TRAMP) mice compared with sterilized water treated control group
(Wong et al. 2009). BZL101 is the aqueous phytochemical extract of SB and it is
shown to arrest the LNCaP cells at G2/M phase and PC-3 cells at S phase. This group
also reported that G2/M arrest in LNCaP cells was associated with the decreases in
Cyclin B1, CDK1 and S phase arrest in PC-3 cells was related to the decrease of
Cyclin A2 and CDK2 (Marconett et al. 2010).
77 1.7.2.3 Anti-proliferative effect of SB in other cancers
Similar to HD, anti-proliferative effect of SB on different types of cancer such as lung
cancer (Yin et al. 2004), uterus cancer (Lee et al. 2004), colon cancer (Goh et al.
2005), colorectal cancer (Yang et al. 2017), leukemia (Kim et al. 2007), liver cancer
(Dai et al. 2008; Kan et al. 2017) were reported.
It has been shown that the ethanol extract of SB is effective in inhibiting the growth of
lung cancer cells by causing apoptosis. According the cDNA microarray analysis, the
cytotoxic effects of SB resulted from downregulation of several genes which involved
in DNA damage, cell cycle control, nucleic acid binding and protein phosphorylation
(Yin et al. 2004).
Lee’s research group had found that treatment with a water extract from SB inhibits the
proliferation of uterine smooth muscle cells (Lee et al. 2004). Water extract from SB
increased uterine smooth muscle cells in G1 phase with increased activity of p27 (Lee
et al. 2004).
The proliferation of human colon cancer cells was inhibited after treatment with SB
extracts in a time-dependent manner. A significant increase in the Sub G1 phase was
observed after treating with a higher dose of SB extract, suggesting that it induced cell
death in the human colon cancer and colon rectal cancer cell line (Goh et al. 2005;
Yang et al. 2017). An ethanol extract of SB has been shown to arrest colon carcinoma
cells at G1/S phase through p53 and Akt modulated pathway (Wei et al. 2013). The
chloroform fraction of SB has been shown to have potent inhibitory effect on the
growth of colon cancer cell lines. The apoptosis induced by chloroform fraction of SB
with up-regulation of the pro-apoptotic Bax/Bcl-2 ratio was also documented. This
78 study also found a decrease in the expression of Cyclin D1 and CDK4 after SB treatment (Zhang et al. 2014).
A study using a water extract of SB showed anti-proliferative activity of SB inducing
G1 arrest and a significant apoptosis in the human promyelocytic leukemia HL-60 cell line. SB treatment also down-regulate the expression of Cyclin A, D1, D2, D3, and E and CDK 2, 4, and 6 with associated up-regulation of p21 (Kim et al. 2007).
Treatment with SB extract decreased the proliferation of hepatoma cells in a dose dependent manner (Kan et al. 2017). A decrease in tumour growth has also found in hepatoma H22-bearing mice after treating with SB extract (Kan et al. 2017).
Previously, Dai’s research group has found that anti-proliferative activity of SB in hepatoma cells is associated with apoptosis and the increase of caspase-3 activity in a dose-dependent manner (Dai et al. 2008). Taken together, the biological properties of
SB suggest that it may have potential in cancer treatment.
79
Chapter 2
80
2 Hypothesis and Aims
81 Active surveillance (AS) is one of the options for men with early PCa. Recent reports
highlight that the proportion of men with low-risk PCa on AS are increasing
worldwide over the decade from 6.7% in 1990-2009 to 40.4% in 2010-2013. In men
aged ≥75 years, the proportion of men undergoing AS is as high as 76.2% (Cooperberg
et al. 2015; Tosoian et al. 2016). Considering PCa will remain one of the top cancer
diagnoses projected for 2030 (Rahib et al. 2014), the absolute number of men on AS
can be expected to increase further in the coming decades. While novel biomarkers,
genomic testing, and image-guided biopsy (MRI-targeted biopsy or fusion biopsy) may
improve disease classification (Carter 2016), the lack of biomarkers that are both
sensitive and specific enough to predict the progression of PCa is likely to stay.
Hence, the need to develop a new treatment option to help men on AS is critically
important.
2.1 Targeting cell cycle progression could be a strategy to impede PCa progression
PCa involves an uncontrolled proliferation of prostatic epithelial cells in the prostate
gland (Lee et al. 2015). In mammalian cells, uncontrolled cell proliferation is a result
of the disrupted cell cycle regulation. Indeed, many cell cycle regulating genes such as
phosphatase and tensin homolog (PTEN) (Vignarajan et al. 2014; Vlietstra et al. 1998),
p53 (Isaacs et al. 1991) and p27 (Chu et al. 2008) are often mutated in PCa. In contrast
to the normal cell cycle, which is strictly controlled by a series of complex signalling
pathways responsible for DNA replication and cell division, cell cycle regulatory
machinery is malfunctioning causing uncontrolled proliferation in cancer cells
(Malumbres et al. 2001).
82 Ki-67 is a DNA associated nuclear protein expressed during all active phase of cell cycle (G1, S, G2 and M phase), but is absent in quiescent cells. Thus, Ki-67 has been used as a marker to determine growth fraction of a given cell population (Gerdes et al.
1984; Khatami et al. 2009). Ki-67 immunostaining has been widely used to determine the rate of cancer cell proliferation in various types of cancer including PCa (Berlin et al. 2017). The expression level of Ki-67 is low in low-grade and low-volume PCa compared with high-grade and high-volume cancers, suggesting an association between Ki-67 protein level and disease progression (Khatami et al. 2009;
Urruticoechea et al. 2005). A recent study has also shown that Ki-67 positivity is correlated to increased chance of metastasis, while low Ki-67 positivity is associated with better overall and disease specific survival in localised PCa (Berlin et al. 2017).
Therefore, it is believed that the fraction of Ki-67 positive cancer cells is correlated with PCa risk and progression (Berlin et al. 2017; Khatami et al. 2009). We reason that a method that is able to impede cell cycle progression and subsequent proliferation is expected to decrease Ki-67 expression, and prevent or slow PCa progression in men undergoing AS.
83 2.2 Hypothesis and Aims
Men undergoing AS need a treatment option in addition to regular check-ups. This
treatment option should meet the criteria of high efficacy, cost effective and minimal
toxicity since men undergoing AS are healthy otherwise. The two herbs medicine DR
is the most commonly prescribed Chinese Medicine to treat cancer in China. The
overarching goal of this project is to examine the potential of DR to impede PCa
progression for men under AS.
2.2.1 Hypotheses
1) DR has an anti-proliferative activity in PCa cells and can inhibit the cell cycle
progression.
2) The mode of action of DR involves targeting of key proteins responsible for
promoting cell cycle progression.
2.2.2 Aims
The aim of this PhD project was to determine the anti-proliferative action and mode of
action of DR in PCa cells. Specific aims and experimental approach were outlined as
follows:
84 2.2.2.1 To determine the anti-proliferative and cytostatic action of DR in PCa cells
To determine the anti-proliferative activity of DR on PCa cells, LNCaP and PC-3 were
treated with DR and the effect of DR on DNA content was analysed by using SYBR
Green DNA analysis assay and cytostatic dose of DR was defined. The effect of DR on
DNA synthesis was verified using BrdU incorporation assay. The proliferative fraction
of DR treated PCa cells were validated using Ki-67 immunocytochemical staining.
Colony formation assay was performed on DR treated PCa cells to observe the
relatively long-term effect of DR. pH and osmolality were tested to exclude any
external impact independent from any anti-cancer property of DR.
2.2.2.2 To examine the effect of DR on cell cycle progression of PCa cells
To examine effect of DR on cell cycle progression, PCa cells treated with DR were
stained with a DNA dye (PI) and cell cycle analysis was performed using flow
cytometry. PCa cells treated with DR were additionally co-stained with PI and
phospho-Histone H3 to further differentiate between G2 and M phases, with
Nocodazole treated PCa cells as positive control.
2.2.2.3 To establish the molecular mechanism underlying cytostatic action of DR in PCa cells
To study the molecular mechanism underlying cytostatic action of DR in PCa cells,
proteins involved in DNA damage response signalling pathways, in particular the
G2/M checkpoint, were examined. Immunofluorescence and immunoblotting were
performed to examine the presence of DNA damage in DR treated PCa cells with
radiation treated PCa cells as positive control. Immunoblotting and RT-PCR were used
85 to determine the expression levels of M phase promoting complex and regulators. The
Dutch based online tool R2: Genomics Analysis and Visualization Platform was used to examine the mRNA expressions of M phase promoting complex and regulators.
Datasets from cBioportal for Cancer Genomics were analysed to determine the genomic alterations of four genes associated with PCa.
86
Chapter 3
87
3 Materials and Methods
88 3.1 Cell lines and Cell Cultures
3.1.1 Prostate cancer cell lines
The lymph node metastasised PCa cell line, LNCaP (Cat. #: CRL- 1740; American
Type Culture Collection, USA) and the bone metastasised PCa cell line, PC-3 (Cat. #:
CRL-1435; American Type Culture Collection, USA), were grown in complete RPMI
medium (Cat. #: A1049101l; Life Technologies, Australia), supplemented with 10%
(v/v) fetal calf serum (FCS) (Cat #: SFBS-F; Bomogen), penicillin at 100 units/mL and
streptomycin at 100 μg/mL (Sigma Aldrich, Australia). All the cells were cultured at
37°C in a humid atmosphere containing 95% air and 5% CO2. The cells were
maintained at optimal growth by splitting regularly and changing media 2 to 3 times
per week.
3.1.2 Cell Passaging
When cells were 70-80% confluent, cells were subcultured in Corning® T-75 flasks
(Cat. #: CLS430641, Sigma-Aldrich). Firstly, culture medium was removed and briefly
rinsed the cell layer with pre-warmed phosphate buffer saline (PBS). PBS was
aspirated and followed by adding 1 mL of TrypLETM Select (GIBCO®, Life
Technologies, Australia) solutions. The cells were incubated at 37°C (usually within 3
to 5 minutes) until the cells were dispersed. Detached cells were collected and
centrifuged at 1500 rpm for 5 minutes. The supernatant was discarded and cells were
subsequently re-suspended in 10 mL of respective complete medium by gentle
pipetting. Appropriate aliquot of the cells at the ratio of 1:6 for LNCaP, cells and 1:10
89 for PC-3 cells was placed into new T75 culture flasks with 15 mL of culture medium.
The newly passaged cells were then incubated at 37°C. As for cell counting and
estimating the viable cells over non-viable cells, hemocytometer and trypan blue (Cat
#: 15250061, Thermo Fisher Scientific, Australia) were used. The passage number of
cells in this study was 16–34 for LNCaP and 26–42 for PC-3.
3.2 Treatment
3.2.1 DR Treatment
DR was provided by Professor Li Zhong from Beijing University of Chinese Medicine.
DR is comprised of Scutellaria Barbata 30g; Hedyotis Diffusa 30g. The instructions
for preparing an extract were as follows: The water decoction is extracted twice in
ethanol and then vacuum dried into powder. This process was conducted in a GMP
laboratory in Beijing University. Dr Cheang Khoo (National Institute of
Complementary Medicine) has used his published liquid chromatography-mass
spectrometry (LC-MS) methods (Lee et al. 2009; Moawad et al. 2010) to profile
chemicals in DR. Dr Cheang Khoo and his research team has profiled five most
abundant chemicals from Hedyotis diffusa and three from Scutellaria barbata (Table
3- 1). These eight compounds have been shown to have anti-cancer property in the
literature (Gao et al. 2017; Janicke et al. 2011; Kim et al. 2018; Vijayababu et al. 2005;
Wu et al. 2012; Yan et al. 2017). The four compounds of eight (Oleanolic acid, P-
coumaric acid, Quercetin and Apigenin) were used to standardise DR between three
different batches.
90 Table 3-1 Chemical profiling in DR measured by LC-MS
Oleanolic P-coumaric Hedyotis diffusa Ursolic acid Ferulic acid Quercetin acid acid
Chemical structure
Concentration 12187 12043 2136 473 439 (ug/g) Co-efficient 1.55 0.78 2.20 2.00 1.18 variation (%) Scutellaria barbata Apigenin Scutellarin Scutellarein
Chemical structure
Concentration 12492 4541 309 (ug/g) Co-efficient 1.24 1.89 0.42 variation (%)
DR powder was stored in -20°C. On the day of treatment, DR powder was dissolved in
the aforementioned complete culture medium at 20 mg/mL by sonication at 35kHz for
90 minutes using a Sonorex Digitec ultrasonic sonicator (DT 102H, Bandelin). After
sonication, DR stock solution was checked thoroughly to confirm whether DR powder
was completely dissolved. Clear coloration of DR stock solution indicates the
complete dissolving. To make the desired solution, the 20 mg/mL stock solution was
diluted further to 0.25, 0.5, 0.75 or 1 mg/mL using RPMI culture media.
3.2.2 Nocodazole treatment
PCa cells were treated with Nocodazole (Cat. #: M1404, Sigma-Aldrich, Australia) at
200 - 800 ng/mL for 18 hr. Cells were then harvested and stained for propidium iodide
(PI) (Cat. #: P4170, Sigma-Aldrich) for flow cytometry DNA analysis and costained
with PI and antibody (Ab) against phospho-Histone H3 for flow cytometry of DNA
and mitosis phase analysis.
91 3.2.3 Radiation treatment
The PCa cells were plated in T75 cm2 flasks (Sarsdedt Australia Pty Ltd, Technology
Park, South Australia) at a density of 1,000,000 cells for PC-3 and 2,000,000 cells for
LNCaP in 15 mL complete RPMI medium and incubated for 48 hr at 37oC. The cells
were then irradiated with a 6 MV photon beam produced by a clinical Varian Novalis
TX linear accelerator at Chris O’Brien lifehouse. The cells were irradiated under full
scatter conditions as previously described (Mackonis et al. 2012). The cell layer was
positioned at a depth of 50 mm and irradiated at a gantry angle of 1800, enabling the
dose to the cell layer to be reliably determined. The cells were irradiated to a uniform
dose of 0 and 2 Gy. For all experiments, unexposed controls were prepared as same
exposures. The cells were harvested after 1hr, 2hr and 3hr of radiation treatment for
immunofluorescence and immunoblotting.
3.3 SYBR Green Assay
The PCa cells were trypsinised and seeded in Corning® Costar ® 96-well plates (Cat. #:
CLS3595, Sigma-Aldrich) at 2500 cells/well for LNCaP and 1200 cells/well for PC-3
in 200 μL of RPMI medium with supplements. After two days of seeding, the cells in
one of two 96 wells plate were harvested and stored at -80°C for baseline. The other
96 well plates with the same number of seeding were treated with DR at certain
working concentrations (0 mg/mL, 0.25 mg/mL, 0.5 mg/mL, 0.75 mg/mL or 1
mg/mL). These 96 wells plates were harvested after 24 hr, 48 hr and 72 hr, thereafter
kept in -80°C for further DNA synthesis analysis.
For SYBR Green assay reading, 2 different lysis buffers, Lysis Buffer A (10 mM Tris-
92 pH 7.5 and 2 M NaCl) and Lysis Buffer B (100 mM Tris-pH 7.5, 50 mM disodium
EDTA and 1% Triton X-100) were prepared. The SYBR Green Lysis Buffer was prepared with 9 portions of Lysis Buffer A, 1 portion of Lysis Buffer B and SYBR
Green I (Cat. #: S-7563, Invitrogen) at 1:10,000 dilution. The cells from DR treated plates and the baseline plates were thawed at room temperature, and then lysed with
100ul/well of SYBR Green Lysis Buffer in the dark for 2 hr. After lysing, the cells from baseline plates were transferred into the empty wells of treatment plate (see
Figure 3.1). The intensity of SYBR Green fluorescence was measured using FLUO star
Optima (BMG Labtech) at wavelength of 485/20 nm for excitation and 528/20 nm for emission. The % of growth inhibition was calculated using the following formula.
% of Growth Inhibition = (FI of control – FI of Baseline ) – (FI of treatment – FI of Baseline ) × 100% (FI of control – Baseline )
FI = Fluorescence Intensity
93
Figure 3.1 Example of sample arrangement in 96 well plate for SYBR Green assay
3.4 Colony formation assay
LNCaP (250,000 cells) and PC-3 (120,000 cells) were seeded in T25 flasks. DR treatment
was introduced after 48 hr of seeding, at concentration of 0 - 0.75 mg/mL for LNCaP and
0 - 1 mg/mL for PC-3 with freshly prepared complete RPMI medium. The PCa cells were
trypsinised after 72 hr of DR treatment and the number of cells in each dose was counted
using a haemocytometer. Total cell numbers obtained from each of the treated flasks were
diluted further to achieve optimal numbers of cells to form colonies. 1000 cells for PC-3
and 5000 cells for LNCaP from each of the samples were counted and seeded into new
T25 flasks with freshly prepared complete respective medium. These T25 flasks were
94 kept in the incubator for 7-10 days without changing medium to attain the colonies growing from a single cell. Medium was removed from T25 flasks and the flasks were dried in the 37°C incubator for 3 days and stained with 1% crystal violet in PBS. Each
T25 flask was then photographed and the colonies consisting of more than 50 cells were scored (Figure 3.2).
Figure 3.2 Morphology of cancer cell colonies originated from PC-3 cells
95 3.5 Flow cytometric cell cycle analysis
3.5.1 Propidium Iodide (PI) staining
The proliferative PCa cells were treated with DR for (24 hr, 48 hr and 72 hr) in T25 cell
culture flasks. To harvest the cells for flow analysis, the cells were trypsinised and re-
suspended with 300 μL of PBS and subsequently fixed in 700 μL of ice-cold ethanol in
drop-wise manner while the suspension was vortexed. The cells were fixed in -20°C
overnight and stored for further analysis. Following fixation, the cells were washed twice
with pre-cold Flow Washing buffer containing PBS with 5%FCS and 0.02% sodium azide
to remove the ethanol residual. The cells were then incubated with 20 μg/mL of PI, and
10 μg/mL RNase A (Cat. #: R6513, Sigma-Aldrich) of for 1 hr at 37°C. After that the
cells were washed with Flow Washing Buffer and re-suspended in the PBS with 5% (v/v)
FCS. PI-stained DNA contents were then assessed using FACS Calibur flow cytometer
(BD Biosciences), acquiring minimum 30,000 events per sample. The percentages of cells
in each phase of the cell cycle were analysed using Flowjo software 10.0.8 (Tree Star
Inc., USA).
3.5.2 Co-staining of PI and phospho-Histone H3 for cell cycle
analysis
Phospho-Histone H3 labeling was used to separate the cells in mitosis phase (M phase)
from G2-M phase. The cells were incubated with Ab against phospho-Histone H3 (1:500,
Cat #: 9701, Cell Signaling Technology) in PBS at 4°C for overnight and PI staining was
introduced to samples on the following day. The cells were washed and analysed with
96 FACS Calibur flow cytometer (BD Biosciences), minimum 30,000 events per sample
were acquired. The percentages of cells in each phase of the cell cycle were analysed
using Flowjo software 10.0.8.
3.6 Immunocytochemistry
3.6.1 Ki-67 Staining
The expression of Ki-67 in DR treated cells was determined by immunocytochemical
staining. The cells from T75 cell culture flasks with DR treatment for 72 hr were washed
with PBS twice and then detached by TripLETM Select. The cells from control group and
treatment group were collected in 15 mL Falcon tubes by centrifugation at 15,000 rpm for
5 minutes. The cells were fixed in 10% neutral buffered formalin (Cat. #: 252549, Sigma-
Aldrich) at 4ᵒC for overnight. On following day, formalin was removed from the cell
pellet by centrifugation. The cell pellets were washed with PBS, and the fixed cells were
then clotted into 1% agarose, and then dehydrated and embedded in paraffin blocks.
Each sample were cut into sections of 5 μm thickness using microtone and loaded onto
Superfrost Plus slides (Menxel-Glaser, Germany). Slides were dried at 45°C overnight
and baked at 60°C for 1 hr to reduce the possibility of sections falling off the slides prior
to immunostaining. The sections were deparaffinised in xylene for 40 minutes and
rehydrated through down-graded ethanol (100%, 95%, and 70%) to distilled water. Then
slides were subjected to antigen retrieval in Tris–EDTA solution (20.0 mM Tris base, 13.4
mM EDTA, 12.4 mM tri-sodium citrate, 0.05% Tween 20, pH 8.0) in microwave oven
for 20 minutes. Afterwards, the sections were cooled down at room temperature, washed
with distilled water and followed by rinsing with Tris-buffered saline containing Tween
97 (TBST; 200 mM Tris-HCl, 150 mM NaCl, 10 mM Tris-base, 0.5% Tween 20, pH 7.5).
Sections were blocked with 10% v/v goat serum in TBST for 20 minutes. The blocking
solution from the sections was rinsed with TBST and incubated with primary Ab to Ki-67
(1:1000, Cat #: RM-9106-S, Thermo Scientific) in TBST for overnight at 4°C.
In next day, the sections were rinsed in TBST and each section was sequentially labeled
with a biotinylated secondary Ab (1:1000, Cat #: BA-1000, Vector Laboratories) for 30
minutes and Vectastain ABC kit (1:1000, Cat #: PK-4000, Vector Laboratories) for 40
minutes at room temperature. Between each of these incubations, sections were rinsed
with distilled water and incubated with TBST for 5 minutes. Thereafter, the
immunolabelling was visualized with 3, 3'-diaminobenzidine tetra-hydrochloride (DAB,
Cat #: K3468; Dako), until brown colouration was observed. The immunoreaction of
DAB was stopped by rinsing the slides with distilled water. The labeled sections were
then counterstained with haematoxylin and followed by acidic ethanol and Scott’s Blue
solution. The slides were dehydrated in graded alcohol (70%, 95% and 100%) and
mounted in Di-n-butyl Phthalate in xylene (DPX; BDH, England) and finally cover-
slipped. The slides were dried for overnight and images were taken for later quantification
purpose (Xi et al. 2016; Yao et al. 2012).
3.6.2 BrdU Incorporation
BrdU (Bromodeoxyuridine, 5-bromo-2'-deoxyuridine) is a synthetic nucleoside, which is
an analog of thymidine. During DNA replication in S phase of cell cycle, BrdU is
incorporated into newly synthesised DNA of replication cells, substituting for thymidine.
Therefore, BrdU incorporation was used as an alternative way to observe DNA synthesis
98 in our DR treated cell culture (Yao et al. 2015). In the last 6 hr of DR treatment, 10 μM
BrdU (B9285, Sigma-Aldrich) was added into treated LNCaP and PC-3 cultured in T75
flasks. Cell were harvested and then processed for immunocytochemical staining for
BrdU incorporation (Cat #: B2531, Sigma-Aldrich). Following antigen retrieval, the
sections were treated with 2N HCl to denature double-stranded DNA for facilitating the
access of the Ab to incorporated BrdU. The immunostaining and coloration were
conducted in a same manner as described in section 3.6.1.
3.7 Immunofluorescence
The experimental cells from paraffin blocks were cut into sections of 5 μm thicknesses
and incubated at 60°C for 1 hr, followed by deparaffinization in xylene, re-hydration in
graded ethanol and distilled water, and sections were subjected to antigen retrieval in
Tris–EDTA solution using a microwave oven. The sections were then blocked with 10%
v/v goat serum and then incubated with primary Ab against to phospho-H2AX (Cat #:
9718, Cell Signaling Technology) and 53BP1 (Cat #: 4937, Cell Signaling Technology)
for 20 hr at 4°C. After being rinsed in TBST, each section was subsequently labelled with
a secondary Ab conjugated with Alaxa594 (Cat #: A-11037, Invitrogen). The labelled
sections were subsequently counterstained for nuclei with DAPI 4′, 6-Diamidino2-
phenylindole dihydrochloride (Cat #: D8417, Sigma-Aldrich) and cover-slipped. The
images of both phospho-H2AX and 53BP1 labelling and nuclear staining of each sample
were obtained from the labelled sections using an Olympus microscope (BX53) equipped
with CellSens software. The acquired images of phospho-Histone H3 labeling and nuclear
staining were superimposed and saved as JPEG files from image of each single channel.
99 3.8 Immunoblotting
3.8.1 Protein extraction and quantification
The cells that were treated with DR in 6-well plates or T25 flasks were washed twice with
cold PBS and incubated in lysis buffer (RIPA-buffer, containing 65 mM Tris, 50 mM
Nacl, 10 M Hcl, 5 mM EDTA, 1% NP-40, 0.5% Sodium deoxycholate, 0.1% SDS and
10% glycerol at pH7.4, Sigma) supplemented with protease inhibitor cocktail (Cat #:
11836145001; Roche) and 50 mM sodium fluoride (Cat #: S7920, Sigma Aldrich) in the
cold room for 45 minutes on the rocker. 1.5 mL Eppendorf tube, pipette tips and rubber
policeman (Costor, Mexico) were pre-cold in -20°C to preserve protein in cell lysates.
Cells were then scraped off by rubber policeman on ice and collected into 1.5 mL
Eppendorf tubes. To avoid protein loss and to eliminate air bubbles, samples were spun
down at highest speed for 1 minute in the cold room. The cell lysates were then
homogenized by sonication on ice using a sonicator (XL-2000, Microson Ultrasonic Cell
Disruptor).
The protein concentration for each of the sample was measured by using Bio-Rad Dc
(detergent compatible) protein assay (Bio-Rad laboratories, California). A protein
standard was prepared using bovine serum albumin (BSA) at 10 mg/mL and it was further
diluted to the range of 0-4 mg/mL (0 mg/mL, 0.25 mg/mL, 0.5 mg/mL, 1 mg/mL, 2
mg/mL, 3 mg/mL, and 4 mg/mL) with RIPA buffer (Cat #: R0278, Sigma Aldrich). The
protein measurement was conducted in Coning 96-well clear flat bottom plates. Each well
was added with 25 μL of Reagent A of the assay kit (80% v/v surfactant solution and 20%
v/v alkaline copper tartrate solution), 5 μL of each diluted BSA standard or experimental
sample, and 200 μL of Reagent B of the assay kit (Folin reagent). Incubation at room
100 temperature for 5 minutes was required for colour development. The intensity of the
colouration was measured at 595 nm wavelength using a spectrophotometer plate reader
(Infinite M1000 Pro, Tecan) equipped with Magellan software (version 7.2). The
absorbance values of all samples was normalised by subtracting them with the absorbance
value of the control well (0 mg/mL of BSA). The concentration of the protein was
subsequently calculated using a BSA standard curve. The loading volume required for 50
μg of protein was calculated based on the protein concentration of each sample. Aliquot
of samples were stored in -30°C until further analysis.
3.8.2 SDS-polyacrylamide gel electrophoresis
The acrylamide-bisacrylamide gels consisting 4% stacking layer and three resolution
layers, 7%, 10% and 13% gel were prepared 1 day ahead using 40% Acrylamide, 1 M
Tris HCl pH 6.8 (for stacking gel), 0.5 M Tris HCl pH 8.8 (for resolving gels), 20% SDS,
dH2O, 10% ammonium persulfate (APS) and TEMED (N, N, N’, N’-
tetramethylethylenediamine). To achieve multiple proteins from the same signalling
pathway in one membrane, gradient gels were prepared as described in Table 3-1 and
figure 3.3.
101 Table 3-2 SDS-PAGE gel formulation
Resolving gel Stacking gel
7% 10% 13% 4%
Acrylamide 40% 1.75 mL 2.5 mL 3.25 mL Acrylamide 40% 1 mL
Tris HCl pH8.8 3.6 mL 3.6 mL 3.6 mL Tris HCl pH6.8 1.260 mL
10% SDS 91.2 μL 91.2 μL 91.2 μL 10% SDS 100 μL
dH O 4.5 mL 3.8 mL 3 mL dH O 7.6 mL 2 2 10% APS 43.2 μL 43.2 μL 43.2 μL 10% APS 50 μL
TEMED 9 μL 9 μL 9 μL TEMED 10 μL
Total 10 mL 10 mL 10 mL Total 10 mL
1 2 3 4 5 6 7 8 9 10
Stacking gel 4%
7%
Resolving gel 10%
13%
Figure 3.3 The layers arrangement of acrylamide gradient gel.
102 3.8.3 Sample preparation for SDS-PAGE
The required volumes of proteins at 50 μg were mixed with 5x LaemmLi loading dye (1
M Tris-Cl pH 6.8, 20% SDS, glycerol, B-mercaptoethanol, Bromophenol blue) in a ratio
of 4:1 and RIPA buffer. The mixtures were centrifuged at 10,000 rpm for 1 minute and
heated at 95°C on a pre-heat thermomixer (Eppendorf, Germany) for 7 minutes. Total
volume of 35 μL of protein sample was loaded into respective wells of the gel. To
determine the migration of the protein with known molecular weight, 5 μL of pre-stained
protein standard (Cat #: 1610374, Bio-Rad) was also loaded into the two end wells of the
gel. Proteins were separated on the basic of molecular weight using % SDS-PAGE.
Electrophoresis was then carried out in Mini-Protean Tetra Cell (Bio-Rad) in the presence
of running buffer (25 mM Tris, 192 mM Glycine, 0.1% SDS, pH 8.3) at 100V for
approximately 1 hr until protein reached into 13% of resolving gel and then increased to
130V for 20 minutes.
3.8.4 Protein Transfer
Polyvinylidene fluoride (PVDF) membranes (Cat #: ISEQ00010, Immobilon) were first
soaked in 100% methanol for 5 minutes and then in pre-cold transfer buffer at 30°C (25
mM Tris, 192 mM glycine, 10% methanol, pH 8.3) for 10 min prior to electroblotting.
Pre-soaking of 4 layers of filter papers and sponges in the cold transfer buffer was
necessary. The transfer cassette sandwich (Mini Trans-Blot Cell, Bio-Rad) was assembled
in the following order: 1) 1 layer of filter sponge, 2) 4 layers of filter paper, 3) gel, 4)
PVDF membrane, 5) 4 layers of filter paper, 6) 1 layer of filter sponge. Wet-transfer was
carried out at 100 V for 2 hr in the cold room for proteins with molecular weight ranging
from 10 to 75 kDa, and 30 V for 20 hr was used for protein with molecular weight from
103 76 to 350 kDa. To disperse the heat that was being produced during electroblotting, an ice
pack and a stirring bar were placed in the Trans-Blot cell (Bio-Rad).
3.8.5 Blocking and Immunodetection
After transfer, nitrocellulose membranes were washed in 1x TBST (10x TBS solutionand
0.5 mL (m/v) TWEEN®20, Sigma-Aldrich, pH 7.5) for 5 minutes. To avoid nonspecific
binding, membranes were blocked in 2% skim milk in TBST for 20 minutes. Membranes
were then washed with three 5-minutes washes using TBST, followed by incubation with
primary Ab against the anticipated protein over night or 2 days at 4°C. The optimal
dilution of each primary Ab, which was determined experimentally, was listed in table 3-
2. These membranes were washed twice in TBST for 10 minutes interval. Membranes
were then incubated with horse radish peroxidase (HRP) conjugated anti-mouse (Cat
#:A4416, Sigma-Aldrish) or anti-rabbit (Cat #: A0545, Sigma-Aldrish) secondary
antibodies (1:10,000) with TBST including 1% skim milk for 2-3 hr in 4 °C. Membranes
were again washed in TBST twice. Prior the protein immunodetection, each membrane
was incubated in 200 μL SuperSignal®West Pico Chemiluminescent Substrate (Cat
#:34078, Thermo Scientific) or Bio-Rad ClarityTM Western enhanced
chemiluminescence ECL substrate (Cat #:170-5060, Bio-Rad). Immuno-labelled protein
TM bands will be captured by a BioRad ChemiDoc MP system (Universal Hood II, Bio-
Rad) equipped with Image Lab (version 5.2.1).
104 Table 3-3 List of antibodies.
105 3.9 Reverse transcription and quantitative real-time polymerase chain reaction
3.9.1 RNA extraction and quantification
To harvest for RNA extraction, cell culture medium was aspirated from the T25 flasks of
PCa cells. The flasks were washed twice with cold PBS before incubation with 300 μL
lysis buffer, containing guanidine thiocyanate (PureLink RNA Mini Kit, Cat #:
12183018A, Life Technologies); and 14.3 M (1% v/v) β-mercaptoethanol (Sigma-
Aldrich, Australia) on the slow shaker in the cold room for 10 minutes. Samples were
kept in -80°C until extraction. On the day of extraction, T25 flasks were thawed and cells
with the lysis buffer were transferred to RNase free eppendorf tubes using sterile, RNase-
free pipette tips. An equal amount of 70% RNase-free ethanol was added to the samples
and then voltexed for 30 seconds to disperse any visible precipitate and to prevent
genomic DNA contamination. The samples were then transferred to spin cartridges up to
700 μL and centrifuged for 15 seconds at 12,000 x g to allow the precipitated RNA to
bind to the column matrices (Figure 3.4). The flow through that contains ethanol, DNA
debris and lysis buffer, was discarded. The spin cartridges were re inserted into the
collecting tube and followed by washing with 700 μL of washing buffer Ι to remove
RNA-bound protein. The samples were centrifuged again for 15 seconds at 12,000 x g to
let protein and ethanol residues through into the collecting tube and then the flow through
were discarded carefully. The cartridges were inserted into new collecting tubes and 500
μL of washing buffer ΙΙ was added into the cartridges in order to remove remaining metal
residue, DNA, wash buffer Ι and/or ethanol. The samples were washed twice with wash
buffer ΙΙ. The flow through were discarded and then centrifuged again at maximum speed
for 1-2 min to dry the membrane with the attached RNA. The collecting tubes were
106 discarded and the cartridges were inserted into new recovery RNase-free tubes. RNase- free water (50 μL) was added into the center of spin cartridge and incubated for 1-2 minutes to dissolve RNA. The total RNA from the spin cartridges was eluted by centrifugation for 2 min at 12,000 x g. The quality and quantity of the extracted RNA samples was determined using the NanoDrop ND-1000 Spectrophotometer
(Thermofisher, Australia).
Figure 3.4 The flow chart illustrating the steps of isolating total RNA using the PureLink RNA Mini Kit
107 3.9.2 Reverse transcription (RT)
To facilitate the PCR analysis of RNA molecules, single stranded RNA was transcribed
into complementary DNA (cDNA) copy by using reverse transcriptase (RT) enzyme from
High-Capacity cDNA Reverse Transcription Kit (Cat. #: 4368813, Life Technologies).
The RT reaction commenced with the addition of master mix I consisting of 50 ng/mL
Random Hexamer, and 50 μM Oligo (dT). Master mix I was added to 1 μg of RNA
samples and diethylpyrocarbonate (DEPC)-treated water and the samples were incubated
with Veriti Thermal Cycler (Applied Biosystems, USA) at 65°C for 5 minutes and 4°C
for 2 minutes. Following incubation, master mix II was prepared using 10x RT buffer, 25
mM MgCl2, 10 mM dNTP mix, 100 mM DTT, 20 U/uL of RNase inhibitor and 50 U/uL
of MultiScribe RT (Life technologies, USA). Non-RT control was prepared as
aforementioned steps without adding of MultiScribe RT. This non-RT control was
included to verify the contamination level of cDNA, which may have yielded less than
optimal results. Formulation of RT reaction was described in Table 3-3.
Final incubation temperatures varied:
Annealing: 25 oC for 5 min.
cDNA synthesis: 42 oC for 30 min
Terminate reaction: 85 oC for 5 min
Store cDNA: hold at 4 oC
Store samples: –20 oC until use.
108 Table 3-4 Formulation of reverse transcription reaction
Volume/Reaction Final
(μL) Concentration RNA Varied 1000ng 7.6 – uL of RNA for samples DEPC-treated H2O Step 1 8.6 – uL of RNA for –ve control
Master Oligo d(T)16 1 2.5 μM Mix I Random Hexamer 1 2.5 μM
10X RT Buffer 2 1X
25mM MgCl2 1.4 1.75 mM 10mM dNTP mix 4 0.5 mM Master 100mM DTT 1 5.0 mM Mix II RNase Inhibitor Step 2 1 1 U/μL (20 U/ μL) MultiScribe RT 1 2.5 U/μL (50 U/ μL) 10.4 μL for samples Volume Master Mix II/reaction 9.4 μL for negative control FINAL Total Volume: 20.0 μL
3.9.3 Designing the primers
Two types of primer (forward and reverse) were required for PCR reaction. The sequence
for the gene of interest was obtained from GeneCards and cDNA sequence was used to
design primer. Primers were designed using Primer 3 and several parameters were set
such that the primers length is between 18 to 20 nucleotides, GC% between 45% and
55%, melting temperature between 55°C and 65°C, annealing temperature between 55°C
and 80°C, avoid GC clamp and secondary structure, and PCR product size between 100-
200 nucleotides. The outputs, multiple possible forward and reverse primer sequences,
were additionally screened for their specificity and quality using the following software:
109 1) OligoEvaluator was used to eliminate primers that form medium to very strong
secondary structures,
2) In-Silico PCR from UCSC Genome Bioinformatics was used to eliminate primer
pairs that amplify non-specifically,
3) NCBI BLAST was used to eliminate primers that amplify genomic DNA and
4) AmplifX was used to determine overall primer quality.
The primer sets (forward and reverse) used for PCR amplification were listed in Table 3-4.
Table 3-5 List of primers
Annealing Product Temp GC% Gene Sequence GC% Temp Size Of (°C) (°C) (bp) Amplicon
CCNB1 5'–CGGGAAGTCACTGGAAACAT–3 ' 54 50 (F) 51 126 44% CCNB1 5'–ATTCTGCATGAACCGATCAA– 3 ' 52 40 (R)
CDC2 5'–GGGGTCAGCTCGTTACTCAA– 3 ' 56 55 (F) 51 139 43% CDC2 5'–AGTGCCCAAAGCTCTGAAAA–3 ' 54 45 (R) PLK1 5'–GCCCCTCACAGTCCTCAATA– 3 ' 55 55 (F) 55 124 58% PLK1 5'–CTGCAGCATGTCACTGAGGT– 3 ' 56 55 (R)
AURKA 5'–TGCACCACTTGGAACAGTTT– 3 ' 54 45 (F) 51 201 39% AURKA 5'–ACTGACCACCCAAAATCTGC– 3 ' 55 50 (R)
36B4 (F) 5'–TGTTTCATTGTGGGAGCAGA– 3 ' 53 45 54 170 56% 36B4 (R) 5'–CGGATATGAGGCAGCAGTTT– 3 ' 54 50
F = forward, R = Reverse
110 3.9.4 Polymerase chain reaction (PCR)
Samples for amplification reaction contained (1) SensiMix™ SYBR® No-ROX (Cat. #:
QT650-05, Bioline), (2) forward and reverse primers of each gene of interest (primers
were synthesised by Geneworks Australia and Sigma-Aldrich, Australia) and (3) diluted
cDNA template, and final volume was made up to 20 μL as described in Table (3-5). 18
μL of the primer with master mix were loaded into each of the sample tubes, 2 μL cDNA
samples (1/50 dilution) was then added to each pre-loaded sample tubes. Triplicates were
carried out for each sample.
Table 3-6 Reagents involved in PCR reaction.
Reagent Volume Final Concentration
SensiMix™ 10 μL 1x 10μM Primer (F) 0.5 μL 250nM 10μM Primer (R) 0.5 μL 250nM Rnase-free H2O 7 μL cDNA 2 μL 1:50 dilution Total 20 μL
3.9.5 Dilution curve and amplification efficiency
The PCR efficiency can also affect the quantification of the template, which is dependent
on the assay, the master mix performance, and sample quality. To determine the
efficiency of each gene of interest, standard samples were prepared by using one sample
of cDNA and serial diluting from 1:3 up to 1:81 dilutions, a total of 4 standard points
(each dilution run in triplicate). A standard curve was constructed by using the
concentrations against the threshold cycle (CT) value obtained from amplification of each
111 dilution. The equation of linear regression line along with r and R2 were also evaluated to
examine the linearity of data and amplification efficiency of PCR. A melt-curve analysis
in each of the genes was also performed to identify the various products of polymerase
chain reaction. The melt step was set to the following conditions: 1 degree rise in
temperature from 65°C to 95°C and held for 5 seconds between each rise in temperature.
Negative controls including non-RT control (reverse transcription control, RNA sample
with no reverse transcriptase enzyme) and no-template controls (by replacing cDNA with
MilliQ H2O) were included in each experiment.
Samples were amplified using a Qiagen Rotor Gene 6000 RT-qPCR machine set to the
following conditions:
Table 3-7 Cycling conditions (Rotor-Gene RG-6000 Corbett Research)
Step Cycles Temperature (°C) Time Initial Denaturation 1 95 10 mins Denaturation 40 95 15 secs Annealing 40 60 15 secs Extension 40 60 15 secs
3.9.6 Data analysis
The peak present in the melt curve occurs when there is a rapid increase in the rate of
fluctuating florescence. Fluorescence decreases as temperature increases. The threshold
cycle parameter (CT) is the calculated fractional cycle number at which the PCR product
112 crosses a threshold of detection. The greater amount of initial DNA template, the more
PCR products are accumulated andthe earlier the Ct value for that sample, i.e., lower CT
values mean higher amounts of your target nucleic acid. The change of the CT Value was
then normalized with 36B4 and analysed by The Relative Expression Software Tool
(REST, version 2009).
3.10 Animal study
All in vivo experiment were conducted with approval from the Animal Ethics Committee
at The University of Sydney. Normal mice were randomly divided into DR treatment
group and vehicle control group (5 mice per group). Subcutaneous injection of vehicle
(200 μL of PBS) or DR at 1 mg/g begun on day 1 and continued through to day 15. Body
weights of the mice were measured daily. After 15 days, mice were humanely killed.
3.11 Quantification
3.11.1 Immunocytochemistry
At least three images were acquired from each immunostained section using fluorescent
microscope (BX51, Olympus) and the images were quantified using Image-Pro Plus
(version 7.0). The number of positive cells (DAB stained brown cells or negative
(haematoxylin-stained blue cells) in each acquired image was counted. The positivity of
each immunolabelling for protein of interest was calculated as following: DAB
density/(DAB plus haematoxylin density). The positivity was converted into relative
percentage by using experimental control (vehicle control) as 100%.
113 3.11.2 Immunofluorescence
The immunofluorescence images captured using fluorescent microscope (BX51, Olympus).
The phospho-H2AX and 53BP1 foci were quantified using Image J 32 software (1.38x,
National institutes of health, USA).
3.11.3 Immunoblotting
The images captured by ChemiDoc™ XRS+ System (Bio-Rad, Australia) were quantified
using Image J 32 software (1.38x, National institutes of health, USA). The ratio of band
intensity between the protein of interest and the housekeeper protein (GAPDH or α-
TUBULIN) was calculated. The net intensity for the band of interest was converted into
relative percentage by using experimental control as 100%.
3.12 Statistical Analysis
Statistical comparison was performed by using NCSS/PASS version 12.0 (NCSS
Statistical and Power Analysis Software). The processed data were analysed using one-
way ANOVA to determine if a significant change had occurred. Fisher’s least significant
difference multiple-comparison test (significance: p<0.05) and Kruskal–Wallis multiple-
comparison z-value test (significance: z-value of >1.96) were applied.
114
Chapter 4
115
4 The effect of DR on proliferation of PCa cells
116 4.1 Introduction
One of the most fundamental traits of cancer cells is the ability to sustain prolonged
proliferation (Hanahan et al. 2011). Normal cells maintain a homeostasis between cell
proliferation and apoptosis leading to no net growth of cell population. However, cancer
cells have the ability to disrupt the balance, resulting in uncontrolled growth. Hence, to
form clinically relevant tumour, cancer cells require uncontrolled proliferation (Hanahan
et al. 2011; Malumbres et al. 2001). Since cancer cell proliferation requires the synthesis
of DNA, any impact on DNA synthesis will interfere with the proliferative ability of
cancer cells (Menyhárt et al. 2016). A number of chemo drugs currently available for
cancer treatment such as cisplatin have achieved anti-proliferative action via their
disruptive effect on DNA replication (Kelland 2007). Thus, establish new methods using
natural or synthetic compounds or botanical extract to inhibit cancer cell proliferation is
expected to interfere cancer DNA synthesis. As aforementioned in Chapter 1,
proliferation index measured as the percentage of Ki-67 positive cancer cells over total
cancer cells is correlated with disease progression in PCa, (Halvorsen et al. 2003;
Khatami et al. 2009). We envisage a method that can impede DNA synthesis, cell cycle
progression and proliferation and subsequently capable of preventing or slowing PCa
progression.
The aim of studies described in this chapter was to determine the effect of DR on
proliferation of PCa cells.
117 4.2 Materials and Methods
4.2.1 Prostate cancer cell lines
The PCa cell line LNCaP and PC-3 were cultured as described in Chapter 3.1.1.
4.2.2 DR treatment
DR stock solution and dose range were prepared as described in Chapter 3.2.1.
4.2.3 SYBR Green assay
The DNA content of PCa cells was determined using SYBR Green assay as described
in Chapter 3.3.
4.2.4 Immunocytochemistry
The PCa cells block preparation and immunolabelling of BrdU and Ki-67 were
performed as described in Chapter 3.6.2 and 3.6.1. The quantification was as
described in Chapter 3.11.1.
4.2.5 Colony formation assay
PCa cell colony formation was measured as described in Chapter 3.4.
4.2.6 Animal study
The effect of DR on mouse body weights was measured as described in Chapter 3.10.
118 4.2.7 Statistical analysis
The statistical software NCSS version 12.0 was used for statistical analysis as
described in Chapter 3.12.
4.3 Results
4.3.1 DR inhibited the proliferation of PCa cells
4.3.1.1 Treatment with DR decreased DNA synthesis in PCa cells by SYBR Green DNA analysis assay
We first monitored the change in DNA content in the presence or absence of DR using
SYBR Green assay. After 48 hr of cell seeding in 96 well plate, LNCaP and PC-3 cells
were treated with a dose range of DR (0-1 mg/mL) for 24, 48 and 72 hr and analysed by
SYBR Green DNA assay. In addition to vehicle control, ie zero DR, a second control
namely a baseline control was also included, which provided the initial DNA content at
time zero of treatment. By comparing with these two controls, we were able to
differentiate between the cytostatic and cytotoxic action of DR.
Vehicle control group represented full growth in which DNA content at 72 hr was
approximately three times higher than the baseline. At 0.25-0.75 mg/ml the DR action
was cytostatic. But at 1 mg/mL of DR, the treatment had cytotoxic activity in LNCaP
cells as the fluorescent intensity was lower than baseline (Figure 4.1). For PC-3 cells,
0.25-1 mg/mL of DR treatment for 72 hr had cytostatic action (Figure 4.2).
The cytostatic action or the extent of growth inhibition (GI) induced by DR was estimated
119 by calculating the percentage of GI based on the SYBR Green result. After 72 hr of DR treatment, the average GI at 0.25, 0.5, and 0.75 mg/mL were 33%, 61%, and 90% in
LNCaP cells (Figure 4.1). In PC-3 cells, the average GI at 72 hr were 26%, 58%, 82% and 94%, respectively for 0.25, 0.5, 0.75 and 1 mg/mL (Figure 4.2). Apart from dose- dependence, GI effect appears to be time-dependent over the study period.
120 60000 LNCaP
50000 y t
i * * * * s n
e # # # t 40000 n I
t * *
n @ @ e 30000 # # * c * s e
r # # α
o @ @ u l 20000 @ F
10000
0 e e e 0 5 5 5 1 0 5 5 5 1 0 5 5 5 1 . . . n n n Dose (mg/mL) 2 7 2 7 2 7 i i i . 0 . . 0 . . 0 . l l l 0 0 0 0 0 0 e e e s s s a a a B B B 24hr 48hr 72hr
% of Growth inhibition (GI) ± STDEV Cells Doses 24hr 48hr 72hr 0 mg/mL 0% ± 46% 0% ± 19% 0% ± 23% 0.25 mg/mL 41% ± 30% 51% ± 38% 33% ± 13% LNCaP 0.5 mg/mL 60% ± 28% 66% ± 14% 61% ± 18% 0.75 mg/mL 120% ± 40% 95% ± 16% 90% ± 7% 1 mg/mL 173% ± 80% 125% ± 26% 109% ± 6%
Figure 4.1 DR inhibited the DNA synthesis of LNCaP cells in a dose-dependent manner. Cells were treated with various doses of DR for 24 hr, 48 hr and 72 hr. Cells were harvested and analysed with SYBR Green assay. SYBR Green fluorescence intensity reflects the amount of DNA content in the experimental samples. Baseline indicates the initial amount of DNA or number of cells at time zero. The percentage of growth inhibition was shown in the table. All experiments were performed in triplicates; data were expressed as the mean from three independent experiments ± SD. * p<0.01 compared to 0 mg/mL (vehicle control). # p<0.05 compared to 0.25 mg/mL, @ p<0.05 compared to 0.5 mg/mL. α p<0.05 compared to 0.75 mg/mL.
121 70000 PC-3
y t i
s 60000 n e t
n * I * * * 50000 e c
n # # # e
c 40000 * * * * s e
r @ @
o # # # u
l 30000 F @ @ α 20000 α 10000
0 e e e Dose (mg/mL) 0 5 5 5 1 0 5 5 5 1 0 5 5 5 1 . . . n n n 2 7 2 7 2 7 i i i . 0 . . 0 . . 0 . l l l 0 0 0 0 0 0 e e e s s s a a a B B B 24hr 48hr 72hr
% of Growth inhibition (GI) ± STDEV Cells Doses 24hr 48hr 72hr 0 mg/mL 0% ± 31% 0% ± 20% 0% ± 23% 0.25 mg/mL 9% ± 72% 16% ± 23% 26% ± 25% PC-3 0.5 mg/mL 12% ± 34% 37% ± 16% 58% ± 27% 0.75 mg/mL 41% ± 47% 67% ± 17% 82% ± 18% 1 mg/mL 109% ± 41% 110% ± 7% 94% ± 12% Figure 4.2 DR inhibited the DNA synthesis in PC-3 cells in a dose-dependent manner. Cells were treated with various doses of DR for 24 hr, 48 hr and 72 hr. Cells were harvested and analysed with SYBR Green assay. SYBR Green fluorescence intensity reflects the amount of DNA content in the experimental samples. Baseline indicates the initial amount of DNA or number of cells at time zero. The percentage of growth inhibition was shown in the table. All experiments were performed in triplicates; data were expressed as the mean from three independent experiments ± SD. * p<0.01 compared to 0 mg/mL (vehicle control). # p<0.05 compared to 0.25 mg/mL, @ p<0.05 compared to 0.5 mg/mL. α p<0.05 compared to 0.75 mg/mL.
122 In summary, DNA analysis by SYBR Green assay showed that DR significantly reduced
(p<0.05) the DNA content of PCa cells in a dose and time dependent manner. We also
established that 0-0.75 mg/mL of DR should be used in LNCaP cells to study the
cytostatic action of DR without confounding cytotoxic action. For PC-3 cells, the dose
range for cytostatic action of DR would be 0-1 mg/mL.
4.3.1.2 Treatment with DR decreased BrdU incorporation in PCa cells by immunocytochemistry
To verify the inhibitory action of DR on DNA content by SYBR green assay, the
immuonocytochemical staining of BrdU was performed. BrdU is thymidine analogue and
will be incorporated into newly synthesised DNA. PCa cells were treated with DR for 72
hr and harvested for immunocytochemistry to observe BrdU incorporation.
There was a significant decrease (p<0.01) in the percentage of BrdU positive LNCaP
cells. By comparison with the vehicle control, we noted a reduction of 15% at 0.25
mg/mL, 54% at 0.5 mg/mL and 75% at 0.75 mg/mL in LNCaP cells (Figure 4.3). In PC-3
cells, the decrease (p<0.01) in BrdU positivity at 0.25, 0.5, 0.75 and 1 mg/mL were 28%,
49%, 67% and 70%, respectively (Figure 4.4).
123 LNCaP 0 mg/mL 0.25 m g/mL
0.5 mg/mL 0.75 mg/mL
120% * * *
100% y
t # # i
v 80% i t
i @ s 60% o P 40% u d r 20% B 0% 0 0.25 0.5 0.75 Dose (mg/ml)
Figure 4.3 DR decreased the BrdU incorporation in LNCaP cells. LNCaP cells were grown in T75 for 48 hr prior to the DR treatment. DR was introduced with different doses (0 - 0.75 mg/mL) for 72 hr. Total density of DAB (BrdU positive cells) and haematoxylin (total number of cells) in each acquired image was measured and the positivity of BrdU was calculated. The values plotted are the mean of 14 sections from each dose taken from three independent experiments ± SD. * p<0.01 compared to 0 mg/mL. # p<0.05 compared to 0.25 mg/mL, @ p<0.05 compared to 0.5 mg/mL.
124 PC-3 0 mg/mL 0.25 m g/mL
0.5 mg/mL 0.75 mg/mL
1 mg/mL 120%
y t
i 100%
v * * * * i t i
s 80% # # # o p 60% @ @ U d r
B 40% 20% 0% 0 0.25 0.5 0.75 1 Dose (mg/mL)
Figure 4.4 DR decreased the BrdU incorporation in PC-3 cells. PC-3 cells were grown in T75 for 48 hr prior to the DR treatment. DR was introduced with different doses (0 - 0.75 mg/mL) for 72 hr. Total density of DAB (BrdU positive cells) and haematoxylin (total number of cells) in each acquired image was measured and the positivity of BrdU was calculated. The values plotted are the mean of 9 sections from each dose taken from three independent experiments ± SD. * p<0.01 compared to 0 mg/mL. # p<0.05 compared to 0.25 mg/mL, @ p<0.05 compared to 0.5 mg/mL.
125 In summary, following the observation that DR decreased DNA content of PCa cells by
SYBR green assay, immunocytochemical staining of BrdU incorporation demonstrated
that DR reduced DNA synthesis in a dose-dependent fashion in both LNCaP and PC-3
cells.
4.3.1.3 Treatment with DR decreased Ki-67 protein level in PCa cells by immunocytochemistry
After confirming an inhibitory effect of DR on DNA synthesis, we next determined DR
effect on cell proliferation by immunocytochemical analysis of Ki-67. Ki-67 is a nuclear
protein associated with cycling cells and Ki-67 positivity indicates the fraction of cycling
cells. PCa cells were treated with DR for 72 hr and harvested for immunochemical
staining of Ki-67.
Immunocytochemistry of Ki-67 staining demonstrated that comparing to the control, the
percentage of Ki-67 positive cells was significantly (p<0.01) reduced by 17%, 49% and
64% at the dose range of 0.25, 0.5 and 0.75 mg/mL in LNCaP cells, respectively (Figure
4.5). Similarly, a noticeable reduction (p<0.01) in Ki-67 positivity at the dose range of
0.25, 0.5, 0.75 and 1 mg/mL was detected with 33%, 48%, 62% and 67% in PC-3 cells,
respectively (Figure 4.6).
126 LNCaP 0 mg/mL 0.25 m g/mL
0.5 mg/mL 0.75 mg/mL
120%
100% * y
t * i * v
i 80% t
i # # s
o 60% P
@ 7
6 40% - i
K 20% 0% 0 0.25 0.5 0.75
Dose (mg/mL)
Figure 4.5 DR decreased the Ki-67 positivity in LNCaP cells. LNCaP cells were grown in T75 for 48 hr prior to the DR treatment. DR was introduced with different doses (0 - 0.75mg/mL) for 72 hr. Total density of DAB (Ki-67 positive cells) and haematoxylin (total number of cells) in each acquired image was measured and the positivity of Ki-67 was calculated. The values plotted are the mean of 17 sections from each dose taken from three independent experiments ± SD. * p<0.01 compared to 0 mg/mL. # p<0.05 compared to 0.25 mg/mL, @ p<0.05 compared to 0.5 mg/mL.
127 PC-3 0 mg/mL 0.25 m g/mL
0.5 mg/mL 0.75 mg/mL
1 mg/mL 120% 100% * * * *
y t i 80% # # # v i t i
s 60% @ o p 40% 7 6 - i 20% K 0% 0 0.25 0.5 0.75 1 Dose (mg/mL)
Figure 4.6 DR decreased the Ki-67 positivity in PC-3 cells. LNCaP cells were grown in T75 for 48 hr prior to the DR treatment. DR was introduced with different doses (0 - 0.75mg/mL) for 72 hr. Total density of DAB (Ki-67 positive cells) and haematoxylin (total number of cells) in each acquired image was measured and the positivity of Ki-67 was calculated. The values plotted are the mean of 8 sections from each dose taken from three independent experiments ± SD. * p<0.01 compared to 0 mg/mL. # p<0.05 compared to 0.25 mg/mL, @ p<0.05 compared to 0.5 mg/mL.
128 In summary, Ki-67 immunocytochemical staining demonstrated that DR can reduce the
proportion of proliferative cancer cells in a dose-dependent manner in PCa cells.
4.3.1.4 Microscopic verification of cytostatic action of DR
Since cell morphology and confluence in culture are indicative of the healthy status of the
cells, we evaluated the effect of DR on cells morphology and confluence. The
microscopic images of PCa cells at time zero and 72 hr after DR treatment were recorded
using Olympus fluorescent microscope.
The control group reached 70%-80% confluence from a baseline at time zero of about
20% over 72 hr. The cell confluence was markedly reduced in the presence of DR over
72 hr. The estimated confluence was about 30% at 0.75 mg/mL (Figure 4.7). In PC-3
cells, the control group reached to 80%-90% confluence from 20% at baseline. After 72
hr treatment with DR, the confluence was noticeably decreased and remained with 50% at
1mg/mL (Figure 4.8). No floating cells were observed in both PCa cells following the DR
treatment.
129 LNCaP Baseline 0 mg/mL
0.25 mg/mL 0.5 mg/mL
0.75 mg/mL
Figure 4.7 DR decreased the confluence of LNCaP cells. The images of Baseline were taken after 48 hr of seeding, before DR was introduced. The rest representative images were taken 72 hr after treatment of DR. 40 × magnification of Olympus fluorescent microscope was used.
130 PC-3 Baseline 0 mg/mL
0.25 mg/mL 0.5 mg/mL
0.75 mg/mL 1 mg/mL
Figure 4.8 DR decreased the confluence of PC-3 cells. The images of Baseline were taken after 48 hr of seeding, before DR was introduced. The rest representative images were taken 72 hr after treatment of DR. 40 × magnification of Olympus fluorescent microscope was used.
131 In summary, microscopic images of PCa cells supported a cytostatic action of DR in a
dose dependent manner.
4.3.1.5 Treatment with DR reduced the number of colony formation
To determine the long-term effect of DR on proliferation of PCa cells, LNCaP and PC-3
cells were treated with DR at various doses for 72 hr. The cells were then cultured for an
additional 7 days in the absence of DR at a density appropriate for formation of detectable
colonies. The number of colonies were quantified and the morphology of colonies were
recorded using Olympus fluorescence microscope using 40 × magnification.
A dose dependent decrease was detected in the number of colony formation after DR
treatment. In LNCaP cells, the number of colony formation was significantly reduced
(p<0.05) to one third of control at 0.75mg/mL (Figure 4.9). Only 10% of colonies were
observed at 1mg/mL treated PC-3 cells (p<0.01) compared to control (Figure 4.10).
132 LNCaP 0 mg/mL 0.25 mg/mL
0.5 mg/mL 0.75 mg/mL
Quantification of Colonies
800
s
e * i 700 n * o
l 600 # o
c # 500 f o 400 r e
b 300 m
u 200
N 100 0 0 0.25 0.5 0.75 Dose (mg/mL)
Figure 4.9 DR reduced the colonies formation of LNCaP cells. LNCaP cells were treated with DR for 72 hr, and re-seeded for 7 days. Cells were harvested and stained with 1% crystal violet in PBS. Each sample was photographed and the colonies consisting of more than 50 cells were scored by software. The values plotted are the mean from three independent experiments ± SD. * p<0.01 compared to 0 mg/mL. # p<0.05 compared to 0.25 mg/mL.
133 PC-3 0 mg/mL 0.25 mg/mL
0.5 mg/mL 0.75 mg/mL
1 mg/mL Quantification of Colonies 800
700 s e i
n 600 o l
o 500 c
f * * * *
o 400 # #
r e 300 b @ m
u 200 n 100 0 0 0.25 0.5 0.75 1 Dose (mg/mL)
Figure 4.10 DR reduced the colonies formation of PC-3 cells. PC-3 cells were treated with DR for 72 hr, and re-seeded for 7 days. Cells were harvested and stained with 1% crystal violet in PBS. Each sample was photographed and the colonies consisting of more than 50 cells were scored by software. The values plotted are the mean from three independent experiments ± SD. * p<0.01 compared to 0 mg/mL. # p<0.05 compared to 0.25 mg/mL, @ p<0.05 compared to 0.5 mg/mL.
134 In summary, the number of colonies were reduced over 7 days following treatment with
DR for 72 hr, suggesting a long term inhibitory effect of DR on cell proliferation.
4.3.2 DR did not modulate pH and osmolality of media bathing
PCa cells
In order to exclude a possibility that these above findings were associated with
modulation of pH and osmolality in the presence of DR, these two parameters at various
dose of DR (0-2 mg/mL) were measured. There was no noticeable change in both
parameters in culture media (Figure 4.11).
(a) pH (b) Osmolality
10 400
9 350 8 300 7
g 250
6 k /
m s H 200
5 O p m 4 150 3 100 2
1 50
0 0
0 25 .5 1 2 0 5 5 1 2 . 0 .2 0. 0 0 Dose (mg/mL) Dose (mg/mL)
Figure 4.11 DR did not modulate the pH and osmolality of culture media. Complete culture media with various dose of DR were tested for (a) pH and (b) osmolality and the data shown were average of three independent experiments.
135 4.3.3 Treatment of normal mice with DR did not change animal
body weight
To confirm that DR has no significant side effect, two groups of animals (5
mice/group) were given either PBS (200 ul) or DR (1 mg/g body weight)
subcutaneously and their body weight was monitored for 15 days. As described in
figure 4.12, no significant changes in body weight were detected in DR treated groups
compared to the vehicle control.
30
25
) s m
a 20 r g (
t h
g 15 i
e PPBSBS w
y PD2 R d 10 o b
5
0 1 2 3 4 5 8 9 10 11 12 15 Days
Figure 4.12 Treatment of normal mice with DR did not change animal body weight. Two groups of normal mice (5 mice/group) were treated with either PBS (200 ul) or DR (1 mg/g) and body weight of animals was measured during a period of 15 days.
136 4.4 Discussion
One of the hallmarks of cancer is uncontrolled proliferation. Hence, we started by
investigating the effect of DR on proliferation of PCa cells. We determined whether DR
could affect DNA synthesis of PCa cells using SYBR Green DNA analysis assay and
BrdU incorporation as our laboratory previously described (Xi et al. 2016; Yao et al.
2012). We have found that DR can decrease the DNA content and DNA synthesis. This
anti proliferative action of DR was supported using Ki-67 immunocytochemical staining
(Gerdes et al. 1984; Khatami et al. 2009), which indicated the reduction of the
proliferative or cycling cells. Additionally, the colony formation assay demonstrated that
a short term exposure of DR may have a long term effect. Importantly, exposure of DR on
normal mice showed no adverse action over 15 days.
4.4.1 Selection of SYBR green assay for DNA analysis
How to choose appropriate methods for in vitro assessment of cell proliferation is
important. Previous literatures had reported the anti-proliferative activities of HD and SB
using colorimetric cell viability assay such as MTT (3-(4,5-Dimethylthiazol-2-yl)-2,5-
diphenyltetrazolium bromide) (Chen et al. 2012; Gao et al. 2017; Lin et al. 2012; Zhang
et al. 2017). MTT assay measures the colorimetric intensity resulted from activity of
NAD(P)H-dependent mitochondria enzyme succinate dehydrogenase. The action of DR
measured by MTT assay could be misleading if DR affects mitochondria succinate
dehydrogenase independent from cell proliferation (Bruggisser et al. 2002). A study of
natural supplement products using MTT assay and DNA dye had shown that MTT assay
overestimated the anti-proliferative activities of those natural botanical products. This is
because the mitochondria enzymatic activity is likely to be affected by the chemicals in
137 natural products (Gao et al. 2014; Wang et al. 2010). In our study, DR is herbal derivative
and using MTT assay may lead to false positive result. As MTT assay rely on the
enzymatic activity of viable cells, the colorimetric measurement needs to be conducted at
the end of treatment duration. Baseline, which is the initial cell viability at time-zero, can
not be measured at the same time with control and treatment group. Consequently,
without having baseline, a differentiation of cytostatic from cytotoxic action is impossible
with MTT assay.
It has been suggested that the assay using DNA dye should provide more consistent result
since the cell proliferation is directly associated with DNA replication (Menyhárt et al.
2016; Wang et al. 2010). In our study, we used SYBR Green assay to provide the direct
evidence of DR action on DNA synthesis. SYBR Green I can directly bind to minor
groove of DNA double helix and the fluorescence intensity emitted from DNA represents
the total DNA content of given sample. The fluorescence intensity in our control cells
showed three folds increase from baseline at 72 hr, which is consistent with the doubling
time of LNCaP and PC-3 cells around 34 hr ± 6hr (Cunningham et al. 2015; Horoszewicz
et al. 1983).
4.4.2 Cytostatic action of DR
SYBR Green assay has allowed us to determine a net cytostatic or cytotoxic action by
comparing two controls: one is at the time zero or baseline, and the other from the vehicle
control for the same treatment period. If the reduced DNA content compared to vehicle
control was still above the baseline, it is a cytostatic action. In contrary, a fall below the
baseline indicates a net of cytotoxic action. Some studies have reported cancer apoptosis
induced by extracts of HD and SB using very high doses, such as 10 mg/mL in liver
138 cancer cells (Chen et al. 2012) and 3 mg/mL in breast and PCa cells (Marconett et al.
2010). As our aim is to provide an effective and safe clinical modality to men under AS for long term use, we aimed to study the cytostatic action and its underlying mechanism.
In conclusion, we have provided the direct evidence of the anti-proliferative activity of
DR in two PCa cell lines using the assays associated with replicative ability of cancer cells.
139
Chapter 5
140
5 The effect of DR on cell cycle progression
141 5.1 Introduction
The key mechanism of cell proliferation is cell cycle progression. In order to divide into
two daughter cells from a single mother cell, cells must go through the cell cycle phases.
As aforementioned in Chapter 1, there are 5 distinct phases of the cell cycle (G1, S, G2, M
and G0 phase). In the G1 phase, cells start preparation to enter into the S phase for DNA
synthesis. After DNA synthesis in S phase, cells enter the G2 phase. In G2 phase, DNA
repair mechanism may occur and cells prepare for mitosis phase. During M phase, sister
chromatid is separated and a single mother cell divides into two new daughter cells. G0
phase is non-cycling quiescent stage and cells may enter into this stage after mitosis
depending on availability of mitogen stimulating signal.
Flow cytometric cell cycle analysis is a fundamental method used to distinguish between
various phases of the cell cycle based on DNA content. Using the fluorescence intensity
from DNA dye and light scattering properties of individual cells, flow cytometry allows
us to measure a population of cells in different phases of cell cycle (Gray et al. 1986). It
is noted that cells in G1 phase are diploid, and cells in G2 phase and M phase are
tetraploid following DNA duplication in S phase. Hence, based on DNA content, flow
cytometry defines G0/G1 phase and G2/M phase, and S phase is defined as intermediate
between G0/G1 and G2/M. Two most commonly used DNA dye for cell cycle analysis are
PI and DAPI (Darzynkiewicz et al. 2001). However, this conventional flow cytometric
method has limitations.
Conventional flow cytometry using DNA content analysis fails to distinguish G0 phase
from G1 phase because both have the same DNA content (diploid). The conventional cell
cycle analysis is also incapable to separate G2 phase from M phase because both phases
142 have the same DNA content (tetraploid). Among other approaches to distinguish G2 from
M phase cells, co-staining of DNA with PI and phospho-Histone H3 is one of the most
specific approaches. Histone H3 is phosphorylated at Ser10 by Aurora B in mitosis phase
only (Gurley et al. 1978) and therefore can be used as M phase marker.
In chapter 3, we have demonstrated an unequivocal cytostatic action of DR in PCa cells.
Since cell cycle progression is the driving force underlying cell proliferation, we aimed to
further investigate how the cell cycle progression was affected by DR treatment.
Specifically, we wanted to confirm which cell cycle arrest was associated with cytostatic
action of DR.
5.2 Materials and Methods
5.2.1 Prostate cancer cell lines
The PCa cells lines, LNCaP and PC-3, were cultured as described in Chapter 3.1.1.
5.2.2 DR treatment
DR stock solution and various dose range of DR were prepared as described in Chapter
3.2.1.
5.2.3 Nocodazole treatment
Nocodazole treatment to PCa cells was prepared as described in Chapter 3.2.2.
143 5.2.4 Flow cytometric analysis of cell cycle using PI staining
The cell cycle phase distribution of PCa cells was determined by flow cytometric analysis
of cells stained with PI as described in Chapter 3.5.1.
5.2.5 Flow cytometric analysis using co-staining of PI and
phospho-Histone H3
The cell cycle phase distribution of PCa cells was determined by flow cytometric analysis
of cells, stained with both PI and Ab against phospho-Histone H3 as described in
Chapter 3.5.2.
5.2.6 Immunoblotting
The cells were treated in T25 flasks and immunoblotting was performed as described in
Chapter 3.8. The primary antibodies used are listed in Table 3-2.
5.2.7 Statistical analysis
The statistical software NCSS version 12.0 was used for statistical analysis as described
in Chapter 3.12.
144 5.3 Result
5.3.1 DR accrued PCa cells at G2/M phase
5.3.1.1 DR treatment enriched the LNCaP cells at G2/M phase by flow cytometric analysis of cell cycle with PI DNA staining.
Flow cytometric DNA analysis was performed to analyse cell cycle distribution after PCa
cells were treated with various doses of DR. A time course of treatment for 24, 48 and 72
hr were chosen to examine if DR had different effects in a course of time.
Following 24 hr of DR treatment, cell cycle analysis in LNCaP cells showed no
significant changes in G0/G1 phase at 0.25 and 0.5 mg/mL, but a significant decrease
(p<0.05) was found at 0.75 mg/mL (Figure 5.1.a). The cells in S phase were significantly
reduced (p<0.05) at 0.5 and 0.75 mg/mL compared to vehicle control. There was a dose-
dependent increase in cells at G2/M phase after 24 hr of DR treatment at 0.5 mg/mL and
0.75mg/mL (p<0.01).
At 48 hr, a trend similar to 24 hr was found at G0/G1 phase of LNCaP cells (Figure 5.1.a).
Comparing to control, the percentage of cells in S phase with DR was decreased. The
cells at G2/M phase were increased significantly (p<0.01) at 0.75 mg/mL.
At 72 hr, 0.25 mg/mL of DR treatment substantially increased the LNCaP cells at G0/G1
phase and a notable reduction (p<0.05) was observed at 0.75 mg/mL (Figure 5.1.a). The
reduction in S phase was significant (p<0.01). The cells at G2/M phase increased with a
dose-dependent manner and cells were increased to two folds (p<0.01) of control at 0.75
145 mg/mL. Sub G1 was remained unchanged at all time points following the treatment in
LNCaP cells (Figure 5.1).
146 (a) LNCaP
G0/G1 S G2/M Sub G1 24hr 0 mg/mL 53.8% ± 4.9% 19.5% ± 2.0% 22.8% ± 3.8% 1.2% ± 1.0% 0.25 mg/mL 55.1% ± 3.6% 16.8% ± 2.7% 23.9% ± 2.6% 1.1% ± 1.9% 0.5 mg/mL 54.2% ± 1.0% 15.1% ± 1.7% * 27.6% ± 1.1% * 0.4% ± 0.1% 0.75 mg/mL 48.2% ± 1.8% * # @ 15.0% ± 3.2% * 33.5% ± 2.5% ** # @ 1.4% ± 1.9%
48hr 0 mg/mL 60.2% ± 5.5% 18.7% ± 2.1% 16.6% ± 4.6% 1.5% ± 0.9% 0.25 mg/mL 64.9% ± 4.6% 14.5% ± 0.9% * 18.0% ± 2.7% 0.8% ± 0.8% 0.5 mg/mL 58.7% ± 5.5% 15.6% ± 1.0% 23.5% ± 2.4% 0.4% ± 0.3% 0.75 mg/mL 45.7% ± 3.2% * # @ 13.8% ± 1.9% * 37.7% ± 1.1% ** # @ 0.6% ± 0.2%
72hr 0 mg/mL 61.2% ± 1.45% 19.8% ± 1.4% 16.8% ± 0.4% 0.7% ± 0.2% 0.25 mg/mL 70.3% ± 6.7% * 11.5% ± 0.9% ** 15.9% ± 3.5% 0.4% ± 0.3% 0.5 mg/mL 64.8% ± 4.3% 14.1% ± 1.2% ** # 18.9% ± 2.9% 0.5% ± 0.1% 0.75 mg/mL 49.6% ± 3.1% * # @ 14.1% ± 1.4% ** 33.4% ± 2.5% ** # @ 0.7% ± 0.2% (b) Cell Cycle analysis histograms of LNCaP cells
0mg/mL 0.25mg/mL 0.5mg/mL 0.75mg/mL
Figure 5.1 DR increased LNCaP cells at G2/M phase. LNCaP cells were treated with various dose of DR for 24, 48 and 72 hr. Cells were harvested and stained with PI for DNA analysis using flow cytometry. (a) The distribution of cell cycle phases in the presence and absence of DR at 24, 48 and 72 hr in LNCaP cells. Values presented are indicative of a mean of 3 independent experiments ± SD. *p<0.05 and **p<0.01 indicate statistical significance in comparison to 0 mg/ml. # p<0.05 compared to 0.25 mg/mL. @ p<0.05 compared to 0.5mg/mL. (b) Representative histograms of cells at 72 hr of cell cycle analysis were shown. 147 5.3.1.2 DR treatment enriched the PC-3 cells at G2/M phase by flow cytometric analysis of cell cycle with PI DNA staining.
Flow cytometric analysis in PC-3 cells (Figure 5.2.a) showed that at 24 hr there was no
significant change in cell cycle phases at 0.25, 0.5 and 0.75 mg/mL of DR treatment
compared to vehicle control. But high dose (1 mg/mL) of DR significantly accumulate
(p<0.05) the cells at G2/M phase and consistently decrease the cells at G0/G1 phase.
After 48 hr of DR treatment, there was a significant decrease in the cells at G0/G1 phase and
increased G2/M phase cells in dose-dependent manners (p<0.05). There was no apparent
change in the cells at S phase (Figure 5.2.a).
At 72 hr, cell cycle distribution of PC-3 was similar to LNCaP cells with a notable increase
(p<0.05) at G0/G1 phase cells with the low dose (Figure 5.2.a). But G0/G1 phase cells were
significantly decreased (p<0.01) when treated with 0.75 and 1 mg/mL. Dose range 0.5-1
mg/mL of DR increased the PC-3 cells at G2/M phase with a dose-dependent fashion
(p<0.01) and cells were increased from 26% at vehicle control to 47% at 1 mg/mL. The
percentage of cells at S phase remained the same between treatment and control group. No
change was observed in Sub G1 fraction of PC-3 cells, at all three time points following the
DR treatment.
148 (a) PC-3
G0/G1 S G2/M Sub G1 24hr 0 mg/mL 46.0% ± 3.1% 20.9% ± 5.1% 31.6% ± 2.5% 0.4% ± 0.3% 0.25 mg/mL 48.6% ± 4.8% 18.0% ± 6.9% 31.9% ± 2.7% 0.4% ± 0.3% 0.5 mg/mL 44.0% ± 5.0% 19.0% ± 5.5% 34.8% ± 8.7% 0.9% ± 0.8% 0.75 mg/mL 41.4% ± 3.9% 16.9% ± 2.8% 39.2% ± 5.8% 1.1% ± 1.0% 1 mg/mL 39.9% ± 0.9% * # 16.1% ± 4.6% 42.5% ± 5.9% * # 0.5% ± 0.3%
48hr 0 mg/mL 54.4% ± 1.0% 16.5% ± 0.8% 28.1% ± 0.4% 0.4% ± 0.3% 0.25 mg/mL 56.4% ± 2.4% 14.9% ± 2.1% 27.8% ± 1.7% 0.5% ± 0.4% 0.5 mg/mL 51.9% ± 1.4% * # 14.4% ± 2.9% 32.5% ± 3.4% * 0.7% ± 0.6% 0.75 mg/mL 42.3% ± 2.0% ** # @ 16.8% ± 2.2% 38.6% ± 1.3% ** # @ 1.2% ± 1.4% 1 mg/mL 35.5% ± 0.1% ** # @ α 18.9% ± 1.8% 42.9% ± 2.3% ** # @ 1.1% ± 0.7%
72hr 0 mg/mL 57.1% ± 3.2% 15.8% ± 3.4% 26.3% ± 1.0% 0.7% ± 0.5% 0.25 mg/mL 63.0% ± 4.0% * 11.5% ± 3.7% 24.3% ± 1.4% * 1.0% ± 0.6% 0.5 mg/mL 57.2% ± 3.5% # 11.7% ± 2.6% 29.9% ± 1.7% ** # 1.0% ± 1.2% 0.75 mg/mL 47.2% ± 2.4% ** # @ 13.2% ± 3.1% 38.5% ± 2.9% ** # @ 0.9% ± 1.2% 1 mg/mL 34.6% ± 2.8% ** # @ α 17.4% ± 2.2% 46.6% ± 3.2% ** # @ α 0.7% ± 0.4% (b) Cell Cycle analysis histograms of PC-3 cells 0mg/mL 0.25mg/mL 0.5mg/mL 0.75mg/mL 1mg/mL
Figure 5.2 DR increased PC-3 cells at G2/M phase. PC-3 cells were treated with various dose range of DR for 24, 48 and 72 hr. Cells were harvested and stained with PI for DNA analysis using flow cytometry. (a) The distribution of cell cycle phases in the presence and absence of DR at 24, 48 and 72 hr in PC-3 cells. Values presented are indicative of a mean of 3 independent experiments ± SD. **p<0.01 and *p<0.05 indicate statistical significance in comparison to 0 mg/ml. # p<0.05 compared to 0.25 mg/mL. @ p<0.05 compared to 0.5mg/mL. α p<0.05 compared to 0.75 mg/mL. (b) Representative histograms of cells at 72 hr of cell cycle analysis were shown.
149 Overall, flow cytometric DNA analysis showed that DR reduced the PCa cells at G0/G1 and
increased cells at G2-M phase in a dose dependent manner. S phase cells were reduced in
LNCaP cells, but no change was observed in PC-3 cells. DR had no noticeable effect on Sub
G1 phase.
5.3.2 DR enriched PCa cells at G2 phase
5.3.2.1 Establish flow cytometric analysis of PCa cells by co-staining with anti phospho-Histone H3 Ab and PI.
DNA analysis of flow cytometry by PI staining showed that DR accrued the PCa cells at
G2/M phase. Next, we examined if the accumulated cells were at G2 phase or M phase.
Considering Histone-H3 is highly phosphorylated at Ser10 in mitosis, we determined the
effect of DR on Histone-H3 in PCa cells.
First, we optimised our experimental method. Nocodazole binds to Tubulin with high
affinity to inhibit microtubule assembly. Here, we used Nocodazole for two purposes. One
was to maintain or ‘trap’ cells at M phase and the other to have a positive control to validate
our detection system on cells at M phase. LNCaP cells were treated with various doses of
Nocodazole (200-800 ng/mL) followed by PI flow analysis. Our data demonstrated that 600
ng/mL of Nocodazole treatment increased the G2/M phase to 44.8% compared with 15.8%
in untreated control (p<0.05). No further increase was found at 800 ng/mL (Figure 5.3.a).
Next, we co-stained LNCaP cells with PI and Ab against phospho-Histone H3 in the
presence or absence of Nocodazole. By simultaneously determining DNA content and
150 phospho-Histone H3 positivity, phospho-Histone H3 positive tetraploid cells were gated out.
Method control, which stained with PI only, was included in the analysis to provide specificity of the method for phospho-Histone H3. Flow cytometric analysis of co-staining revealed a significant escalation in M phase cells in Nocodazole treated LNCaP cells compared to control (Figure 5.3.b), indicating the established method should be able to maintain and ‘trap’ cells which have entered M phase.
151 (a)
Duration G0/G1 S G2/M Sub G1 16hr Control 61.9% ± 0.6% 19.3% ± 0.4% 15.8% ± 1.1% 0.8% ± 0.5% 16hr Nocodazole 200 ng/mL 65.6% ± 0.1%* 16.9% ± 0.5%* 14.8% ± 0.4% 1.0% ± 0.3% 16hr Nocodazole 400 ng/mL 59.1% ± 0.2%*# 14.2% ± 0.1%*# 24.4% ± 0.5% *# 1.1% ± 0.4% 16hr Nocodazole 600 ng/mL 41.5% ± 1.5%*#@ 10.8% ± 0.2%*#@ 44.8% ± 0.9% *#@ 1.5% ± 0.2% 16hr Nocodazole 800 ng/mL 41.1% ± 0.9%*#@ 11.5% ± 0.2%*#@ 44.3% ± 0.6% *#@ 1.2% ± 0.1%
Nocodazole Nocodazole Nocodazole Nocodazole (b) Control 200 ng/mL 400 ng/mL 600 ng/mL 800 ng/mL
(c) Nocodazole Nocodazole Nocodazole Control Method Control 400 ng/mL 600 ng/mL 800 ng/mL
3 H
e 18.8% n 1.01% 7.1% 13.1%
o 0.02% t s i H - o h p s o h p
PI Figure 5.3 Nocodazole treatment increased phospho-Histone H3 positive cells. LNCaP cells were treated with a dose range (200-800 ng/mL) of Nocodazole and harvested for flow cytometric analysis. (a) Table showed the distribution of cell cycle phases in the presence and absence of Nocodazole in LNCaP cells. The results were mean value ± SD of two independent experiments. * p<0.05 compared to Control, # p<0.05 compared to 200 ng/mL, @ p<0.5 compared to 400 ng/mL. (b) The representative histograms of PI stained control cells and dose range (200-800 ng/mL) of Ncodazole treated cells. (c) The representative dot plots, which were co-stained with PI and phosphor-Histone H3 in the presence and absence of Nocodazole treatment. Method control lacked immunolabelling of phospho-Histone H3.
152 5.3.2.2 DR accrued PCa cells at G2 phase by co-staining and immunoblotting.
After establishing the detection method, we determined whether DR arrested the PCa cells at
M phase, cell cycle analysis with co-stained cells was performed. DR was introduced to the
PCa cells at the dose of 0-0.75 mg/mL in LNCaP and 0-1 mg/mL in PC-3 cells for 72 hr.
The Nocodazole at 800 ng/mL was introduced in the last 16 hr prior to harvesting.
As expected, the treatment with Nocodazole alone maintained a high number of cells at M
phase compared to the control. Interestingly, treatment with DR significantly reduced cells
at M phase in a dose-dependent manner (Figure 5.4 and 5.5). Compared to control as 100%,
0.75 mg/mL of DR decreased (p<0.01) LNCaP cells at M phase by 50% (Figure 5.4.a).
Similarly, PC-3 cells at M phase were noticeably reduced (p<0.01) by more than 50% even
at 0.25 mg/mL. The proportion of PC-3 cells in M phase was diminished to only 12% at 1
mg/mL of DR (Figure 5.5.a).
153 LNCaP
(a) % of phospho-Histone H3 LNCaP 0 mg/mL 0.80% ± 0.17% 0.25 mg/mL 0.63% ± 0.11% 0.5 mg/mL 0.53% ± 0.15% * 0.75 mg/mL 0.39% ± 0.16% * Nocodazole 19.0% ± 0.14% Method control 0.01% ± 0.00% (b) 0 mg/mL 0.25 mg/mL 0.5 m g/mL
0.77% 0.68% 0.55%
3 H e n o t s i 0.75 mg/mL Nocodazole M ethod control H - o h p s o 0.01% h 0.38% 19.0% p
PI Figure 5.4 DR decreased phospho-Histone H3 positive cells by flow cytometric analysis in LNCaP cells. LNCaP cells were treated with various dose of DR for 72 hr. Cells were labelled with phospho-Histone H3 to perform the cell cycle analysis. Nocodazole (600ng/mL) treated cells were used as positive control. (a) Quantification data of three independent experiments mean ± SD were presented. * indicates p<0.01 compared to 0 mg/ml. (b) The representative dot plots of phospho-Histone H3 positivity in DR treated LNCaP cells.
154 PC-3
(a) % of phospho-Histone H3 PC-3 0 mg/mL 1.87% ± 0.22% 0.25 mg/mL 0.56% ± 0.13% 0.5 mg/mL 0.40% ± 0.12% 0.75 mg/mL 0.28% ± 0.07% * 1 mg/mL 0.22% ± 0.06% * Method control 0.01% ± 0.02% (b) 0 mg/mL 0.25 m g/mL 0.5 m g/mL
1.99% 0.52% 0.40%
3 H e n o t s i H - o h
p 0.75 mg/mL 1mg/mL Method Control s o h p
0.32% 0.25% 0.02%
PI
Figure 5.5 DR decreased phospho-Histone H3 positive cells by flow cytometry analysis in PC-3 cells. PC-3 cells were treated with various dose range of DR for 72 hr. Cells were labelled with phospho-Histone H3 to perform the cell cycle analysis. (a) Quantification data of three independent experiments mean ± SD were presented. * indicates p<0.01 compared to 0 mg/ml. (b) The representative dot plots of phospho- Histone H3 positivity in DR treated PC-3 cells.
155 To confirm the finding from the flow analysis of co-staining, the cancer cells were
treated in the same fashion and harvested for immunoblotting. Consistently, the protein
level of phospho-Histone H3 was diminished in both cell lines, while total Histone H3
level remained unchanged (Figure 5.6), supporting the conclusion that the arrested
cells are not in the M phase.
LNCaP PC-3 (a) 0 0.25 0.5 0.75 mg/mL 0 0.25 0.5 0.75 1 mg/mL
Histone H3 Histone H3
phsopho- phospho- Histone H3 Histone H3
α - Tubulin α - Tubulin (b)
180%
Histone H3 Histone H3 160% % %
160% y
140% n i b
140% y y 120% r r t t 120% e e 100% m m 100% o o t t 80% i i 80% s s n n 60% e e 60% d d
40% e e 40% v v i i t t 20% 20% a a l l e e 0% 0% R R 0 0.25 0.5 0.75 0 0.25 0.5 0.75 1 Dose (mg/mL) Dose (mg/mL)
140% 160% phospho-Histone H3
phospho-Histone H3 %
120% % 140%
y n b i
y 100% y 120% r r t t e * e 100% m
80% m o o t
t * * i # i 80% s 60% s n n e e 60% # d d
e 40% e v v
i 40% i t t a a l 20% l e
e 20% R 0% R 0% 0 0.25 0.5 0.75 0 0.25 0.5 0.75 1 Dose (mg/ml) Dose (mg/mL)
Figure 5.6 DR decreased phospho-Histone H3 protein level in PCa cells. PCa cells were treated with various dose range of DR for 72 hr and the samples were harvested for immunoblotting. (a) The representative images of total and phospho-Histone H3 protein level of PCa cells. α-Tubulin served as a loading control. (b) Quantification of immunoblotting. Triplicates were normalized by loading control and plotted as the histograms with mean ± SD. * p<0.05 compared to 0 mg/mL, # p<0.05 compared to 0.25 mg/mL.
156 5.4 Discussion
We had confirmed the anti-proliferative activities of DR in chapter 3. This chapter
described our investigation as how DR impacts the cell cycle distribution. Flow
cytometry of PI-stained cells showed an accumulation at G2/M phase after treatment with
DR. Sub G1 population remained unchanged even after 72 hr treatment indicating no
association with cell death, which was consistent with the cytostatic action of DR at the
dose used in the study. Subsequent flow cytometric analysis of co-staining with PI and
phosho-Histone H3 Ab as well immunoblotting showed that DR decreased the phospho-
Histone H3 level, indicating the G2 rather than M phase arrest by DR treatment.
5.4.1 Differentiation of G2 phase and M phase
Flow cytometric analysis using PI staining is a conventional method of cell cycle analysis
based on the quantitation of DNA content. However, cell cycle analysis of PI staining
alone is not able to separate between G2 and M phase as both phases have similar DNA
content (tetraploid). To delineate the cells at G2 phase from those at M phase, we used
phospho-Histone H3, which is a well-characterised M phase marker (Gurley et al. 1978).
It was reported that phosphorylation at Ser10 of Histone H3 by Aurora B is strictly
correlated with chromosome condensation during onset of both mitosis and meiosis
(Chen et al. 2017; Mellone et al. 2003; Sawicka et al. 2012). A mutation in the serine
residue of Histone H3 caused mitotic defects including chromosome segregation
(Mellone et al. 2003). Hence, phosphorylation of Histone H3 at Ser10 is indispensable in
M phase.
We reasoned that, if DR treated PCa cells were arrested at M phase, we would expect to
see an increase in phospho-Histone H3 positivity. If a decrease in phospho-Histone H3
157 positivity was observed, it would indicate a blockade of G2-M transition. Our
experimental results supported the latter. As Nocodazole alone treated PCa cells were
included as positive control and shown a marked increase in M phase, any increase in
PCa cells at the M phase following DR treatment would have been detected.
Immunoblotting with Ab against total and Ser10 phosphorylated form of Histone H3 was
another clear indication that DR treatment enriched the cells at G2 rather than M phase.
Since post-translational modification of Histone H3 such as acetylation, phosphorylation,
methylation can affect the accessibility of chromatin to transcription factors (Sawicka et
al. 2012), the reduction of phospho-Histone H3 by DR may prevent the transcriptions of
those genes essential to promote the mitosis.
5.4.2 Diversity of cell cycle arrests induced by HD and SB
A number of studies have reported the cell cycle arrest associated with HD and SB in
different cancer cells (Chen et al. 2012; Dai et al. 2008; Kim et al. 2007; Kuo et al. 2015;
Lee et al. 2004; Lin et al. 2012; Marconett et al. 2010; Wei et al. 2013). Most of the cell
cycle arrest caused by HD was related to G1 phase arrest, including either G0-G1 or G1-S
arrest (Chen et al. 2012; Kuo et al. 2015; Lin et al. 2012). The cell cycle arrests caused by
SB were more varied. G1 arrest induced by ethanol extract of SB in colon cancer cells
(Wei et al. 2013), and water extract in leukaemia cells (Kim et al. 2007) and smooth
muscle cells (Lee et al. 2004), were also reported. In PCa cells, a study with SB extract
showed the G2/M arrest in LNCaP and S phase arrest in PC-3 cells (Marconett et al.
2010). However, no study describing the effect of combination of these two herbal
medicines on cell cycle has been reported thus far. Therefore, our study has provided
evidence for the first time of DR on G2 phase cell cycle arrest. Moreover, efforts to
158 dissect G2 phase from M phase has not been made in the study of TCM, even though this approach has previously been used in the study with chemical compounds (Zhu et al.
2009) and drugs (Nomura et al. 2007).
In conclusion, DR induced accumulation of PCa cells at G2/M by flow cytometric analysis of PI-staining is likely due to arrest at G2. Hence, the mechanism of this DR action could be impeding the transition of PCa cells from G2 to M phase.
159
Chapter 6
160
6 Molecular Mechanism of
DR induced G2 arrest in PCa cells
161 6.1 Introduction
The mammalian cell cycle is highly regulated through different mechanisms to assure the
duplication of DNA with high fidelity and successful cell division (Otto et al. 2017). Two
distinct mechanisms are involved in cell cycle regulation. The first one involves proteins
such as Cyclins and CDKs, which promote the progression of cell cycle from one phase
to next in response to growth stimuli. The second regulatory mechanism involves cell
cycle checkpoint proteins such as INK4, Cip/Kip and checkpoint kinase family proteins.
They inhibit the activity of Cyclins-CDKs complexes upon genomic instability and anti-
mitogenic stimulation (Malumbres et al. 2001; Otto et al. 2017; Pietenpol et al. 2002).
Since checkpoint proteins regulate the rate of cell division, the activation of checkpoints
may cause either cell cycle arrest or cell death.
Described in chapter 3 and 4, our study revealed that the anti-proliferative activity of DR
involved enrichment of PCa cells at G2 phase. The mechanisms underlying DR-induced
G2 phase arrest can be a consequence of DNA damage-triggered activation of G2
checkpoint. Upon DNA damage, G2 checkpoint kinases CHK1 and CHK2 are activated
through ATM and ATR signalling pathway. That activation consequently inhibits the
activity of effector M phase promoting complex, Cyclin B1-CDK1 complex (DiPaola
2002). CHK1 can activate Wee1 through stimulatory phosphorylation, which in turn
inhibits the activity of Cyclin B1-CDK1 complex at G2-M transition (Do et al. 2013;
Pietenpol et al. 2002; Shaltiel et al. 2015). The activity of CDC25C is inhibited by CHK1
and CHK2 in response to DNA damage, leaving Cyclin B1-CDK1 complex inactive
(Shaltiel et al. 2015; Toyoshima‐Morimoto et al. 2002). Hence, an activating
162 phosphorylation of DNA damage transducers, CHK1 and CHK2, is a key manifestation of DNA damage-induced G2 phase arrest.
Progression from G2 to M phase requires the M phase promoting complex Cyclin B1-
CDK1, and the positive regulators PLK1 and Aurora A (Otto et al. 2017). During G2 phase, Aurora A activating phosphorylates PLK1 at Thr210. An active PLK1 is required to stimulate Cyclin B1-CDK1 complex and promote G2 to M phase progression, leading to centrosome maturation (Macurek et al. 2008). CDC25C is a phosphatase that can remove inhibitory phosphates from CDK1 resulting its activation. PLK1 stimulates CDC25C by phosphorylation at Ser198 and translocates it into the nucleus to activate the Cyclin B1-
CDK1 complex (Toyoshima‐Morimoto et al. 2002). PLK1 also inactivates Wee1
(Watanabe et al. 2004), which can add inhibitory phosphate to Cyclin B1-CDK1 at Tyr15
(Matheson et al. 2016). Studies have reported that PLK1 and Aurora A expressions are frequently elevated in cancer including prostate (Mosquera et al. 2013) and down- regulation of those proteins by respective inhibitors induce cell cycle arrest and apoptosis
(Görgün et al. 2010; Otto et al. 2017; Rudolph et al. 2009; Strebhardt 2010; Yan et al.
2016). Hence, the protein levels of Aurora A, PLK1 and Cyclin B1-CDK1 complex reflect the cellular readiness to progress to M phase.
The aim of the studies described in this chapter was to examine the mechanism by which
DR caused arrest of PCa cells at G2 phase leading to blockage of G2-M transition.
Specially, we determined firstly if DR caused DNA damage, and secondly if DR inhibited
M phase promoting complex and regulators. Lastly, we examined the clinical significance of M phase promoting complex and its regulators in PCa by analyzing the various datasets including R2 Genomic Analysis and Visualization Platform and cBiooportal for
Cancer Genomic.
163 6.2 Materials and Methods
6.2.1 Prostate cancer cell lines
The PCa cell lines LNCa and PC-3 cells were cultured as described in Chapter 3.1.1.
6.2.2 DR treatment
DR stock solution and various dose range of DR were prepared as described in
Chapter 3.2.1.
6.2.3 Radiation treatment
Radiation treated PCa cells were prepared as described in Chapter 3.2.3.
6.2.4 Immunofluorescence
Immunolabelling of phospho-H2AX and 53BP1 in PCa cells were prepared as
described in Chapter 3.7.
6.2.5 Immunoblotting
The cells were treated in T25 flasks and immunoblotting was performed as described
in Chapter 3.8. The primary antibodies used are listed in Table 3-2.
164 6.2.6 RT-PCR
RT-PCR was performed as described in Chapter 3.9. All the primer sequences used
for RT-PCR in this study are listed in Table 3-4.
6.2.7 Database analysis
The statistical difference in mRNA levels of Cyclin B1, CDK1, PLK1 or Aurora A
between benign prostatic hyperplasia (BPH) and PCa, or between primary and
metastatic PCa were analysed using the Dutch based online tool R2: Genomics
Analysis and Visualization Platform. The prostate data set used for analysis was
Sawyers–370. All data were log-transformed provided by dataset.
The genomic alterations of four genes associated with PCa were determined using
datasets from cBioportal for Cancer Genomics. The data of genomic alterations in
Cyclin B1, CDK1, PLK1 and Aurora A genes were analysed across 13 studies, over
2700 specimens of PCa.
6.2.8 Statistical analysis
The statistical software NCSS version 12.0 was used for statistical analysis as
described in Chapter 3.12. Comparison between BPH and cancer, or primary and
metastasis from R2: Sawyers-370 dataset were performed using one-way ANOVA.
The correlations between each mRNA levels of gene of interest and Ki-67 were
analysed using one-way ANOVA.
165 6.3 Results
6.3.1 DR solicited no DNA damage in PCa cells
6.3.1.1 DR did not initiate phospho-H2AX and 53BP1 foci by immunofluorescence
As a delay in G2-M transition is often associated with DNA damage, we questioned
whether DR could cause DNA damage in the treated cells. The PCa cells treated with DR
were analysed for DNA damage based on phospho-H2AX and p53-binding protein 1
(53BP1) foci. In parallel, the cancer cells treated with IR (2 Gy) were included as positive
control.
Immunofluorescence imaging showed that phospho-H2AX and 53BP1 foci were induced
in PCa cells treated with IR at 2 Gy. But DR did not initiate phospho-H2AX and 53BP1
foci in comparison with irradiated cells (Figure 6.1, 6.2, 6.3, 6.4 and 6.5).
166 LNCaP DAPI phospho-H2AX Merge
0mg/mL
0.25mg/mL
0.5mg/mL
0.75mg/mL
Radiation
Figure 6.1 DR did not increase the phospho-H2AX in LNCaP cells by immunofluorescence. LNCaP cells were treated with IR (2Gy) for positive control and harvested 3 hr after treatment. DR was introduced to LNCaP cells for 72 hr, and harvested to fix with 10% formalin in PBS. Samples were embedded in paraffin block and 5 μm thickness slices were cut to perform immunostaining, using the Ab against phospho-H2AX. DAPI was used for nuclear stain. Representative images of LNCaP cells were shown. Columns (left to right), nucleus (blue), phospho-H2AX (green), and merge. Arrows indicated phospho-H2AX foci.
167 PC-3 DAPI phospho-H2AX Merge
0mg/mL
0.25mg/mL
0.5mg/mL
0.75mg/mL
1 mg/mL
Radiation
Figure 6.2 DR did not increase the phospho-H2AX in PC-3 cells by immunofluorescence. PC-3 cells were treated with IR (2Gy) for positive control and harvested 3 hr after treatment. DR was introduced to PC-3 cells for 72 hr, and harvested to fix with 10% formalin in PBS. Samples were embedded in paraffin block and 5 μm thickness slices were cut to perform immunostaining, using the Ab against phospho- H2AX. DAPI was used for nuclear stain. Representative images of PC-3 cells were shown. Columns (left to right), nucleus (blue), phospho-H2AX (green), and merge. Arrows indicated phospho-H2AX foci.
168 LNCaP DAPI 53BP1 Merge
0 mg/mL
0.25 mg/mL
0.5 mg/mL
0.75 mg/mL
Radiation
Figure 6.3 DR did not increase the 53BP1 in LNCaP cells by immunofluorescence. LNCaP cells were treated with IR (2Gy) for positive control and harvested 3 hr after treatment. DR was introduced to LNCaP cells for 72 hr, and harvested to fix with 10% formalin in PBS. Samples were embedded in paraffin block and 5 μm thickness slices were cut to perform immunostaining, using the Ab against 53BP1. DAPI was used for nuclear stain. Columns (left to right), nucleus (blue), 53BP1 (red), and merge. Representative images were shown. Arrows indicated 53BP1 foci.
169 PC-3 DAPI 53BP1 Merge
0mg/mL
0.25mg/mL
0.5mg/mL
0.75mg/mL
1 mg/mL
Radiation
Figure 6.4 DR did not increase the 53BP1 in PC-3 cells by immunofluorescence. PC- 3 cells were treated with IR (2Gy) for positive control and harvested 3 hr after treatment. DR was introduced to PC-3 cells for 72 hr, and harvested to fix with 10% formalin in PBS. Samples were embedded in paraffin block and 5 μm thickness slices were cut to perform immunostaining, using the Ab against 53BP1. DAPI was used for nuclear stain. Representative images were also shown. Columns (left to right), nucleus (blue), 53BP1 (red), and merge. Arrows indicated 53BP1 foci.
170 phospho-H2AX (LNCaP) phospho-H2AX ( PC-3)
* s 10 s 10 u u e e l l c c u * u n n
r r e e p p
i 5 i 5 c c o o f f
f f o o
r r e e b b m 0 m 0 u u N 0 0.25 0.5 0.75 Radiation N 0 0.25 0.5 0.75 1 Radiation DR (mg/mL) DR (mg/mL)
Treatment Treatment
s 53BP1 ( LNCaP ) 53BP1 (PC-3)
u 10 s 10 e u
l * e c
* l u c n u
n r
e r p e
i p
c 5 i 5 o c f
o f f
o f
o s
r s e r b e b m 0 0 u m u N 0 0.25 0.5 0.75 Radiation 0 0.25 0.5 0.75 1 Radiation N DR (mg/mL) DR (mg/mL) Treatment Treatment
Figure 6.5 Quantification of phospho-H2AX and 53BP1 immunofluorescence staining in PCa cells. Immunofluorescence results from triplicates were quantified and plotted as the average number of number of foci per nucleus ± SD. * represents statistically significant compared to 0 p<0.05.
Hence, no distinct foci of phospho-H2AX and 53BP1 were found in DR treated PCa cells
in comparison to radiation treated cells (Figure 6.1 - 6.5).
6.3.1.2 DR had no effect on DNA damage response transducer proteins by immunoblotting.
To confirm that DR did not initiate DNA damage response in the treated cells, the major
components or transducers of DNA damage response including total and phosphorylated
ATR, ATM, CHK1 and CHK2 were examined by immunoblotting. PCa cells were treated
with DR for 72 hr, and at the same time the same batch of PCa cells were treated with IR
(2 Gy) as positive control.
171 Consistent with the findings of phospho-H2AX and 53BP1, DR treatment did not result in detectable changes in either phosphorylated or total protein kinase level in LNCaP cells
(Figure 6.6 and 6.7). In contrast, irradiation led to increased levels of phosphorylated
ATM, ATR and CHK2 without an obvious change in total protein levels (Figure 6.6 and
6.7). The radiation did not elicit an obvious alteration in total and phosphorylated CHK1.
172 LNCaP
DR (mg/mL) Radiation 0 0.25 0.5 0.75 Control 1hr 2hr 3hr ATM
phospho-ATM
CHK2
Phospho-CHK2
ATR
phospho-ATR
CHK1
phospho-CHK1
α-Tubulin
Figure 6.6 DR did not increase DNA damage response proteins in LNCaP cells by immunoblotting. DR was introduced to LNCaP cells for 72 hr, and harvested for immunoblotting. The same batch of LNCaP cells were also treated with IR (2Gy) and harvested 1 hr, 2 hr and 3 hr after treatment. IR treated cells were used as positive control for activation of DNA of damage response. The immunoblot images were representative of three independent experiments. α-Tubulin served as a loading control.
173
Figure 6.7 Quantification of immunoblotting in DNA damage response proteins in LNCaP cells. Immunoblotting results from triplicates were normalized by respective loading control. Histograms were plotted from the average density from three independent experiments ± SD. * represents statistically significant compared to 0 and No IR p<0.05.
174 In PC-3 cells, consistent with aforementioned results of phospho-H2AX and 53BP1,
there were no significant changes in the DNA damage response transducer kinases
after DR treatment (Figure 6.8 and 6.9). Irradiation increased both total and
phosphorylated form of ATM, ATR and CHK2 in PC-3 cells, (Figure 6.8 and 6.9),
while no significant change was observed in both total and phospho-CHK1.
Figure 6.8 DR did not increase DNA damage response proteins in PC-3 cells by immunoblotting. DR was introduced to PC-3 cells for 72 hr, and harvested for immunoblotting. The same batch of PC-3 cells were also treated with IR (2Gy) and harvested 1 hr, 2 hr and 3 hr after treatment. IR treated cells were used as positive control for activation of DNA of damage response. The immunoblot images were representative of three independent experiments. GAPDH served as a loading control.
175
Figure 6.9 Quantification of immunoblotting in DNA damage response proteins in PC-3 cells. Immunoblotting resulted from triplicates were normalized by respective loading control. Histograms were plotted from the average density from three independent experiments ± SD. * represents statistically significant compared to 0 and No IR p<0.05.
176 Comparing to vehicle control and radiation-treated PCa cells, immunoblotting showed no
significant increase in ATM, ATR, CHK1 and CHK2 protein levels after DR treatment
(Figure 6.6-6.9).
6.3.2 DR impaired the expression of mitosis promoting complex
and regulators in PCa cells
6.3.2.1 DR reduced the protein levels of M phase promoting complex and
regulators governing G2-M transition
Following exclusion of the possibility that DR-impeding G2-M transition was due to
DNA damage-triggered G2 arrest, we examined the effect of DR on protein levels of
Cyclin B1, CDK1, PLK-1 and Aurora A kinase, as these proteins are required for
promoting G2-M transition. After treatment of PCa cell lines with DR for 72 hr, these
proteins were measured by immunoblotting.
Immunoblotting showed that DR reduced protein levels of all four proteins in PCa cells
(p<0.05). High dose of DR (at 0.75 mg/mL) decreased the protein levels of Cyclin B1,
CDK1 and PLK1 by approximately 60% and Aurora A by 75% in LNCaP cells (Figure
6.10.a - 6.11.a). A 60% reduction was found in inactive phosphorylated form of CDK1
(CDK1-Tyr15), following the DR treatment at high dose, although it was not statistically
significant.
177 In PC-3 cells, high dose (1 mg/mL) of DR reduced the protein levels of Cyclin B1 and
CDK1 by 50%, Aurora A by 60% and PLK1 by 75%, respectively (Figure 6.10.b-
6.11.b). There was no significant change in the level of phospho-CDK1 in PC-3 cells after DR treatment.
(a) LNCaP (b) PC-3
0 0.25 0.5 0.75 mg/mL 0 0.25 0.5 0.75 1 mg/mL
Cyclin B1 Cyclin B1
CDK1 CDK1
phospho- phospho- CDK1 CDK1
PLK1 PLK1
Aurora A Aurora A
GAPDH GAPDH
Figure 6.10 DR decreased the protein level of M phase promoting complex and regulators. PCa cells were cultured for 48 hr and treated with DR for 72 hr. Images presented were the representative of three independent experiments in (a) LNCaP and (b) PC-3 cells.
178
Figure 6.11 Quantification of immunoblotting in M phase promoting complex and regulators in PCa cells. Immunoblotting resulted from triplicates were normalized by respective loading control. Histograms were plotted from the average density from four independent experiments ± SD. * p<0.05 compared to 0 mg/mL. # p<0.05 compared to 0.25 mg/mL, @ p< 0.05 compared to 0.5 mg/mL, α p<0.05 compared to 0.75 mg/mL.
179 Following the confirmation of DR did not cause DNA damage, immunoblotting of M
phase promoting complex and regulators showed that DR reduced all four proteins in PCa
cells.
6.3.2.2 Establish RT-PCR analysis of M phase promoting complex and regulators
To determine the mRNA level of M phase promoting complex and regulators in DR
treated PCa cells, we firstly established RT-PCR analysis. A serial dilution of cDNA
reversed transcribed from total RNA extracted from PCa cells was employed to check the
amplification efficiency of housekeeper gene, 36B4 and genes of interest, Cyclin B1,
CDK1, PLK1 and Aurora A by RT-PCR. We also analysed the melting curves of all five
genes to determine the specificity of the amplified PCR products. Here, we presented the
data from housekeeper 36B4 and CDK1 as the representative gene of interest.
In control LNCaP cells, the threshold cycle (CT) values reflected by 36B4 amplicon at
1/3, 1/9, 1/27 and 1/81 dilutions of cDNA were 14.2, 15.9, 17.5 and 19.3, respectively.
The average difference of CT values between every three-fold dilution was 1.7 (Figure
6.12.a and b). In DR (0.5 mg/mL) treated LNCaP cells, the CT values of 36B4 at 1/3, 1/9,
1/27 and 1/81 dilutions were 12.4, 14.2, 15.7 and 17.4, respectively and the average
difference of CT values between every three fold dilution was 1.6 (Figure 6.12.a and b).
The amplification efficiencies calculated in control and DR treated cells were 96% and
100%, respectively (Figure 6.12.b). Both control and DR treated LNCaP cells showed a
single peak of 36B4 at 86°C in the melting curve analysis (Figure 6.12.c).
180 The CT values of CDK1 gene in control at 1/3, 1/9, 1/27 and 1/81 dilutions of cDNA were
18.9, 20.4, 22.3 and 24.3, respectively and the average difference was 1.8 (Figure 6.13.a and b). The CT values of CDK1 cDNA dilutions in DR treated cells were 19, 20.3, 22 and
23.6, respectively, and the average difference was 1.6 (Figure 6.13.a and b). The amplification efficiencies of CDK1 gene calculated in both control and DR treated
LNCaP cells were 83% and 100% respectively (Figure 6.13.b). A single peak at 81°C was found in the melting curve analysis of both control and DR treated LNCaP cells (Figure
6.13.c).
181
Figure 6.12 DR had no effect on the amplification efficiency of 36B4 by RT-PCR in LNCaP cells. Cells were treated with either vehicle control or 0.5 mg/mL of DR for 72 hr. A serial dilution of a cDNA template extracted from LNCaP cells was run using primers of 36B4 and results were generated as a dilution curve. (a) The amplification plots of 36B4. (b) The dilution curves were plotted using the log of dilution factor against the threshold cycle (CT) value obtained from amplification of each dilution. The equation of linear regression line along with r and R2 were also evaluated to examine the linearity of data and amplification efficiency of RT-PCR. (c) A melt-curve analysis in each of the genes was also performed to identify the various products of polymerase chain reaction.
182
Figure 6.13 DR had no effect on the amplification efficiency of CDK1 by RT-PCR in LNCaP cells. Cells were treated with either vehicle control or 0.5 mg/mL of DR for 72 hr. A serial dilution of a cDNA template extracted from LNCaP cells was run using primers of CDK1 and results were generated as a dilution curve. (a) The amplification plots of CDK1. (b) The dilution curves were plotted using the log of dilution factor against the threshold cycle (CT) value obtained from amplification of each dilution. The equation of linear regression line along with r and R2 were also evaluated to examine the linearity of data and amplification efficiency of RT-PCR. (c) A melt-curve analysis in each of the genes was also performed to identify the various products of polymerase chain reaction.
.
183 In PC-3 cells, CT values of 36B4 in control at 1/3, 1/9, 1/27 and 1/81 dilutions were 11.2,
12.7, 14.1 and 15.8, respectively. The average difference of CT values between every three fold dilution was 1.6 (Figure 6.14.a and b). The CT values of 36B4 in DR treated
PC-3 cells at 1/3, 1/9, 1/27 and 1/81 dilutions were 12.3, 14.5, 16.4 and 17.7, respectively and the average difference of CT values from serial dilution was 1.8 (Figure 6.14.a and b).
There was a moderate difference in amplification efficiencies between control and DR treated cells with 100% and 88%, respectively (Figure 6.14.b). A single peak at 86°C was observed in both control and DR treated PC-3 cells in the melting curve analysis (Figure
6.14.c).
The CT values of CDK1 gene in control at 1/3, 1/9, 1/27 and 1/81 dilutions of cDNA were
15.5, 17, 18.5 and 20.29, respectively and the average difference was 1.6 (Figure 6.15.a and b). The CT values of CDK1 cDNA dilutions in DR treated cells were 16, 17.5, 19.1 and 20.8, respectively, and the average difference was 1.6 (Figure 6.15.a and b). The calculated amplification efficiency of CDK1 gene in both control and DR treated PC-3 cells was 100% (Figure 6.15.b). Both control and DR treated cells illustrated a single peak at 80°C in the melting curve analysis (Figure 6.15.c).
184
Figure 6.14 DR had no effect on the amplification efficiency of 36B4 by RT-PCR in PC-3 cells. Cells were treated with either vehicle control or 0.5 mg/mL of DR for 72 hr. A serial dilution of a cDNA template extracted from PC-3 cells was run using primers of 36B4 and results were generated as a dilution curve. (a) The amplification plots of 36B4. (b) The dilution curves were plotted using the log of dilution factor against the threshold cycle (CT) value obtained from amplification of each dilution. The equation of linear regression line along with r and R2 were also evaluated to examine the linearity of data and amplification efficiency of RT-PCR. (c) A melt-curve analysis in each of the genes was also performed to identify the various products of polymerase chain reaction.
185
Figure 6.15 DR had no effect on the amplification efficiency of CDK1 by RT-PCR in PC-3 cells. Cells were treated with either vehicle control or 0.5 mg/mL of DR for 72 hr. A serial dilution of a cDNA template extracted from PC-3 cells was run using primers of CDK1 and results were generated as a dilution curve. (a) The amplification plots of CDK1. (b) The dilution curves were plotted using the log of dilution factor against the threshold cycle (CT) value obtained from amplification of each dilution. The equation of linear regression line along with r and R2 were also evaluated to examine the linearity of data and amplification efficiency of RT-PCR. (c) A melt-curve analysis in each of the genes was also performed to identify the various products of polymerase chain reaction.
186 Together, amplification plot and dilution curve of 36B4 and CDK1 showed that treatment
with DR did not affect the amplification efficiency of cDNA associated with those genes
by RT-PCR. Melting curve analysis also revealed that primers of those genes were
specific.
6.3.2.3 DR reduced the mRNA level of M phase promoting complex and regulators
After validating the RT-PCR, we performed RT-PCR to examine the mRNA level of
Cyclin B1, CDK1, PLK1 and Aurora A in DR treated PCa cells. At 0.5 and 0.75 mg/mL,
DR significantly reduced (p<0.05) the mRNA levels of all four genes in LNCaP cells
(Figure 6.16.a). Considering the vehicle control as 100%, the mRNA levels of Cyclin B1,
CDK1, PLK1 and Aurora A at 0.5 mg/mL were reduced by 50%, 67%, 65% and 67%,
respectively. Further reduction was found in mRNA level of four genes at 0.75 mg/mL by
60%, 72%, 77% and 73%, respectively.
In PC-3 cells, DR dose range (0.5-1 mg/mL) significantly decreased (p<0.05) mRNA
levels of all four genes of interest (Figure 6.16.b). The reductions in mRNA levels of
four genes at 0.5 mg/mL were 83%, 76%, 89% and 81%, respectively. At 0.75 mg/mL,
the mRNA levels of four genes were reduced by 83%, 82%, 90% and 78%, respectively.
1 mg/mL of DR further decreased the mRNA levels of all four genes by 89%, 86%, 93%
and 85%, respectively.
187 140% (a) LNCaP
120% l e v e l 100% n o i
s * * * * * * * * * s
e 80% r # # # # # # # # p 0 mg/mL x e 60% e 0.25 mg/mL v i t a l 0.5 mg/mL
e 40% R 0.75 mg/mL 20%
0% Cyclin B1 CDK1 PLK1 Aurora A Gene of interest
140% (a) PC-3
l 120% e v e l
n 100%
o * i s s
e 80% r 0 mg/mL p x e 60% 0.25 mg/mL e * * * * v
i * * * * * * * * t
a 0.5 mg/mL l 40% # # # # e
R 0.75 mg/mL 20% 1 mg/mL 0% Cyclin B1 CDK1 PLK1 Aurora A
Gene of interest
Figure 6.16 DR decreased the mRNA levels of Cyclin B1, CDK1, PLK1 and Aurora A. PCa cells were cultured for 48 hr and treated with DR for 72 hr. Cells were washed with pre cold PBS and lysate buffer was added into the samples. Total RNA content were extracted and samples was analysed by RT-PCR. HK, housekeeping protein 36B4 was used as loading control. The results are representative of three experiments. * p<0.05 compared to 0 mg/mL. # p<0.05 compared to 0.25 mg/mL.
188 Taken together, RT-PCR of PCa cells showed that DR decreased the mRNA levels of
all four proteins.
6.3.3 mRNA levels of Cyclin B1, CDK1, PLK1 and Aurora A were
increased in human PCa tissue and correlated with disease
progression.
6.3.3.1 mRNA levels of Cyclin B1, CDK1, PLK1 and Aurora A were increased in PCa
To determine whether M phase promoting complex and regulators are associated with
PCa, mRNA levels of each gene were analysed using R2 microarray analysis and
visualization platform. Analysis of Sawyers–370 dataset showed that mRNA levels of
Cyclin B1, CDK1, PLK1 and Aurora A in PCa (N=300) were significantly higher
(p<0.05) than that in BPH (N=58) (Figure 6.17).
189
Figure 6.17 mRNA levels of M phase promoting complex and regulators in BPH and cancer tissue of prostate. mRNA levels of M phase promoting complex and regulators were plotted for BPH (n=58) and PCa (n=300) tissues from prostate dataset of Sawyers– 370, using R2 microarray analysis and visualization platform. p values of statistical difference between BPH and PCa were described.
6.3.3.2 mRNA levels of Cyclin B1, CDK1, PLK1 and Aurora A were increased in metastatic PCa tissues
Next, to examine the correlation between four proteins of interest and cancer progression,
the mRNA levels of each gene were investigated in Sawyers-370 dataset from R2
database. Analysis on Sawyers-370 dataset revealed that the each mRNA levels were
190 significantly higher (p<0.01) in metastasis (n=38) than in primary PCa tumour (262)
(Figure 6.18).
Figure 6.18 mRNA levels of M phase promoting complex and regulators in metastasis and primary tumour. mRNA levels of M phase promoting complex and regulators were plotted for Metastasis (38) and Primary tumour (262) from prostate dataset of Sawyers–370 of R2 microarray analysis and visualization platform. p values of statistically difference between metastasis and primary tumour were described.
191 6.3.3.3 mRNA levels of Cyclin B1, CDK1, PLK1 and Aurora A were correlated with Ki-67 expression level
To determine whether Cyclin B1, CDK1, PLK1 and Aurora A expressions are associated
with proliferative marker Ki-67, the correlation between the mRNA levels of four genes
of interest and Ki-67 was analysed using Sawyers–370 dataset (n=370) of R2 microarray
analysis and visualization platform. The mRNA levels of all four genes were positively
correlated (p<0.01) with Ki-67 (Figure 6.19).
Figure 6.19 M phase promoting complex and regulators were correlated with proliferative marker Ki-67 in PCa tissues. mRNA levels of M phase promoting complex and regulators and Ki-67 were plotted from prostate dataset of Sawyers–370 of R2 microarray analysis and visualization platform (n=370). r values and p values are described.
192 6.3.3.4 Genomic alterations of Cyclin B1, CDK1, PLK1 and Aurora A in PCa tissues
To investigate the association between genomic alterations in PCa, 13 different datasets
from over 27,00 patients on cBioportal database were analysed to visualise the
multidimensional cancer genomics data. The summary data of gene alterations such as
mutation, deletion, amplification and multiple alterations in Cyclin B1, CDK1, PLK1 and
Aurora A genes were presented in figure 6.19 and the quantitative analysis of gene
alterations from each of the study were shown in Table 6-1 to 6-4 (Cerami et al. 2012;
Gao et al. 2013).
The most common genomic alteration of Cyclin B1 in PCa was deletion and it was found
in 6 of 13 datasets with the highest of 13% and lowest of 0.9% (Table 6-1 and Figure
6.20). Amplification was found in 5 of 13 datasets with the highest of 7.5% and the
lowest of 0.2%. Only one dataset showed the mutation of Cyclin B1 gene in PCa with
0.7%.
Table 6-1 Alteration summary for Cyclin B1 gene in 13 PCa datasets.
% of % of Multiple Source No of cases % of Mutation % of Deletion Amplification Alterations 1 Prostate MSKCC 2010 216 - - - - 2 Prostate Organoids 12 - - - - 3 Prostate MSKCC 2014 104 - - - - 4 Prad_mskcc_2017 504 - - - - 5 Prostate (Broad/Cornell 2012) 112 - - - - 6 PRAD Hallmarks (CPCG-GENE, 2017) 477 - - - - 7 Prostate (SU2C) 150 0.7% - 0.7% - 8 Prostate (Broad/Cornell 2013) 56 - 3.6% - - 9 Prostate (TCGA) 492 - 5.9% 0.2% - 10 Prostate (TCGA 2015) 333 - 6.0% 0.3% - 11 NEPC (Trento/Cornell/Broad 2016) 107 - 0.9% 7.5% - 12 Prostate (FHCRC, 2016) 136 - 8.8% 0.7% - 13 Prostate (MICH) 61 - 13.1% - -
193 Amplification was the most common gene alteration of CDK1 and it was found in 8 of 13
datasets with the highest of 15% and lowest of 0.4% (Table 6-2 and Figure 6.20).
Deletion and mutation of CDK1 gene were observed in 2 and 3 datasets of PCa and the
highest percentage was 0.9% and the lowest were 0.8% and 0.2%, respectively.
Table 6-2 Alteration summary for CDK1 gene in 13 PCa datasets.
% of % of Multiple Source No of cases % of Mutation % of Deletion Amplification Alterations 1 Prostate MSKCC 2010 103 - - 1.0% - 2 Prostate Organoids 12 - - - - 3 Prostate MSKCC 2014 104 - - - - 4 Prad_mskcc_2017 504 - - - - 5 Prostate (Broad/Cornell 2012) 112 - - - - 6 PRAD Hallmarks (CPCG-GENE, 2017) 477 - - - - 7 Prostate (SU2C) 150 0.7% - 10.0% - 8 Prostate (Broad/Cornell 2013) 56 - - 1.8% - 9 Prostate (TCGA) 492 0.2% 0.8% 0.4% - 10 Prostate (TCGA 2015) 333 - 0.9% 0.6% - 11 NEPC (Trento/Cornell/Broad 2016) 107 0.9% - 15.0% - 12 Prostate (FHCRC, 2016) 136 - - 3.7% - 13 Prostate (MICH) 61 - - 4.9% -
The most common alteration in PLK1 gene was amplification and it was found in 5 of 13
datasets with the highest of 14% and the lowest of 0.6% (Table 6-3 and Figure 6.20).
Deletion and mutation of PLK1 gene were found in 3 of 13 datasets with the highest of
2% and 1.5%, respectively and the lowest of 0.2%.
Table 6-3 Alteration summary for PLK1 gene in 13 PCa datasets.
% of % of Multiple Source No of cases % of Mutation % of Deletion Amplification Alterations 1 Prostate MSKCC 2010 216 - - - - 2 Prostate Organoids 12 - - - - 3 Prostate MSKCC 2014 104 - - - - 4 Prad_mskcc_2017 504 - - - - 5 Prostate (Broad/Cornell 2012) 112 - - - - 6 PRAD Hallmarks (CPCG-GENE, 2017) 477 - - - - 7 Prostate (SU2C) 150 2.0% - - - 8 Prostate (Broad/Cornell 2013) 56 - - - - 9 Prostate (TCGA) 492 0.2% 0.2% 0.6% - 10 Prostate (TCGA 2015) 333 0.3% 0.3% 0.9% - 11 NEPC (Trento/Cornell/Broad 2016) 107 - - 14.0% - 12 Prostate (FHCRC, 2016) 136 - 1.5% 2.9% - 13 Prostate (MICH) 61 - - 1.6% -
194 Amplification was most common alteration of Aurora A gene and 7 of 13 studies reported
in PCa with the highest of 25% and the lowest of 0.4% (Table 6-4 and Figure 6.20).
Mutation of Aurora A was found in 5 of 13 datasets with the highest of 2% and the lowest
of 0.2%. Deletion of Aurora A gene was shown in 1 of 13 datasets with 0.6%.
Table 6-4 Alteration summary for Aurora A gene in 13 PCa datasets.
% of % of Multiple Source No of cases % of Mutation % of Deletion Amplification Alterations 1 Prostate MSKCC 2010 216 - - - - 2 Prostate Organoids 12 - - - - 3 Prostate MSKCC 2014 104 - - - - 4 Prad_mskcc_2017 501 0.2% - 0.4% - 5 Prostate (Broad/Cornell 2012) 109 0.9% - - - 6 PRAD Hallmarks (CPCG-GENE, 2017) 449 0.2% - - - 7 Prostate (SU2C) 150 2.0% - 3.3% - 8 Prostate (Broad/Cornell 2013) 56 - - - - 9 Prostate (TCGA) 492 - - 0.6% - 10 Prostate (TCGA 2015) 333 - 0.6% 1.2% - 11 NEPC (Trento/Cornell/Broad 2016) 107 1.9% - 25.2% - 12 Prostate (FHCRC, 2016) 136 - - 0.7% - 13 Prostate (MICH) 61 - - 1.6% -
In summary, searching cBioPortal across 13 PCa datasets, we found a deletion in Cyclin
B1 gene and amplification of CDK1, PLK1 and Aurora A genes in PCa suggesting their
association with PCa.
195
Figure 6.20 Gene alterations of Cyclin B1, CDK1, PLK1 and Aurora A associated with PCa. Using cBioportal genomic database, gene alterations of were analysed across 13 datasets. CAN is defined as copy number alteration.
196 6.4 Discussion
After confirming the G2 arrest caused by DR, we questioned what is the mechanism
causing G2 arrest in DR treated PCa cells. The G2 checkpoint can be activated due to
DNA damage, thereby inhibits the activity of effector proteins Cyclin B1-CDK1 complex
through DNA damage signalling transducer kinases such as ATM, ATR, CHK1 and
CHK2 (DiPaola 2002). Indeed, the DNA damaging agent could arrest G2 checkpoint by
activating the damage signalling pathway (Hirose et al. 2001; Jackson et al. 2000).
However, using immunofluorescence, we found neither significant increase in phospho-
H2AX and 53BP1 foci nor activation of DNA damage transducer kinases in DR treated
PCa cells. But, interestingly, the downstream effector protein Cyclin B1-CDK1 complex,
which is responsible for the transition of G2 to M phase and activators PLK1 and Aurora
A were clearly reduced at protein level following DR treatment in both PCa cell lines.
Our well-optimised RT-PCR also showed that DR reduced mRNA levels of all four
genes.
When we searched for the clinical relevance of M phase promoting complex and the two
regulators using R2 genomic analysis and visualizing platform, we found that the mRNA
levels of all four were higher in PCa compared to BPH. Also, the mRNA levels of M
phase promoting complex and regulators were higher in metastasis than primary tumour.
Moreover, increased mRNA levels were highly correlated with increased Ki-67
expression level. Using cBioportal genomic database, we found a deletion of Cyclin B1
and amplifications of CDK1, PLK1 and Aurora A genes across 13 datasets.
197 6.4.1 Cytostatic dose of DR caused no DNA damage
DNA damage repair can be activated by double strand breaks induced by irradiation
(Jackson et al. 2009). Therefore, by including the radiation-treated cells as positive
control, we could verify that our system is able to detect DNA damage if it is present.
Immunofluorescence based assays are sensitive and reliable in visualization of distinct
nuclear foci formed by H2AX phosphorylation and 53BP1 upon DNA damage (Mah et al.
2010; Panier et al. 2014). The conventional methods based on DNA fragmentation by
constant field gel electrophoresis or pulsed field gel and comet assay can only detect
larger doses of IR. But, immunofluorescence of phospho-H2AX and 53BP1 can detect a
range from low to high dose of radiation consistent with clinical use (Taneja et al. 2004).
In addition, immunofluorescence detection of phospho-H2AX and 53BP1 foci can locate
the DNA damage site with intact cell morphology and does not need lysing the cells in
contrast to DNA fragmentation based assays (Yu et al. 2006).
Phospho-H2AX is an important initiator for DNA repair and its deficiency would lead to
chromosomal instability and apoptosis due to a lack of activation of G2/M checkpoint and
G2/M arrest (Mah et al. 2010). 53BP1, which is the binding partner of p53, is the mediator
and effector of DNA double strand break response and play multiple roles in DNA
damage signalling (Panier et al. 2014). In our study, radiation-treated PCa cells clearly
exhibited phsopho-H2AX and 53BP1 foci formation. Yet, there was no clear increase of
both foci in DR treated cells compared with vehicle control.
In eukaryotes, ATM induced stimulatory phosphorylation of H2AX at Ser134 (γ-H2AX)
and formation of phospho-H2AX foci along the DNA damage site initiate DNA repair
mechanism (Mah et al. 2010; Markova et al. 2007). The recruitment of 53BP1 protein to
198 DNA damage site and rapid formation of 53BP1 foci is also induced by ATM or ATR
mediated DNA damage response (Daley et al. 2014). Hence, as aforementioned in chapter
1, ATM, ATR, CHK1 and CHK2 are main transducers of DNA damage signalling
pathway. Consistently, immunoblotting of ATM and ATR in radiation treated PCa cells
showed an increase in the phosphorylated form of both ATM and ATR, which
represented their activation induced by radiation. Moreover, CHK2, a DNA damage
transducer and checkpoint protein, was notably phosphorylated in PCa cells by radiation.
By comparison with activated DNA damage repair mediators and transducer proteins in
radiation-treated PCa cells, it is clear that there was no sign of DNA damage transducers
activation in the DR treated PCa cells, although more replicates could have used for the
immunblotting of DNA damage checkpoint proteins as the error bars in quantification
were relatively high.
Very limited information was available on DNA damage induced by HD and SB. Kho’s
group reported that ethanol extract of HD alone induced DNA damage and cell death
using comet assay in human leukemia cells (Kuo et al. 2015). Our study showed no
association between the cytostatic action of DR and DNA damage in PCa cells.
6.4.2 Enrichment of PCa cells at G2 phase is associated with
impairment in M phase promoting complex and regulators
The biological pathways involved in G2 checkpoint are the signalling cascades that inhibit
the activation of CDK1. Several G2 checkpoint proteins such as CHK1 and CHK2 are
upstream negative regulators of CDK1 and main transducers of DNA damage response.
The activation of CHK1 and CHK2 could increase Tyr15 phosphorylated form of CDK1
through enhancing the activity of Wee1 and inhibiting the activity of CDC25C (Ahn et al.
199 2004; Shaltiel et al. 2015). In our study, we have found a reduction of the effectors Cyclin
B1 and CDK1 by DR without activation of DNA damage response transducers proteins,
CHK1 and CHK2. Immunoblotting revealed that DR reduced both total and phosphorylated form of CDK1 in LNCaP cells. While a decrease in total CDK1 was noted in PC-3, the change in phospho-CDK1 was not obvious. This observation suggests that a reduction of CDK1 caused by DR is independent from transducer proteins of DNA damaging signalling pathway.
PLK1 and Aurora A are positive regulators of Cyclin B1-CDK1 complex (DiPaola 2002;
Otto et al. 2017). The phosphorylation on Cyclin B1 by PLK1 leads to nuclear localisation of Cyclin B1-CDK1 complex to promote G2-M transition (Strebhardt 2010;
Toyoshima-Morimoti et al. 2001). PLK1 not only activates but also localizes the
CDC25C, whose function in de-phosphorylation of inhibitory phosphate on Try15 of
CDK1 resulting in CDK1 activation thus promoting cells progressing from G2 phase to M phase (Toyoshima‐Morimoto et al. 2002). Aurora A can phosphorylate and activate the
PLK1. Our study showed a substantial reduction of Cyclin B1, CDK1, PLK1 and Aurora
A by DR, suggesting the impairment of these four proteins is most likely responsible for activating the G2 checkpoint and blocking the G2 to M transition. This is an interesting finding as it indicates that impairment of M phase promoting complex and two regulators can trigger G2 arrest in PCa cells without involving upstream DNA damage transducer proteins.
This observation is consistent with the previous finding where BZL101, a phytochemical extract from SB was found to arrest LNCaP cells in the G2/M phase by ablating the expression of Cyclin B1 and CDK1 (Marconett et al. 2010). Early studies on flavoprotein inhibitor in liver cancer and breast cancer cells showed G2 arrest with impairment in
200 Cyclin B1 (Scaife 2004). Studies have also reported that down regulation of Cyclin B1
and CDK1 by anti-cancer drugs induce G2/M arrest (Lohberger et al. 2015; Shi et al.
2017). Interestingly, one study on the effect of Menthol in PC-3 cells reported G2/M
phase arrest associated with reduction of PLK1 and CDC25C, together with defect in
nuclear localisation of both proteins (Kim et al. 2012). Similarly, the association between
the loss of Aurora A and G2/M phase arrest has been documented in human small cell
lung cancer cells (Lu et al. 2014). Together, these information suggested that G2 phase
cell cycle arrest induced by DR was mainly due to down regulation of Cyclin B1, CDK1,
PLK1 and Aurora A.
6.4.3 Clinical relevance of M phase promoting complex and
regulators
Following the observation that the impairment in transition of PCa cells from G2 phase to
M phase by DR was likely due to reduction in M phase promoting complex and
regulators, we wanted to establish the clinical relevance of those proteins. When we
searched for the mRNA expression of four proteins using R2 database, we found that the
mRNA levels of all four were strongly correlated with disease status and tumour types
suggesting the importance of those proteins for disease progression. In addition, mRNA
levels of M phase promoting complex and regulators were correlated significantly with
Ki-67 mRNA levels. As we discussed in chapter 1, Ki-67 expression level is associated
with tumour grade and therefore our analysis also supported the notion that Cyclin B1,
CDK1, PLK1 and Aurora A are associated with disease status and progression.
Reduction of those proteins by DR treatment may have a high inhibitory effect on PCa
progression. Emerging evidence also supported that PLK1 and Aurora A can be
201 prognostic markers for various types of cancer and therefore, natural or synthetic inhibitors targeting those proteins could be clinically significant (Otto et al. 2017;
Strebhardt et al. 2006; Yan et al. 2016).
By studying the genomic alterations of M phase promoting complex and regulators on cBioportal across 13 different datasets, we also found amplifications in CDK1, PLK1 and
Aurora A genes in PCa. It may also be suggested that amplification of those three genes could be the reason for the increase in mRNA expressions of CDK1, PLK1 and Aurora A in PCa. Mutation and deletion of those three genes were also found in PCa. But the deletion mainly occurred in Cyclin B1 gene in PCa. Considering Cyclin B1 protein together with CDK1 promotes cell cycle progression, the deletion of this gene in PCa is unexpected. The mechanism of how deletion of Cyclin B1 gene related to PCa is also unclear.
The genetic alterations of M phase promoting complex and regulators were varied across the 13 studies reflecting the clinical heterogeneity of PCa. Apart from heterogeneity, another possible reason might be the difference in sample number and type. The percentages of amplification were varied across the datasets. Based on CDK1, the high frequency of gene amplification occurs in the study with low sample numbers. For example, although TCGA dataset (The Cancer Genome Atlas Research 2015) and
Broad/Cornell dataset (Baca et al. 2013) used similar tumour type, the difference in sample numbers (333 and 56, respectively) may cause variation in percentage of amplification. Therefore, it is possible that the real frequencies of amplifications may not be as it appears to be. For sample type, NEPC and Prostate SUTC studies obtained the specimens from metastatic tumour (Beltran et al. 2016; Robinson et al. 2015) and the specimens of TCGA (Cell 2015) study were derived from primary tumour (The Cancer
202 Genome Atlas Research 2015) suggesting the percentages of genetic alteration may be associated with tumour types.
In summary, mRNA levels of M phase promoting complex and regulators were correlated with prostate disease status, i.e. BPH and cancer, and tumour types, i.e. primary and metastatic cancer. These data suggest that, by reducing the mRNA and protein levels of these PCa progression-associated key players, DR may impede PCa progression in men under AS via suppressing G2-M transition.
203
Chapter 7
204
7 Final Discussion
205 7.1 Discussion
PCa is one of the leading causes of cancer related death in men worldwide (Aggarwal et
al. 2017). Men with low grade and low volume PCa often opt for AS. While this option
decreases unnecessary overtreatment for some men (Klotz et al. 2014), it does cause
anxiety about the possibility of undetected disease progression in many men (Klotz
2013). Indeed, 24–40% of men under AS can experience disease progression, ultimately
requiring medical intervention (ie. prostatectomy or radiation). As discussed in the
introduction, there is no treatment modality available at present for men under AS, apart
from regular PSA testing, digital examination, and biopsy. Hence, there is an excellent
prospect for a cost effective and non-toxic therapy that could help preventing or impeding
disease progression. If this alternate therapy was failed, the choice for definitive treatment
(prostatectomy or radiation) at a later stage would still be present.
TCM has been used for over centuries in treating and improving the symptoms
experienced by cancer patients (Liu et al. 2015). TCM has attracted our attention as it
may meet the three needs for men under AS. DR recipe contains HD and SB, both have
been reported as the most common herbal medicines used in the treatment of breast (Yeh
et al. 2014) and colon cancer (Chao et al. 2014) in China. However, a detailed
understanding of the mechanism of HD and SB in combination in PCa is lacking.
206 7.1.1 Major findings
Firstly, we found that DR has anti-proliferative activity in PCa cells through inhibiting the
DNA synthesis as assessed by SYBR Green assay and BrdU incorporation.
Immunocytochemical staining of Ki-67 showed a clear reduction in proliferative cells
after 72 hr of DR treatment. Long-term inhibitory effect of DR on cancer cell
proliferation was noted by the colony formation assay. The pH and osmolality test of DR
containing culture medium indicated that the anti-proliferative activity of DR is intrinsic.
An animal study demonstrated that DR may not have apparent adverse action at least in a
short-term.
Secondly, flow cytometric cell cycle analysis of PI-stained PCa cells indicated that DR
induces cell accumulation at the G2/M phase and subsequent flow cytometry using co-
staining of PI and phospho-Histone H3 showed the reduction in M phase cells, suggesting
that DR arrests the PCa cells at the G2 phase. G2 phase cell cycle arrest is often associated
with DNA damage and therefore, we performed immunofluorescence of DNA damage
markers phospho-H2AX and 53BP1. Using radiation treated PCa cells as positive control
for DNA damage, we confirmed that DR did not induce the DNA damage foci. Consistent
with this finding, immunoblotting of DNA damage checkpoint proteins (CHK1 and
CHK2) also showed no activation in comparison to radiation-treated PCa cells.
Thirdly, M phase promoting complex and its regulators are important for transition of G2
phase to M phase. Immunoblotting and RT-PCR showed that both protein and mRNA
levels of all four were reduced by DR. The activity of Cyclin B1-CDK1 complex and its
positive regulators PLK1 and Aurora A kinase confer the G2-M transition, and a reduction
207 of their mRNA and proteins by DR revealed a mechanism by which DR impairs the
transition of G2 phase to M phase.
Lastly, using a Dutch based online tool (R2: Genomics Analysis and Visualization
Platform), we showed that mRNA expression levels of M phase promoting complex and
its regulators in PCa tissues were strongly correlated with disease status and tumour
types. The mRNA levels of those four were positively correlated with that of Ki-67
supporting their association with disease progression. Studying the genomic alterations of
those four genes across 13 datasets from cBioportal, we found that amplifications in
CDK1, PLK1 and Aurora A genes and a deletion in Cyclin B1 in PCa.
7.1.2 Validity and significance of the major finding
Two PCa cell lines, LNCaP and PC-3, were used in the study. LNCaP cells express
androgen receptors (AR) and secrete prostate specific antigen (PSA) (Horoszewicz et al.
1983). Being dependent on androgens, LNCaP is a model of hormone sensitive PCa.
Originally from human bone metastases PCa cells, PC-3 lacks AR and PSA expression
(Kaighn et al. 1979). Tumour suppressor p53 is mutated in PC-3 (Isaacs et al. 1991),
while WT p53 is found in LNCaP cells (Cunningham et al. 2015). Furthermore, abnormal
regulations of the PTEN gene, are frequently found in primary (Cairns et al. 1997) and
metastatic PCa (Cunningham et al. 2015; Suzuki et al. 1998). Both LNCaP and PC-3 cells
lack a functional PTEN gene, specifically a frame-shift mutation in LNCaP cells
(Vlietstra et al. 1998) and a deletion in PC-3 cells (Li et al. 1997). Our study showed that
DR has similar effect on both cell lines suggesting the cytostatic action of DR is not
associated with AR or p53 function. Since both PCa cell lines contain dysfunctional
PTEN, the anti-proliferative effect of DR may not require the presence of WT PTEN.
208 The anti-proliferative activity of DR was determined by carefully chosen assays. MTT and MTS are popular cell viability assays based on mitochondria enzyme activities, but their limitations are undeniable in the study using botanical products because of their likely effect on mitochondria (Menyhárt et al. 2016; Wang et al. 2010). Since proliferation must be reflected on DNA synthesis, we chose SYBR Green DNA analysis to investigate the replicative capacity of PCa in the presence of DR. By further including two controls, vehicle and baseline DNA content, we were able to further distinguish cytostatic from cytotoxic doses of DR by SYBR green assay.
Not many methods are available to separate out activity on G2 from M phases. Using
Nocodazole treated PCa cells as a positive control for cells arrested at mitosis, co-staining of PCa cells with PI and phospho-Histone H3 Ab followed by flow cytometry analysis revealed that DR induces the accumulation of PCa cells at G2 phase. After exclusion of
DR induced DNA damage causing G2 arrest, we established that DR reduced at both mRNA and protein levels Cyclin B1, CDK1, PLK1 and Aurora A. We propose that DR impairs the transition of G2 to M phase of PCa cells through these proteins.
Finally, the approach used in this study from establishing DR effect on proliferation, cell cycle distribution and then mechanism for arresting at particular cell cycle phase will be useful not only for understanding the action and mode of action of DR, but also providing a practical platform to assess the biological activity of TCM in future.
209 7.2 Limitations and Future Directions
Previous studies have shown the anti-tumour activity of SB in PCa using TRAMP
transgenic models (Wong et al. 2009). However, no specific mechanism of DR action was
examined. Based on our study, it will be informative if the immunostaining or
immunoblotting can be used to verify DR effect on phospho-H3 and Cyclin B1, CDK1,
PLK1 and Aurora A in tumours in mice. For DR action, it would also be meaningful if we
could establish the effect of DR on both prevention and progression of tumours. For
prevention, DR can be given prior to implantation of PCa cells for impeding progression,
DR will be given after tumour has been established.
Due to time limitations of this project, we were not able to perform the aforementioned
preventive or treatment study in animals, apart from a short-term toxicity study with a
dose calculated based on human intake of DR. We have prepared PCa cells transduced
with Green fluorescence plasmid (Yao et al. 2015). By measuring the fluorescence
intensity of the tumour in vivo, we would be able to monitor the tumour growth
quantitatively and accurately.
Further studies are also needed to determine the effect of DR on stability of mRNAs of
Cyclin B1, CDK1, PLK1 and Aurora A. The reduction of the steady-state mRNA levels of
these four proteins in the presence of DR is expected due to a decrease in either gene
transcription or mRNA stability. To determine mRNA stability, actinomycin D can be
used to inhibit transcription. The decay of the pre-transcribed mRNA over time measured
by RT-PCR in the presence or absence of DR will reflect its impact on mRNA stability.
Previous studies have demonstrated that the stability of mRNA is reflected on the length
of poly A tail. To prevent the degradation of mRNA in the cytomplasm, poly A tail is
210 added at 3’ end of mRNA. Therefore, if a study with actinomycin D indicates a reduction in mRNA stability in the presence of DR, we will verify that by a RT-PCR based method to measure individual mRNA poly (A) length followed by sequencing of PCR product to get an accurate quantification of the number of adenosine (Kusov et al. 2001). If mRNA stability is not affected, we would then examine whether transcriptional activity or accumulation of RNA polymerase II at the promoter regions of those four genes are compromised by DR in vitro by chromatin immunoprecipitation.
Build on the foundation laid through this project, further study on the action of DR in vivo and the mode of action at deep levels are expected to provide more insight into the fascinating capacity of TCM in cancer prevention and treatment.
211 7.3 References
Abbas, T, Sivaprasad, U, Terai, K, Amador, V, Pagano, M & Dutta, A 2008, 'PCNA- dependent regulation of p21 ubiquitylation and degradation via the CRL4Cdt2 ubiquitin ligase complex', Genes & development, vol. 22, no. 18, pp. 2496-506.
Agarwal, R 2000, 'Cell signaling and regulators of cell cycle as molecular targets for prostate cancer prevention by dietary agents', Biochemical pharmacology, vol. 60, no. 8, pp. 1051-9.
Aggarwal, RR, Feng, FY & Small, EJ 2017, 'Emerging Categories of Disease in Advanced Prostate Cancer and Their Therapeutic Implications', Oncology (Williston Park, NY), vol. 31, no. 6.
Ahn, J, Urist, M & Prives, C 2004, 'The Chk2 protein kinase', DNA repair, vol. 3, no. 8–9, pp. 1039-47.
Baca, SC, Prandi, D, Lawrence, MS, Mosquera, JM, Romanel, A, Drier, Y, Park, K, Kitabayashi, N, MacDonald, TY, Ghandi, M, Van Allen, E, Kryukov, GV, Sboner, A, Theurillat, J-P, Soong, TD, Nickerson, E, Auclair, D, Tewari, A, Beltran, H, Onofrio, RC, Boysen, G, Guiducci, C, Barbieri, CE, Cibulskis, K, Sivachenko, A, Carter, SL, Saksena, G, Voet, D, Ramos, AH, Winckler, W, Cipicchio, M, Ardlie, K, Kantoff, PW, Berger, MF, Gabriel, SB, Golub, TR, Meyerson, M, Lander, ES, Elemento, O, Getz, G, Demichelis, F, Rubin, MA & Garraway, LA 2013, 'Punctuated Evolution of Prostate Cancer Genomes', Cell, vol. 153, no. 3, pp. 666-77.
Bai, M, Ni, J, Wu, J, Wang, B, Shen, S & Yu, L 2014, 'A novel mechanism for activation of Aurora-A kinase by Ajuba', Gene, vol. 543, no. 1, pp. 133-9.
Bartek, J & Lukas, J 2003, 'Chk1 and Chk2 kinases in checkpoint control and cancer', Cancer Cell, vol. 3, no. 5, pp. 421-9.
Beltran, H, Prandi, D, Mosquera, JM, Benelli, M, Puca, L, Cyrta, J, Marotz, C, Giannopoulou, E, Chakravarthi, BVSK, Varambally, S, Tomlins, SA, Nanus, DM, Tagawa, ST, Van Allen, EM, Elemento, O, Sboner, A, Garraway, LA, Rubin, MA & Demichelis, F 2016, 'Divergent clonal evolution of castration-resistant neuroendocrine prostate cancer', Nat Med, vol. 22, no. 3, pp. 298-305.
Bendris, N, Lemmers, B, Blanchard, J-M & Arsic, N 2011, 'Cyclin A2 mutagenesis analysis: a new insight into CDK activation and cellular localization requirements', PloS one, vol. 6, no. 7, p. e22879.
Berlin, A, Castro-Mesta, JF, Rodriguez-Romo, L, Hernandez-Barajas, D, González- Guerrero, JF, Rodríguez-Fernández, IA, González-Conchas, G, Verdines-Perez, A & Vera- Badillo, FE 2017, 'Prognostic role of Ki-67 score in localized prostate cancer: A systematic review and meta-analysis', Urologic Oncology: Seminars and Original Investigations, vol. 35, no. 8, pp. 499-506.
212 Blasina, A, Van de Weyer, I, Laus, MC, Luyten, WH, Parker, AE & McGowan, CH 1999, 'A human homologue of the checkpoint kinase Cds1 directly inhibits Cdc25 phosphatase', Current biology, vol. 9, no. 1, pp. 1-10.
Borgne, A, Ostvold, AC, Flament, S & Meijer, L 1999, 'Intra-M phase-promoting factor phosphorylation of cyclin B at the prophase/metaphase transition', Journal of Biological Chemistry, vol. 274, no. 17, pp. 11977-86.
Bouwman, P, Aly, A, Escandell, JM, Pieterse, M, Bartkova, J, van der Gulden, H, Hiddingh, S, Thanasoula, M, Kulkarni, A & Yang, Q 2010, '53BP1 loss rescues BRCA1 deficiency and is associated with triple-negative and BRCA-mutated breast cancers', Nature structural & molecular biology, vol. 17, no. 6, pp. 688-95.
Bretones, G, Delgado, MD & León, J 2015, 'Myc and cell cycle control', Biochimica et Biophysica Acta (BBA) - Gene Regulatory Mechanisms, vol. 1849, no. 5, pp. 506-16.
Bruggisser, R, von Daeniken, K, Jundt, G, Schaffner, W & Tullberg-Reinert, H 2002, 'Interference of plant extracts, phytoestrogens and antioxidants with the MTT tetrazolium assay', Planta medica, vol. 68, no. 05, pp. 445-8.
Burma, S, Chen, BP, Murphy, M, Kurimasa, A & Chen, DJ 2001, 'ATM phosphorylates histone H2AX in response to DNA double-strand breaks', Journal of Biological Chemistry, vol. 276, no. 45, pp. 42462-7.
Cai, Q, Lin, J, Wei, L, Zhang, L, Wang, L, Zhan, Y, Zeng, J, Xu, W, Shen, A, Hong, Z & Peng, J 2012, 'Hedyotis diffusa Willd Inhibits Colorectal Cancer Growth in Vivo via Inhibition of STAT3 Signaling Pathway', International Journal of Molecular Sciences, vol. 13, no. 5, pp. 6117-28.
Cairns, P, Okami, K, Halachmi, S, Halachmi, N, Esteller, M, Herman, JG, Jen, J, Isaacs, W, Bova, GS & Sidransky, D 1997, 'Frequent inactivation of PTEN/MMAC1 in primary prostate cancer', Cancer research, vol. 57, no. 22, pp. 4997-5000.
Canman, CE & Lim, D-S 1998, 'The role of ATM in DNA damage responses and cancer', Oncogene, vol. 17, no. 25.
Carter, HB 2016, 'Optimizing Active Surveillance', European urology, vol. 70, no. 6, pp. 909-11.
Celeste, A, Difilippantonio, S, Difilippantonio, MJ, Fernandez-Capetillo, O, Pilch, DR, Sedelnikova, OA, Eckhaus, M, Ried, T, Bonner, WM & Nussenzweig, A 2003, 'H2AX Haploinsufficiency Modifies Genomic Stability and Tumor Susceptibility', Cell, vol. 114, no. 3, pp. 371-83.
Cerami, E, Gao, J, Dogrusoz, U, Gross, BE, Sumer, SO, Aksoy, BA, Jacobsen, A, Byrne, CJ, Heuer, ML, Larsson, E, Antipin, Y, Reva, B, Goldberg, AP, Sander, C & Schultz, N 2012, 'The cBio Cancer Genomics Portal: An Open Platform for Exploring Multidimensional Cancer Genomics Data', Cancer Discovery, vol. 2, no. 5, pp. 401-4.
213 Chao, T-H, Fu, P-K, Chang, C-H, Chang, S-N, Chiahung Mao, F & Lin, C-H 2014, 'Prescription patterns of Chinese herbal products for post-surgery colon cancer patients in Taiwan', Journal of Ethnopharmacology, vol. 155, no. 1, pp. 702-8.
Chen, C, Zhang, Z, Cui, P, Liao, Y, Zhang, Y, Yao, L, Rui, R & Ju, S 2017, 'Phosphorylation of histone H3 on Ser-10 by Aurora B is essential for chromosome condensation in porcine embryos during the first mitotic division', Histochemistry and Cell Biology, vol. 148, no. 1, pp. 73-83.
Chen, R, He, J, Tong, X, Tang, L & Liu, M 2016, 'The Hedyotis diffusa Willd. (Rubiaceae): A Review on Phytochemistry, Pharmacology, Quality Control and Pharmacokinetics', Molecules, vol. 21, no. 6, p. 710.
Chen, X-Z, Cao, Z-Y, Chen, T-S, Zhang, Y-Q, Liu, Z-Z, Su, Y-T, Liao, L-M & Du, J 2012, 'Water extract of Hedyotis Diffusa Willd suppresses proliferation of human HepG2 cells and potentiates the anticancer efficacy of low-dose 5-fluorouracil by inhibiting the CDK2-E2F1 pathway', Oncology reports, vol. 28, no. 2, pp. 742-8.
Chieffi, P, Cozzolino, L, Kisslinger, A, Libertini, S, Staibano, S, Mansueto, G, De Rosa, G, Villacci, A, Vitale, M & Linardopoulos, S 2006, 'Aurora B expression directly correlates with prostate cancer malignancy and influence prostate cell proliferation', The Prostate, vol. 66, no. 3, pp. 326-33.
Chu, IM, Hengst, L & Slingerland, JM 2008, 'The Cdk inhibitor p27 in human cancer: prognostic potential and relevance to anticancer therapy', Nature Reviews. Cancer, vol. 8, no. 4, pp. 253-67.
Clute, P & Pines, J 1999, 'Temporal and spatial control of cyclin B1 destruction in metaphase', Nature cell biology, vol. 1, no. 2.
Cooperberg, MR & Carroll, PR 2015, 'Trends in management for patients with localized prostate cancer, 1990-2013', JAMA, vol. 314, no. 1, pp. 80-2.
Cunningham, D & You, Z 2015, 'In vitro and in vivo model systems used in prostate cancer research', Journal of biological methods, vol. 2, no. 1.
Dai, Z-J, Wang, X-J, Li, Z-F, Ji, Z-Z, Ren, H-T, Tang, W, Liu, X-X, Kang, H-F, Guan, H-T & Song, L-Q 2008, 'Scutellaria barbate extract induces apoptosis of hepatoma H22 cells via the mitochondrial pathway involving caspase-3', World Journal of Gastroenterology: WJG, vol. 14, no. 48, p. 7321.
Daley, JM & Sung, P 2014, '53BP1, BRCA1, and the choice between recombination and end joining at DNA double-strand breaks', Molecular and cellular biology, vol. 34, no. 8, pp. 1380-8.
Dall’Era, MA, Albertsen, PC, Bangma, C, Carroll, PR, Carter, HB, Cooperberg, MR, Freedland, SJ, Klotz, LH, Parker, C & Soloway, MS 2012, 'Active Surveillance for Prostate Cancer: A Systematic Review of the Literature', European urology, vol. 62, no. 6, pp. 976- 83.
214 Darzynkiewicz, Z & Zhao, H 2001, 'Cell Cycle Analysis by Flow Cytometry', in eLS, John Wiley & Sons, Ltd.
De Falco, G, Leucci, E, Onnis, A, Bellan, C, Tigli, C, Wirths, S, Cerino, G, Cocco, M, Crupi, D & De Luca, A 2008, 'Cdk9/Cyclin T1 complex: a key player during the activation/differentiation process of normal lymphoid B cells', Journal of cellular physiology, vol. 215, no. 1, pp. 276-82.
Diogo, V, Teixeira, J, Silva, PMA & Bousbaa, H 2017, 'Spindle Assembly Checkpoint as a Potential Target in Colorectal Cancer: Current Status and Future Perspectives', Clinical Colorectal Cancer, vol. 16, no. 1, pp. 1-8.
DiPaola, RS 2002, 'To arrest or not to G2-M cell-cycle arrest', Clinical cancer research, vol. 8, no. 11, pp. 3311-4.
Diril, MK, Ratnacaram, CK, Padmakumar, VC, Du, T, Wasser, M, Coppola, V, Tessarollo, L & Kaldis, P 2012, 'Cyclin-dependent kinase 1 (Cdk1) is essential for cell division and suppression of DNA re-replication but not for liver regeneration', Proceedings of the National Academy of Sciences, vol. 109, no. 10, pp. 3826-31.
DiTullio, RA, Mochan, TA, Venere, M, Bartkova, J, Sehested, M, Bartek, J & Halazonetis, TD 2002, '53BP1 functions in an ATM-dependent checkpoint pathway that is constitutively activated in human cancer', Nature cell biology, vol. 4, no. 12, pp. 998-1002.
Djuzenova, CS, Zimmermann, M, Katzer, A, Fiedler, V, Distel, LV, Gasser, M, Waaga- Gasser, A-M, Flentje, M & Polat, B 2015, 'A prospective study on histone γ-H2AX and 53BP1 foci expression in rectal carcinoma patients: correlation with radiation therapy- induced outcome', BMC cancer, vol. 15, p. 856.
Do, K, Doroshow, JH & Kummar, S 2013, 'Wee1 kinase as a target for cancer therapy', Cell cycle, vol. 12, no. 19, pp. 3348-53.
Dutertre, S, Cazales, M, Quaranta, M, Froment, C, Trabut, V, Dozier, C, Mirey, G, Bouché, J-P, Theis-Febvre, N, Schmitt, E, Monsarrat, B, Prigent, C & Ducommun, B 2004, 'Phosphorylation of CDC25B by Aurora-A at the centrosome contributes to the G2–M transition', Journal of Cell Science, vol. 117, no. 12, pp. 2523-31.
Dyson, N 1998, 'The regulation of E2F by pRB-family proteins', Genes & development, vol. 12, no. 15, pp. 2245-62.
Eagle, H & Levine, EM 1967, 'Growth regulatory effects of cellular interaction', Nature, vol. 213, pp. 1102-6.
Engström, W, Darbre, P, Eriksson, S, Gulliver, L, Hultman, T, Karamouzis, MV, Klaunig, JE, Mehta, R, Moorwood, K & Sanderson, T 2015, 'The potential for chemical mixtures from the environment to enable the cancer hallmark of sustained proliferative signalling', Carcinogenesis, vol. 36, no. Suppl_1, pp. S38-S60.
Enserink, JM & Kolodner, RD 2010, 'An overview of Cdk1-controlled targets and processes', Cell Division, vol. 5, no. 1, p. 11.
215 Falck, J, Mailand, N, Syljuasen, RG, Bartek, J & Lukas, J 2001, 'The ATM-Chk2-Cdc25A checkpoint pathway guards against radioresistant DNA synthesis', Nature, vol. 410, no. 6830, p. 842.
Ferlay, J, Shin, HR, Bray, F, Forman, D, Mathers, C & Parkin, DM 2010, 'Estimates of worldwide burden of cancer in 2008: GLOBOCAN 2008', International journal of cancer, vol. 127, no. 12, pp. 2893-917.
Floyd, S, Pines, J & Lindon, C 2008, 'APC/CCdh1 Targets Aurora Kinase to Control Reorganization of the Mitotic Spindle at Anaphase', Current biology, vol. 18, no. 21, pp. 1649-58.
Friedenson, B 2007, 'The BRCA1/2 pathway prevents hematologic cancers in addition to breast and ovarian cancers', BMC cancer, vol. 7, no. 1, p. 152.
Fu, X, Chen, G, Cai, Z-d, Wang, C, Liu, Z-z, Lin, Z-y, Wu, Y-d, Liang, Y-x, Han, Z-d & Liu, J-c 2016, 'Overexpression of BUB1B contributes to progression of prostate cancer and predicts poor outcome in patients with prostate cancer', OncoTargets and therapy, vol. 9, p. 2211.
Furnari, B, Rhind, N & Russell, P 1997, 'Cdc25 mitotic inducer targeted by chk1 DNA damage checkpoint kinase', Science, vol. 277, no. 5331, pp. 1495-7.
Gao, C, Zhou, Y, Jiang, Z, Zhao, Y, Zhang, D, Cong, X, Cao, R, Li, H & Tian, W 2017, 'Cytotoxic and chemosensitization effects of Scutellarin from traditional Chinese herb Scutellaria altissima L. in human prostate cancer cells', Oncology reports, vol. 38, no. 3, pp. 1491-9.
Gao, J, Aksoy, BA, Dogrusoz, U, Dresdner, G, Gross, B, Sumer, SO, Sun, Y, Jacobsen, A, Sinha, R, Larsson, E, Cerami, E, Sander, C & Schultz, N 2013, 'Integrative Analysis of Complex Cancer Genomics and Clinical Profiles Using the cBioPortal', Science Signaling, vol. 6, no. 269, pp. pl1-pl.
Gao, J, Lu, W-F, Dai, Z-J, Lin, S, Zhao, Y, Li, S, Zhao, N-N, Wang, X-J, Kang, H-F, Ma, X- B & Zhang, W-G 2014, 'Induction of apoptosis by total flavonoids from Scutellaria barbata D. Don in human hepatocarcinoma MHCC97-H cells via the mitochondrial pathway', Tumor Biology, vol. 35, no. 3, pp. 2549-59.
García, dPEJ, Alegre, DRE & Asensi, DR 2017, 'Docetaxel in hormone-sensitive advanced prostate cancer; GENESIS-SEFH evaluation reporta', Farmacia hospitalaria: organo oficial de expresion cientifica de la Sociedad Espanola de Farmacia Hospitalaria, vol. 41, no. 4, p. 550.
Garisto, JD & Klotz, L 2017, 'Active Surveillance for Prostate Cancer: How to Do It Right', Oncology (Williston Park, NY), vol. 31, no. 5.
Gerdes, J, Lemke, H, Baisch, H, Wacker, H-H, Schwab, U & Stein, H 1984, 'Cell cycle analysis of a cell proliferation-associated human nuclear antigen defined by the monoclonal antibody Ki-67', The Journal of Immunology, vol. 133, no. 4, pp. 1710-5.
216 Girard, F, Strausfeld, U, Fernandez, A & Lamb, NJ 1991, 'Cyclin A is required for the onset of DNA replication in mammalian fibroblasts', Cell, vol. 67, no. 6, pp. 1169-79.
Glotzer, M, Murray, AW & Kirschner, MW 1991, 'Cyclin is degraded by the ubiquitin pathway', Nature, vol. 349, no. 6305, p. 132.
Goh, D, Lee, YH & Ong, ES 2005, 'Inhibitory effects of a chemically standardized extract from Scutellaria barbata in human colon cancer cell lines, LoVo', Journal of agricultural and food chemistry, vol. 53, no. 21, pp. 8197-204.
Golan, A, Yudkovsky, Y & Hershko, A 2002, 'The cyclin-ubiquitin ligase activity of cyclosome/APC is jointly activated by protein kinases Cdk1-cyclin B and Plk', Journal of Biological Chemistry, vol. 277, no. 18, pp. 15552-7.
Golsteyn, RM, Schultz, SJ, Bartek, J, Ziemiecki, A, Ried, T & Nigg, EA 1994, 'Cell cycle analysis and chromosomal localization of human Plk1, a putative homologue of the mitotic kinases Drosophila polo and Saccharomyces cerevisiae Cdc5', Journal of Cell Science, vol. 107, no. 6, pp. 1509-17.
Görgün, G, Calabrese, E, Hideshima, T, Ecsedy, J, Perrone, G, Mani, M, Ikeda, H, Bianchi, G, Hu, Y & Cirstea, D 2010, 'A novel Aurora-A kinase inhibitor MLN8237 induces cytotoxicity and cell-cycle arrest in multiple myeloma', Blood, vol. 115, no. 25, pp. 5202-13.
Görgün, G, Calabrese, E, Hideshima, T, Ecsedy, J, Perrone, G, Mani, M, Ikeda, H, Bianchi, G, Hu, Y, Cirstea, D, Santo, L, Tai, Y-T, Nahar, S, Zheng, M, Bandi, M, Carrasco, RD, Raje, N, Munshi, N, Richardson, P & Anderson, KC 2010, 'A novel Aurora-A kinase inhibitor MLN8237 induces cytotoxicity and cell-cycle arrest in multiple myeloma', Blood, vol. 115, no. 25, pp. 5202-13.
Gray, JW, Dolbeare, F, Pallavicini, MG, Beisker, W & Waldman, F 1986, 'Cell Cycle Analysis Using Flow Cytometry', International Journal of Radiation Biology and Related Studies in Physics, Chemistry and Medicine, vol. 49, no. 2, pp. 237-55.
Greifenberg, AK, Hönig, D, Pilarova, K, Düster, R, Bartholomeeusen, K, Bösken, CA, Anand, K, Blazek, D & Geyer, M 2016, 'Structural and Functional Analysis of the Cdk13/Cyclin K Complex', Cell Reports, vol. 14, no. 2, pp. 320-31.
Gupta, A, Hunt, CR, Chakraborty, S, Pandita, RK, Yordy, J, Ramnarain, DB, Horikoshi, N & Pandita, TK 2013, 'Role of 53BP1 in the regulation of DNA double-strand break repair pathway choice', Radiation research, vol. 181, no. 1, pp. 1-8.
Gupta, S, Zhang, D, Yi, J & Shao, J 2004, 'Anticancer activities of Oldenlandia diffusa', Journal of Herbal Pharmacotherapy, vol. 4, no. 1, pp. 21-33.
Gurley, LR, D'ANNA, JA, BARHAM, SS, DEAVEN, LL & TOBEY, RA 1978, 'Histone phosphorylation and chromatin structure during mitosis in Chinese hamster cells', The FEBS Journal, vol. 84, no. 1, pp. 1-15.
Halvorsen, OJ, Haukaas, SA & Akslen, LA 2003, 'Combined loss of PTEN and p27 expression is associated with tumor cell proliferation by Ki-67 and increased risk of
217 recurrent disease in localized prostate cancer', Clinical cancer research, vol. 9, no. 4, pp. 1474-9.
Hamdy, FC, Donovan, JL, Lane, JA, Mason, M, Metcalfe, C, Holding, P, Davis, M, Peters, TJ, Turner, EL & Martin, RM 2016, '10-year outcomes after monitoring, surgery, or radiotherapy for localized prostate cancer', New England Journal of Medicine, vol. 375, no. 15, pp. 1415-24.
Hanahan, D & Weinberg, Robert A 2011, 'Hallmarks of Cancer: The Next Generation', Cell, vol. 144, no. 5, pp. 646-74.
Hauf, S, Cole, RW, LaTerra, S, Zimmer, C, Schnapp, G, Walter, R, Heckel, A, Van Meel, J, Rieder, CL & Peters, J-M 2003, 'The small molecule Hesperadin reveals a role for Aurora B in correcting kinetochore–microtubule attachment and in maintaining the spindle assembly checkpoint', J Cell Biol, vol. 161, no. 2, pp. 281-94.
Hirose, Y, Berger, MS & Pieper, RO 2001, 'Abrogation of the Chk1-mediated G2 checkpoint pathway potentiates temozolomide-induced toxicity in a p53-independent manner in human glioblastoma cells', Cancer research, vol. 61, no. 15, pp. 5843-9.
Hirota, T, Kunitoku, N, Sasayama, T, Marumoto, T, Zhang, D, Nitta, M, Hatakeyama, K & Saya, H 2003, 'Aurora-A and an Interacting Activator, the LIM Protein Ajuba, Are Required for Mitotic Commitment in Human Cells', Cell, vol. 114, no. 5, pp. 585-98.
Holt, LJ, Tuch, BB, Villén, J, Johnson, AD, Gygi, SP & Morgan, DO 2009, 'Global analysis of Cdk1 substrate phosphorylation sites provides insights into evolution', Science, vol. 325, no. 5948, pp. 1682-6.
Horoszewicz, JS, Leong, SS, Kawinski, E, Karr, JP, Rosenthal, H, Chu, TM, Mirand, EA & Murphy, GP 1983, 'LNCaP Model of Human Prostatic Carcinoma', Cancer research, vol. 43, no. 4, pp. 1809-18.
Hu, E, Wang, D, Chen, J & Tao, X 2015, 'Novel cyclotides from Hedyotis diffusa induce apoptosis and inhibit proliferation and migration of prostate cancer cells', International Journal of Clinical and Experimental Medicine, vol. 8, no. 3, pp. 4059-65.
Huang, KC 1998, The pharmacology of Chinese herbs, vol. 874, CRC press.
Huen, MS, Huang, J, Leung, JW, Sy, SM-H, Leung, KM, Ching, Y-P, Tsao, SW & Chen, J 2010, 'Regulation of chromatin architecture by the PWWP domain-containing DNA damage-responsive factor EXPAND1/MUM1', Molecular Cell, vol. 37, no. 6, pp. 854-64.
Isaacs, WB, Carter, BS & Ewing, CM 1991, 'Wild-Type p53 Suppresses Growth of Human Prostate Cancer Cells Containing Mutant p53 Alleles', Cancer research, vol. 51, no. 17, pp. 4716-20.
Jackson, JR, Gilmartin, A, Imburgia, C, Winkler, JD, Marshall, LA & Roshak, A 2000, 'An indolocarbazole inhibitor of human checkpoint kinase (Chk1) abrogates cell cycle arrest caused by DNA damage', Cancer research, vol. 60, no. 3, pp. 566-72.
218 Jackson, SP & Bartek, J 2009, 'The DNA-damage response in human biology and disease', Nature, vol. 461, no. 7267, p. 1071.
Janicke, B, Hegardt, C, Krogh, M, Önning, G, Åkesson, B, Cirenajwis, HM & Oredsson, SM 2011, 'The antiproliferative effect of dietary fiber phenolic compounds ferulic acid and p- coumaric acid on the cell cycle of Caco-2 cells', Nutrition and cancer, vol. 63, no. 4, pp. 611-22.
Jiang, Z, Jiang, J, Yang, H, Ge, Z, Wang, Q, Zhang, L, Wu, C & Wang, J 2014, 'Silencing of Aurora kinase A by RNA interference inhibits tumor growth in human osteosarcoma cells by inducing apoptosis and G2/M cell cycle arrest', Oncology reports, vol. 31, no. 3, pp. 1249- 54.
Johnson, D & Walker, C 1999, 'Cyclins and cell cycle checkpoints', Annual review of pharmacology and toxicology, vol. 39.
Kaighn, M, Narayan, KS, Ohnuki, Y, Lechner, J & Jones, L 1979, 'Establishment and characterization of a human prostatic carcinoma cell line (PC-3)', Investigative urology, vol. 17, no. 1, pp. 16-23.
Kan, X, Zhang, W, You, R, Niu, Y, Guo, J & Xue, J 2017, 'Scutellaria barbata D. Don extract inhibits the tumor growth through down-regulating of Treg cells and manipulating Th1/Th17 immune response in hepatoma H22-bearing mice', BMC Complementary and Alternative Medicine, vol. 17, no. 1, p. 41.
Kelland, L 2007, 'The resurgence of platinum-based cancer chemotherapy', Nature reviews. Cancer, vol. 7, no. 8, p. 573.
Khatami, A, Hugosson, J, Wang, W & Damber, J-E 2009, 'Ki-67 in screen-detected, low- grade, low-stage prostate cancer, relation to prostate-specific antigen doubling time, Gleason score and prostate-specific antigen relapse after radical prostatectomy', Scandinavian Journal of Urology and Nephrology, vol. 43, no. 1, pp. 12-8.
Kim, E-K, Kwon, K-B, Han, M-J, Song, M-Y, Lee, J-H, Ko, Y-S, Shin, B-C, Yu, J, Lee, Y- R & Ryu, D-G 2007, 'Induction of G1 arrest and apoptosis by Scutellaria barbata in the human promyelocytic leukemia HL-60 cell line', International journal of molecular medicine, vol. 20, no. 1, pp. 123-8.
Kim, G-J, Jo, H-J, Lee, K-J, Choi, JW & An, JH 2018, 'Oleanolic acid induces p53- dependent apoptosis via the ERK/JNK/AKT pathway in cancer cell lines in prostatic cancer xenografts in mice', Oncotarget, vol. 9, no. 41, p. 26370.
Kim, J, Daniel, J, Espejo, A, Lake, A, Krishna, M, Xia, L, Zhang, Y & Bedford, MT 2006, 'Tudor, MBT and chromo domains gauge the degree of lysine methylation', EMBO reports, vol. 7, no. 4, pp. 397-403.
Kim, S-H, Lee, S, Piccolo, SR, Allen-Brady, K, Park, E-J, Chun, JN, Kim, TW, Cho, N-H, Kim, I-G, So, I & Jeon, J-H 2012, 'Menthol induces cell-cycle arrest in PC-3 cells by down- regulating G2/M genes, including polo-like kinase 1', Biochemical and Biophysical Research Communications, vol. 422, no. 3, pp. 436-41.
219
Kim, Y, Holland, AJ, Lan, W & Cleveland, DW 2010, 'Aurora Kinases and Protein Phosphatase 1 Mediate Chromosome Congression through Regulation of CENP-E', Cell, vol. 142, no. 3, pp. 444-55.
Klotz, L 2013, 'Active surveillance, quality of life, and cancer-related anxiety', European urology, vol. 64, no. 1, pp. 37-9.
Klotz, L & Emberton, M 2014, 'Management of low risk prostate cancer [mdash] active surveillance and focal therapy', Nature reviews Clinical oncology, vol. 11, no. 6, pp. 324-34.
Kobayashi, J 2004, 'Molecular mechanism of the recruitment of NBS1/hMRE11/hRAD50 complex to DNA double-strand breaks: NBS1 binds to γ-H2AX through FHA/BRCT domain', Journal of radiation research, vol. 45, no. 4, pp. 473-8.
Krystyniak, A, Garcia-Echeverria, C, Prigent, C & Ferrari, S 2006, 'Inhibition of Aurora A in response to DNA damage', Oncogene, vol. 25, no. 3, p. 338.
Kuo, YJ, Yang, JS, Lu, CC, Chiang, Sy, Lin, JG & Chung, JG 2015, 'Ethanol extract of Hedyotis diffusa willd upregulates G0/G1 phase arrest and induces apoptosis in human leukemia cells by modulating caspase cascade signaling and altering associated genes expression was assayed by cDNA microarray', Environmental toxicology, vol. 30, no. 10, pp. 1162-77.
Kusov, YY, Shatirishvili, G, Dzagurov, G & Gauss-Müller, V 2001, 'A new G-tailing method for the determination of the poly (A) tail length applied to hepatitis A virus RNA', Nucleic Acids Research, vol. 29, no. 12, pp. e57-e.
Lammer, C, Wagerer, S, Saffrich, R, Mertens, D, Ansorge, W & Hoffmann, I 1998, 'The cdc25B phosphatase is essential for the G2/M phase transition in human cells', Journal of Cell Science, vol. 111, no. 16, pp. 2445-53.
Lampson, MA & Cheeseman, IM 2011, 'Sensing centromere tension: Aurora B and the regulation of kinetochore function', Trends in Cell Biology, vol. 21, no. 3, pp. 133-40.
Lane, HA & Nigg, EA 1996, 'Antibody microinjection reveals an essential role for human polo-like kinase 1 (Plk1) in the functional maturation of mitotic centrosomes', The Journal of Cell Biology, vol. 135, no. 6, pp. 1701-13.
Lavecchia, A, Di Giovanni, C & Novellino, E 2010, 'Inhibitors of Cdc25 phosphatases as anticancer agents: a patent review', Expert opinion on therapeutic patents, vol. 20, no. 3, pp. 405-25.
Lee, JJ, Thomas, I-C, Nolley, R, Ferrari, M, Brooks, JD & Leppert, JT 2015, 'Biologic differences between peripheral and transition zone prostate cancer', The Prostate, vol. 75, no. 2, pp. 183-90.
Lee, S, Khoo, CS, Hennell, JR, Pearson, JL, Jarouche, M, Halstead, CW & Bensoussan, A 2009, 'LC determination of albiflorin and paeoniflorin in Bai Shao (Paeonia lactiflora) as a
220 raw herb and dried aqueous extract', Journal of AOAC International, vol. 92, no. 4, pp. 1027-34.
Lee, T-K, Lee, D-K, Kim, D-I, Lee, Y-C, Chang, Y-C & Kim, C-H 2004, 'Inhibitory effects of Scutellaria barbata D. Don on human uterine leiomyomal smooth muscle cell proliferation through cell cycle analysis', Int Immunopharmacol, vol. 4, no. 3, pp. 447-54.
Li, J, Yen, C, Liaw, D, Podsypanina, K, Bose, S, Wang, SI, Puc, J, Miliaresis, C, Rodgers, L & McCombie, R 1997, 'PTEN, a putative protein tyrosine phosphatase gene mutated in human brain, breast, and prostate cancer', Science, vol. 275, no. 5308, pp. 1943-7.
Li, Y, Zhou, W, Wei, L, Jin, J, Tang, K, Li, C, Teh, BT & Chen, X 2012, 'The effect of Aurora kinases on cell proliferation, cell cycle regulation and metastasis in renal cell carcinoma', International journal of oncology, vol. 41, no. 6, pp. 2139-49.
Li, Y-l, Zhang, J, Min, D, Hongyan, Z, Lin, N & Li, Q-s 2016, 'Anticancer Effects of 1,3- Dihydroxy-2-Methylanthraquinone and the Ethyl Acetate Fraction of Hedyotis Diffusa Willd against HepG2 Carcinoma Cells Mediated via Apoptosis', PloS one, vol. 11, no. 4, p. e0151502.
Lin, J, Chen, Y, Wei, L, Chen, X, Xu, W, Hong, Z, Sferra, TJ & Peng, J 2010, 'Hedyotis Diffusa Willd extract induces apoptosis via activation of the mitochondrion-dependent pathway in human colon carcinoma cells', International journal of oncology, vol. 37, no. 5, pp. 1331-8.
Lin, J, Li, Q, Chen, H, Lin, HUI, Lai, Z & Peng, JUN 2015, 'Hedyotis diffusa Willd. extract suppresses proliferation and induces apoptosis via IL-6-inducible STAT3 pathway inactivation in human colorectal cancer cells', Oncology Letters, vol. 9, no. 4, pp. 1962-70.
Lin, M, Lin, J, Wei, L, Xu, W, Hong, Z, Cai, Q, Peng, J & Zhu, D 2012, 'Hedyotis diffusa Willd extract inhibits HT‑ 29 cell proliferation via cell cycle arrest', Experimental and therapeutic medicine, vol. 4, no. 2, pp. 307-10.
Lin, W-C, Lin, F-T & Nevins, JR 2001, 'Selective induction of E2F1 in response to DNA damage, mediated by ATM-dependent phosphorylation', Genes & development, vol. 15, no. 14, pp. 1833-44.
Litwin, MS & Tan, H-J 2017, 'The Diagnosis and Treatment of Prostate Cancer: A Review', JAMA, vol. 317, no. 24, pp. 2532-42.
Liu, F, Stanton, JJ, Wu, Z & Piwnica-Worms, H 1997, 'The human Myt1 kinase preferentially phosphorylates Cdc2 on threonine 14 and localizes to the endoplasmic reticulum and Golgi complex', Molecular and cellular biology, vol. 17, no. 2, pp. 571-83.
Liu, J, Wang, S, Zhang, Y, Fan, H-t & Lin, H-s 2015, 'Traditional Chinese medicine and cancer: History, present situation, and development', Thoracic Cancer, vol. 6, no. 5, pp. 561- 9.
221 Liu, J, Wang, S, Zhang, Y, Fan, Ht & Lin, Hs 2015, 'Traditional Chinese medicine and cancer: History, present situation, and development', Thoracic Cancer, vol. 6, no. 5, pp. 561- 9.
Liu, Q, Guntuku, S, Cui, X-S, Matsuoka, S, Cortez, D, Tamai, K, Luo, G, Carattini-Rivera, S, DeMayo, F & Bradley, A 2000, 'Chk1 is an essential kinase that is regulated by Atr and required for the G2/M DNA damage checkpoint', Genes & development, vol. 14, no. 12, pp. 1448-59.
Liu, Q, Kaneko, S, Yang, L, Feldman, RI, Nicosia, SV, Chen, J & Cheng, JQ 2004, 'Aurora- A abrogation of p53 DNA binding and transactivation activity by phosphorylation of serine 215', Journal of Biological Chemistry, vol. 279, no. 50, pp. 52175-82.
Logarinho, E & Bousbaa, H 2008, 'Kinetochore-microtubule interactions “in check” by Bub1, Bub3 and BubR1: The dual task of attaching and signalling', Cell cycle, vol. 7, no. 12, pp. 1763-8.
Lohberger, B, Leithner, A, Stuendl, N, Kaltenegger, H, Kullich, W & Steinecker- Frohnwieser, B 2015, 'Diacerein retards cell growth of chondrosarcoma cells at the G2/M cell cycle checkpoint via cyclin B1/CDK1 and CDK2 downregulation', BMC cancer, vol. 15, no. 1, p. 891.
Lopez-Girona, A, Furnari, B, Mondesert, O & Russell, P 1999, 'Nuclear localization of Cdc25 is regulated by DNA damage and a 14-3-3 protein', Nature, vol. 397, no. 6715, p. 172.
Lou, Z, Minter-Dykhouse, K, Franco, S, Gostissa, M, Rivera, MA, Celeste, A, Manis, JP, Van Deursen, J, Nussenzweig, A & Paull, TT 2006, 'MDC1 maintains genomic stability by participating in the amplification of ATM-dependent DNA damage signals', Molecular Cell, vol. 21, no. 2, pp. 187-200.
Lu, Y, Liu, Y, Jiang, J, Xi, Z, Zhong, N, Shi, S, Wang, J & Wei, X 2014, 'Knocking down the expression of Aurora-A gene inhibits cell proliferation and induces G2/M phase arrest in human small cell lung cancer cells', Oncology reports, vol. 32, no. 1, pp. 243-9.
Mackonis, EC, Suchowerska, N, Naseri, P & McKenzie, DR 2012, 'Optimisation of exposure conditions for in vitro radiobiology experiments', Australasian physical & engineering sciences in medicine, vol. 35, no. 2, pp. 151-7.
Macurek, L, Lindqvist, A, Lim, D, Lampson, MA, Klompmaker, R, Freire, R, Clouin, C, Taylor, SS, Yaffe, MB & Medema, RH 2008, 'Polo-like kinase-1 is activated by aurora A to promote checkpoint recovery', Nature, vol. 455, no. 7209, p. 119.
Mah, L, El-Osta, A & Karagiannis, T 2010, '[gamma] H2AX: a sensitive molecular marker of DNA damage and repair', Leukemia, vol. 24, no. 4, p. 679.
Malumbres, M & Barbacid, M 2001, 'Milestones in cell division: to cycle or not to cycle: a critical decision in cancer', Nature reviews. Cancer, vol. 1, no. 3, p. 222.
222 Mao, C-G, Tao, Z-Z, Wan, L-J, Han, J-B, Chen, Z & Xiao, B-K 2014, 'The efficacy of traditional Chinese Medicine as an adjunctive therapy in nasopharyngeal carcinoma: a systematic review and meta-analysis', J BUON, vol. 19, no. 2, pp. 540-8.
Marconett, CN, Morgenstern, TJ, San Roman, AK, Sundar, SN, Singhal, AK & Firestone, GL 2010, 'BZL101, a phytochemical extract from the Scutellaria barbata plant, disrupts proliferation of human breast and prostate cancer cells through distinct mechanisms dependent on the cancer cell phenotype', Cancer biology & therapy, vol. 10, no. 4, pp. 397- 405.
Maréchal, A & Zou, L 2013, 'DNA damage sensing by the ATM and ATR kinases', Cold Spring Harbor perspectives in biology, vol. 5, no. 9, p. a012716.
Markova, E, Schultz, N & Belyaev, I 2007, 'Kinetics and dose-response of residual 53BP1/γ- H2AX foci: Co-localization, relationship with DSB repair and clonogenic survival', International journal of radiation biology, vol. 83, no. 5, pp. 319-29.
Marumoto, T, Hirota, T, Morisaki, T, Kunitoku, N, Zhang, D, Ichikawa, Y, Sasayama, T, Kuninaka, S, Mimori, T & Tamaki, N 2002, 'Roles of aurora‐A kinase in mitotic entry and G2 checkpoint in mammalian cells', Genes to Cells, vol. 7, no. 11, pp. 1173-82.
Marumoto, T, Honda, S, Hara, T, Nitta, M, Hirota, T, Kohmura, E & Saya, H 2003, 'Aurora- A kinase maintains the fidelity of early and late mitotic events in HeLa cells', Journal of Biological Chemistry, vol. 278, no. 51, pp. 51786-95.
Matheson, CJ, Backos, DS & Reigan, P 2016, 'Targeting WEE1 kinase in cancer', Trends in pharmacological sciences, vol. 37, no. 10, pp. 872-81.
Matsuoka, S, Huang, M & Elledge, SJ 1998, 'Linkage of ATM to cell cycle regulation by the Chk2 protein kinase', Science, vol. 282, no. 5395, pp. 1893-7.
McCulloch, M, See, C, Shu, X-j, Broffman, M, Kramer, A, Fan, W-y, Gao, J, Lieb, W, Shieh, K & Colford Jr, JM 2006, 'Astragalus-based Chinese herbs and platinum-based chemotherapy for advanced non–small-cell lung cancer: meta-analysis of randomized trials', Journal of Clinical Oncology, vol. 24, no. 3, pp. 419-30.
McCullough, AR 2005, 'Sexual dysfunction after radical prostatectomy', Reviews in urology, vol. 7, no. Suppl 2, p. S3.
Mellone, BG, Ball, L, Suka, N, Grunstein, MR, Partridge, JF & Allshire, RC 2003, 'Centromere silencing and function in fission yeast is governed by the amino terminus of histone H3', Current biology, vol. 13, no. 20, pp. 1748-57.
Menyhárt, O, Harami-Papp, H, Sukumar, S, Schäfer, R, Magnani, L, de Barrios, O & Győrffy, B 2016, 'Guidelines for the selection of functional assays to evaluate the hallmarks of cancer', Biochimica et Biophysica Acta (BBA) - Reviews on Cancer, vol. 1866, no. 2, pp. 300-19.
223 Moawad, M, Khoo, CS, Lee, S & Hennell, JR 2010, 'Simultaneous determination of eight sympathomimetic amines in urine by gas chromatography/mass spectrometry', Journal of AOAC International, vol. 93, no. 1, pp. 116-22.
Morgan, DO 1995, 'Principles of CDK regulation', Nature, vol. 374, no. 6518, pp. 131-4.
Mosquera, JM, Beltran, H, Park, K, MacDonald, TY, Robinson, BD, Tagawa, ST, Perner, S, Bismar, TA, Erbersdobler, A, Dhir, R, Nelson, JB, Nanus, DM & Rubin, MA 2013, 'Concurrent AURKA and MYCN Gene Amplifications Are Harbingers of Lethal TreatmentRelated Neuroendocrine Prostate Cancer', Neoplasia, vol. 15, no. 1, pp. 1-IN4.
Murray, AW, Solomon, MJ & Kirschner, MW 1989, 'The role of cyclin synthesis and degradation in the control of maturation promoting factor activity', Nature, vol. 339, no. 6222, pp. 280-6.
Nair, JS, Ho, AL & Schwartz, GK 2012, 'The induction of polyploidy or apoptosis by the Aurora A kinase inhibitor MK8745 is p53-dependent', Cell cycle, vol. 11, no. 4, pp. 807-17.
Nakajima, H, Toyoshima-Morimoto, F, Taniguchi, E & Nishida, E 2003, 'Identification of a consensus motif for Plk (Polo-like kinase) phosphorylation reveals Myt1 as a Plk1 substrate', Journal of Biological Chemistry, vol. 278, no. 28, pp. 25277-80.
Nguyen, PL, Alibhai, SM, Basaria, S, D’Amico, AV, Kantoff, PW, Keating, NL, Penson, DF, Rosario, DJ, Tombal, B & Smith, MR 2015, 'Adverse effects of androgen deprivation therapy and strategies to mitigate them', European urology, vol. 67, no. 5, pp. 825-36.
Niu, Y & Meng, Q-X 2013, 'Chemical and preclinical studies on Hedyotis diffusa with anticancer potential', Journal of Asian natural products research, vol. 15, no. 5, pp. 550-65.
Nomura, N, Nomura, M, Newcomb, EW & Zagzag, D 2007, 'Geldanamycin induces G2 arrest in U87MG glioblastoma cells through downregulation of Cdc2 and cyclin B1', Biochemical Pharmacology, vol. 73, no. 10, pp. 1528-36.
Ohtsubo, M, Theodoras, AM, Schumacher, J, Roberts, JM & Pagano, M 1995, 'Human cyclin E, a nuclear protein essential for the G1-to-S phase transition', Molecular and cellular biology, vol. 15, no. 5, pp. 2612-24.
Olive, PL & Banáth, JP 2004, 'Phosphorylation of histone H2AX as a measure of radiosensitivity', International Journal of Radiation Oncology* Biology* Physics, vol. 58, no. 2, pp. 331-5.
Otto, T & Sicinski, P 2017, 'Cell cycle proteins as promising targets in cancer therapy', Nature reviews. Cancer, vol. 17, no. 2, p. 93.
Oudard, S, Fizazi, K, Sengeløv, L, Daugaard, G, Saad, F, Hansen, S, Hjälm-Eriksson, M, Jassem, J, Thiery-Vuillemin, A & Caffo, O 2017, 'Cabazitaxel Versus Docetaxel As First- Line Therapy for Patients With Metastatic Castration-Resistant Prostate Cancer: A Randomized Phase III Trial—FIRSTANA', Journal of Clinical Oncology, p. JCO. 2016.72. 1068.
224 Pajalunga, D, Mazzola, A, Franchitto, A, Puggioni, E & Crescenzi, M 2008, 'The logic and regulation of cell cycle exit and reentry', Cellular and molecular life sciences: CMLS, vol. 65, no. 1, p. 8.
Palla, V-V, Karaolanis, G, Katafigiotis, I, Anastasiou, I, Patapis, P, Dimitroulis, D & Perrea, D 2017, 'gamma-H2AX: Can it be established as a classical cancer prognostic factor?', Tumor Biology, vol. 39, no. 3, p. 1010428317695931.
Pan, L-T, Sheung, Y, Guo, W-P, Rong, Z-B & Cai, Z-M 2016, 'Hedyotis diffusa plus Scutellaria barbata Induce Bladder Cancer Cell Apoptosis by Inhibiting Akt Signaling Pathway through Downregulating miR-155 Expression', Evidence-Based Complementary and Alternative Medicine, vol. 2016, p. 10.
Panier, S & Boulton, SJ 2014, 'Double-strand break repair: 53BP1 comes into focus', Nat Rev Mol Cell Biol, vol. 15, no. 1, pp. 7-18.
Parker, LL & Piwnica-Worms, H 1992, 'Inactivation of the p34cdc2-cyclin B complex by the human WEE1 tyrosine kinase', Science, vol. 257, no. 5078, pp. 1955-8.
Peng, C-Y, Graves, PR, Ogg, S, Thoma, RS, Byrnes 3rd, M, Wu, Z, Stephenson, MT & Piwnica-Worms, H 1998, 'C-TAK1 protein kinase phosphorylates human Cdc25C on serine 216 and promotes 14-3-3 protein binding', Cell growth & differentiation: the molecular biology journal of the American Association for Cancer Research, vol. 9, no. 3, pp. 197-208.
Peng, C-Y, Graves, PR, Thoma, RS, Wu, Z, Shaw, AS & Piwnica-Worms, H 1997, 'Mitotic and G2 checkpoint control: regulation of 14-3-3 protein binding by phosphorylation of Cdc25C on serine-216', Science, vol. 277, no. 5331, pp. 1501-5.
Petronczki, M, Lénárt, P & Peters, J-M 2008, 'Polo on the rise—from mitotic entry to cytokinesis with Plk1', Developmental cell, vol. 14, no. 5, pp. 646-59.
Pietenpol, J & Stewart, Z 2002, 'Cell cycle checkpoint signaling:: Cell cycle arrest versus apoptosis', Toxicology, vol. 181, pp. 475-81.
Porter, LA & Donoghue, DJ 2003, 'Cyclin B1 and CDK1: nuclear localization and upstream regulators', PROGRESS IN CELL CYCLE RESEARCH., vol. 5, pp. 335-48.
Pouliliou, S & Koukourakis, MI 2014, 'Gamma histone 2AX (γ-H2AX) as a predictive tool in radiation oncology', Biomarkers, vol. 19, no. 3, pp. 167-80.
Qin, L, Tong, T, Song, Y, Xue, L, Fan, F & Zhan, Q 2009, 'Aurora-A interacts with Cyclin B1 and enhances its stability', Cancer Letters, vol. 275, no. 1, pp. 77-85.
Rahib, L, Smith, BD, Aizenberg, R, Rosenzweig, AB, Fleshman, JM & Matrisian, LM 2014, 'Projecting cancer incidence and deaths to 2030: the unexpected burden of thyroid, liver, and pancreas cancers in the United States', Cancer research, vol. 74, no. 11, pp. 2913-21.
Riballo, E, Kühne, M, Rief, N, Doherty, A, Smith, GC, Recio, Ma-J, Reis, C, Dahm, K, Fricke, A & Krempler, A 2004, 'A pathway of double-strand break rejoining dependent upon
225 ATM, Artemis, and proteins locating to γ-H2AX foci', Molecular Cell, vol. 16, no. 5, pp. 715-24.
Ricke, RM, Jeganathan, KB & van Deursen, JM 2011, 'Bub1 overexpression induces aneuploidy and tumor formation through Aurora B kinase hyperactivation', The Journal of Cell Biology, vol. 193, no. 6, pp. 1049-64.
Rickert, P, Corden, JL & Lees, E 1999, 'Cyclin C/CDK8 and cyclin H/CDK7/p36 are biochemically distinct CTD kinases', Oncogene, vol. 18, no. 4.
Robinson, D, Van Allen, Eliezer M, Wu, Y-M, Schultz, N, Lonigro, Robert J, Mosquera, J- M, Montgomery, B, Taplin, M-E, Pritchard, Colin C, Attard, G, Beltran, H, Abida, W, Bradley, Robert K, Vinson, J, Cao, X, Vats, P, Kunju, Lakshmi P, Hussain, M, Feng, Felix Y, Tomlins, Scott A, Cooney, Kathleen A, Smith, David C, Brennan, C, Siddiqui, J, Mehra, R, Chen, Y, Rathkopf, Dana E, Morris, Michael J, Solomon, Stephen B, Durack, Jeremy C, Reuter, Victor E, Gopalan, A, Gao, J, Loda, M, Lis, Rosina T, Bowden, M, Balk, Stephen P, Gaviola, G, Sougnez, C, Gupta, M, Yu, Evan Y, Mostaghel, Elahe A, Cheng, Heather H, Mulcahy, H, True, Lawrence D, Plymate, Stephen R, Dvinge, H, Ferraldeschi, R, Flohr, P, Miranda, S, Zafeiriou, Z, Tunariu, N, Mateo, J, Perez-Lopez, R, Demichelis, F, Robinson, Brian D, Schiffman, M, Nanus, David M, Tagawa, Scott T, Sigaras, A, Eng, Kenneth W, Elemento, O, Sboner, A, Heath, Elisabeth I, Scher, Howard I, Pienta, Kenneth J, Kantoff, P, de Bono, Johann S, Rubin, Mark A, Nelson, Peter S, Garraway, Levi A, Sawyers, Charles L & Chinnaiyan, Arul M 2015, 'Integrative Clinical Genomics of Advanced Prostate Cancer', Cell, vol. 161, no. 5, pp. 1215-28.
Roy, A, Lavrovsky, Y, Song, C, Chen, S, Jung, M, Velu, N, Bi, B & Chatterjee, B 1998, 'Regulation of androgen action', Vitamins & Hormones, vol. 55, pp. 309-52.
Ru Li, WS, Xue Qiao, Jia Liu, Hong Liang, Min Ye 2015, 'Chemical profiling of Scutellaria barbata by ultra high performance liquid chromatography coupled with hybrid quadrupole- orbitrap mass spectrometry ', Journal of Chinese Pharmaceutical Sciences, vol. 24, no. 10, pp. 635-46.
Rudolph, D, Steegmaier, M, Hoffmann, M, Grauert, M, Baum, A, Quant, J, Haslinger, C, Garin-Chesa, P & Adolf, GR 2009, 'BI 6727, A Polo-like Kinase Inhibitor with Improved Pharmacokinetic Profile and Broad Antitumor Activity', Clinical cancer research, vol. 15, no. 9, pp. 3094-102.
Saad, F 2012, 'Management of castration-resistant prostate cancer: a global approach', Current Oncology, vol. 19, p. 5.
Safar, AM, Spencer, H, Su, X, Coffey, M, Cooney, CA, Ratnasinghe, LD, Hutchins, LF & Fan, C-Y 2005, 'Methylation profiling of archived non–small cell lung cancer: a promising prognostic system', Clinical cancer research, vol. 11, no. 12, pp. 4400-5.
Santaguida, S, Tighe, A, D'Alise, AM, Taylor, SS & Musacchio, A 2010, 'Dissecting the role of MPS1 in chromosome biorientation and the spindle checkpoint through the small molecule inhibitor reversine', The Journal of Cell Biology, vol. 190, no. 1, pp. 73-87.
226 Santamaria, D, Barriere, C, Cerqueira, A, Hunt, S, Tardy, C, Newton, K, Caceres, JF, Dubus, P, Malumbres, M & Barbacid, M 2007, 'Cdk1 is sufficient to drive the mammalian cell cycle', Nature, vol. 448, no. 7155, pp. 811-5.
Santo, L, Siu, KT & Raje, N 2015, 'Targeting Cyclin-Dependent Kinases and Cell Cycle Progression in Human Cancers', Seminars in Oncology, vol. 42, no. 6, pp. 788-800.
Sawicka, A & Seiser, C 2012, 'Histone H3 phosphorylation – A versatile chromatin modification for different occasions', Biochimie, vol. 94, no. 11, pp. 2193-201.
Scaife, RM 2004, 'G2 cell cycle arrest, down-regulation of cyclin B, and induction of mitotic catastrophe by the flavoprotein inhibitor diphenyleneiodonium', Molecular cancer therapeutics, vol. 3, no. 10, pp. 1229-37.
Schröder, FH, Hugosson, J, Roobol, MJ, Tammela, TL, Ciatto, S, Nelen, V, Kwiatkowski, M, Lujan, M, Lilja, H & Zappa, M 2012, 'Prostate-cancer mortality at 11 years of follow-up', New England Journal of Medicine, vol. 366, no. 11, pp. 981-90.
Schulze, A, Zerfass, K, Spitkovsky, D, Middendorp, S, Berges, J, Helin, K, Jansen-Dürr, P & Henglein, B 1995, 'Cell cycle regulation of the cyclin A gene promoter is mediated by a variant E2F site', Proceedings of the National Academy of Sciences, vol. 92, no. 24, pp. 11264-8.
Seki, A, Coppinger, JA, Jang, C-Y, Yates, JR & Fang, G 2008, 'Bora and Aurora A Cooperatively Activate Plk1 and Control the Entry into Mitosis', Science (New York, N.Y.), vol. 320, no. 5883, pp. 1655-8.
Sgambato, A, Cittadini, A, Faraglia, B & Weinstein, IB 2000, 'Multiple functions of p27Kip1 and its alterations in tumor cells: a review', Journal of cellular physiology, vol. 183, no. 1, pp. 18-27.
Shaltiel, IA, Krenning, L, Bruinsma, W & Medema, RH 2015, 'The same, only different– DNA damage checkpoints and their reversal throughout the cell cycle', J Cell Sci, vol. 128, no. 4, pp. 607-20.
Sherr, CJ & Roberts, JM 2004, 'Living with or without cyclins and cyclin-dependent kinases', Genes & development, vol. 18, no. 22, pp. 2699-711.
Shi, H, Li, Y, Ren, X, Zhang, Y, Yang, Z & Qi, C 2017, 'A novel quinazoline-based analog induces G2/M cell cycle arrest and apoptosis in human A549 lung cancer cells via a ROS- dependent mechanism', Biochemical and Biophysical Research Communications, vol. 486, no. 2, pp. 314-20.
Shiotani, B & Zou, L 2009, 'Single-stranded DNA orchestrates an ATM-to-ATR switch at DNA breaks', Molecular Cell, vol. 33, no. 5, pp. 547-58.
Shoemaker, M, Hamilton, B, Dairkee, SH, Cohen, I & Campbell, MJ 2005, 'In vitro anticancer activity of twelve Chinese medicinal herbs', Phytotherapy Research, vol. 19, no. 7, pp. 649-51.
227 Siegel, RL, Miller, KD & Jemal, A 2017, 'Cancer statistics, 2017', CA: a cancer journal for clinicians, vol. 67, no. 1, pp. 7-30.
Smits, VA, Klompmaker, R, Arnaud, L, Rijksen, G, Nigg, EA & Medema, RH 2000, 'Polo- like kinase-1 is a target of the DNA damage checkpoint', Nature cell biology, vol. 2, no. 9, p. 672.
Strebhardt, K 2010, 'Multifaceted polo-like kinases: drug targets and antitargets for cancer therapy', Nature reviews. Drug discovery, vol. 9, no. 8, p. 643.
Strebhardt, K & Ullrich, A 2006, 'Targeting polo-like kinase 1 for cancer therapy', Nature reviews. Cancer, vol. 6, no. 4, p. 321.
Stucki, M & Jackson, SP 2006, 'γH2AX and MDC1: anchoring the DNA-damage-response machinery to broken chromosomes', DNA repair, vol. 5, no. 5, pp. 534-43.
Stuenæs, JT, Bolling, A, Ingvaldsen, A, Rommundstad, C, Sudar, E, Lin, FC, Lai, YC & Jensen, J 2010, ' β‐Adrenoceptor stimulation potentiates insulin ‐ stimulated PKB phosphorylation in rat cardiomyocytes via cAMP and PKA', British journal of pharmacology, vol. 160, no. 1, pp. 116-29.
Sumara, I, Giménez-Abián, JF, Gerlich, D, Hirota, T, Kraft, C, de la Torre, C, Ellenberg, J & Peters, J-M 2004, 'Roles of Polo-like Kinase 1 in the Assembly of Functional Mitotic Spindles', Current biology, vol. 14, no. 19, pp. 1712-22.
Suzuki, H, Freije, D, Nusskern, DR, Okami, K, Cairns, P, Sidransky, D, Isaacs, WB & Bova, GS 1998, 'Interfocal heterogeneity of PTEN/MMAC1 gene alterations in multiple metastatic prostate cancer tissues', Cancer research, vol. 58, no. 2, pp. 204-9.
Takeda, S, Nakamura, K, Taniguchi, Y & Paull, TT 2007, 'Ctp1/CtIP and the MRN complex collaborate in the initial steps of homologous recombination', Molecular Cell, vol. 28, no. 3, pp. 351-2.
Takizawa, CG & Morgan, DO 2000, 'Control of mitosis by changes in the subcellular location of cyclin-B1–Cdk1 and Cdc25C', Current opinion in cell biology, vol. 12, no. 6, pp. 658-65.
Tan, ME, Li, J, Xu, HE, Melcher, K & Yong, E-l 2015, 'Androgen receptor: structure, role in prostate cancer and drug discovery', Acta Pharmacologica Sinica, vol. 36, no. 1, p. 3.
Taneja, N, Davis, M, Choy, JS, Beckett, MA, Singh, R, Kron, SJ & Weichselbaum, RR 2004, 'Histone H2AX phosphorylation as a predictor of radiosensitivity and target for radiotherapy', Journal of Biological Chemistry, vol. 279, no. 3, pp. 2273-80.
Tang, Z, Shu, H, Oncel, D, Chen, S & Yu, H 2004, 'Phosphorylation of Cdc20 by Bub1 Provides a Catalytic Mechanism for APC/C Inhibition by the Spindle Checkpoint', Molecular Cell, vol. 16, no. 3, pp. 387-97.
228 The Cancer Genome Atlas Research, N 2015, 'The molecular taxonomy of primary prostate cancer', Cell, vol. 163, no. 4, pp. 1011-25.
Tosoian, JJ, Carter, HB, Lepor, A & Loeb, S 2016, 'Active surveillance for prostate cancer: current evidence and contemporary state of practice', Nature Reviews Urology, vol. 13, no. 4, pp. 205-15.
Toyoshima-Morimoti, F, Taniguchi, E, Shinya, N, Iwamatsu, A & Nishida, E 2001, 'erratum: Polo-like kinase 1 phosphorylates cyclin B1 and targets it to the nucleus during prophase', Nature, vol. 410, no. 6830, p. 847.
Toyoshima ‐ Morimoto, F, Taniguchi, E & Nishida, E 2002, 'Plk1 promotes nuclear translocation of human Cdc25C during prophase', EMBO reports, vol. 3, no. 4, pp. 341-8.
Tsvetkov, L, Xu, X, Li, J & Stern, DF 2003, 'Polo-like kinase 1 and Chk2 interact and co- localize to centrosomes and the midbody', Journal of Biological Chemistry, vol. 278, no. 10, pp. 8468-75.
Urruticoechea, A, Smith, IE & Dowsett, M 2005, 'Proliferation marker Ki-67 in early breast cancer', Journal of Clinical Oncology, vol. 23, no. 28, pp. 7212-20.
Valko, M, Rhodes, C, Moncol, J, Izakovic, M & Mazur, M 2006, 'Free radicals, metals and antioxidants in oxidative stress-induced cancer', Chemico-biological interactions, vol. 160, no. 1, pp. 1-40.
Van Vugt, MA & Medema, RH 2005, 'Getting in and out of mitosis with Polo-like kinase-1', Oncogene, vol. 24, no. 17, p. 2844.
Van Zon, W, Ogink, J, ter Riet, B, Medema, RH, te Riele, H & Wolthuis, RMF 2010, 'The APC/C recruits cyclin B1–Cdk1–Cks in prometaphase before D box recognition to control mitotic exit', The Journal of Cell Biology, vol. 190, no. 4, pp. 587-602.
Vignarajan, S, Xie, C, Yao, M, Sun, Y, Simanainen, U, Sved, P, Liu, T & Dong, Q 2014, 'Loss of PTEN stabilizes the lipid modifying enzyme cytosolic phospholipase A2α via AKT in prostate cancer cells', Oncotarget, vol. 5, no. 15, p. 6289.
Vijayababu, M, Kanagaraj, P, Arunkumar, A, Ilangovan, R, Aruldhas, M & Arunakaran, J 2005, 'Quercetin-induced growth inhibition and cell death in prostatic carcinoma cells (PC- 3) are associated with increase in p21 and hypophosphorylated retinoblastoma proteins expression', Journal of cancer research and clinical oncology, vol. 131, no. 11, pp. 765-71.
Visconti, R, Della Monica, R & Grieco, D 2016, 'Cell cycle checkpoint in cancer: a therapeutically targetable double-edged sword', Journal of Experimental & Clinical Cancer Research, vol. 35, no. 1, p. 153.
Vlietstra, RJ, van Alewijk, DC, Hermans, KG, van Steenbrugge, GJ & Trapman, J 1998, 'Frequent inactivation of PTEN in prostate cancer cell lines and xenografts', Cancer research, vol. 58, no. 13, pp. 2720-3.
229 Wang, P, Henning, SM & Heber, D 2010, 'Limitations of MTT and MTS-Based Assays for Measurement of Antiproliferative Activity of Green Tea Polyphenols', PloS one, vol. 5, no. 4, p. e10202.
Wang, X, Jin, D-Y, Ng, RW, Feng, H, Wong, YC, Cheung, AL & Tsao, SW 2002, 'Significance of MAD2 expression to mitotic checkpoint control in ovarian cancer cells', Cancer research, vol. 62, no. 6, pp. 1662-8.
Wang, Y, Sun, H, Wang, Z, Liu, M, Qi, Z, Meng, J, Sun, J & Yang, G 2014, 'Aurora-A: a potential DNA repair modulator', Tumor Biology, vol. 35, no. 4, pp. 2831-6.
Watanabe, N, Arai, H, Nishihara, Y, Taniguchi, M, Watanabe, N, Hunter, T & Osada, H 2004, 'M-phase kinases induce phospho-dependent ubiquitination of somatic Wee1 by SCFβ-TrCP', Proceedings of the National Academy of Sciences of the United States of America, vol. 101, no. 13, pp. 4419-24.
Wei, L, Lin, J, Wu, G, Xu, W, Li, H, Hong, Z & Peng, J 2013, 'Scutellaria barbata D. Don induces G1/S arrest via modulation of p53 and Akt pathways in human colon carcinoma cells', Oncology reports, vol. 29, no. 4, pp. 1623-8.
Wilt, TJ, Brawer, MK, Jones, KM, Barry, MJ, Aronson, WJ, Fox, S, Gingrich, JR, Wei, JT, Gilhooly, P & Grob, BM 2012, 'Radical prostatectomy versus observation for localized prostate cancer', New England Journal of Medicine, vol. 367, no. 3, pp. 203-13.
Wong, BY, Nguyen, DL, Lin, T, Wong, HH, Cavalcante, A, Greenberg, NM, Hausted, RP & Zheng, J 2009, 'Chinese medicinal herb Scutellaria barbata modulates apoptosis and cell survival in murine and human prostate cancer cells and tumor development in TRAMP mice', European Journal of Cancer Prevention, vol. 18, no. 4, pp. 331-41.
Wu, W-H, Chen, T-Y, Lu, R-W, Chen, S-T & Chang, C-C 2012, 'Benzoxazinoids from Scoparia dulcis (sweet broomweed) with antiproliferative activity against the DU-145 human prostate cancer cell line', Phytochemistry, vol. 83, pp. 110-5.
Wu, W-j, Hu, K-s, Wang, D-s, Zeng, Z-l, Zhang, D-s, Chen, D-l, Bai, L & Xu, R-h 2013, 'CDC20 overexpression predicts a poor prognosis for patients with colorectal cancer', Journal of translational medicine, vol. 11, no. 1, p. 142.
Wu, X & Chen, J 2003, 'Autophosphorylation of checkpoint kinase 2 at serine 516 is required for radiation-induced apoptosis', Journal of Biological Chemistry, vol. 278, no. 38, pp. 36163-8.
Xi, Z, Yao, M, Li, Y, Xie, C, Holst, J, Liu, T, Cai, S, Lao, Y, Tan, H, Xu, HX & Dong, Q 2016, 'Guttiferone K impedes cell cycle re-entry of quiescent prostate cancer cells via stabilization of FBXW7 and subsequent c-MYC degradation', Cell Death & Disease, vol. 7, no. 6, p. e2252.
Yan, M, Wang, C, He, B, Yang, M, Tong, M, Long, Z, Liu, B, Peng, F, Xu, L & Zhang, Y 2016, 'Aurora‐A Kinase: A Potent Oncogene and Target for Cancer Therapy', Medicinal research reviews, vol. 36, no. 6, pp. 1036-79.
230 Yan, X, Qi, M, Li, P, Zhan, Y & Shao, H 2017, 'Apigenin in cancer therapy: anti-cancer effects and mechanisms of action', Cell & bioscience, vol. 7, no. 1, p. 50.
Yang, N, Zhao, Y, Wang, Z, Liu, Y & Zhang, Y 2017, 'Scutellarin suppresses growth and causes apoptosis of human colorectal cancer cells by regulating the p53 pathway', Molecular medicine reports, vol. 15, no. 2, pp. 929-35.
Yao, M, Xie, C, Constantine, M, Hua, S, Hambly, BD, Jardine, G, Sved, P & Dong, Q 2012, 'How can food extracts consumed in the Mediterranean and East Asia suppress prostate cancer proliferation?', British Journal of Nutrition, vol. 108, no. 3, pp. 424-30.
Yao, M, Xie, C, Kiang, M-Y, Teng, Y, Harman, D, Tiffen, J, Wang, Q, Sved, P, Bao, S, Witting, P, Holst, J & Dong, Q 2015, 'Targeting of cytosolic phospholipase A(2)α impedes cell cycle re-entry of quiescent prostate cancer cells', Oncotarget, vol. 6, no. 33, pp. 34458- 74.
Yaxley, J, Yaxley, J, Gardiner, R & Yaxley, W 2013, 'Prostate cancer: Active surveillance as a management option', Australian family physician, vol. 42, no. 1/2, p. 74.
Yeh, Y-C, Chen, H-Y, Yang, S-H, Lin, Y-H, Chiu, J-H, Lin, Y-H & Chen, J-L 2014, 'Hedyotis diffusa Combined with Scutellaria barbata Are the Core Treatment of Chinese Herbal Medicine Used for Breast Cancer Patients: A Population-Based Study', Evidence- Based Complementary and Alternative Medicine, vol. 2014, p. 9.
Yin, X, Zhou, J, Jie, C, Xing, D & Zhang, Y 2004, 'Anticancer activity and mechanism of< i> Scutellaria barbata extract on human lung cancer cell line A549', Life sciences, vol. 75, no. 18, pp. 2233-44.
Yu, XQ, Luo, Q, Smith, DP, Clements, MS & O’Connell, DL 2015, 'Prostate cancer prevalence in New South Wales Australia: A population-based study', Cancer Epidemiology, vol. 39, no. 1, pp. 29-36.
Yu, Y, Zhu, W, Diao, H, Zhou, C, Chen, FF & Yang, J 2006, 'A comparative study of using comet assay and γ H2AX foci formation in the detection of N-methyl-N ′ -nitro-N- nitrosoguanidine-induced DNA damage', Toxicology in vitro : an international journal published in association with BIBRA, vol. 20, no. 6, pp. 959-65.
Zakian, VA 1995, 'ATM-related genes: what do they tell us about functions of the human gene?', Cell, vol. 82, no. 5, pp. 685-7.
Zeitlin, SG, Shelby, RD & Sullivan, KF 2001, 'CENP-A is phosphorylated by Aurora B kinase and plays an unexpected role in completion of cytokinesis', J Cell Biol, vol. 155, no. 7, pp. 1147-58.
Zetterberg, A, Larsson, O & Wiman, KG 1995, 'What is the restriction point?', Current opinion in cell biology, vol. 7, no. 6, pp. 835-42.
Zhang, L, Cai, Q, Lin, J, Fang, Y, Zhan, Y, Shen, A, Wei, L, Wang, L & Peng, J 2014, 'Chloroform fraction of Scutellaria barbata D. Don promotes apoptosis and suppresses
231 proliferation in human colon cancer cells', Molecular medicine reports, vol. 9, no. 2, pp. 701-6.
Zhang, L, Ren, B, Zhang, J, Liu, L, Liu, J, Jiang, G, Li, M, Ding, Y & Li, W 2017, 'Anti- tumor effect of Scutellaria barbata D. Don extracts on ovarian cancer and its phytochemicals characterisation', Journal of Ethnopharmacology, vol. 206, pp. 184-92.
Zhang, L, Zhang, J, Qi, B, Jiang, G, Liu, J, Zhang, P, Ma, Y & Li, W 2016, 'The anti-tumor effect and bioactive phytochemicals of Hedyotis diffusa willd on ovarian cancer cells', Journal of Ethnopharmacology, vol. 192, pp. 132-9.
Zhang, P, Zhang, B, Gu, J, Hao, L, Hu, F & Han, C 2015, 'The Study of the Effect of Hedyotis diffusa on the Proliferation and the Apoptosis of the Cervical Tumor in Nude Mouse Model', Cell Biochemistry and Biophysics, vol. 72, no. 3, pp. 783-9.
Zhu, H, Miao, Z-H, Huang, M, Feng, J-M, Zhang, Z-X, Lu, J-J, Cai, Y-J, Tong, L-J, Xu, Y- F, Qian, X-H & Ding, J 2009, 'Naphthalimides Induce G2 Arrest Through the ATM- Activated Chk2-Executed Pathway in HCT116 Cells', Neoplasia, vol. 11, no. 11, pp. 1226- 34.
232