DOCSLIB.ORG

Prohibitin Mutations Are Uncommon in Prostate Cancer Families Linked to Chromosome 17Q

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Prohibitin Mutations Are Uncommon in Prostate Cancer Families Linked to Chromosome 17Q Prostate Cancer and Prostatic Diseases (2006) 9, 298–302 & 2006 Nature Publishing Group All rights reserved 1365-7852/06 $30.00 www.nature.com/pcan ORIGINAL ARTICLE Prohibitin mutations are uncommon in prostate cancer families linked to chromosome 17q KA White1, EM Lange2, AM Ray1, KJ Wojno3 and KA Cooney1,3 1Department of Internal Medicine, University of Michigan Medical School, Ann Arbor, MI, USA; 2Departments of Genetics and Biostatistics, University of North Carolina, Chapel Hill, NC, USA and 3Department of Urology, University of Michigan Medical School, Ann Arbor, MI, USA Background: Linkage studies have provided evidence for a prostate cancer susceptibility locus on chromosome 17q. The mitochondrial protein prohibitin (PHB) is a plausible candidate gene based on its chromosomal location (17q21) and known function. Methods: All coding regions and intron/exon junctions of the PHB gene were sequenced in 32 men from families participating in the University of Michigan Prostate Cancer Genetics Project that demonstrated evidence of linkage to 17q markers. Results: Although a number of nucleotide variants were identified, no coding region substitutions were identified in any of the 32 men with prostate cancer from 32 unrelated multiplex prostate cancer families. Conclusions: PHB mutations do not appear to account for the linkage signal on 17q21–22 detected in PCGP families. Fine mapping of this region is in progress to refine the candidate region and highlight additional candidate prostate cancer susceptibility genes for sequence analysis. Prostate Cancer and Prostatic Diseases (2006) 9, 298–302. doi:10.1038/sj.pcan.4500878; published online 30 May 2006 Keywords: hereditary cancer; linkage studies; sequence analysis Introduction evidence for linkage at this location.3 A combined genome-wide analysis of 426 prostate cancer families, Prostate cancer has been shown to have a strong familial including the 175 from the PCGP, also found evidence for component leading many research teams including our a prostate cancer susceptibility gene on 17q (nonpara- own to collect multiplex prostate cancer families in order metric multipoint Kong and Cox allele-sharing LOD to identify the molecular basis for this common disease. score ¼ 3.16 at marker D17S787; P ¼ 0.00007).4 Most However, despite the collection of many families and the recently, a linkage signal was also detected on 17q in a formation of an international consortium (the Inter- combined genome-wide screen of 1233 prostate cancer national Consortium for Prostate Cancer Genetics or families sponsored by the ICPCG (HLOD 1.99 near ICPCG),1 the genes that cause hereditary prostate cancer marker D17S1820 using a dominant mode-of-inheritance remain elusive. This is likely due to locus heterogeneity parametric model),1 despite little evidence for this region as well as factors specific to the disease itself, including from research teams other than the PCGP.5 In fact, no late age at diagnosis and a high background rate of other prostate research group in the ICPCG observed a sporadic cases (see review2). LOD score 41.0 at 17q21 whereas the PCGP families had Several linkage studies have provided evidence for a a HLOD score of 3.07 using the same dominant model. prostate cancer susceptibility gene on the long arm of Taken together, there is linkage evidence for a prostate chromosome 17. A genome-wide scan of 175 prostate cancer susceptibility locus on 17q, and the PCGP families cancer families from the University of Michigan Prostate appear to be relatively enriched for families with Cancer Genetics Project (PCGP) first revealed strong mutations at this locus thus representing the optimal suggestive evidence for linkage on chromosome 17q families for gene identification strategies. (LOD ¼ 2.36); the subset of pedigrees with four or more There are a number of interesting candidate genes for affected individuals (LOD ¼ 3.27) provided even greater inherited prostate cancer susceptibility that map to this 17q21–22 region. We previously performed full gene mutation analysis of the breast cancer susceptibility Correspondence: Dr KA Cooney, Department of Internal Medicine, gene BRCA1 in 93 PCGP families with nonparametric University of Michigan Medical School, 7310 CCGC, 1500 East linkage (NPL) scores 40 at 17q.6 Using denaturing high- Medical Center Drive, Ann Arbor, MI 48109-0946, USA. E-mail: [email protected] performance liquid chromatography and direct sequence Received 30 January 2006; revised 27 March 2006; accepted 27 March analysis, we identified only one deleterious BRCA1 2006; published online 30 May 2006 mutation in one man who had a family history of both Prohibitin mutations in prostate cancer KA White et al prostate and ovarian cancer. This led us to conclude that informed consent, and all research protocols and consent 299 there is likely one or more additional genes in this region forms were approved by the Institutional Review Board that may be contributing to prostate cancer susceptibility. at the University of Michigan Medical School. Cases of In this report, we describe sequence analysis of the prostate cancer were confirmed by medical records/ tumor suppressor gene prohibitin (PHB) in 32 PCGP death certificates when possible. Occasionally, indepen- families with the most significant linkage evidence at 17q dent confirmation by two family members of prostate (NPL score 41.0). PHB is located within 1 cM from the cancer in a deceased relative was used when medical marker nearest the linkage peak in the 79 PCGP families records could not be obtained. Blood samples collected with four or more confirmed cases of prostate cancer from affected individuals and from unaffected indivi- (Figure 1).3 PHB is thus a candidate hereditary prostate duals that were informative for linkage were used. DNA cancer susceptibility gene based on its location as well as was isolated from nucleated blood cells by use of the recent data demonstrating that prohibitin is down- Puregene kit (Gentra Systems, Minneapolis, MN, USA). regulated by androgens and may play a role in cell-cycle For this report, we describe results from 32 families that progression.7 were determined to have an NPL score 41 at 60.1 cM on chromosome 17. This distance was selected because it represents the linkage peak for all families analyzed Materials and methods together. Patient selection Men with prostate cancer who have at least one living Genetic analysis affected relative were asked to participate in the Sequencing primers were designed to amplify all seven University of Michigan PCGP by providing a blood PHB exons including intron/exon borders and to sample, extended family history information, and access minimize amplification of known pseudogenes (Table 1). to medical records. All participants gave written Polymerase chain reaction (PCR) was performed in a Linkage peak in GWS for 175 PCGP families D17S798 D17S1868 D17S787 53.41 cM 64.16 cM 74.99 cM BRCA1 PHB 55 60 65 70 75 80 Centromere Telomere Map Position (cM) Figure 1 Location of BRCA1 (63 cM) and PHB (63.62 cM) relative to the markers used in the Prostate Cancer Genetics Project (PCGP) GWS for prostate cancer susceptibility genes (second horizontal line). The linkage peak observed when all 175 PCGP families were analyzed together was at 60.1 cM, which is closest to marker D17S1868.3 Map distances are from The Center for Genetics at Marshfield Medical Research Foundation (www.marshmed.org/genetics). Data from the National Center for Biotechnology (www.ncbi.nlm.nih.gov) was used to place genes relative to markers. Table 1 Sequencing primers used to amplify PHB exons as well as portions of the 50 and 30 untranslated regions PCR product size (bp) Primer sequence Exon 1 F 474 ACTCACAGCGCTCTTCCACACCAA R CTCCGCCCCACCGTCGTT Exon 2 F 367 GGGGAAATAAATAGCCAGGTTGAAAAGTGA R TGTGGTATGAAATGGCAGGAGGTGAGC Exon 3 F 296 GCACCAGGGCTCTTTCAA R AGCACCTCTTCCACACTCCCTACTTTA Exon 4/5 F 631 TGGGAGGCAGAGGTTGTAGTGA R AGCCCCTTCCCCTCCTCGGTCTC Exon 6 F 523 CTGGGGAGGTGGTCGATTGAGTAGATA R CCGGAAGAAGGGATGACAGATGA Exon 7 F 808 GCCACAGCCCCGATGATT R TGAACGAGGGGGCCAGGAACG Exon 7 F 593 TAGCCTGACATGCGGTGCCCTGAG R CCCGCCTGCGTGCTGCCAAATG 30 UTR F 627 CCGGGGAGGGGCAGAGA R CCTTCGGGTTGGGGATGGAT Abbreviatons: F, forward, PCR, polymerase chain reaction; PHB, prohibitin; R, reverse. All primers are listed in 50 to 30 order. Prostate Cancer and Prostatic Diseases Prohibitin mutations in prostate cancer KA White et al 300 50 ml reaction mixture containing 5 ml10Â buffer cancer from 32 unrelated multiplex prostate cancer (Invitrogen Life Technologies, Carlsbad, CA, USA), 1 ml families failed to identify any nonsynonymous or 50 mM MgC12,1ml10mM dNTPS, 2 ml each of the two truncating mutations. A number of single nucleotide PCR primers at 5 mM concentration, 3.0 ml template DNA variants were identified, however, including four at 20 ng/ml, and 0.5 mlofTaq (Platinum Taq Polymerase, novel nucleotide substitutions, and these data Invitrogen) in double-distilled H2O. Polymerase chain are presented in Table 2. No sequence variations reaction amplification for each primer set was based on were identified in exons. the maximum annealing performance and this informa- tion is available on request. Polymerase chain reaction products were cleaned for sequencing using Montage PCR Centrifugal Filter Devices (Millipore, Billerica, MA, Discussion USA). Samples were sequenced using an ABI Prism 3100 Prohibitin was identified in 1989 through a set of Genetic Analyzer using Big Dye Terminator v1.1 che- experiments in which investigators
Load more

Recommended publications
  • RB1 Dual Role in Proliferation and Apoptosis: Cell Fate Control and Implications for Cancer Therapy
    www.impactjournals.com/oncotarget/ Oncotarget, Vol. 6, No. 20 RB1 dual role in proliferation and apoptosis: Cell fate control and implications for cancer therapy Paola Indovina1,2, Francesca Pentimalli3, Nadia Casini2, Immacolata Vocca3, Antonio Giordano1,2 1Sbarro Institute for Cancer Research and Molecular Medicine, Center for Biotechnology, College of Science and Technology, Temple University, Philadelphia, PA, USA 2 Department of Medicine, Surgery and Neuroscience, University of Siena and Istituto Toscano Tumori (ITT), Siena, Italy 3Oncology Research Center of Mercogliano (CROM), Istituto Nazionale Tumori “Fodazione G. Pascale” – IRCCS, Naples, Italy Correspondence to: Antonio Giordano, e-mail: [email protected] Keywords: RB family, apoptosis, E2F, cancer therapy, CDK inhibitors Received: May 14, 2015 Accepted: June 06, 2015 Published: June 18, 2015 ABSTRACT Inactivation of the retinoblastoma (RB1) tumor suppressor is one of the most frequent and early recognized molecular hallmarks of cancer. RB1, although mainly studied for its role in the regulation of cell cycle, emerged as a key regulator of many biological processes. Among these, RB1 has been implicated in the regulation of apoptosis, the alteration of which underlies both cancer development and resistance to therapy. RB1 role in apoptosis, however, is still controversial because, depending on the context, the apoptotic cues, and its own status, RB1 can act either by inhibiting or promoting apoptosis. Moreover, the mechanisms whereby RB1 controls both proliferation and apoptosis in a coordinated manner are only now beginning to be unraveled. Here, by reviewing the main studies assessing the effect of RB1 status and modulation on these processes, we provide an overview of the possible underlying molecular mechanisms whereby RB1, and its family members, dictate cell fate in various contexts.
    [Show full text]
  • 1 Mitochondrial Quality Control Mechanisms and the PHB (Prohibitin)
    Preprints (www.preprints.org) | NOT PEER-REVIEWED | Posted: 12 November 2018 doi:10.20944/preprints201811.0268.v1 Peer-reviewed version available at Cells 2018, 7, 238; doi:10.3390/cells7120238 1 Review 2 Mitochondrial quality control mechanisms and the PHB (prohibitin) complex 3 Blanca Hernando-Rodríguez 1,2 and Marta Artal-Sanz 1,2,* 4 1 Andalusian Center for Developmental Biology, Consejo Superior de Investigaciones Científicas/Junta de 5 Andalucía/Universidad Pablo de Olavide, Seville, Spain 6 2 Department of Molecular Biology and Biochemical Engineering, Universidad Pablo de Olavide, Seville, 7 Spain 8 * Correspondence: [email protected]; Tel.: +34- 954 978-323 9 10 Abstract: Mitochondrial functions are essential for life, critical for development, maintenance of 11 stem cells, adaptation to physiological changes, responses to stress and aging. The complexity of 12 mitochondrial biogenesis requires coordinated nuclear and mitochondrial gene expression, owing 13 to the need of stoichiometrically assemble the OXPHOS system for ATP production. It requires, in 14 addition, the import of thousands of proteins from the cytosol to keep optimal mitochondrial 15 function and metabolism. Moreover, mitochondria require lipid supply for membrane biogenesis, 16 while it is itself essential for the synthesis of membrane lipids. 17 To achieve mitochondrial homeostasis, multiple mechanisms of quality control have evolved to 18 ensure that mitochondrial function meets cell, tissue and organismal demands. Herein, we give an 19 overview of mitochondrial mechanisms that are activated in response to stress, including 20 mitochondrial dynamics, mitophagy and the mitochondrial unfolded protein response (UPRmt). We 21 then discuss the role of these stress responses in aging, with particular focus on Caenorhabditis 22 elegans.
    [Show full text]
  • Hijacking the Chromatin Remodeling Machinery: Impact of SWI/SNF Perturbations in Cancer Bernard Weissman1 and Karen E
    Published OnlineFirst October 20, 2009; DOI: 10.1158/0008-5472.CAN-09-2166 Review Hijacking the Chromatin Remodeling Machinery: Impact of SWI/SNF Perturbations in Cancer Bernard Weissman1 and Karen E. Knudsen2 1Department of Pathology and Laboratory and Lineberger Cancer Center, University of North Carolina, Chapel Hill, North Carolina and 2Department of Cancer Biology, Department of Urology, and Kimmel Cancer Center, Thomas Jefferson University, Philadelphia, Pennsylvania Abstract quently show differentially altered expression patterns and in vivo There is increasing evidence that alterations in chromatin re- functions. modeling play a significant role in human disease. The SWI/ Accompanying each ATPase are 10 to 12 proteins known as SNF chromatin remodeling complex family mobilizes nucleo- BAFs (BRG1- or BRM-associated factors) consisting of core and ac- somes and functions as a master regulator of gene expression cessory subunits (Fig. 1). The core subunits, BAF155, BAF170, and and chromatin dynamics whose functional specificity is driv- SNF5 (also referred to as SMARCB1, BAF47, or INI1), were func- en by combinatorial assembly of a central ATPase and associ- tionally classified on the basis of their ability to restore efficient ation with 10 to 12 unique subunits. Although the biochemical nucleosome remodeling in vitro (8, 9). BAF155 maintains a scaf- consequence of SWI/SNF in model systems has been extensive- folding-like function, and can influence both stability and assembly ly reviewed, the present article focuses on the evidence linking of other SWI/SNF subunits (10). The function of BAF170, which SWI/SNF perturbations to cancer initiation and tumor pro- shares homology with BAF155, is less well understood, but may gression in human disease.
    [Show full text]
  • Tumor Suppression by the Prohibitin Gene 3 Untranslated Region RNA
    [CANCER RESEARCH 63, 5251–5256, September 1, 2003] Tumor Suppression by the Prohibitin Gene 3؅Untranslated Region RNA in Human Breast Cancer1 Sharmila Manjeshwar, Dannielle E. Branam, Megan R. Lerner, Daniel J. Brackett, and Eldon R. Jupe2 Program in Immunobiology and Cancer [S. M., D. E. B., E. R. J.], Oklahoma Medical Research Foundation; InterGenetics, Inc. [S. M., E. R. J.]; and Departments of Surgery [M. R. L., D. J. B., E. R. J.] and Pathology [E. R. J.], University of Oklahoma Health Sciences Center, and Veterans Affairs Medical Center [M. R. L., D. J. B.], Oklahoma City, Oklahoma 73104 ABSTRACT protein-coding regions for mutations in familial and sporadic breast cancers (17–19). Extensive searches failed to identify protein coding Prohibitin is a candidate tumor suppressor gene located on human region mutations in familial cancers. Only 5 of 120 sporadic breast chromosome 17q21, a region of frequent loss of heterozygosity in breast cancers. We showed previously that microinjection of RNA encoded by cancers had mutations, and these were confined to regions in or ؅ ؅ around exon 4. In addition, no mutations were found in primary the prohibitin gene 3 untranslated region (3 UTR) blocks the G1-S tran- sition causing cell cycle arrest in several human cancer cell lines, including tumors of the ovary, liver, lung, or bladder (19–21). MCF7. Two allelic forms (C versus T) of the prohibitin 3؅UTR exist, and Despite the lack of mutations in protein coding regions, our studies carriers of the less common variant (T allele) with a family history of confirmed the antiproliferative activity of full-length prohibitin tran- breast cancer exhibited an increased risk of breast cancer.
    [Show full text]
  • Significance of Prohibitin Domain Family in Tumorigenesis and Its Implication in Cancer Diagnosis and Treatment
    Yang et al. Cell Death and Disease (2018) 9:580 DOI 10.1038/s41419-018-0661-3 Cell Death & Disease REVIEW ARTICLE Open Access Significance of prohibitin domain family in tumorigenesis and its implication in cancer diagnosis and treatment Jie Yang1,BinLi1 and Qing-Yu He 1 Abstract Prohibitin (PHB) was originally isolated and characterized as an anti-proliferative gene in rat liver. The evolutionarily conserved PHB gene encodes two human protein isoforms with molecular weights of ~33 kDa, PHB1 and PHB2. PHB1 and PHB2 belong to the prohibitin domain family, and both are widely distributed in different cellular compartments such as the mitochondria, nucleus, and cell membrane. Most studies have confirmed differential expression of PHB1 and PHB2 in cancers compared to corresponding normal tissues. Furthermore, studies verified that PHB1 and PHB2 are involved in the biological processes of tumorigenesis, including cancer cell proliferation, apoptosis, and metastasis. Two small molecule inhibitors, Rocaglamide (RocA) and fluorizoline, derived from medicinal plants, were demonstrated to interact directly with PHB1 and thus inhibit the interaction of PHB with Raf-1, impeding Raf-1/ERK signaling cascades and significantly suppressing cancer cell metastasis. In addition, a short peptide ERAP and a natural product xanthohumol were shown to target PHB2 directly and prohibit cancer progression in estrogen-dependent cancers. As more efficient biomarkers and targets are urgently needed for cancer diagnosis and treatment, here we summarize the functional role of prohibitin domain family proteins, focusing on PHB1 and PHB2 in tumorigenesis and cancer development, with the expectation that targeting the prohibitin domain family will offer more clues for cancer 1234567890():,; 1234567890():,; therapy.
    [Show full text]
  • BRG1 Knockdown Inhibits Proliferation Through Multiple Cellular Pathways in Prostate Cancer Katherine A
    Giles et al. Clin Epigenet (2021) 13:37 https://doi.org/10.1186/s13148-021-01023-7 RESEARCH Open Access BRG1 knockdown inhibits proliferation through multiple cellular pathways in prostate cancer Katherine A. Giles1,2,3, Cathryn M. Gould1, Joanna Achinger‑Kawecka1,4, Scott G. Page2, Georgia R. Kafer2, Samuel Rogers2, Phuc‑Loi Luu1,4, Anthony J. Cesare2, Susan J. Clark1,4† and Phillippa C. Taberlay3*† Abstract Background: BRG1 (encoded by SMARCA4) is a catalytic component of the SWI/SNF chromatin remodelling com‑ plex, with key roles in modulating DNA accessibility. Dysregulation of BRG1 is observed, but functionally uncharacter‑ ised, in a wide range of malignancies. We have probed the functions of BRG1 on a background of prostate cancer to investigate how BRG1 controls gene expression programmes and cancer cell behaviour. Results: Our investigation of SMARCA4 revealed that BRG1 is over‑expressed in the majority of the 486 tumours from The Cancer Genome Atlas prostate cohort, as well as in a complementary panel of 21 prostate cell lines. Next, we utilised a temporal model of BRG1 depletion to investigate the molecular efects on global transcription programmes. Depleting BRG1 had no impact on alternative splicing and conferred only modest efect on global expression. How‑ ever, of the transcriptional changes that occurred, most manifested as down‑regulated expression. Deeper examina‑ tion found the common thread linking down‑regulated genes was involvement in proliferation, including several known to increase prostate cancer proliferation (KLK2, PCAT1 and VAV3). Interestingly, the promoters of genes driving proliferation were bound by BRG1 as well as the transcription factors, AR and FOXA1.
    [Show full text]
  • Prohibitins: a Critical Role in Mitochondrial Functions and Implication in Diseases
    cells Review Prohibitins: A Critical Role in Mitochondrial Functions and Implication in Diseases Anna Signorile 1,*, Giuseppe Sgaramella 2, Francesco Bellomo 3 and Domenico De Rasmo 4,* 1 Department of Basic Medical Sciences, Neurosciences and Sense Organs, University of Bari “Aldo Moro”, 70124 Bari, Italy 2 Water Research Institute (IRSA), National Research Council (CNR), Viale F. De Blasio, 5, 70132 Bari, Italy; [email protected] 3 Laboratory of Nephrology, Department of Rare Diseases, Bambino Gesù Children’s Hospital, Viale di S. Paolo, 15, 00149 Rome, Italy; [email protected] 4 Institute of Biomembrane, Bioenergetics and Molecular Biotechnology (IBIOM), National Research Council (CNR), 70126 Bari, Italy * Correspondence: [email protected] (A.S.); [email protected] (D.D.R.); Tel.: +39-080-544-8516 (A.S. & D.D.R.) Received: 7 December 2018; Accepted: 15 January 2019; Published: 18 January 2019 Abstract: Prohibitin 1 (PHB1) and prohibitin 2 (PHB2) are proteins that are ubiquitously expressed, and are present in the nucleus, cytosol, and mitochondria. Depending on the cellular localization, PHB1 and PHB2 have distinctive functions, but more evidence suggests a critical role within mitochondria. In fact, PHB proteins are highly expressed in cells that heavily depend on mitochondrial function. In mitochondria, these two proteins assemble at the inner membrane to form a supra-macromolecular structure, which works as a scaffold for proteins and lipids regulating mitochondrial metabolism, including bioenergetics, biogenesis, and dynamics in order to determine the cell fate, death, or life. PHB alterations have been found in aging and cancer, as well as neurodegenerative, cardiac, and kidney diseases, in which significant mitochondrial impairments have been observed.
    [Show full text]
  • Epigenetic Regulation of Lung Cancer Cell Proliferation and Migration by the Chromatin Remodeling Protein BRG1 Zilong Li1,Junxia2, Mingming Fang3,4 Andyongxu1,4
    Li et al. Oncogenesis (2019) 8:66 https://doi.org/10.1038/s41389-019-0174-7 Oncogenesis ARTICLE Open Access Epigenetic regulation of lung cancer cell proliferation and migration by the chromatin remodeling protein BRG1 Zilong Li1,JunXia2, Mingming Fang3,4 andYongXu1,4 Abstract Malignant lung cancer cells are characterized by uncontrolled proliferation and migration. Aberrant lung cancer cell proliferation and migration are programmed by altered cancer transcriptome. The underlying epigenetic mechanism is unclear. Here we report that expression levels of BRG1, a chromatin remodeling protein, were significantly up- regulated in human lung cancer biopsy specimens of higher malignancy grades compared to those of lower grades. Small interfering RNA mediated depletion or pharmaceutical inhibition of BRG1 suppressed proliferation and migration of lung cancer cells. BRG1 depletion or inhibition was paralleled by down-regulation of cyclin B1 (CCNB1) and latent TGF-β binding protein 2 (LTBP2) in lung cancer cells. Further analysis revealed that BRG1 directly bound to the CCNB1 promoter to activate transcription in response to hypoxia stimulation by interacting with E2F1. On the other hand, BRG1 interacted with Sp1 to activate LTBP2 transcription. Mechanistically, BRG1 regulated CCNB1 and LTBP2 transcription by altering histone modifications on target promoters. Specifically, BRG1 recruited KDM3A, a histone H3K9 demethylase, to remove dimethyl H3K9 from target gene promoters thereby activating transcription. KDM3A knockdown achieved equivalent effects as BRG1 silencing by diminishing lung cancer proliferation and migration. Of interest, BRG1 directly activated KDM3A transcription by forming a complex with HIF-1α. In conclusion, 1234567890():,; 1234567890():,; 1234567890():,; 1234567890():,; our data unveil a novel epigenetic mechanism whereby malignant lung cancer cells acquired heightened ability to proliferate and migrate.
    [Show full text]
  • 1 the Mitochondrial Chaperone Prohibitin 1 Negatively Regulates
    The mitochondrial chaperone Prohibitin 1 negatively regulates interleukin-8 in human liver cancers Jin Won Yang1,2*, Ben Murray1*, Lucia Barbier-Torres1*, Ting Liu3, Zhenqiu Liu4, Heping Yang1, Wei Fan1 Jiaohong Wang1, Yuan Li1,3, Ekihiro Seki1, José M. Mato5, and Shelly C. Lu1 From the 1Division of Digestive and Liver Diseases, Cedars-Sinai Medical Center, LA, CA 90048, USA; 2College of Pharmacy, Woosuk University, Wanju, South Korea; 3Department of Gastroenterology, Xiangya Hospital, Central South University, Changsha, Hunan, China; 4Department of Public Health Sciences, Penn State College of Medicine, Hershey, PA; 5CIC bioGUNE, Centro de Investigación Biomédica en Red de Enfermedades Hepáticas y Digestivas (Ciberehd), Technology, Park of Bizkaia, 48160 Derio, Bizkaia, Spain Running title: Prohibitin 1 negatively regulates IL-8 transcription *Share first-authorship To whom correspondence should be addressed: Shelly C. Lu, M.D., Cedars-Sinai Medical Center, Davis Building, Room #2097, 8700 Beverly Blvd., Los Angeles, CA, 90048. Tel: (310) 423-5692, Fax: (310) 423-0653, e-mail: [email protected] Keywords: Interleukin-8, Jun N-terminal Kinase, liver cancer, nuclear factor κB, prohibitin 1, tumor supressor ABSTRACT lowered IL-8 expression and secretion. Silencing Prohibitin 1 (PHB1) is a mitochondrial PHB1 increased JNK and NF-κB activity, induced chaperone whose expression is dysregulated in nuclear accumulation of c-JUN and p65 and cancers. In liver cancer, PHB1 acts as a tumor enhanced their binding to the IL-8 promoter suppressor but the mechanisms of tumor containing AP-1 and NF-κB elements. Conditioned suppression are incompletely understood. Here we medium from PHB1-silenced HepG2 cells aimed to determine PHB1 target genes to better increased migration and invasion of parental understand how PHB1 influences liver HepG2 and SK-hep-1 cells, and this was blocked tumorigenesis.
    [Show full text]
  • 1 - Biorxiv Preprint Doi: This Version Posted October 4, 2019
    bioRxiv preprint doi: https://doi.org/10.1101/792465; this version posted October 4, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 Prohibitin depletion suppresses mitochondrial, lipogenic and autophagic 2 defects of SGK-1 mutant extending lifespan; implication of autophagy and 3 the UPRmt. 4 5 6 Blanca Hernando-Rodríguez1,2,*, Mercedes M. Pérez-Jiménez1,2,*, María Jesús 7 Rodríguez-Palero1,2, Antoni Pla1,2, Manuel David Martínez-Bueno1,2, Patricia de la Cruz 8 Ruiz1,2, Roxani Gatsi1,2 and Marta Artal-Sanz1,2 # 9 10 1Andalusian Centre for Developmental Biology, Consejo Superior de Investigaciones 11 Científicas/Junta de Andalucía/Universidad Pablo de Olavide, Seville, Spain 12 2Department of Molecular Biology and Biochemical Engineering, Universidad Pablo de 13 Olavide, Seville, Spain 14 #Correspondence to: [email protected] 15 *Equal contribution 16 - 1 - bioRxiv preprint doi: https://doi.org/10.1101/792465; this version posted October 4, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 17 Aging is a complex and multifactorial process influenced by different pathways 18 interacting in a not completely defined manner. Mitochondrial prohibitins (PHBs) 19 are strongly evolutionarily conserved proteins with a peculiar effect on lifespan.
    [Show full text]
  • Prohibitin 3 Untranslated Region Polymorphism and Breast Cancer
    Vol. 12, 1273–1274, November 2003 Cancer Epidemiology, Biomarkers & Prevention 1273 Null Results in Brief Prohibitin 3Ј Untranslated Region Polymorphism and Breast Cancer Risk Ian G. Campbell,1 James Allen,1 and Diana M. Eccles2 as described previously (8, 9). Briefly, women were invited to 1VBCRC Cancer Genetics Laboratory, Centre for Cancer Genomics and take part in a research study, the primary goal of which was to Predictive Medicine, Peter MacCallum Cancer Centre, St. Andrew’s Place, ascertain and verify family histories for segregation analysis. East Melbourne, Victoria, Australia and 2Wessex Clinical Genetics Service, The breast cancer cases diagnosed before 40 years of age were Princess Anne Hospital, Southampton, United Kingdom consecutively ascertained without regard to family history. The group of women with bilateral breast cancer were ascertained in Introduction the same clinics, but the selection criterion was the presence of Prohibitin is an antiproliferative protein (1) and may function as bilateral breast cancer diagnosed after 39 years of age. The a tumor suppressor through interaction with the retinoblastoma familial breast cancer cases consisted of women presenting to tumor suppressor protein and its family members (2). In addi- the same clinics with a strong family history of breast or tion, somatic mutations have been identified in human cancers, ovarian cancer or both. Family histories were verified to the including breast cancer (3, 4). Interestingly, the prohibitin 3Ј greatest possible extent from medical records and death certif- UTR3 exhibits the characteristics of a trans-acting regulatory icates. Blood was taken from all recruits who consented to RNA that is able to arrest cell proliferation (5).
    [Show full text]
  • Prohibitin Is Required for Transcriptional Repression by the WT1–BASP1 Complex
    Oncogene (2014) 33, 5100–5108 & 2014 Macmillan Publishers Limited All rights reserved 0950-9232/14 www.nature.com/onc ORIGINAL ARTICLE Prohibitin is required for transcriptional repression by the WT1–BASP1 complex E Toska1, J Shandilya1, SJ Goodfellow2, KF Medler1 and SGE Roberts1,3 The Wilms’ tumor-1 protein (WT1) is a transcriptional regulator that can either activate or repress genes controlling cell growth, apoptosis and differentiation. The transcriptional corepressor BASP1 interacts with WT1 and mediates WT1’s transcriptional repression activity. BASP1 is contained within large complexes, suggesting that it works in concert with other factors. Here we report that the transcriptional repressor prohibitin is part of the WT1–BASP1 transcriptional repression complex. Prohibitin interacts with BASP1, colocalizes with BASP1 in the nucleus, and is recruited to the promoter region of WT1 target genes to elicit BASP1- dependent transcriptional repression. We demonstrate that prohibitin and BASP1 cooperate to recruit the chromatin remodeling factor BRG1 to WT1-responsive promoters and that this results in the dissociation of CBP from the promoter region of WT1 target genes. As seen with BASP1, prohibitin can associate with phospholipids. We demonstrate that the recruitment of PIP2 and HDAC1 to WT1 target genes is also dependent on the concerted activity of BASP1 and prohibitin. Our findings provide new insights into the function of prohibitin in transcriptional regulation and uncover a BASP1–prohibitin complex that plays an essential role in the PIP2-dependent recruitment of chromatin remodeling activities to the promoter. Oncogene (2014) 33, 5100–5108; doi:10.1038/onc.2013.447; published online 28 October 2013 Keywords: WT1; BASP1; prohibitin; transcription INTRODUCTION Previous gel filtration analyses revealed that BASP1 is contained 8 The Wilms’ tumor-1 protein (WT1) plays an important role in within large complexes within the nucleus.
    [Show full text]