975 Analysis of the estrogen regulation of the zebrafish estrogen receptor (ER) reveals distinct effects of ER
, ER1 and ER2

A Menuet, Y Le Page, O Torres, L Kern, O Kah and F Pakdel Endocrinologie Moléculaire de la Reproduction, UMR CNRS 6026, Université de Rennes 1, 35042 Rennes cedex, France

(Requests for offprints should be addressed to F Pakdel, Endocrinologie Moléculaire de la Reproduction, UMR CNRS 6026, Université de Rennes 1, Campus de Beaulieu, 35042 Rennes cedex, France; Email : [email protected])

Abstract

We have previously cloned and characterized three estrogen receptors (ER) in the zebrafish (zfER
, zfER1 and zfER2). We have also shown that they are functional in vitro and exhibit a distinct expression pattern, although partially overlapping, in the brain of zebrafish. In this paper, we have shown that the hepatic expression of these zfER genes responds differently to estradiol (E2). In fact, a 48-h direct exposure of zebrafish to E2 resulted in a strong stimulation of zfER
gene expression while zfER1 gene expression was markedly reduced and zfER2 remained virtually unchanged. To establish the potential implication of each zfER in the E2 upregulation of the zfER
gene, the promoter region of this gene was isolated and characterized. Transfection experiments with promoter–luciferase reporter constructs together with different zfER expression vectors were carried out in different cell contexts. The data showed that in vivo E2 upregulation of the zfER
gene requires ER
itself and a conserved transcription unit sequence including at least an imperfect estrogen-responsive element (ERE) and an AP-1/ERE half site at the proximal transcription initiation site. Interestingly, although in the presence of E2 zfER
was the most potent at inducing the expression of its own gene, the effect of E2 mediated by zfER2 represented 50% of the zfER
activity. In contrast, zfER1 was unable to upregulate the zfER
gene whereas this receptor form was able to tightly bind E2 and activate a reporter plasmid containing a consensus ERE. Altogether, these results indicated that the two ER forms recently characterized in teleost fish could have partially distinct and not redundant functions. Journal of Molecular Endocrinology (2004) 32, 975–986

Introduction ERs can regulate the transcription by direct protein–protein interactions with the AP-1 or Sp1 In all vertebrates, estradiol (E2) is involved in transcription factors (Paech et al. 1997, Webb et al. numerous physiological processes during develop- 1999, Saville et al. 2000). Although the mammalian ment and adult life. These effects are mediated ERs share the same modular organization, recent by members of the nuclear receptor family, the data showed that they may have different estrogen receptors ER
and ER. These proteins transcriptional capacities on E2 target genes classically regulate the expression of E2 target (Kuiper et al. 1997, Tremblay et al. 1997). genes by direct binding with a specific palindromic Differences between ER subtypes in relative DNA sequence called the estrogen-responsive ligand-binding affinity have been described. A element (ERE: AGGTCAnnnTGACCT) which range of natural and synthetic agonists or permits recruitment of cofactors necessary for antagonists induced distinct conformational transcription (Zilliacus et al. 1995, Klinge 2000). changes in the tertiary structure of the ERs which Moreover, an important number of E2-sensitive induced differential cofactor recruitment. In conse- genes, which do not contain ERE but do contain quence, the effects of E2 at the transcriptional other cis-elements such as AP-1 or Sp1, have been level depend on the promoter, the presence of described. It was recently proved that, in this case, cell-specific factors and the ER subtype, which

Journal of Molecular Endocrinology (2004) 32, 975–986 Online version via http://www.endocrinology.org 0952–5041/04/032–975 © 2004 Society for Endocrinology Printed in Great Britain

Downloaded from Bioscientifica.com at 10/01/2021 09:37:16AM via free access 976 A MENUET and others · Estrogen regulation of three zebrafish ERs

could explain in part the pleiotropic effects of E2 at transcripts. To investigate whether or not zfER1 the physiological level. and zfER2 are involved in hepatic vitellogenesis In addition to natural hormones or effectors, and therefore in hepatic zfER
regulation, the including growth factors, several classes of envir- zfER
promoter region was isolated and character- onmental contaminants could also interact with ized. The data showed that, in contrast to zfER1, ERs and modulate the expression of E2 target zfER2 was able to significantly stimulate the genes. These latter molecules, usually referred to as expression of the zfER
gene in the presence of endocrine disrupters, are susceptible to impairing E2. Moreover, expression of zfER1 was strongly the reproductive success in all classes of vertebrates downregulated by in vivo E2 treatment. This, added (Petit et al. 1997, Tyler et al. 1998, Le Guevel to the fact that in vitro data demonstrated that & Pakdel 2001, McLachlan 2001, Jobling et al. zfER1 is not directly implicated in the E2 2003). upregulation of zfER
, suggests diverging functions Although in mammals only two ER subtypes for zfER1 and zfER2 in the liver. have been characterized (Green et al. 1986, Kuiper et al. 1996, Mosselman et al. 1996), we and others have recently reported the existence of three ER Materials and methods forms in fish species: ER
,ER1 and ER2 Animals (Hawkins et al. 2000, Ma et al. 2000, Menuet et al. 2002). These receptors are generated from three In this study, mature zebrafish (Danio rerio), raised in distinct genes, are able to bind E2 with high affinity our facilities, were anesthetized on ice. Hormonal and activate, with approximately the same fold treatments consisted of exposure of fish for 48 h to induction, a reporter gene under the control of a 10
8 M17-estradiol (E2) or to a solvent control consensus ERE (Bardet et al. 2002, Lassiter et al. (0·1% ethanol) before anesthesia. The liver was 2002, Menuet et al. 2002). These results clearly removed by dissection and total RNA was demonstrated that these new ER forms were extracted using the Trizol method according functional ligand-dependent transcription factors. to the manufacturer’s instructions (Gibco-BRL, However, in vivo, the majority of E2 target genes Eggenstein, Germany). The liver RNA samples present imperfect ERE sequences or complex were enriched in poly(A)+-RNA by the oligotex organizations with, notably, the presence of ½ERE mRNA mini kit (Qiagen, Courtaboeuf, France). close to the ERE. In consequence, it is necessary to investigate the respective transcriptional enhance- Northern blot assay ment capacities of the ER forms on an endogenous target gene. Northern blot experiments were performed accord- In oviparous species, in addition to the ing to the previously published protocol (Thomas hypothalamic–pituitary–gonad axis, the liver is an 1980). Poly(A)+-RNA (1·5 µg) from E2-treated or important E2 target organ, in which the synthesis untreated zebrafish liver was denatured at 65 C for of the yolk protein vitellogenin by hepatocyte cells 10 min in formamide–formaldehyde solution, is strictly under the control of E2. The vitellogenin separated on agarose–formaldehyde gel and trans- production which is crucial for embryo develop- ferred onto a nylon membrane (Hybond-N; ment and reproduction success is tightly coupled to Amersham, Uppsala, Sweden). RNA were fixed by a substantial E2-dependent upregulation of ER
u.v. exposure (254 nm for 2 min) and by baking at gene expression. In chicken, Xenopus and trout, E2 80 C for 2 h. The membrane was prehybridized treatment increases the ER
mRNA and protein for 5–6 h, hybridized overnight with the probe accumulation in the liver (Pakdel et al. 1991, labeled with [
-32P]dCTP corresponding to the Ninomiya et al. 1992, Lee et al. 1995). This coding region of each zfER cDNA or to acidic induction occurs at the transcriptional and ribosomal phosphoprotein (PO) cDNA as control. post-transcriptional levels (Flouriot et al. 1996a). The membrane was then washed four times with Here, we have shown that zebrafish (zf) ER1 2SSC, 0·1% SDS solution at room temperature and zfER2 mRNAs are co-expressed with zfER
for 5 min and three times with 0·2SSC, 0·1% in the liver and that E2 treatment differentially SDS solution at 55 C for 30 min and exposed to modifies the expression levels of these receptor biomax film.

Journal of Molecular Endocrinology (2004) 32, 975–986 www.endocrinology.org

Downloaded from Bioscientifica.com at 10/01/2021 09:37:16AM via free access Estrogen regulation of three zebrafish ERs · A MENUET and others 977

After hybridization with the zfER
probe, the genomic DNA fragment (1181 bp) was amplified by membrane was kept at
80 C for 1 month to PCR with a forward primer within exon 1 decrease the radioactivity and stripped (incubation (5-AGTCAGAGATACATCAGTGAGAG-3) and for 2 h at 65 C with 75% formamide, 10 mM a reverse primer within exon 2 (5-GCGCTGTG  NaH2PO4 solution) in order to rehybridize with the CTCCTCCTTAG-3 ). This fragment was sub- zfER2 probe. The same procedure was used for cloned and sequenced. PO and zfER1 probes. The zebrafish genomic library inserted in gt10 EMBL 3 SP6/T7 vector was obtained from Clontech (Palo Alto, CA, USA). Recombinants Primer extension analysis phages (5105) were screened with a 32P-labeled The probe synthesis was carried out according to probe corresponding to exon 1, intron 1 and exon the protocol described previously (Flouriot et al. 2 (corresponding to the 1181 bp genomic DNA 1996b). Briefly, a biotinylated single-stranded DNA fragment). A positive clone, 2021, containing a template was used to prepare a labeled probe by 7 kb genomic fragment was purified after two to extension from a specific primer by the T7 DNA three rounds of screening. The fragment was polymerase in the presence of [
-32P]dCTP. To subcloned into the BamHI site of Bluescribe vector generate the probe, the vector containing the (Stratagene, La Jolla, CA, USA) and the promoter zfER
cDNA was used to obtain biotinylated PCR region restricted to 1·8 kb upstream of the initiation product (346 bp) with a biotinylated primer 1 site was inserted into the KpnI/BglII site of (5-atgtaccctaaggaggagcacagcg-3) beginning at the pGL2-basic vector containing the luciferase re- ATG of the exon 2 and a non-biotinylated primer porter gene. This construct, named PA-1·8 kb, was 2(5-cctgctgagaggacaccaca-3). After purification, sequenced on both strands by the PRISM ready the biotinylated PCR product was bound to reaction big dye terminator cycle sequencing streptavidin-coated magnetic beads (Dynal, Great protocol (PE Biosystems, Courtaboeuf, France) and Neck, NY, USA) and non-biotinylated single-strand the putative transcription factor binding sites were DNA was eluted in 0·1 M NaOH. The labeled analysed by the MatInspector program (Quandt probe (320 bp) was obtained by extension in the et al. 1995). presence of [
-32P]dCTP from internal primer 3 of exon 3 (5-tggctcagatacggggacag-3). The probes Plasmid constructions and site-directed were then eluted with an alkaline solution and mutagenesis purified on a 4% denaturing polyacrylamide–urea gel. Approximately 2105 c.p.m. of single-strand PA-0·3 kb construct was obtained from the probe were coprecipitated with 30 µg RNA (RNA PA-1·8 kb vector by deletion of the 1500 bp from E2-treated zebrafish liver or yeast total RNA upstream of the AP4 box using the Nco1 restriction as control) and resuspended in 20 µl hybridization site. The PA-0·23 kb, PA-ERE, PA-EREm1 and buffer. The templates were denaturated at 80 C PA-AP-1:½ERE constructs, corresponding to vari- for 10 min and incubated at 50 C overnight. After ous lengths of the 5 flanking sequence of the an ethanol precipitation of RNA/probe hybrids, zfER
gene, were obtained by PCR from the reverse transcription was carried out at 42 C PA-1·8 kb vector. The forward primers (A, B, C, D) for 1 h with 50 U Expand reverse transcriptase and the reverse primer (Rev) contained the BamHI (Boehringer Mannheim, Mannheim, Germany). or SmaI restriction site and are described in Table RNA matrix was digested at 37 C for 30 min with 1. PCR products were subcloned in SmaI/BglII RNase A and EDTA (0·1 M). After purification sites of the pGL2-basic vector (Promega, Madison, and denaturation, the samples were separated WI, USA). The QuickChange site-directed muta- through a 4% denaturing polyacrylamide–urea gel. genesis kit from Stratagene was used for ½ERE and 3 ERE half-site mutations of the PA-0·23 kbm and PA-EREm2 constructs. The primers used are Cloning of zfER
promoter also described in Table 1. Finally, each construct To clone the zfER
promoter, we generated a was sequenced on both strands by the PRISM genomic DNA fragment corresponding to exon 1 ready reaction big dye terminator cycle sequencing (+15), intron 1 and exon 2 (+426). This zebrafish protocol. www.endocrinology.org Journal of Molecular Endocrinology (2004) 32, 975–986

Downloaded from Bioscientifica.com at 10/01/2021 09:37:16AM via free access 978 A MENUET and others · Estrogen regulation of three zebrafish ERs

Table 1 Oligonucleotides used for plasmid constructions and site-directed mutagenesis

Constructs Sequences Primers A PA-0·23 kb TCCCCCGGGATCAAGCGGTGACCTCCTAT B PA-ERE TCCCCCGGGCTGGTTGCCATGACCTGCT C PA-EREm1 TCCCCCGGGCTaaTTGCCATGACCTGCTC D PA-AP1:½ERE TCCCCCGGGGCTCTGAGAAGTGACCGTCAG Rev All CGCGGATCCGTTCACTCCTCTGATGTTTTAC QC-0·23up PA-0·23 kbm GGGATCAAGCGGTGAaaTCCTATCTCTTGTTTACCTGG QC-0·23do PA-0·23 kbm CAAGAGATAGGAttTCACCGCTTGATCCCGGGGG QC-EREup PA-EREm2 GGGCTGGTTGCCATGAaaTGCTCTGAGAAGTGACC QC-EREdo PA-EREm2 CTCAGAGCATttCATGGCAACCAGCCCGGGG

Italic letters correspond to enzyme restriction site SmaI and BamHI. Responsive elements are underlined. Nucleotide mutations are noted by small bold letters.

Cell culture and transfection experiments or the vehicle (ethanol 0·1%). The livers from each + CHO, Hela, and HepG2 cells were maintained at group were mixed and poly(A) -RNA was pre-  pared. Figure 1 shows the results of Northern blot 37 Cina5%CO2 atmosphere in Dulbecco’s modified Eagle’s medium (DMEM; Sigma, St experiments using each zfER probe. Hybridization Louis, MO, USA) supplemented with 5% fetal calf with zfER
probe showed a single band of 4·8 kb serum (FCS; Life Technologies, Carlsbad, CA, which was clearly upregulated after E2 treatment. USA), 100 U/ml penicillin, 100 mg/ml streptomy- The zfER1 probe revealed a strong signal band at cin and 25 mg/ml amphotericin (Sigma). CHO 4 kb in the liver of control animals. Interestingly, and Hela cells were seeded in 24-well plates this mRNA was markedly downregulated after E2 (5105 cells/well) or in six-well plates (30104 cells/well) for HepG2 cells. After 24 h, the medium was replaced by fresh phenol red-free DMEM-F12 containing 2·5% charcoal/dextran FCS and ethanol (0·1%) with or without E2 (10
8 M). Cells were transfected with plasmid using FuGENE 6 reagent as indicated by the manufacturer (Boe- hringer Mannheim). The DNA templates for CHO and Hela transfections contained 25 ng expression vector (with or without the coding region of each zfER), 150 ng luciferase reporter gene vector and 50 ng internal -galactosidase control vector. For HepG2 transfection assays, the DNA templates contained four times more vector. The luciferase activities were assayed 36 h later using a luciferase assay system (Promega). The -galactosidase Figure 1 Northern blot analysis of ER mRNAs in the activity was used to normalize transfection effi- liver of untreated and E2-treated zebrafish. ciency in all experiments. Poly(A)+-RNA (1·5 µg), from the liver of zebrafish exposed for 48 h to ethanol (−) or 10 nM E2 (+), was separated on a denaturing formaldehyde–agarose gel Results and transferred to a nylon membrane. This membrane was successively hybridized under stringent conditions E2 upregulates zfER
mRNA expression but with 32P-labeled zfER
,zfER1, zfER2 and PO not zfER forms probes prior to autoradiography. The size of zfER mRNAs was determined from standard markers and the Twenty-four adult zebrafish were divided into two position of ribosomal RNA stained by methylene blue is
groups and treated for 48 h either with 10 8 ME2 indicated on the right.

Journal of Molecular Endocrinology (2004) 32, 975–986 www.endocrinology.org

Downloaded from Bioscientifica.com at 10/01/2021 09:37:16AM via free access Estrogen regulation of three zebrafish ERs · A MENUET and others 979 treatment. Hybridization with the zfER2 probe showed a more complex expression pattern. A major signal was detected at 7·5 kb and two lower bands were also observed at 2·8 kb and 1·4 kb. The amounts of these mRNAs were not modified after E2 treatment.

Characterization of the promoter region and transcription initiation start site of the zfER
gene To investigate the molecular mechanisms involved in the E2 upregulation of zfER
mRNA, we cloned the promoter region of the zfER
gene. A genomic DNA library was screened using a probe spanning exon 1 and exon 2. A sequence of 1·8 kb at the 5 end of the zfER
gene was isolated and sequenced. First, to identify the transcription initiation site, a primer extension experiment on total RNA from liver was carried out (Fig. 2). The size of the major product of the primer extension assay was determined using the accompanying sequence ladder and was localized 139 bp upstream of the ATG of exon 2 (Fig. 2). Staining of other lower extension fragments was also detected and corre- sponded to minor initiation start sites. In a second step, the presence of presumptive transcription factor DNA-binding sites was deter- mined using computer analysis (Fig. 3). The identified promoter sequence was composed of Figure 2 Identification of the transcription initiation start 1745 bp. The major initiation start site is sites of the zfER
gene. represented by an arrow. The promoter has no Labeled probe, extending from exon 2 to exon 3, was TATA or CAAT box, but presents an Inr sequence hybridized with 30 µg total RNA (tRNA) from E2-treated at
50 bp (Javahery et al. 1994). Two C-Ets-1 sites zebrafish liver or with yeast tRNA as control. The major at
1625 and +8bp and two C/EBP- sites at extension product signal is noted by a thicker arrow and

the lesser stainings by the other arrows. The extension 1280 and 150 bp were found. Four GATA product sizes were determined using the accompanying potential binding sites were also located (three sequence ladder. The differently initiated mRNA are GATA-1 sites at
1744,
785 and +17 bp; schematically represented on the left. GATA-2 or 3 at
1321 bp). Brn2 and SREBP potential binding sites were identified at
1708 and
1265 bp respectively. Three AP-1 potential treatment, the zfER
gene promoter (PA-1·8 kb) binding sites, which could include a ½ERE, were was used as the reporter gene and was cotrans- located at
850,
129 and
80 bp. In the fected with the zfER
expression vector into CHO proximal part of the promoter region, an imperfect
cells. After 36 h of E2 treatment (10 8 M), a ERE was found at
104 bp. AP-1 and AP-4 sites significant E2-dependent induction (approximately were also located at
605 and at
200 bp. 10-fold) of the PA-1·8 kb reporter was observed (Fig. 4). Because this result showed that the zfER
E2-dependent upregulation of the zfER
gene gene was induced by zfER
itself, we next uses an imperfect ERE examined whether DNA potential sites, particularly To determine if the transcription rate of the zfER
the imperfect ERE described above at
104 bp by gene was altered directly by ERs under E2 computer analysis, could be involved. To address www.endocrinology.org Journal of Molecular Endocrinology (2004) 32, 975–986

Downloaded from Bioscientifica.com at 10/01/2021 09:37:16AM via free access 980 A MENUET and others · Estrogen regulation of three zebrafish ERs

Figure 3 Sequence analysis of the 5′ end region of the zfER
gene. The putative DNA-binding sites for several transcription factors were determined with the MatInspector program (Quandt et al. 1995) and are boxed. The major initiation start site is noted by an arrow. Exon 1 is identified by bold letters and the italic letters correspond to intron 1. The underlined sequence corresponds to exon 2. The potential ATG codon is noted by an asterisk.

Journal of Molecular Endocrinology (2004) 32, 975–986 www.endocrinology.org

Downloaded from Bioscientifica.com at 10/01/2021 09:37:16AM via free access Estrogen regulation of three zebrafish ERs · A MENUET and others 981

Figure 4 A complex unit containing ½ERE–ERE is involved in the E2-dependent upregulation of the zfER
gene. E2-treated or untreated CHO cells were cotransfected with an expression vector (empty or containing the coding region of zfER
) and several constructs of the zfER
gene promoter described at the left. Mutations on the half site and imperfect ERE are indicated by asterisks. On the right, data are expressed as percentage of activity versus the E2 induction (±S.E.M.) of PA-1·8 kb. Each experiment was repeated at least twice in triplicate. this question, we compared E2 induction of several half site is involved in the E2-dependent induction luciferase constructs versus the E2 induction of of the zfER
gene (Fig. 4). To investigate the role PA-1·8 kb. of the imperfect ERE (
104 bp), two different Figure 4 shows that, compared with the mutations were performed. Figure 4 shows that the PA-1·8 kb construct, the PA-0·3 kb vector was less stimulatory effect of E2 on the PA-ERE promoter inducible by zfER
(65% of E2-PA-1·8 kb) was reduced from 50% to 25% of E2-PA-1·8 kb indicating that several binding sites, notably the activity by mutation of the ERE in the 5 half site CEPB- and AP-1:½ERE, located between (PA-EREm1). Interestingly, this induction was
1280 and
850 bp, could be involved in the completely abolished with the mutation in the 3 E2-dependent zfER
gene induction. Curiously, half site (PA-EREm2). Moreover, the deletion of E2 induction of the PA-0·23 kb construct was this ERE, PA-AP-1:½ERE construct, also showed higher (85% of E2-PA-1·8 kb) than PA-0·3 kb no obvious induction. These data confirmed the (65% of E2-PA-1·8 kb), suggesting that a silencer importance of this imperfect ERE for the positive element, unidentified by computer analysis, could regulation of the zfER
gene. The comparison of exist between
205 and
135 bp. the zfER
promoter region with the proximal Compared with PA-0·23 kb, E2 induction was promoter of several estrogen-sensitive fish genes significantly diminished when the AP-1:½ERE highlights a complex unit containing a ½ERE located at
129 bp was mutated (PA-0·23 kbm) or close to an ERE presenting the same structural entirely deleted (PA-ERE), demonstrating that this organization (Fig. 5). www.endocrinology.org Journal of Molecular Endocrinology (2004) 32, 975–986

Downloaded from Bioscientifica.com at 10/01/2021 09:37:16AM via free access 982 A MENUET and others · Estrogen regulation of three zebrafish ERs

Figure 5 Alignment of the proximal promoters from some estrogen-sensitive fish genes. Proximal promoters of the ER
and brain aromatase genes from several fish species (zf, zebrafish; gf, goldfish; rt, rainbow trout) were aligned with the GeneJockey II program. Putative EREs, as well as Inr sequences, are shaded. bp Positions were calculated from the transcriptional start site when it had been determined. The relative position of the three ½EREs on the DNA double helix is schematically illustrated below.

zfER2 but not zfER1 upregulates the zfER
expression vector. Nevertheless, this form clearly gene induced the ERE-TK-luc construct under the same In order to investigate the E2-dependent transcrip- experimental conditions (data not shown) (Menuet tional capacity of the two zfERs on the zfER
et al. 2002). gene, each expression vector (empty or containing the different coding region of each zfER) was Discussion cotransfected with PA-1·8 kb into CHO (Fig. 6A), Hela (Fig. 6B) and HepG2 cells (Fig. 6C). E2 The egg yolk protein vitellogenin can be activated stimulation of the reporter gene mediated by de novo from a totally silent state within hepatocytes zfER
reached 10-fold in CHO, 6·5-fold in Hela by estrogens. In oviparous species, this process of and 5-fold in HepG2. When using the zfER2 hepatic vitellogenin is tightly coupled to a clear expression vector, the E2 stimulation of the E2-dependent upregulation of ER
gene expres- reporter gene was 50–60% lower with 3- to 4-fold sion (Pakdel et al. 1991, Flouriot et al. 1996a). We induction in CHO and in Hela cells and 2·5-fold in have recently cloned and characterized two zfER HepG2 cells. Surprisingly, irrespective of the cell forms which co-express with zfER
in the liver of line used, no obvious E2 induction of the zfER
zebrafish (Menuet et al. 2002). In this study, we promoter was observed when using the zfER1 have investigated the responsiveness of these zfER

Figure 6 zfER
and zfER2, but not zfER1, induce the zfER
gene promoter. (A) CHO, (B) Hela and (C) HepG2 cells were cotransfected with different expression vectors (control (ctrl), zfER
,zfER1orzfER2) and the PA-1·8 kb reporter gene. Cells were treated with 10 nM E2 (solid bars) or 0·1% ethanol as control (open bars). The histograms show the mean of fold induction versus ethanol (etoh) (±S.E.M.) for each reporter gene. Each experiment was repeated at least twice in triplicate.

Journal of Molecular Endocrinology (2004) 32, 975–986 www.endocrinology.org

Downloaded from Bioscientifica.com at 10/01/2021 09:37:16AM via free access Estrogen regulation of three zebrafish ERs · A MENUET and others 983 genes to in vivo E2 treatment and studied the exon 2, while a minor isoform, rtER
long, was potential effects of these zfER forms on zfER
raised from an in-frame ATG initiator codon gene regulation. located in an intronic sequence of intron 1 (called Nothern blot analysis of zebrafish liver revealed exon 2a) which can be differentially spliced (Pakdel one single major band of 4·8 kb for zfER
, one et al. 2000). As expected, our primer extension band of 4 kb for zfER1 and three bands of 7 kb, analysis showed that the major zfER
isoform 2·8 kb and 1·4 kb for zfER2. Since the entire corresponded with the classical short isoform issued coding region of zfER2 extends over 1·8 kb from transcripts containing exon 1/exon 2. (Menuet et al. 2002), one can assume that the 1·4 kb However, the presence of an additional in-frame transcript would generate a truncated zfER2 ATG initiator codon in intron 1 (or exon 2a) protein isoform. Similarly, small transcripts for located at the same position as in the rtER
gene ERs were also found in the liver of other teleost suggested that a zfER
long isoform also exists in fish (Xia et al. 2000, Socorro et al. 2000). It would zebrafish. therefore be interesting to investigate whether or From the genomic DNA, we have isolated 1·8 kb not these transcripts could generate truncated of the 5 end of zfER
gene and linked it to the protein and to seek their potential roles. luciferase reporter gene. Cotransfection analysis of Interestingly, exposure of zebrafish to E2 showed this promoter construct with the zfER
expression a differential response of zfER genes. Our data vector in different cell lines showed a clear confirmed that in the zebrafish, as in other induction of the reporter gene in the presence of oviparous species, the expression of the zfER
gene E2. These results confirmed the E2 stimulation of is robustly stimulated by E2 treatment in vivo.In the zebrafish ER
gene in vivo and demonstrated contrast and surprisingly, the expression level of that E2 upregulation of the ER
gene by ER
itself zfER1 was strongly reduced whereas the level of is likely widespread among oviparous vertebrates zfER2 mRNA was either not affected or very (Pakdel et al. 1991, Ninomiya et al. 1992, Le Drean slightly affected. At the present time, the transcrip- et al. 1995, Lee et al. 1995). Mutations and deletions tional and/or post-transcriptional effects of E2 of this promoter region showed clearly that the treatment on these messengers remain to be ½ERE (
127 bp) and the imperfect ERE determined. However, the present results may (
104 bp) were largely involved in the E2- indicate that, during the reproductive cycle, when dependent induction of the zfER
gene. The E2 levels fluctuate, the zfER forms could have comparison of the proximal promoter region of different patterns of expression, suggesting a some fish estrogen-sensitive genes (ER
and brain distinct implication on hepatic functions, notably aromatase) showed the conserved presence of on vitellogenesis. ½ERE and ERE, separated by 21–23 bp (center- To investigate the effect of zfERs on this to-center). This number corresponds to two helix function, we analysed in vitro their potential actions turns, indicating that these two elements are on the on the regulation of the zfER
gene expression same side of the DNA (Fig. 5). This organization known to be essential for vitellogenin production. could stabilize receptor binding and enhance E2 First, a zebrafish genomic DNA library was induction. However, for the zfER
gene, we screened and a 7 kb DNA fragment was isolated. cannot exclude that the ½ERE located at This fragment contained 1·8 kb of the promoter
850 bp and
80 bp could also contribute to the region and the first exons and introns of the zfER
E2 responsiveness. Moreover, computer analysis gene. Interestingly, this genomic fragment showed revealed that the ½EREs are included in an a similar organization and structure to that of the AP-1-like site. Numerous studies showed that ERs corresponding fragment in the rainbow trout ER
are able to modulate promoter activity by gene. In fact, two classes of ER
mRNAs could interacting with different DNA-bound transcription be generated from the trout ER
gene by an factors such as Jun and Fos which bind specifically alternative splicing and promoter usage (Leroux to the AP-1 element (Paech et al. 1997, Webb et al. et al. 1993, Pakdel et al. 2000). These transcripts 1999). In this regard, more investigations will be encode two functional ER
isoforms with different necessary to determine if AP-1-like elements are estrogen dependencies. The major hepatic isoform, also involved in the E2-dependent induction of the rtER
short, was initiated from the ATG located in zfER
gene. www.endocrinology.org Journal of Molecular Endocrinology (2004) 32, 975–986

Downloaded from Bioscientifica.com at 10/01/2021 09:37:16AM via free access 984 A MENUET and others · Estrogen regulation of three zebrafish ERs

To investigate the ER effects on the zfER
could also be largely involved. Interestingly, promoter, transfection experiments were carried zfER2 has been characterized by a better out in several cell lines including CHO, Hela and affinity for E2 than the other forms (Menuet et al. HepG2. Curiously, the two ER forms were 2002). Furthermore, the present data revealed characterized by differential impacts on the that zfER2 expression is unmodified by E2 and E2-dependent induction of the zfER
construct. In that it is able to induce zfER
promoter activity fact, although clear inductions were obtained with significantly. Consequently, it is tempting to zfER
,zfER2 seemed to be less effective (about speculate that, in vivo,zfER2 could be involved in 40–50% of zfER
activity). In contrast, whatever the maintenance of zfER
gene expression when the cell line used, zfER1 showed very low, if any, the E2 levels are low during the reproductive cycle. transcriptional activity on the zfER
promoter. Moreover, the fact that, in contrast with zfER
, The molecular reasons for this low transcriptional zfER1 expression is downregulated by E2 activity are still unknown. However, these data treatment and unable to significantly induce contrast with previous results showing that zfER1 zfER
promoter activity in vitro, suggests that this is able to induce reporter genes under the control zfER form is likely not involved in vivo in of a consensus ERE in the same way as zfER
and zfER
gene regulation and in the vitellogenesis zfER2 (Bardet et al. 2002, Menuet et al. 2002). process. Besides the fact that the ERE of the zfER
gene is In conclusion, this study has shown for the first imperfect with three mutations, it is possible that time that the two ER forms that have emerged in the inefficiency of zfER1 to induce zfER
teleost species are differentially regulated by E2 in promoter is due to its incapacity to recognize the the liver and characterized by distinct transcrip- zfER
ERE with high affinity. Gel mobility shift tional activity on an endogenous gene such as assays carried out with labeled oligonucleotides zfER
. These data may also suggest that each ER containing this imperfect ERE sequence did not form has different physiological functions that allow us to obtain information about the in vitro remain to be elucidated. Moreover, the isolation of DNA-binding capacity of these different zfERs. We the zfER
promoter and the demonstration of its were limited by the low sensitivity of this technique sensitivity to estrogen provide new molecular tools due to the high degree of mutation in this ERE in the zebrafish, a species commonly used to sequence. Nevertheless, our assays performed in analyze the impact of endocrine disrupters in a parallel with a consensus ERE showed low, but whole vertebrate model organism. detectable, specific complexes, with higher intensity for zfER
than both zfERs (data not shown). Similar to our finding, previous studies have Acknowledgements reported that mammalian ERs have lower transcriptional activity than ER
(Tremblay et al. This work was supported by the European 1997, Cowley & Parker 1999). At the present time, Community (project QLK4-CT-2002–00603- it is difficult to know which one of the zfERs EDEN), the French Ministry for Environment functions like the mammalian ER. This will (Programme Environnement et Santé, subvention necessitate a full comparison using a series of no. 01108), ACI (Biologie du Développement et endogenous E2-sensitive genes. Moreover, these Physiologie Intégrative), CNRS and fellowships experiments may provide information about poten- from the French Ministry for Education, Research tial EREs that could favor ER transcriptional and Technology to A M. activity preferentially. Although numerous studies have demonstrated that in oviparous species ER
gene regulation References involves several nuclear factors including ER
itself, COUP-TFI (Lazennec et al. 1997, Petit et al. Bardet PL, Horard B, Robinson-Rechavi M, LaudetV&Vanacker 1999, Métivier et al. 2002), C/EBP and the JM 2002 Characterization of oestrogen receptors in zebrafish glucocorticoid receptor (Lethimonier et al. 2000, (Danio rerio). Journal of Molecular Endocrinology 28 153–163. Cowley SM & Parker MG 1999 A comparison of transcriptional 2002), the present study has revealed that the activation by ER alpha and ER beta. Journal of Steroid Biochemistry zfER forms, and more probably zfER2, and Molecular Biology 69 165–175.

Journal of Molecular Endocrinology (2004) 32, 975–986 www.endocrinology.org

Downloaded from Bioscientifica.com at 10/01/2021 09:37:16AM via free access Estrogen regulation of three zebrafish ERs · A MENUET and others 985

Flouriot G, PakdelF&Valotaire Y 1996a Transcriptional and Menuet A, Pellegrini E, Anglade I, Blaise O, Laudet V, Kah O & post-transcriptional regulation of rainbow trout estrogen receptor Pakdel F 2002 Molecular characterization of three estrogen and vitellogenin gene expression. Molecular and Cellular Endocrinology receptor forms in zebrafish: binding characteristics, transactivation 124 173–183. properties, and tissue distributions. Biology of Reproduction 66 Flouriot G, Nestor P, Kenealy MR, PopeC&GannonF1996b An 1881–1892. S1 nuclease mapping method for detection of low abundance Métivier R, Gay FA, Hubner MR, Flouriot G, Salbert G, Gannon transcripts. Analytical Biochemistry 237 159–161. F,KahO&Pakdel F 2002 Formation of an hER Green S, Walter P, Kumar V, Krust A, Bornert JM, Argos P alpha-COUP-TFI complex enhances hER alpha AF-1 through & Chambon P 1986 Human oestrogen receptor cDNA: Ser118 phosphorylation by MAPK. EMBO Journal 21 3443–3453. sequence, expression and homology to v-erb-A. Nature 320 Mosselman S, PolmanJ&Dijkema R 1996 ER beta: identification 134–139. and characterization of a novel human estrogen receptor. FEBS Hawkins MB, Thornton JW, Crews D, Skipper JK, Dotte A & Letters 392 49–53. Thomas P 2000 Identification of a third distinct estrogen receptor Ninomiya Y, Mochii M, Eguchi G, Hasegawa T, Masushige S & and reclassification of estrogen receptors in teleosts. PNAS 97 Kato S 1992 Tissue-specific response of estrogen receptor gene 10751–10756. expression to estrogen in chick. Biochemical and Biophysical Research Javahery R, Khachi A, Lo K, Zenzie-Gregory B & Smale ST Communications 187 1374–1380. 1994 DNA sequence requirements for transcriptional initiator Paech K, Webb P, Kuiper GG, Nilsson S, Gustafsson J, Kushner PJ activity in mammalian cells. Molecular and Cellular Biology 14 & Scanlan TS 1997 Differential ligand activation of estrogen 116–127. receptors ERalpha and ERbeta at AP1 sites. Science 277 Jobling S, Casey D, Rodgers-Gray T, Oehlmann J, 1508–1510. Schulte-Oehlmann U, Pawlowski S, Baunbeck T, Turner AP & Pakdel F, Feon S, Le Gac F, Le MennF&Valotaire Y 1991 In vivo Tyler CR 2003 Comparative responses of molluscs and fish to estrogen induction of hepatic estrogen receptor mRNA and environmental estrogens and an estrogenic effluent. Aquatic correlation with vitellogenin mRNA in rainbow trout. Molecular Toxicology 65 205–220. and Cellular Endocrinology 75 205–212. Klinge CM 2000 Estrogen receptor interaction with co-activators Pakdel F, Metivier R, FlouriotG&Valotaire Y 2000 Two estrogen and co-repressors. Steroids 65 227–251. receptor (ER) isoforms with different estrogen dependencies are Kuiper GG, Enmark E, Pelto-Huikko M, Nilsson S & Gustafsson JA generated from the trout ER gene. Endocrinology 141 571–580. 1996 Cloning of a novel receptor expressed in rat prostate and Petit F, Le Goff P, Cravédi JP, ValotaireY&PakdelF1997Two ovary. PNAS 93 5925–5930. complementary bioassays for screening the estrogenic potency of Kuiper GG, Carlsson B, Grandien K, Enmark E, Haggblad J, xenobiotics: recombinant yeast for trout estrogen receptor and Nilsson S & Gustafsson JA 1997 Comparison of the ligand trout hepatocyte cultures. Journal of Molecular Endocrinology 19 binding specificity and transcript tissue distribution of estrogen 321–335. receptors alpha and beta. Endocrinology 138 863–870. Petit F, Métivier R, ValotaireY&PakdelF1999Synergism Lassiter CS, KelleyB&LinneyE2002Genomicstructure and between a half site estrogen-responsive-element (ERE) and an embryonic expression of estrogen receptor beta a (ERbeta a) in imperfect ERE and cooperation with COUP-TFI are required for zebrafish (Danio rerio). Gene 299 141–151. estrogen receptor (ER) to achieve a maximal estrogen-stimulation Lazennec G, Kern L, ValotaireY&Salbert G 1997 The nuclear of rainbow trout ER gene. European Journal of Biochemistry 259 orphan receptors COUP-TF and ARP-1 positively regulate the 385–395. trout estrogen receptor gene through enhancing autoregulation. Quandt K, Frech K, Karas H, WingenderE&Werner T 1995 Molecular and Cellular Biology 17 5053–5066. MatInd and MatInspector: new fast and versatile tools for Le Drean Y, Lazennec G, Kern L, Saligaut D, PakdelF&Valotaire detection of consensus matches in nucleotide sequence data. Y 1995 Characterization of an estrogen-responsive element Nucleic Acids 23 4878–4884. implicated in regulation of the rainbow trout estrogen receptor Saville B, Wormke M, Wang F, Nguyen T, Enmark E, Kuiper G, gene. Journal of Molecular Endocrinology 115 37–47. Gustafsson JA & Safe S 2000 Ligand-, cell-, and estrogen receptor Lee JH, Kim J & Shapiro DJ 1995 Regulation of Xenopus laevis estrogen subtype (alpha/beta)-dependent activation at GC-rich (Sp1) receptor gene expression is mediated by an estrogen response ele- promoter elements. Journal of Biological Chemistry 275 5379–5387. ment in the protein coding region. DNA Cell Biology 14 419–430. Socorro S, Power DM, Olsson PE & Canario AV 2000 Two LeGuevelR&PakdelF2001Assessment of oestrogenic potency of estrogen receptors expressed in the teleost fish, Sparus aurata: chemicals used as growth promoter by in vitro methods. Human cDNA cloning, characterization and tissue distribution. Journal of Reproduction 16 1030–1036. Endocrinology 166 293–306. Le Roux MG, Theze N, WolffJ&LePennecJP1993Organization Thomas PS 1980 Hybridization of denatured RNA and small DNA of a rainbow trout estrogen receptor gene. Biochimica et Biophysica fragments transferred to nitrocellulose. PNAS 77 5201–5205. Acta 1172 226–230. Tremblay GB, Tremblay A, Copeland NG, Gilbert DJ, Jenkins NA, Lethimonier C, Flouriot G, Valotaire Y, Kah O & Ducouret B 2000 LabrieF&GiguereV1997 Cloning, chromosomal localization, Transcriptional interference between glucocorticoid receptor and and functional analysis of the murine estrogen receptor beta. estradiol receptor mediates the inhibitory effect of cortisol on fish Molecular Endocrinology 11 353–365. vitellogenesis. Biology of Reproduction 62 1763–1771. Tyler CR, Jobling S & Sumpter JP 1998 Endocrine disruption in Lethimonier C, Flouriot G, Kah O & Ducouret B 2002 The wildlife: a critical review of the evidence. Critical Reviews in glucocorticoid receptor represses the positive autoregulation of the Toxicology 28 319–361. trout estrogen receptor gene by preventing the enhancer effect of Webb P, Nguyen P, Valentine C, Lopez GN, Kwok GR, McInerney a C/EBPbeta-like protein. Endocrinology 143 2961–2974. E, Katzenellenbogen BS, Enmark E, Gustafsson JA, Nilsson S & Ma CH, Dong KW & Yu KL 2000 cDNA cloning and expression of Kushner PJ 1999 The estrogen receptor enhances AP-1 activity a novel estrogen receptor beta-subtype in goldfish (Carassius by two distinct mechanisms with different requirements for auratus). Biochimica et Biophysica Acta 1490 145–152. receptor transactivation functions. Molecular Endocrinology 13 McLachlan JA 2001 Environmental signaling: what embryos and 1672–1685. evolution teach us about endocrine disrupting chemicals. Endocrine Xia Z, Gale WL, Chang X, Langenau D, Patino R, Maule AG & Reviews 22 319–341. Densmore LD 2000 Phylogenetic sequence analysis, recombinant www.endocrinology.org Journal of Molecular Endocrinology (2004) 32, 975–986

Downloaded from Bioscientifica.com at 10/01/2021 09:37:16AM via free access 986 A MENUET and others · Estrogen regulation of three zebrafish ERs

expression, and tissue distribution of a channel catfish estrogen Received in final form 8 January 2004 receptor beta. General and Comparative Endocrinology 118 139–149. Accepted 19 March 2004 Zilliacus J, Wright AP, Carlstedt-Duke J & Gustafsson JA 1995 Structural determinants of DNA-binding specificity by steroid receptors. Molecular Endocrinology 9 389–400.

Journal of Molecular Endocrinology (2004) 32, 975–986 www.endocrinology.org

Downloaded from Bioscientifica.com at 10/01/2021 09:37:16AM via free access