Prohibitin Mutations Are Uncommon in Prostate Cancer Families Linked to Chromosome 17Q

Prohibitin mutations are uncommon in prostate cancer families linked to chromosome 17q

KA White1, EM Lange2, AM Ray1, KJ Wojno3 and KA Cooney1,3 1Department of Internal Medicine, University of Michigan Medical School, Ann Arbor, MI, USA; 2Departments of Genetics and Biostatistics, University of North Carolina, Chapel Hill, NC, USA and 3Department of Urology, University of Michigan Medical School, Ann Arbor, MI, USA

Background: Linkage studies have provided evidence for a prostate cancer susceptibility locus on chromosome 17q. The mitochondrial protein prohibitin (PHB) is a plausible candidate gene based on its chromosomal location (17q21) and known function. Methods: All coding regions and intron/exon junctions of the PHB gene were sequenced in 32 men from families participating in the University of Michigan Prostate Cancer Genetics Project that demonstrated evidence of linkage to 17q markers. Results: Although a number of nucleotide variants were identified, no coding region substitutions were identified in any of the 32 men with prostate cancer from 32 unrelated multiplex prostate cancer families. Conclusions: PHB mutations do not appear to account for the linkage signal on 17q21–22 detected in PCGP families. Fine mapping of this region is in progress to refine the candidate region and highlight additional candidate prostate cancer susceptibility genes for sequence analysis. Prostate Cancer and Prostatic Diseases (2006) 9, 298–302. doi:10.1038/sj.pcan.4500878; published online 30 May 2006

Keywords: hereditary cancer; linkage studies; sequence analysis

Introduction evidence for linkage at this location.3 A combined genome-wide analysis of 426 prostate cancer families, Prostate cancer has been shown to have a strong familial including the 175 from the PCGP, also found evidence for component leading many research teams including our a prostate cancer susceptibility gene on 17q (nonpara- own to collect multiplex prostate cancer families in order metric multipoint Kong and Cox allele-sharing LOD to identify the molecular basis for this common disease. score ¼ 3.16 at marker D17S787; P ¼ 0.00007).4 Most However, despite the collection of many families and the recently, a linkage signal was also detected on 17q in a formation of an international consortium (the Inter- combined genome-wide screen of 1233 prostate cancer national Consortium for Prostate Cancer Genetics or families sponsored by the ICPCG (HLOD 1.99 near ICPCG),1 the genes that cause hereditary prostate cancer marker D17S1820 using a dominant mode-of-inheritance remain elusive. This is likely due to locus heterogeneity parametric model),1 despite little evidence for this region as well as factors specific to the disease itself, including from research teams other than the PCGP.5 In fact, no late age at diagnosis and a high background rate of other prostate research group in the ICPCG observed a sporadic cases (see review2). LOD score 41.0 at 17q21 whereas the PCGP families had Several linkage studies have provided evidence for a a HLOD score of 3.07 using the same dominant model. prostate cancer susceptibility gene on the long arm of Taken together, there is linkage evidence for a prostate chromosome 17. A genome-wide scan of 175 prostate cancer susceptibility locus on 17q, and the PCGP families cancer families from the University of Michigan Prostate appear to be relatively enriched for families with Cancer Genetics Project (PCGP) first revealed strong mutations at this locus thus representing the optimal suggestive evidence for linkage on chromosome 17q families for gene identification strategies. (LOD ¼ 2.36); the subset of pedigrees with four or more There are a number of interesting candidate genes for affected individuals (LOD ¼ 3.27) provided even greater inherited prostate cancer susceptibility that map to this 17q21–22 region. We previously performed full gene mutation analysis of the breast cancer susceptibility Correspondence: Dr KA Cooney, Department of Internal Medicine, gene BRCA1 in 93 PCGP families with nonparametric University of Michigan Medical School, 7310 CCGC, 1500 East linkage (NPL) scores 40 at 17q.6 Using denaturing high- Medical Center Drive, Ann Arbor, MI 48109-0946, USA. E-mail: [email protected] performance liquid chromatography and direct sequence Received 30 January 2006; revised 27 March 2006; accepted 27 March analysis, we identified only one deleterious BRCA1 2006; published online 30 May 2006 mutation in one man who had a family history of both Prohibitin mutations in prostate cancer KA White et al prostate and ovarian cancer. This led us to conclude that informed consent, and all research protocols and consent 299 there is likely one or more additional genes in this region forms were approved by the Institutional Review Board that may be contributing to prostate cancer susceptibility. at the University of Michigan Medical School. Cases of In this report, we describe sequence analysis of the prostate cancer were confirmed by medical records/ tumor suppressor gene prohibitin (PHB) in 32 PCGP death certificates when possible. Occasionally, indepen- families with the most significant linkage evidence at 17q dent confirmation by two family members of prostate (NPL score 41.0). PHB is located within 1 cM from the cancer in a deceased relative was used when medical marker nearest the linkage peak in the 79 PCGP families records could not be obtained. Blood samples collected with four or more confirmed cases of prostate cancer from affected individuals and from unaffected indivi- (Figure 1).3 PHB is thus a candidate hereditary prostate duals that were informative for linkage were used. DNA cancer susceptibility gene based on its location as well as was isolated from nucleated blood cells by use of the recent data demonstrating that prohibitin is down- Puregene kit (Gentra Systems, Minneapolis, MN, USA). regulated by androgens and may play a role in cell-cycle For this report, we describe results from 32 families that progression.7 were determined to have an NPL score 41 at 60.1 cM on chromosome 17. This distance was selected because it represents the linkage peak for all families analyzed Materials and methods together.

Patient selection Men with prostate cancer who have at least one living Genetic analysis affected relative were asked to participate in the Sequencing primers were designed to amplify all seven University of Michigan PCGP by providing a blood PHB exons including intron/exon borders and to sample, extended family history information, and access minimize amplification of known pseudogenes (Table 1). to medical records. All participants gave written Polymerase chain reaction (PCR) was performed in a

Linkage peak in GWS for 175 PCGP families

D17S798 D17S1868 D17S787 53.41 cM 64.16 cM 74.99 cM

BRCA1 PHB

55 60 65 70 75 80 Centromere Telomere Map Position (cM)

Figure 1 Location of BRCA1 (63 cM) and PHB (63.62 cM) relative to the markers used in the Prostate Cancer Genetics Project (PCGP) GWS for prostate cancer susceptibility genes (second horizontal line). The linkage peak observed when all 175 PCGP families were analyzed together was at 60.1 cM, which is closest to marker D17S1868.3 Map distances are from The Center for Genetics at Marshfield Medical Research Foundation (www.marshmed.org/genetics). Data from the National Center for Biotechnology (www.ncbi.nlm.nih.gov) was used to place genes relative to markers.

Table 1 Sequencing primers used to amplify PHB exons as well as portions of the 50 and 30 untranslated regions PCR product size (bp) Primer sequence

Exon 1 F 474 ACTCACAGCGCTCTTCCACACCAA R CTCCGCCCCACCGTCGTT Exon 2 F 367 GGGGAAATAAATAGCCAGGTTGAAAAGTGA R TGTGGTATGAAATGGCAGGAGGTGAGC Exon 3 F 296 GCACCAGGGCTCTTTCAA R AGCACCTCTTCCACACTCCCTACTTTA Exon 4/5 F 631 TGGGAGGCAGAGGTTGTAGTGA R AGCCCCTTCCCCTCCTCGGTCTC Exon 6 F 523 CTGGGGAGGTGGTCGATTGAGTAGATA R CCGGAAGAAGGGATGACAGATGA Exon 7 F 808 GCCACAGCCCCGATGATT R TGAACGAGGGGGCCAGGAACG Exon 7 F 593 TAGCCTGACATGCGGTGCCCTGAG R CCCGCCTGCGTGCTGCCAAATG 30 UTR F 627 CCGGGGAGGGGCAGAGA R CCTTCGGGTTGGGGATGGAT

Abbreviatons: F, forward, PCR, polymerase chain reaction; PHB, prohibitin; R, reverse. All primers are listed in 50 to 30 order.

Prostate Cancer and Prostatic Diseases Prohibitin mutations in prostate cancer KA White et al

300 50 ml reaction mixture containing 5 ml10Â buffer cancer from 32 unrelated multiplex prostate cancer (Invitrogen Life Technologies, Carlsbad, CA, USA), 1 ml families failed to identify any nonsynonymous or 50 mM MgC12,1ml10mM dNTPS, 2 ml each of the two truncating mutations. A number of single nucleotide PCR primers at 5 mM concentration, 3.0 ml template DNA variants were identified, however, including four at 20 ng/ml, and 0.5 mlofTaq (Platinum Taq Polymerase, novel nucleotide substitutions, and these data Invitrogen) in double-distilled H2O. Polymerase chain are presented in Table 2. No sequence variations reaction amplification for each primer set was based on were identified in exons. the maximum annealing performance and this information is available on request. Polymerase chain reaction products were cleaned for sequencing using Montage PCR Centrifugal Filter Devices (Millipore, Billerica, MA, Discussion USA). Samples were sequenced using an ABI Prism 3100 Prohibitin was identified in 1989 through a set of Genetic Analyzer using Big Dye Terminator v1.1 che- experiments in which investigators set out to identify mistries (Applied Biosystems, Foster City, CA, USA) genes that exhibit negative growth control properties.8 according to the manufacturer’s instructions. Sequences The gene is highly conserved across species and is were analyzed using Mutation Surveyor Software (Soft- ubiquitously expressed in many tissues.9 PHB was first Genetics, State College, PA, USA) and were reviewed by suspected to play a role in human cancer based on data two independent researchers (KAW and AMR). published by Sato et al.10 in 1992. These investigators cloned the human homologue and mapped PHB to 17q21. They next sequenced exons 4 and 5 of PHB using Results somatic DNA isolated from a set of human breast cancers including cancers exhibiting allelic loss at 17q21. Four of In the 32 families selected for this analysis based on 23 sporadic tumors were shown to have a mutation linkage evidence to chromosome 17q, the average including two missense substitutions and one frame- number of confirmed affected family members was 4.4 shift.11 However, further studies by this same group (range 3–13) and the average number of affected family identified only one additional PHB mutation out of 120 members in whom DNA samples were available was 2.8 breast cancer cases and no mutations in a series of (range 2–6). Genomic DNA was amplified from one ovarian, liver and lung cancer leading the investigators affected man in each of the 32 families with evidence of to conclude that PHB is unlikely to be a common tumor linkage to chromosome 17. The youngest affected family suppressor gene like TP53. member was selected for sequencing in 24 of 32 families. More recently, a single nucleotide polymorphism In the remaining eight families, the second youngest (SNP) was identified in the 30UTR of PHB (rs6917), and affected male was sequenced based on DNA availability. the variant T allele was shown to be associated with Three families described themselves as African American breast cancer susceptibility. In a case–control study in and the remaining families were European American. which 205 women with breast cancer were compared to The average age of prostate cancer diagnosis in the men 1046 geographic controls, an association was detected selected for sequencing was 56.1 years (range 37–71 between the T allele and breast cancer in women with a years). Five of the men whose DNA was sequenced had family history of the disease (odds ratio 2.5, P ¼ 0.005).12 one or more additional cancers including cases of Previous research suggested a functional role for this pancreas, kidney, head and neck as well as nonmelano- variant as the 30UTR of this gene has been shown to have ma skin cancer. a regulatory function by blocking cell-cycle progres- The PHB gene is comprised of seven exons and sion.13 This same association was not observed with in encodes a 272 amino-acid protein. Sequencing of all follow-up studies of Australian women with breast seven exons and well as intron/exon junctions and the 30 cancer14 or ovarian cancer.15 In our report, the variant untranslated region (30UTR) from 32 men with prostate T allele was observed in five out of 64 alleles (7.8%),

Table 2 Variants identified in genomic DNA from 32 men with hereditary prostate cancer SNP Alleles Genotypes Location Contig position

WT/WT WT/V V/V

rs2277636 IVS1+20C4T C/T 29 2 1 Intron 1–2 44847176 Nra IVS1+26C4T C/T 31 1 0 Intron 1–2 44847170 Nra IVS1+63A4G A/G 30 2 0 Intron 1–2 44847133 rs2277637 IVS4+9A4G A/G 29 2 1 Intron 4–5 44841683 rs2233666 IVS5-70A4G A/G 30 2 0 Intron 5–6 44839285 rs2233667 IVS5-12C4G C/G 19 12 1 Intron 5–6 44839227 rs2233668 IVS6+71G4A G/A 30 2 0 Intron 6–7 44839049 rs9893420 1358T4C T/C 31 1 0 30 UTR 44836887 rs6917 1703C4T C/T 28 3 1 30 UTR 44836542 rs1049620 1732G4A G/A 20 11 1 30 UTR 44836513 rs4987082 A/G 13 11 8 Downstream flanking 44836373

Abbreviation: Nr, not previously reported. For alleles, the wild-type (WT) sequence is listed first followed by the variant (V) sequence. The genotypes frequencies are presents in order: homozygous WT, heterozygous WT/V, and homozygous V/V.

Prostate Cancer and Prostatic Diseases Prohibitin mutations in prostate cancer KA White et al 301

Figure 2 Prohibitin expression in normal prostate tissue, prostatic intraepithelial neoplasia (PIN) and cancer. Using microwave antigen retrieval, formalin-fixed paraffin-embeded prostate tissue was stained with a rabbit polycloncal antibody to prohibitin (ab2996; Abcam Inc., Cambridge, MA, USA) at a titer 1:80. No staining was observed in the secretory cells of benign glands (a, normal prostate tissue), although some staining of basal cell cytoplasm was detected. Strong cytoplasmic staining was noted in PIN (b) and adenocarcinoma (c). Although most of the staining appears to be cytoplasmic, nuclear staining was occasionally observed in malignant epithelium (d).

which is a lower frequency than in any of the three prior case selected from a given family for sequence analysis reports of women with breast or ovarian cancer or the was a sporadic case based on the high frequency of respective control populations.13–15 Additional studies disease in the general population. However, our strategy using a case–control design should be carried out explore of selecting the youngest age of onset case from each the potential association between the functionally im- family for PHB sequencing should minimize this portant T allele and prostate cancer susceptibility. potential bias. Direct sequence analysis of PHB is Prohibitin has been speculated to have several complicated by the existence of four processed pseudo- different roles in the cell based on subcellular localiza- genes: PHBP1 in 6q25, PHBP2 on 11p11.2, PHBP3 in tion. As described above, prohibitin has antiproliferative 1p31.3 and PHBP4 on 2q21.11 Use of intronic sequence properties presumably through its interaction with primers limited contamination with pseudogene se- nuclear proteins.16 However, confocal microscopy has quence which shares high homology to PHB. Finally, been used to confirm that prohibitin is also localized in only approximately 50% of the promoter was sequenced the mitochondria of the prostate cancer line LNCaP.7 as well as limited amounts of intronic sequence, there- Prohibitin expression can be detected in the basal cells of fore we cannot fully exclude the possibility of mutations normal prostate epithelium using immunohistochemis- in regulatory regions. try (Figure 2). The level of protein expression appears to In conclusion, prostate cancer has a strong hereditary be higher in prostatic intraepithelial neoplasia and component although characterization of the genes con- cancer, and both cytoplasmic and nuclear staining is tributing to this phenotype has been difficult. The demonstrated. It is thought that prohibitin serves to linkage signal on 17q21–22 first detected in the Uni- stabilize enzymes in the mitochondria. Prohibitin may versity of Michigan PCGP families3 and later found in also play a role in senescence based in the observation several combined linkage studies.4,5 represents one of the that protein levels decline with aging (see review16). most consistent linkage signals for hereditary prostate In our study, we were unable to identify any clearly cancer. To date, sequence analysis has excluded both functional mutations in 32 men with prostate cancer BRCA1 and PHB as likely candidate genes to explain a from families with hereditary prostate cancer and large number of chromosome 17-linked prostate cancer linkage evidence to 17q. None of the variants that we families. Fine mapping of this region using a denser identified were in exons. However, we cannot fully panel of markers is in progress. In the meantime, testing exclude the possibility that one or more of the variants of plausible candidate genes based on chromosomal that we identified creates a splice variant or alters position and function continues to be a reasonable transcription. Several additional limitations to our study approach for implicating genes in hereditary prostate include the limited sample size and possibility that the cancer.

Prostate Cancer and Prostatic Diseases Prohibitin mutations in prostate cancer KA White et al 302 Acknowledgements 8 Nuell MJ, Steward DA, Walker L, Friedman V, Wood CM, Owens GA et al. Prohibitin, an evolutionarily conserved intra- This work was supported by the following grants from cellular protein that blocks DNA synthesis in normal fibroblasts the NIH: R01 CA79596 and U01 CA89600. and HeLa cells. Mol Cell Biol 1991; 11: 1372–1381. 9 McClung JK, Jupe ER, Liu XT, Dell’Orco RT. Prohibitin: potential role in senescence, development, and tumor suppression. Exp References Gerontol 1995; 30: 99–124. 10 Sato T, Saito H, Swensen J, Olifant A, Wood C, Danner D et al. 1 Xu JF, Dimitrov L, Chang BL, Adams TS, Turner AR, Meyers DA The human prohibitin gene located on chromosome 17q21 et al. A combined genomewide linkage scan of 1233 families for is mutated in sporadic breast cancer. Cancer Res 1992; 52: prostate cancer-susceptibility genes conducted by the interna- 1643–1646. tional consortium for prostate cancer genetics. Am J Hum Genet 11 Sato T, Sakamoto T, Takita K, Saito H, Okui K, Nakamura Y. The 2005; 77: 219–229. human prohibitin (PHB) gene family and its somatic mutations 2 Schaid DJ. The complex genetic epidemiology of prostate cancer. in human tumors. Genomics 1993; 17: 762–764. Hum Mol Genet 2004; 13 (Spec No 1): R103–R121. 12 Jupe ER, Badgett AA, Neas BR, Craft MA, Mitchell DS, Resta R 3 Lange EM, Gillanders EM, Davis CC, Brown WM, Campbell JK, et al. Single nucleotide polymorphism in prohibitin 39 untrans- Jones MP et al. Genome-wide scan for prostate cancer suscep- lated region and breast-cancer susceptibility. Lancet 2001; 357: tibility genes using families from the university of michigan 1588–1589. prostate cancer genetics project finds evidence for linkage on 13 Manjeshwar S, Lerner MR, Zang XP, Branam DE, Pento JT, Lane chromosome 17 near BRCA1. Prostate 2003; 57: 326–334. MM et al. Expression of prohibitin 30 untranslated region 4 Gillanders EM, Xu J, Chang BL, Lange EM, Wiklund F, Bailey- suppressor RNA alters morphology and inhibits motility of Wilson JE et al. Combined genome-wide scan for prostate cancer breast cancer cells. J Mol Histol 2004; 35: 639–646. susceptibility genes. J Natl Cancer Inst 2004; 96: 1240–1247. 14 Spurdle AB, Hopper JL, Chen X, McCredie MR, Giles GG, 5 Easton DF, Schaid DJ, Whittemore AS, Isaacs WJ. Where are Newman B et al. Prohibitin 30 untranslated region polymorphism the prostate cancer gene? – a summary of eight genome wide and breast cancer risk in Australian women. Lancet 2002; 360: searches. Prostate 2003; 57: 261–269. 925–926. 6 Zuhlke KA, Madeoy JJ, Beebe-Dimmer J, White KA, Griffin A, 15 Spurdle AB, Purdie DM, Chen X, Chenevix-Trench G. The Lange EM et al. Truncating BRCA1 mutations are uncommon in prohibitin 30 untranslated region polymorphism is not a cohort of hereditary prostate cancer families with evidence of associated with risk of ovarian cancer. Gynecol Oncol 2003; 90: linkage to 17q markers. Clin Cancer Res 2004; 10: 5975–5980. 145–149. 7 Gamble SC, Odontiadis M, Waxman J, Westbrook JA, Dunn MJ, 16 Mishra S, Murphy LC, Nyomba BL, Murphy LJ. Prohibitin: a Wait R et al. Androgens target prohibitin to regulate proliferation potential target for new therapeutics. Trends Mol Med 2005; 11: of prostate cancer cells. Oncogene 2004; 23: 2996–3004. 192–197.

Prostate Cancer and Prostatic Diseases