DOCSLIB.ORG

1 the Genetics of Heterochromatin in Metazoa

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
1 the Genetics of Heterochromatin in Metazoa The genetics of heterochromatin in metazoa MCB 140 11/29/06 1 Hermann Joseph Muller 1946 Nobel Prize in Medicine: "for the discovery of the production of mutations by means of X-ray irradiation" MCB 140 11/29/06 3 MCB 140 11/29/06 4 The true meaning of "red eye reduction": White wild-type White mutant 12.14 MCB 140 11/29/06 5 MCB 140 11/29/06 6 1 Gene behavior can change depending on where on the chromosome the gene lies. = “position effect” (bar is the most commonly used example) “Position effect variegation” (PEV): cell-to-cell variability of expression of a gene that has been relocated to a new position in the genome. Epigenetic phenomenon: Stable change in expression without change in sequence! 12.14 MCB 140 11/29/06 7 MCB 140 11/29/06 8 2 genes: Su(var)2-5 Enhancer of PEV Su(var)3-9 Suppressor of PEV MCB 140 11/29/06 9 MCB 140 11/29/06 10 MCB 140 11/29/06 11 MCB 140 11/29/06 12 2 HP1 (Sarah Elgin) (heterochromatin protein 1) Identified in a BIOCHEMICAL scheme to discover proteins that are associated with heterochromatin. MCB 140 11/29/06 13 MCB 140 11/29/06 14 biochemistry genetics “Biochemical epistasis” (T. Jenuwein) HP1 = Su(var)2-5 Conserved in humans and in mice (both in terms of sequence and intranuclear location!). Why does HP1 go to places that HP1 goes to? Overexpression of mouse Su(var)3-9 leads to a MASSIVE redistribution of HP1 in the nucleus of mouse cells. MCB 140 11/29/06 15 MCB 140 11/29/06 16 Who would have thunk it? Histone methylation NCBI: Su(var)3-9 contains a domain (the SET domain) that is somewhat similar to, ahem, RUBISCO methyltransferase. Su(var)3-9 is a HISTONE methyltransferase. MCB 140 11/29/06 17 MCB 140 11/29/06 18 3 Calling David Duchovny And finally and Gillian Anderson • HP1 preferentially BINDS histone H3 • Su(var)3-9 was given this name because it methylated on lysine 9. was the 9th gene isolated on the 3rd • That’s why Su(var)3-9 determines chromosome in a screen for Su(var)s. localization of HP1 to heterochromatin (it • It methylates lysine 9 in histone H3. methylates histones in heterochromatin). • At least in fission yeast, and perhaps in This was discovered 18 years after it was worms, this has to do with RNAi. ☺ named. MCB 140 11/29/06 19 MCB 140 11/29/06 20 MCB 140 11/29/06 21 MCB 140 11/29/06 22 HP1 HP1===HP1 HP1 HP1 HP1 HP1 HP1 HP1 HP1 MCB 140 11/29/06 23 MCB 140 11/29/06 24 4 Remembrance of things past: Homology chromatin as an epigenetic vehicle (orthologs of heterochomatin proteins in fission yeast, insects, and humans) MCB 140 11/29/06 25 MCB 140 11/29/06 26 Analogy Nature, October 10, 2002 The polycomb group protein EZH2 is involved in progression of prostate cancer Varambally et al. Prostate cancer is a leading cause of cancer-related death in males and is second only to lung cancer. Although effective surgical and radiation treatments exist for clinically localized prostate cancer, metastatic prostate cancer remains essentially incurable. Here we show, through gene expression profiling, that the polycomb group protein enhancer of zeste homolog 2 (EZH2) is overexpressed in hormone-refractory, metastatic prostate cancer. … Dysregulated expression of EZH2 may be involved in the progression of prostate cancer, as well as being a marker that distinguishes indolent prostate cancer from those at risk of lethal progression. Fission yeast, flies, mammals. Budding yeast. MCB 140 11/29/06 27 MCB 140 11/29/06 28 From egg to embryo ? 29 30 5 Homeotic mutations (W. Bateson) Genetics Allele Heterozygous Homozygous “… Not that there has merely been a change, but that something has been changed wt antennapedia into the likeness of something else.” MCB 140 11/29/06 31 MCB 140 11/29/06 32 The segmentation hierarchy 34 MCB 140 11/29/06 33 “Do you have any idea who I think I am?!!” How Polycomb and Trithorax work 1. Segment identity is determined by transcription factors. 2. They act on target genes only transiently. Then they go away, and the activity of their targets is maintained by large complexes: Polycomb represses genes, and Trithorax activates them. 3. Nobody knew how Polycomb and Trithorax do this. MCB 140 11/29/06 35 MCB 140 11/29/06 36 6 E(z) does it Posted September 13, 2002 – CELL immediate early publication extra sex combs Czermin, B., Melfi, R., McCabe, D., Seitz, V., Imhof, A., and Pirrotta, V. Drosophila Enhancer of Zeste/ESC complexes have a histone H3 methyltransferase activity that marks chromosomal Polycomb sites. Cell. Published online September 13, 2002. enhancer of zeste 10.1016/S0092867402009753 Müller, J., Hart, C.M., Francis, N.J., Vargas, M.L., Sengupta, A., Wild, B., Miller, E.L., O'Connor, M.B., Kingston, R.E., and Simon, J.A. Histone methyltransferase activity of a Drosophila Polycomb group repressor complex. Cell. Published online September 13, 2002. 10.1016/S0092867402009765 MCB 140 11/29/06 37 MCB 140 11/29/06 38 “Influential ideas are always simple. Since natural phenomena need not be simple, we master them, if at all, by formulating simple ideas and exploring their limitations.” Al Hershey MCB 140 11/29/06 39 MCB 140 11/29/06 40 stimulus + + Regulation of genes occurs via the interaction of trans- acting factors (proteins) with cis-acting sequences near the genes themselves. MCB 140 11/29/06 41 MCB 140 11/29/06 42 7 Bicoid is the anterior morphogen 43 44 What democracy, I mean, gene regulation, is really like • Trans-acting factors do not distribute in the nucleus based on the primary sequence of the genome: some factors fail to bind most genes that have sequences waiting for them, and other factors bind a large number of genes that do NOT have sequences for them • Even when a factor binds next to a gene, many times, nothing happens; the same factor bound to two different genes can exert diametrically opposite effects • Most genes in the human genome are under considerable regulatory influence from entities other than “simple” trans-acting factors; these entities include noncoding RNA and modified histones MCB 140 11/29/06 45 MCB 140 11/29/06 46 Boyer and Young David Allis: “the histone code” Cell Sept. 23, 2005 MCB 140 11/29/06 47 Fischle, Wang, Allis COCB 2003 8 1963-2000 2000 -… Genetic information Lac operator gaattgtgagcggataacaattt Henry et al. (11/1/2003) Genes Dev. 17: 2648. MCB 140 11/29/06 51 - Genetic information Genetic information ? + 9.
Load more

Recommended publications
  • The Role of Histone H2av Variant Replacement and Histone H4 Acetylation in the Establishment of Drosophila Heterochromatin
    The role of histone H2Av variant replacement and histone H4 acetylation in the establishment of Drosophila heterochromatin Jyothishmathi Swaminathan, Ellen M. Baxter, and Victor G. Corces1 Department of Biology, Johns Hopkins University, Baltimore, Maryland 21218, USA Activation and repression of transcription in eukaryotes involve changes in the chromatin fiber that can be accomplished by covalent modification of the histone tails or the replacement of the canonical histones with other variants. Here we show that the histone H2A variant of Drosophila melanogaster, H2Av, localizes to the centromeric heterochromatin, and it is recruited to an ectopic heterochromatin site formed by a transgene array. His2Av behaves genetically as a PcG gene and mutations in His2Av suppress position effect variegation (PEV), suggesting that this histone variant is required for euchromatic silencing and heterochromatin formation. His2Av mutants show reduced acetylation of histone H4 at Lys 12, decreased methylation of histone H3 at Lys 9, and a reduction in HP1 recruitment to the centromeric region. H2Av accumulation or histone H4 Lys 12 acetylation is not affected by mutations in Su(var)3-9 or Su(var)2-5. The results suggest an ordered cascade of events leading to the establishment of heterochromatin and requiring the recruitment of the histone H2Av variant followed by H4 Lys 12 acetylation as necessary steps before H3 Lys 9 methylation and HP1 recruitment can take place. [Keywords: Chromatin; silencing; transcription; histone; nucleus] Received September 8, 2004; revised version accepted November 4, 2004. The basic unit of chromatin is the nucleosome, which is guchi et al. 2004). The role of histone variants, and spe- made up of 146 bp of DNA wrapped around a histone cially those of H3 and H2A, in various nuclear processes octamer composed of two molecules each of the histones has been long appreciated (Wolffe and Pruss 1996; Ah- H2A, H2B, H3, and H4.
    [Show full text]
  • TALE-Light Imaging Reveals Maternally Guided, H3k9me2/3-Independent Emergence of Functional Heterochromatin in Drosophila Embryos
    Downloaded from genesdev.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press TALE-light imaging reveals maternally guided, H3K9me2/3-independent emergence of functional heterochromatin in Drosophila embryos Kai Yuan and Patrick H. O’Farrell Department of Biochemistry, University of California at San Francisco, San Francisco, California 94158, USA Metazoans start embryogenesis with a relatively naïve genome. The transcriptionally inert, late-replicating het- erochromatic regions, including the constitutive heterochromatin on repetitive sequences near centromeres and telomeres, need to be re-established during development. To explore the events initiating heterochromatin forma- tion and examine their temporal control, sequence specificity, and immediate regulatory consequence, we estab- lished a live imaging approach that enabled visualization of steps in heterochromatin emergence on specific satellite sequences during the mid-blastula transition (MBT) in Drosophila. Unexpectedly, only a subset of satellite se- quences, including the 359-base-pair (bp) repeat sequence, recruited HP1a at the MBT. The recruitment of HP1a to the 359-bp repeat was dependent on HP1a’s chromoshadow domain but not its chromodomain and was guided by maternally provided signals. HP1a recruitment to the 359-bp repeat was required for its programmed shift to later replication, and ectopic recruitment of HP1a was sufficient to delay replication timing of a different repeat. Our results reveal that emergence of constitutive heterochromatin follows a stereotyped developmental program in which different repetitive sequences use distinct interactions and independent pathways to arrive at a heterochro- matic state. This differential emergence of heterochromatin on various repetitive sequences changes their replica- tion order and remodels the DNA replication schedule during embryonic development.
    [Show full text]
  • Drosophila Ribosomal Proteins Are Associated with Linker Histone H1 and Suppress Gene Transcription
    Downloaded from genesdev.cshlp.org on October 2, 2021 - Published by Cold Spring Harbor Laboratory Press Drosophila ribosomal proteins are associated with linker histone H1 and suppress gene transcription Jian-Quan Ni,1,3 Lu-Ping Liu,1,3 Daniel Hess,1 Jens Rietdorf,1 and Fang-Lin Sun1,2,4 1Friedrich Miescher Institute for Biomedical Research, Basel CH-4058, Switzerland; 2Institute of Epigenetics and Cancer Research, School of Medicine, Tsinghua University, Beijing 100080, China The dynamics and function of ribosomal proteins in the cell nucleus remain enigmatic. Here we provide evidence that specific components of Drosophila melanogaster ribosomes copurify with linker histone H1. Using various experimental approaches, we demonstrate that this association of nuclear ribosomal proteins with histone H1 is specific, and that colocalization occurs on condensed chromatin in vivo. Chromatin immunoprecipitation analysis confirmed that specific ribosomal proteins are associated with chromatin in a histone H1-dependent manner. Overexpression of either histone H1 or ribosomal protein L22 in Drosophila cells resulted in global suppression of the same set of genes, while depletion of H1 and L22 caused up-regulation of tested genes, suggesting that H1 and ribosomal proteins are essential for transcriptional gene repression. Overall, this study provides evidence for a previously undefined link between ribosomal proteins and chromatin, and suggests a role for this association in transcriptional regulation in higher eukaryotes. [Keywords: Ribosomal protein; L22; histone H1; chromatin; transcription] Supplemental material is available at http://www.genesdev.org. Received September 25, 2005; revised version accepted May 8, 2006. Transcription and translation in eukaryotes are generally discrete nuclear sites was sensitive to inhibitors of both believed to take place within two spatially separated cel- transcription and translation, arguing that the two pro- lular compartments.
    [Show full text]
  • Introduction to the Genomics Education Partnership and Collaborative Genomics Research in Drosophila
    Tested Studies for Laboratory Teaching Proceedings of the Association for Biology Laboratory Education Vol. 34, 135-165, 2013 Introduction to the Genomics Education Partnership and Collaborative Genomics Research in Drosophila Julia A. Emerson1, S. Catherine Silver Key2, Consuelo J. Alvarez3, Stephanie Mel4, Gerard P. McNeil5, Kenneth J. Saville6, Wilson Leung7, Christopher D. Shaffer7 and Sarah C. R. Elgin7 1Amherst College, Department of Biology, P.O. Box 5000, Amherst MA 01002 USA 2North Carolina Central University, Department of Biology, 2246 MTSB, Durham NC 27701 USA 3Longwood University, Department of Biological and Environmental Sciences, 201 High St., Farmville VA 23909 USA 4University of California San Diego, Division of Biological Sciences, 9500 Gilman Drive 0355, La Jolla CA 92093 USA 5York College/CUNY, Department of Biology, 94-20 Guy R. Brewer Blvd., Jamaica NY 11451 USA 6 Albion College, Biology Department, 611 E. Porter St., Albion MI 49224 USA 7Washington University, Department of Biology, Campus Box 1137, One Brookings Dr., St. Louis MO 3130 USA ([email protected]; [email protected]; [email protected]; [email protected]; [email protected]; [email protected]; [email protected]; [email protected]; [email protected]) The GEP, a group of faculty from over 90 primarily undergraduate institutions, is using comparative genomics to engage students in research within regular courses. Using a versatile curriculum, GEP undergraduates undertake projects to improve draft genomic sequences and/or participate in the annotation of these improved sequences. An additional goal of the annotation curriculum is for students to gain a sophisticated understanding of eukaryotic gene structure. Students do so by carefully mapping the protein-coding regions of putative genes from recently- sequenced Drosophila species.
    [Show full text]
  • Workshop Notebook
    GCAT WORKSHOPS 2009 NSF SUPPORTED DNA MICROARRAY WORKSHOPS FOR HISTORICALLY BLACK COLLEGES AND UNIVERSITIES, HISPANIC-SERVING INSTITUTIONS AND TRIBAL COLLEGES FACULTY JULY 5 - July 11, 2009 HOST INSTITUTION: MOREHOUSE COLLEGE BIOLOGY DEPARTMENT; ATLANTA, GA INSTRUCTORS Consuelo Alvarez, Malcolm Campbell, Todd Eckdahl, Edison Fowlks, Charles Hauser, Laurie Heyer, and Anne Rosenwald Genome Consortium for Active Teaching (GCAT) NSF GRANT DBI-0520908 Awarded to Hampton University PI: Edison R. Fowlks; Co-PIs: Mary Lee Ledbetter and Anne Rosenwald and NSF GRANT DBI-0520908 Awarded to Davidson College PI: Malcolm Campbell; Co-PIs: Laurie Heyer and Todd Eckdahl By the DIRECTORATE FOR BIOLOGICAL SCIENCES NATIONAL SCIENCE FOUNDATION DR. SALLY O’CONNOR, MANAGERING PROGRAM OFFICER NSF-SPONSORED GCAT DNA MICROARRAY SUMMER WORKSHOPS FOR UNDERGRADUATE HBCU, HSI AND TRIBAL COLLEGE FACULTY TAB I. Origin of this NSF Workshop and History of GCAT 1 II. Workshop Participants and Instructors 2 III. Workshop Schedule of Dry and Wet Lab Activities 3 IV. Assessment Material 4 A. Pre-Test B. Post-Test V. Wet Lab Activities 6 A. Culturing Yeast B. Isolating RNA C. 3DNA Protocol VI. Dry Lab Activities 7 A. Magic Tool User Guide B. Magic Tool: Exploring Diauxic Shift Microarray Data C. Exploring Correlations VII. Sampling of Microarray Articles 7 VIII. Notes, Special Instructions & Directions 8 ORIGIN OF THIS NSF WORKSHOP At a curriculum gathering during summer of 2004, Drs. Fowlks and Campbell presented their perspectives on the undergraduate educational implications of the NIH Roadmap. Fowlks addressed curricular changes in undergraduate biology, as well as recruitment and training for underrepresented populations. Campbell provided an overview of activities by GCAT, a non-profit educational consortium, to bring functional genomics methods into undergraduate courses and independent student research.
    [Show full text]
  • Claire Barrett, Greg Creacy, Charles Hauser
    Charles R. Hauser Associate Professor of Bioinformatics St. Edward’s University Voice: (512) 233.1671 Bioinformatics Program Fax. (512) 448.8764 Austin TX 78704 e-mail: [email protected] Professional Preparation University of Texas, Austin, TX 1972-1977 Botany University of Houston, TX 1984-1989 PhD. Biochemistry and Biophysics Duke University 1989-1995 Post-doctoral fellowship Appointments 2008 - Associate Professor Bioinformatics, St. Edward’s University 2004 - 2008 Assistant Professor Bioinformatics, St. Edward’s University 2000 - 2004 Research Scientist: Duke University, Durham NC 1995 - 2000 Research Associate: Duke University, Durham, NC 1989 - 1995 Postdoctoral Associate: Duke University, Durham, NC 1984 - 1989 Graduate Student/Researcher: University of Houston Awards and Honors 2016 St. Edward’s School of Natural Sciences Distinguished Research Award, 2015-16. 1990 NIH Postdoctoral Fellowship. Department of Botany, Duke University, Durham, NC. 1989 Hargitt Fellowship. Department of Zoology, Duke University, Durham, NC. Grants 2016 Howard Hughes Medical Institute (USE), Inclusive Excellence Grants 2017 Pre-proposal. Research L Kopec (PI), Charles R Hauser (collaborator) 2016 NSF, IUSE, “Integrating Bioinformatics into the Life Sciences—Phase 3” Mark Pauley (U. Nebraska, Omaha), Vince Buonaccorsi (Juniata College), Anya Goodman (California Polytechnic State University), Anne Rosenwald (Georgetown University) and Bill Tapprich (University of Nebraska at Omaha) Co-PIs. Charles Hauser (Advisory Committee Member). 2015 USDA, The Agricultural-STEM Pipeline: Progressive Experiential Learning Linking Three HSI Academic Tiers (Ag-STEM), 3 year ($275,000), Drs. O’Leary (PI), Quinn, Hauser, Deaton (co-PIs) 2015 NIH, “A Genome Browser On Ramp to Engage Biologists with Big Data”, Dr. Sarah Elgin, Washington University St. Louis (PI), Hauser (collaborator).
    [Show full text]
  • Finding Genes in a New Fly Genome: Teaching About Genes/Genomes Via Bioinformatics Research
    Finding Genes in a New Fly Genome: Teaching about Genes/Genomes via Bioinformatics Research Sarah Elgin, Anya Goodman, Wilson Leung Eric Tsoi, Charlene Emerson, David Carranza January 2012 Workshop Goals • Introduce Genomics Education Partnership • Hands-on practice with genome annotation • Discussion of curriculum options 3-week module ( ~10 hr: 1 lecture, 3X3 lab) 5-week – add a more difficult project 10-week - real research! • Scientific background on Drosophila genome • http://gep.wustl.edu [email protected] • Next workshops: June 24-26, August 19-22 (HHMI supported) Genomics Education Partnership (GEP) Goal: to engage students in a genomics research project, via a research-oriented AY lab course. Work organized through the GEP website. Our GEP research goal: Use comparative genomics to learn more about heterochromatic domains, analyzing the dot chromosomes and a control euchromatic region of Drosophila genomes Status Reference Completed Annotation Sequence Improvement New Project FlyBase: http://flybase.org I hear and I forget. I see and I remember. I do and I understand Confucius The scientific method allows ordinary people to do extraordinary things. Francis Bacon Genomics provides terrific opportunities to engage undergraduates in research! Strategy: divide and conquer! The D. mojavensis dot chromosome • Students completed 68 projects covering 1.7 Mb closing 26/28 gaps, adding ~15,000 bp and improving ~5000 bp. • Each project finished and annotated (all isoforms) twice; reconciliation for quality control done at Wash U Fosmid
    [Show full text]
  • Heterochromatin-Associated Interactions of Drosophila Hp1a with Dadd1, HIPP1, and Repetitive Rnas
    Downloaded from genesdev.cshlp.org on October 3, 2021 - Published by Cold Spring Harbor Laboratory Press Heterochromatin-associated interactions of Drosophila HP1a with dADD1, HIPP1, and repetitive RNAs Artyom A. Alekseyenko,1,2 Andrey A. Gorchakov,1,2,3 Barry M. Zee,1,2 Stephen M. Fuchs,4 Peter V. Kharchenko,5,6,7 and Mitzi I. Kuroda1,2,7 1Division of Genetics, Department of Medicine, Brigham and Women’s Hospital, Harvard Medical School, Boston, Massachusetts 02115, USA; 2Department of Genetics, Harvard Medical School, Boston, Massachusetts 02115, USA; 3Institute of Molecular and Cellular Biology, Novosibirsk 630090, Russia; 4Department of Biology, Tufts University, Medford, Massachusetts 02155, USA; 5Center for Biomedical Informatics, Harvard Medical School, Boston, Massachusetts 02115, USA; 6Hematology/Oncology Program, Children’s Hospital, Boston, Massachusetts 02115, USA Heterochromatin protein 1 (HP1a) has conserved roles in gene silencing and heterochromatin and is also implicated in transcription, DNA replication, and repair. Here we identify chromatin-associated protein and RNA interactions of HP1a by BioTAP-XL mass spectrometry and sequencing from Drosophila S2 cells, embryos, larvae, and adults. Our results reveal an extensive list of known and novel HP1a-interacting proteins, of which we selected three for validation. A strong novel interactor, dADD1 (Drosophila ADD1) (CG8290), is highly enriched in heterochromatin, harbors an ADD domain similar to human ATRX, displays selective binding to H3K9me2 and H3K9me3, and is a classic genetic suppressor of position-effect variegation. Unexpectedly, a second hit, HIPP1 (HP1 and insulator partner protein-1) (CG3680), is strongly connected to CP190-related complexes localized at putative insulator sequences throughout the genome in addition to its colocalization with HP1a in heterochro- matin.
    [Show full text]
  • Driving Gene Expression in the Heterochromatic Environment of the Fourth Chromosome of D
    Washington University in St. Louis Washington University Open Scholarship Washington University Volume 12 Undergraduate Research Digest Spring 2017 Driving Gene Expression in the Heterochromatic Environment of the Fourth Chromosome of D. melanogaster Jacob Cantrell Washington University in St. Louis Follow this and additional works at: https://openscholarship.wustl.edu/wuurd_vol12 Recommended Citation Cantrell, Jacob, "Driving Gene Expression in the Heterochromatic Environment of the Fourth Chromosome of D. melanogaster" (2017). Volume 12. 25. https://openscholarship.wustl.edu/wuurd_vol12/25 This Abstracts A-I is brought to you for free and open access by the Washington University Undergraduate Research Digest at Washington University Open Scholarship. It has been accepted for inclusion in Volume 12 by an authorized administrator of Washington University Open Scholarship. For more information, please contact [email protected]. Toward a Better Understanding of... Driving Gene Expression in the Heterochromatic Environment of the Fourth Chromosome of D. melanogaster Jacob Cantrell Mentor: Sarah Elgin Genomes of higher eukaryotes can be divided into two fundamental and dynamic subtypes: euchromatin and heterochromatin. The fourth chromosome of Drosophila melanogaster is of particular interest because, despite the fact that it appears to be entirely heterochromatic, the genes within this densely packaged chromosome are expressed. Genes that are active in a euchromatic environment are silenced when transposed to heterochromatin. Our aim is to identify heterochromatic gene regulatory elements that drive their active transcription. Insertion of a euchromatic hsp70-white transgene, which exhibits a uniform red eye phenotype when present in euchromatin, into heterochromatic regions on the fourth chromosome results in sporadic silencing, or Position Effect Variegation (PEV).
    [Show full text]
  • Download PDF of This Story
    s she faced the end of grad time away from the lab will mean fewer publications—and more school, Karmella Haynes difficulty getting a job. wasn’t sure what direction Haynes’s mentor was Sarah Elgin, an HHMI professor who to take. “I couldn’t think of a created the Genomics Education Partnership and is intensely research project that got me involved in developing better ways to teach genomics. Haynes really excited,” says the gradu- recalls Elgin strongly encouraging her to take a traditional ate of Washington University research postdoc at first. But Haynes was persistent, so Elgin in St. Louis. pointed her toward a teaching postdoc position at Davidson Col- Haynes thought she might want to teach. But, like many lege in North Carolina. modern grad students and postdocs, she didn’t have enough Haynes thought it might be a chance to find out about life at experience teaching to know if she liked it—or if she could a liberal arts college while exploring whether she liked teaching. get a job doing it. She chose Davidson’s postdoc over other teaching opportunities Science educators say teaching experience is vital for post- because it provided a mix of education and research—just in case docs, many of whom are going to be teaching as part of their she changed her mind. faculty duties someday. But a lot of schools are struggling with “I was very aware of the fact that I was taking an alternative how to prepare graduate students and postdocs to teach, and there path,” Haynes says.
    [Show full text]
  • Technological Breakthroughs Transform Biological Inquiry in Neuroscience
    A Magazine | The School of Molecular and Cellular Biology at the University of Illinois at Urbana-Champaign | Issue 10, 2017 MCB TECHNOLOGICAL BREAKTHROUGHS TRANSFORM BIOLOGICAL INQUIRY IN NEUROSCIENCE College of Liberal Arts and Sciences LETTER FROM THE DIRECTOR Fifty-three years ago, Bob Dylan released the song “The Times They Are a Changin’.” Today, times are indeed different at the University of Illinois. Many of you know that I earned my Ph.D. in Physics in the College of Engineering here, matriculating in 1970. This was the height of the VietnamWar and the draft took several fellow graduate students – some not returning, while others were forced to change from experiment to theory due to loss of multiple limbs. Those were polarized times, and they remain so. The campus is putting in place financial models that call for a reduced reliance on the State for resources. Despite these challenges, MCB remains a bright and shining jewel. Campus resources are committed to two exciting academic projects: A new Carle-Illinois College of Medicine and a cross-campus Siebel Design Center. MCB will play important roles in these and other initiatives. The School of MCB is on solid financial ground, with high demand for the MCB major and undergraduate enrollments limited only by the availability of instructional space. The research prowess of MCB faculty has translated into MCB Dr. Stephen G. Sligar leading in the receipt of external funding from the National Institutes of Health, the main source of the United States investment in health related research. That said, we increasingly rely on support from our alumni and friends, as demonstrated in several articles in this issue of the MCB Magazine.
    [Show full text]
  • 2017 St Louis Midstates Program Fnl 11 8
    The Midstates Consortium for Math and Science presents ndergraduate esearch ymposium Biological Sciences and Psychology November 10 & 11, 2017 Washington University in St. Louis Beloit College - Carthage College - Colorado College - Grinnell College Gustavus Adolphus College - Hope College - Knox College Lawrence University - Luther College - Macalester College St. Olaf College - University of Chicago Washington University in St. Louis Table of Contents Program Schedule .................................................................................................................................................. 4 2017 Keynote Lecture: Combating Antibiotic Resistant Superbugs Across Diverse Habitats ................................ 6 2017 Janet Andersen Lecture: Research Without Borders: Research as Service .................................................. 7 Information about the Janet Andersen Lecture Award ......................................................................................... 7 Oral Sessions Schedule ........................................................................................................................................... 9 Poster Sessions Schedule ..................................................................................................................................... 11 Abstracts for all Sessions ...................................................................................................................................... 17 Students presenting at St. Louis Midstates Undergraduate
    [Show full text]