The of in metazoa

MCB 140 11/29/06 1

Hermann Joseph Muller

1946 Nobel Prize in Medicine:

"for the discovery of the production of mutations by means of X-ray irradiation"

MCB 140 11/29/06 3 MCB 140 11/29/06 4

The true meaning of "red eye reduction":

White wild-type

White mutant

12.14 MCB 140 11/29/06 5 MCB 140 11/29/06 6

1 Gene behavior can change depending on where on the chromosome the gene lies.

= “position effect” (bar is the most commonly used example)

“Position effect variegation” (PEV): cell-to-cell variability of expression of a gene that has been relocated to a new position in the genome.

Epigenetic phenomenon: Stable change in expression without change in sequence!

12.14 MCB 140 11/29/06 7 MCB 140 11/29/06 8

2 genes:

Su(var)2-5

Enhancer of PEV Su(var)3-9

Suppressor of PEV

MCB 140 11/29/06 9 MCB 140 11/29/06 10

MCB 140 11/29/06 11 MCB 140 11/29/06 12

2 HP1 (Sarah Elgin)

(heterochromatin protein 1)

Identified in a BIOCHEMICAL scheme to discover proteins that are associated with heterochromatin.

MCB 140 11/29/06 13 MCB 140 11/29/06 14

genetics “Biochemical epistasis” (T. Jenuwein) HP1 = Su(var)2-5

Conserved in humans and in mice (both in terms of sequence and intranuclear location!).

Why does HP1 go to places that HP1 goes to?

Overexpression of mouse Su(var)3-9 leads to a MASSIVE redistribution of HP1 in the nucleus of mouse cells.

MCB 140 11/29/06 15 MCB 140 11/29/06 16

Who would have thunk it? Histone methylation

NCBI: Su(var)3-9 contains a domain (the SET domain) that is somewhat similar to, ahem, RUBISCO methyltransferase.

Su(var)3-9 is a HISTONE methyltransferase.

MCB 140 11/29/06 17 MCB 140 11/29/06 18

3 Calling David Duchovny And finally and Gillian Anderson • HP1 preferentially BINDS histone H3 • Su(var)3-9 was given this name because it methylated on lysine 9. was the 9th gene isolated on the 3rd • That’s why Su(var)3-9 determines chromosome in a screen for Su(var)s. localization of HP1 to heterochromatin (it • It methylates lysine 9 in histone H3. methylates histones in heterochromatin). • At least in fission yeast, and perhaps in This was discovered 18 years after it was worms, this has to do with RNAi. ☺ named.

MCB 140 11/29/06 19 MCB 140 11/29/06 20

MCB 140 11/29/06 21 MCB 140 11/29/06 22

HP1 HP1===HP1 HP1 HP1 HP1 HP1 HP1

HP1 HP1

MCB 140 11/29/06 23 MCB 140 11/29/06 24

4 Remembrance of things past: Homology chromatin as an epigenetic vehicle (orthologs of heterochomatin proteins in fission yeast, insects, and humans)

MCB 140 11/29/06 25 MCB 140 11/29/06 26

Analogy Nature, October 10, 2002

The polycomb group protein EZH2 is involved in progression of prostate cancer Varambally et al. Prostate cancer is a leading cause of cancer-related death in males and is second only to lung cancer. Although effective surgical and radiation treatments exist for clinically localized prostate cancer, metastatic prostate cancer remains essentially incurable. Here we show, through gene expression profiling, that the polycomb group protein enhancer of zeste homolog 2 (EZH2) is overexpressed in hormone-refractory, metastatic prostate cancer. … Dysregulated expression of EZH2 may be involved in the progression of prostate cancer, as well as being a marker that distinguishes indolent prostate cancer from those at risk of lethal progression.

Fission yeast, flies, mammals. Budding yeast. MCB 140 11/29/06 27 MCB 140 11/29/06 28

From egg to embryo

?

29 30

5 Homeotic mutations (W. Bateson)

Genetics Allele Heterozygous Homozygous

“… Not that there has merely been a change, but that something has been changed wt antennapedia into the likeness of something else.”

MCB 140 11/29/06 31 MCB 140 11/29/06 32

The segmentation hierarchy

34

MCB 140 11/29/06 33

“Do you have any idea who I think I am?!!” How Polycomb and Trithorax work

1. Segment identity is determined by transcription factors. 2. They act on target genes only transiently. Then they go away, and the activity of their targets is maintained by large complexes: Polycomb represses genes, and Trithorax activates them. 3. Nobody knew how Polycomb and Trithorax do this.

MCB 140 11/29/06 35 MCB 140 11/29/06 36

6 E(z) does it

Posted September 13, 2002 – CELL immediate early publication

extra sex combs Czermin, B., Melfi, R., McCabe, D., Seitz, V., Imhof, A., and Pirrotta, V. Enhancer of Zeste/ESC complexes have a histone H3 methyltransferase activity that marks chromosomal Polycomb sites. Cell. Published online September 13, 2002. enhancer of zeste 10.1016/S0092867402009753

Müller, J., Hart, C.M., Francis, N.J., Vargas, M.L., Sengupta, A., Wild, B., Miller, E.L., O'Connor, M.B., Kingston, R.E., and Simon, J.A. Histone methyltransferase activity of a Drosophila Polycomb group repressor complex. Cell. Published online September 13, 2002. 10.1016/S0092867402009765

MCB 140 11/29/06 37 MCB 140 11/29/06 38

“Influential ideas are always simple. Since natural phenomena need not be simple, we master them, if at all, by formulating simple ideas and exploring their limitations.”

Al Hershey

MCB 140 11/29/06 39 MCB 140 11/29/06 40

stimulus + +

Regulation of genes occurs via the interaction of trans- acting factors (proteins) with cis-acting sequences near the genes themselves.

MCB 140 11/29/06 41 MCB 140 11/29/06 42

7 Bicoid is the anterior morphogen

43 44

What democracy, I mean, gene regulation, is really like • Trans-acting factors do not distribute in the nucleus based on the primary sequence of the genome: some factors fail to bind most genes that have sequences waiting for them, and other factors bind a large number of genes that do NOT have sequences for them • Even when a factor binds next to a gene, many times, nothing happens; the same factor bound to two different genes can exert diametrically opposite effects • Most genes in the human genome are under considerable regulatory influence from entities other than “simple” trans-acting factors; these entities include noncoding RNA and modified histones

MCB 140 11/29/06 45 MCB 140 11/29/06 46

Boyer and Young David Allis: “the histone code” Cell Sept. 23, 2005

MCB 140 11/29/06 47 Fischle, Wang, Allis COCB 2003

8 1963-2000 2000 -…

Genetic information

Lac operator

gaattgtgagcggataacaattt

Henry et al. (11/1/2003) Genes Dev. 17: 2648.

MCB 140 11/29/06 51

-

Genetic information Genetic information

? +

9