SILENCING SUPPRESSION BY HERPES SIMPLEX VIRUS TYPE 1
DISSERTATION
Presented in Partial Fulfillment of the Requirements for
the Degree Doctor of Philosophy in the Graduate
School of The Ohio State University
By
Zetang Wu, M.S.
*****
The Ohio State University 2008
Dissertation Committee: Approved by Dr. Deborah S. Parris, Advisor
Dr. Biao Ding
Dr. Kathleen Boris Lawrie Advisor Molecular, Cellular, and Developmental Biology Dr. David M. Bisaro Graduate Program
ABSTRACT
It was hypothesized that herpes simplex virus type 1 (HSV 1) encodes one or more proteins capable of functioning as a silencing suppressor during productive infection. A transient silencing system was developed that relies on co transfection of mammalian cells with a plasmid that expresses a silencing target (EGFP) and one that expresses either a perfect EGFP specific hairpin (dsEGFP) or an imperfect hairpin
(midsEGFP). Co transfection of target plasmid with a plasmid that expresses perfect or imperfect hairpins specific for lacZ (dsLacZ or midsLacZ, respectively), was used as a control. Results demonstrated that dsEGFP and midsEGFP reduced the EGFP mRNA level by 2.5 and 7 fold, respectively, compared with control hairpins, and a 1:1 molar ratio of midsEGFP to target plasmid yielded maximum silencing of EGFP. Silencing by the midsEGFP hairpin decreased the half life of EGFP mRNA ~2 fold compared with the control imperfect hairpin.
Infection of transfected cells with HSV 1 wild type strain KOS increased the steady state amount of EGFP mRNA, regardless of whether or not the EGFP transcript contained an intron. This increase was due, at least in part, to an increase in the half life of EGFP mRNA in silenced cells, consistent with silencing suppression. This increased
EGFP mRNA half life occurred despite the fact that host shut off functions of HSV 1 are
ii known to globally reduce the stability of mRNAs. Indeed viruses with loss of function mutations in these host shut off genes increased the stability of EGFP mRNA in silenced cells to an even greater extent than the wild type virus. Increased accumulation of target
EGFP mRNA occurred as early as 4 hr after HSV 1 infection and did not require viral
DNA synthesis, suggesting that the silencing suppressor activity was an immediate early gene product or a virion component.
We tested several immediate early genes and a virion component gene for ability to suppress silencing in an established plant assay and found that only the virion component, US11, could suppress silencing in plants in the absence of other HSV 1 genes. Further experiments suggest that US11 could play an important role in silencing suppression in mammalian cells.
Taken together these results demonstrate that infection by HSV 1 can suppress established silencing and suggest that this silencing suppression may have evolved as a means to counter a very early host silencing response following virus infection. A prediction of this hypothesis is that replication of HSV 1 would be enhanced if the host
silencing response were abrogated. To test this prediction, siRNAs were transfected into
cells to knock down the RNA slicer activity, argonaut 2 (Ago 2), prior to virus infection.
The yields of virus following HSV 1 infection of cells treated with siRNA to Ago 2,
compared to those treated with RISC free control RNA duplex, were significantly
increased.
iii
Dedicated to my parents, my wife and daughter
iv
ACKNOWLEDGMENTS
I express my sincere appreciation to my advisor, Dr. Deborah S. Parris for her
guidance, insight, encouragement and constant support. Also, I deeply thank her for her patience throughout the research. Her full support was the key to the success of my work.
I extend my gratitude to my committee members Dr. Biao Ding, Dr. Kathleen
Boris Lawrie and Dr. David M. Bisaro for their generosity with their time, valuable
suggestions and enthusiastic support.
I would like to express my sincere gratefulness to all the former and current
members in Dr. Parris’ lab, Dr. Yali Zhu, Dr. Liping Song, Dr. Kelly S. Trego, Dr.
Murari Chaudhuri, and Ms. Houleye Diallo for their help, friendship and encouragement.
Especially, I thank Dr. Yali Zhu for her experienced technical support and stimulating
discussions.
I extend my appreciation to all the former and current members in Dr. Bisaro’ lab,
Dr. Hui Wang, Dr. Kenneth Buckley, Priya Raja, Cody Buchmann, Xiaojuan Yang,
Gireesha Mohannath for generous help and dedicated cooperation. In particular, I would
like to express my sincere thanks to Dr. Hui Wang for his excellent technical support and
useful suggestions, to Dr. Kenneth Buckley for his kind help in revising my candidacy
exam proposal and doing the plant experiment for the project.
v I would also like to express my deepest appreciation to Mrs. Yaoling Shu for helping me do the quantitative real time PCR.
Finally, I would like to sincerely thank my parents and my family for their continuous love, unconditional support and encouragement. To my parents, Chenan Wu and Zhongyu Tian, I sincerely thank you for life long love. To my wife, Shuangling He, and my daughter, Iris Wu, I am sorry for not taking the responsibilities for the family I should have shouldered in the past several years, and I deeply apologize to you for the inconvenience I have brought home over all the challenging time. I know that without your understanding, constant love and encouragement, it would be impossible for me to have completed this work. Thank you all for your support.
vi
VITA
1981 1985………………… B.S, Agronomy, Agronomy Department, Southwest Agriculture University, Chongqing, P.R.C
1985 1988………………… M.S, Biochemistry, The Basic Science Department, Southwest Agriculture University, Chongqing, P.R.C
1988 1998………………… Lecturer/Assistant Professor, The Department of Biology, China West Normal University, Nanchong, Sichuan, P.R.C
1998 2001………………… Research Associate, The Department of Chemical Engineering, The Ohio State University
2001 Present……………… Research Associate, The Department of Molecular Virology, Immunology, and Medical Genetics, The Ohio State University
2003 Present……………… Ph.D student, MCDB, The Ohio State University
PUBLICATIONS
1. Zetang Wu , Shang Tian Yang (2003). Butyric acid extractive fermentation by
immobilized clostridium tyrobutyricum in fibroud bed bioreactor. Biotechnol.
Bioeng., 82(1),92 102
2. Ying Zhu, Zetang Wu , Shang Tian Yang (2002). Butyric acid production from Acid
vii hydrolysate of corn fiber by clostridium tyrobutyricum in a fibroud bed
bioreactor. Process Biochemistry, 38(5), 657 – 666
3. Huang, Yu Liang; Wu, Zetang ; Zhang, Likun; Ming Cheung, Chun; Yang, Shang
Tian (2002). Production of carboxylic acids from hydrolyzed corn meal by
immobilized cell fermentation in a fibrous bed bioreactor. Bioresource Technology,
82(1), 51 59
4. Tang Wen qiang, Bai Juan, Wu Shu ping, Zetang Wu et. al (1999). Influence of
different pH on the biological activity of calmodulin, an insight into the regulation
mechanism of extracellular calmodulin. Journal of Hebei Normal University, 23(1),
106 111
5. Zetang Wu (1998). Studies on the reasons for low activity of SOD of Nanhuang
barley leaves. Journal of Sichuan Teachers College, 19(2), 152 155
6. Yang Jin, Zetang Wu (1998). Studies on optimal conditions for measurement of
protein content by Bradford method. Journal of Sichuan Teachers College, 19(2),
198 200
7. Zetang Wu , Hou Wan Ru (1997). Study on the relation between the influences of
KT, ABA and MDA on SOD activity. SOD conformation and hydrophobicity
changes. Chinese Biochemical Journal, 13(6),716 718
viii
8. Hou wanru, Zetang Wu , Xu XinMing (1996). The quantitative measurement standard
for copper sodium chlorophyll. Journal of Sichuan Teachers College, 17(3), 24 27
9. Zetang Wu ( 1991). Relationship between superoxide radical and destruction of
chlorophyll during leaf senescence. Plant Physiology Communications, 27(4), 277
279
10. Zetang Wu , Yang Daqi (1991). Studies on the protective effect of ethanol on the
destruction of plasma membrane during plant leave senescence. Journal of Southwest
Agriculture University, 13(2), 204 206
11. Zetang Wu , Zhang Gangyuan (1990). Studied on the influence of ABA and 6 benzyl
aminopurine on the destruction of plasma membrane of leaves. Journal of Sichuan
Teachers College, 11(3), 213 216
12. Zetang Wu , Zhang Gang Yaun (1990). Effects of abscisic acid, cytokinin and
malonaldehyde on superoxide dismutase activity. Plant Physiology Communications,
4, 30 32
13. Zetang Wu , Yang Daqi (1990). Studies on the relation between enzyme activities
and the destruction of plasma membrane during detached leaf senescence. Journal of
Southwest Agriculture University, 12(4), 371 374
ix
FIELDS OF STUDY
Major Field: Molecular, Cellular, and Developmental Biology
x
TABLE OF CONTENTS
Page
Abstract……………………………………………………………………………... ii
Dedication………………………………………………………………………...... iv
Acknowledgments………………………………………………………………… v
Vita…………………………………………………………………………………. vii
List of Tables……………………………………………………………………….. xiv
List of Figures……………………………………………………………………… xv
List of Abbreviations……………………………………………………………….. xvii
CHAPTER 1………………………………………………………………………... 1
INTRODUCTION………………………………………………………………….. 1
1. Background information about herpes simplex virus type 1………………. 1 1.1. HSV 1 virion and genetic structures…………………………………. 1 1.2. HSV 1 life cycles…………………………………………………….. 4 1.3. Productive cycle of HSV 1…………………………………………... 5 1.4. HSV 1 encodes mechanisms to alter the cellular environment in 9 favor of viral replication………………………………………………….. 1.5. HSV 1 induces interferon response during lytic infection and 10 encodes several mechanisms to antagonize this anti viral defense………. 2. RNA silencing.…………………………………………………………….. 15 3. RNA silencing and viral infection in mammalian cells.…………………... 18 3.1. Mammalian viruses can be targets of siRNAs……………………….. 19 3.2. Mammalian viruses encode virus derived miRNAs and several virus 20 derived miRNAs have been discovered to target viral mRNAs for cleavage…………………………………………………………………… 3.3. RNA silencing might be a general mechanism adopted by 21 mammalian cells to overcome viral infection…………………………….. xi 4. HSV 1 infection and RNA silencing……………………………………… 23 4.1. HSV 1 produces dsRNAs and encodes viral miRNAs during lytic 23 Infection………………………………………………………………….. 4.2. US11 encoded by HSV 1 functions similarly to a known silencing 23 suppressor in mammalian cells, influenza NS1 protein………………….. 4.3. Do hosts employ RNAi to antagonize HSV 1 infection?…………… 25 CHAPTER 2………………………………………………………………………... 29
MATERIALS AND METHODS…………………………………………………... 29
CHAPTER 3………………………………………………………………………... 50
OPTIMIZATION OF A TRANSIENT SILENCING SYSTEM IN MAMMALIAN CELLS……………………………………………………………. 50
Effect of perfect and imperfect RNA hairpins on target mRNA levels……… 50 Effect of molar ratio of pmidsEGFP to pEGFP C2 on silencing…………….. 52 Effect of midsEGFP on EGFP mRNA degradation rate……………….…….. 53 CHAPTER 4………………………………………………………………………... 62
INFECTION BY HSV 1 SUPPRESSSES SILENCING…………………………... 62
Effect of HSV 1 infection on steady state target mRNA levels in 62 silenced and control cells……………………………………………….……. Effect of HSV 1 infection on expression of intron containing EGFP in 63 silenced cells…………………………………………………………………. Effect of infection of silenced and control cells with HSV 1 on the half life 66 of target EGFP mRNA……………………………………………..………… Effect of mutation in viral host shut off functions or ICP27 on steady state 67 target levels and the half life of target mRNA………………………………. Effect of HSV 1 infection on miRNA induced silencing……………………. 70 Effect of knock down of Ago 2 on HSV 1 yield of progeny………………... 72 CHAPTER 5………………………………………………………………………... 95
ATTEMPTS TO IDENTIFY A HSV 1 SILENCING SUPPRESSOR ……………. 95
Kinetics of HSV 1 induced silencing suppression…………………………... 95 Expression profiles of HSV 1 mRNAs………………………………………. 96 Testing of candidate HSV 1 genes for silencing suppression in plants..…….. 97 Effects of infection by a US11 null mutant on silencing suppression….……. 99 CHAPTER 6………………………………………………………………………... 117
DISCUSSION……………………………………………………………………… 117 Mammalian cells mount a RNAi response to inhibit HSV 1 replication……. 117 xii Establishment of optimum conditions to achieve maximum silencing……… 118 HSV 1 encodes one or more silencing suppressors…………………………. 119 HSV 1 suppresses miRNA induced silencing effectively…………………… 121 Silencing suppressor activity of HSV 1 could be an immediateearly gene 121 product or a virion component……………………………………………….. HSV 1 US11 can function as a silencing suppressor in plants………………. 122 US11 might be involved in silencing suppression by HSV 1 in mammalian 122 cells…………………………………………………………………………... BIBLIOGRAPHY…………………………………………………………………... 125
xiii
LIST OF TABLES
Page Table 1 Description of HSV 1 mutants and phenotypes..…………………… 40
Table 2 Sequences of oligos used for expressing RNA hairpins……………. 41
Table 3 Primers used for PCR……………………………………………….. 42
Table 4 PCR amplification…………………………………………………… 43
Table 5 Construction of plasmids……………………………………………. 44
xiv
LIST OF FIGURES
Page Figure 1.1 miRNA and siRNA pathways in mammalian cells………………... 27 Figure 2.1 Organization of EGFP expression plasmids……………………….. 46 Figure 2.2 Structure of RNA hairpin expression plasmids……………………. 48 Figure 3.1 Effects of the perfect and imperfect dsEGFP hairpins on EGFP 54 mRNA levels………………………………………………………. Figure 3.2 Effect of molar ratio of pmidsEGFP and pmidsLac Z to pEGFP C2 57 on steady state EGFP mRNA levels………………………………. Figure 3.3 Effect of midsEGFP on the half lives of EGFP and β actin 59 mRNAs…………………………………………………………….. Figure 4.1 Effect of HSV 1 infection on steady state target and non target 74 mRNA levels………………………………………………………. Figure 4.2 Effect of intron within the target EGFP gene on mRNA 77 accumulation in silenced and control cells………………………… Figure 4.3 Effect of HSV 1 infection on accumulaton of EGFP mRNA from 79 transcripts with or without intron………………………………….. Figure 4.4 Effects of HSV 1 infection on the half lives of target and non 81 target mRNAs……………………………………………………… Figure 4.5 Effects of infection by HSV 1 host shut off mutants on 85 accumulation of target and non target mRNAs……………………. Figure 4.6 Effects of loss of host shut off function on the half lives of target 87 and non target mRNAs…………………………………………….. Figure 4.7 Silencing suppression by HSV 1 using a miRNA directed 90 luciferase reporter assay…………………………………………… Figure 4.8 Effect of knock down of Ago 2 on HSV 1 yield of progeny……... 93 Figure 5.1 Kinetics of silencing suppression by HSV 1………………………. 103 Figure 5.2 Expression profiles of representative immediate early, early and 105 late HSV 1 genes…………………………………………………... Figure 5.3 Effects of the HSV 1 DNA synthesis inhibitor, PAA, on the ability 107 of HSV 1 to suppress silencing……………………………………. Figure 5.4 Silencing suppression assay by HSV 1 genes in plants…………… 109 Figure 5.5 Effects of infection by HSV 1 US11 null mutant, the rescuant or 112 the wild type virus on the target EGFP and non target β–actin mRNA levels ………………………………………………………
xv Figure 5.6 FIG. 5.6. Effects of infection by HSV 1 US11 null mutant, the 114 rescuant or the wild type virus on the half lives of the target EGFP and β–actin RNAs………………………………………………….
xvi
LIST OF ABBREVIATIONS
Act D Actinomycin D
DMSO Dimethylsulfoxide dsEGFP Perfect EGFP RNA hairpin dsLac Z Perfect Lac Z RNA hairpin
EGFP Enhanced green fluorescence protein hr Hour(s) midsEGP Imperfect EGFP RNA hairpin midsEGP Imperfect Lac Z RNA hairpin m.o.i. Multiplicity of infection
PAA Phosphonoacetic acid
PFU Plaque forming units
xvii
CHAPTER 1
INTRODUCTION
1. Background information about herpes simplex virus type 1
1.1. HSV 1 virion and genetic structures
Herpes simplex virus type 1 (HSV 1) is an important human pathogen. HSV 1 causes cold sores, eye disease and genital lesion in humans. Under rare circumstances,
HSV 1 infection results in life threatening encephalitis. In addition, HSV 1 can cause significant morbility and mortality among immunosuppressed individuals (Reviewed in
Roizman et al., 1996).
Research indicates that 60 90% of the adult population in the world is sero positive for HSV 1, and there are millions of new cases each year (Carr et al., 2001). It is estimated that the direct medical costs (physician visits and pharmacy claims) of known cases of HSV 1 infection in the United States alone are as high as one billion per year— which is considered by most to be a gross underestimate of the actual cost. The direct medical costs of known cases of genital herpes are as high as $208 million in the United
States per year (Arvin, 2002; Rirn, 1995).
1 HSV 1 possesses a dsDNA genome of 152Kbp with 68% G+C content (Boehmer and Villani, 2003). The HSV 1 virion has a spherical shape with a diameter of 120 nm.
The outer layer of the virion is the envelope, which consists of altered host membrane and several unique viral glycoproteins (Roizman et al., 1996). Viral glycoproteins are embedded in the envelope and project from the surfaces as short spikes (Roizman et al.,
1974; Stannard et al., 1987). Beneath the envelope is the tegument, an asymmetrically amorphous layer. It is composed of viral enzymes and proteins (Zhou et al., 1999).
Some of the tegument components are involved in taking control of the host cells’ chemical processes and subverting them for viral production while some function to defend against the host immune responses (Coller et al., 2007;Xiong et al., 2007; Bucks et al., 2007; Read and Patterson, 2007; Donnelly et al., 2007; Morrison et al., 1998;
Vittone et al., 2005) . The tegument also contains some proteins with unknown functions.
Nucleocapsids are surrounded by the tegument. The HSV 1 nucleocapsid is icosahedral, and consists of 162 capsomers, with a diameter of 100 nm ( Vittone et a.l, 2005, Preston,
1997). The inner layer is the core of the virion, which is composed of a single linear
molecule of dsDNA in the form of a torus (Bucker et al., 1968). The DNA genome is
wrapped by fibrillar spool with the ends anchored to the inner side of the capsid shell
(Reviewed in Roizman et al., 1996).
The HSV 1 genome is divided into two unique regions, termed unique long
region (U L) and unique short region (U S) (Hayward et al., 1975, Morese et al., 1978). The two unique regions are bounded by internal inverted repeats while the genome termini are
2 bounded by regions of ~ 400 bp direct repeats called the “a” sequence, which is in an
inverted orientation relative to the junction between U L and U S (Roizman et al., 2001).
The U L and U S regions of the genome have the capacity to invert with respect to
each other at a high frequency, generating four equimolar isomers of viral DNA
(Roizman et al., 2001). In the genome, there are three origins, with two in U S and one in
UL (Mocarski, ES et al., 1982, Vlazy et al., 1982). Experiments have indicated that the three origins have an equal efficiency to initiate viral DNA replication in tissue culture
(Knopf et al., 1986, Quinn et al., 1985). In infected cells, the HSV 1 genome has been discovered to exist in at least three different forms: linear, circular and concatemeric
(Deshmane et al., 1995; Garber et al., 1993; Poffenberger et al., 1985). In virions, the genome is in linear form. However, the two ends of the genome join together resulting in an active endless form for DNA replication within several hours after infection. Viral
DNA replication has been thought to be initiated by an origin dependent mechanism at the early stages of infection and switches to a rolling cycle mode at the late stages of infection (Strang and Stow, 2005). Rolling cycle replication of the genome results in formation of head to tail concatemers, which are cleaved into a monomeric unit and packaged into the virions for the second round of infection (Deiss et al., 1986).
The HSV 1 genes, like those of their eukaryotic hosts, are not arranged in operons, and in most cases have individual promoters. However, unlike eukaryotic genes, very few HSV 1 genes contain introns (Roizman et al., 2001). The HSV 1 genome encodes at least 85 different products (Sacks et al., 1985). Less than half of the encoded proteins are essential for the virus to grow in tissue culture (Schranz et al., 1989; Weber
3 et al., 1987). However, the other “dispensable” genes function to modulate the cellular environment for virus production, promote cell to cell spread or defend against the host immune system, and many have been proven to be required for in vivo infection (Chou et al., 1990; Subak Sharpe and Dargan, 1998).
1.2. HSV 1 life cycles
HSV 1 alternates between two life cycles in vivo, lytic infection and latency
(Decman et al., 2005; Preston, 2000). During lytic infection, the virus replicates and infects adjacent cells. In humans, lytic infection usually lasts for 5 10 days depending on the site of infection. Subsequently, the virus is cleared from the infected tissue due to the host’s adaptive immune defenses (Kaufman et al., 1998). During lytic infection, a fraction of viruses gains access to neuronal termini, which innervate the epithelial cells at the site of lytic replication. The virus is transported by retrograde flow to the cell bodies of neurons in a sensory ganglion such as the trigeminal ganglion (TG) or dorsal root ganglion (DRG). In sensory ganglia, the virus replicates briefly and subsequently establishes latency, a quiescent state (Metcalf et al., 1987; Pereira FA, 1996). Virus replication is not necessary for latency to be established. However, brief replication of the virus increases the pool for establishment of latency. A variety of external stimuli or physiological stresses have been shown to activate the latent viruses leading to productive replication. Activated viruses from latency are transported by anterograde transport to the initially infected tissues or adjacent organs, where new rounds of lytic infection can occur and cause diseases in humans (Carr et al., 2001).
4 1.3. Productive cycle of HSV 1
The lytic replication cycle can be divided into several steps: attachment, entry, uncoating, macromolecular synthesis, assembly of viral nucleocapsids, maturation of viruses, and egress from the infected cells (Roizman et al., 2001).
Entry of HSV 1 into cells and injection of the genome DNA into the nucleus of infected cells
Entry of the virus into cells is achieved through interaction of viral glycoprotein(s) with cellular receptors (Roizman et al., 1996; Roizman et al., 2001). The interaction directly results in fusion of the virion envelope with the cell membrane. At least five HSV 1 glycoproteins, which are gB, gC,gD, gH, gL respectively, have been demonstrated to be involved in viral entry into cells (Reske et al., 2007; Aguilar et al.,
2007). During attachment, gC interacts with heparan sulfate proteoglycan on the cell membrane surface (kwon et al., 2006). This interaction is labile until other glycoproteins, such as gB and gD, begin to participate in the entry process. gB also harbors a site for interaction with other glycosoaminoglycans (Bender et al., 2005) while gD provides a stable attachment to cellular receptors such as the herpesvirus entry mediator (HVEM)
(Tsvitov et al., 2007). Binding to cellular receptors causes a conformational change of gD, which facilitates the interaction of gD with the gH/gL heterodimer (Galdiero et al.,
2004; Cairns et al., 2005). Fusion domains of the gH/gL complex and gB allows for the virus to penetrate cells in a pH independent manner (Roizman et al., 1996). What cellular receptors, other than HVEM, are required for HSV 1 entry is unknown. However, it is widely accepted that HSV 1 might utilize different receptors on different cell types,
5 which is very common among all large, complex DNA viruses. Alternatively, the virus could use common cell surface molecules rather than specific proteins as receptors for attachment (Reske et al., 2007). Endocytosis is not required for the entry of HSV 1 into the host. However, it may serve as an alternative route for penetration (Nicola et al.,
2003).
Fusion of the viral glycoproteins with the cell membrane results into release of the capsid into the cytoplasm. Next, the capsid is transported along microtubules to the nucleus (Sodeik et al., 1997), where it binds to the nuclear pore complexes (NPCs) and
the viral genome is injected into the nucleus via the nuclear pore (Ojala et al, 2000;
Batterson et al., 1983; Tognon et al., 1981). The viral genome is then circularized in the
nucleus (Strang et al., 2005). Release of the genome into the nucleus is accompanied by a
tegument protein, VP16, which functions to enhance expression of immediate early genes
through interactions with cellular transcription factors (Mcknight et al., 1987).
Viral gene expression
In the nucleus, the genome is expressed in a highly coordinated manner (Honess
et al., 1974, Roizman and Knipe, 2001). Viral proteins are classified into three distinct
categories based on their expression order immediate early genes, early genes and late
genes.
Immediate early genes are transcribed by the cellular machinery without prior
viral gene expression. A tegument protein, VP 16 (or α TIF), also plays an important role in this process (Roizman and Knipe, 2001). Oct 1, one member of Oct gene family, is the key cellular protein for initiating expression of HSV 1 immediate early genes. This
6 protein contains a DNA binding structure known as the POU domain, which is shared by the Oct gene family. Oct 1 binds to an octamer sequence, TAATGARAT (R is a purine nucleotide). HSV 1 immediate early genes have at least one copy of such an octamer sequence in their promoters (Herr et al., 1995). The binding of Oct 1 to TAATGARAT in the immediate early gene promoters results in recruitment of HSV 1 VP16 and a cellular protein, HCF (host cellular factor) to form a complex (O’Hare, 1993). The formation of this three component complex brings the C terminal domain of VP16, a strong transcription activating element, into proximity with the pre initiation complex to initiate transcription. Other members of the Oct protein family can bind to
TAATGARAT in the promoters of HSV 1 immediate early genes. However, their binding prevents expression of viral genes (Turner et al., 1996). A main function of HSV
1 immediate early genes is to trans activate early and/or late genes.
Among early gene products are the enzymes and accessory proteins for viral DNA synthesis. Early gene expression requires the prior expression of immediate early genes.
However, accumulation of early gene products leads to reduced expression of IE genes and initiation of genome replication (Roizman and Knipe, 2001). Proteins encoded by late genes include tegument and capsid proteins, and glycoproteins. They are actually divided into two subgroups, late (γ 1) and true late (γ 2) genes depending on whether their synthesis is strictly dependent upon viral DNA replication. γ 1 genes are expressed prior to
DNA replication. However, viral DNA replication enhances their expression. γ 2 gene products are not expressed in the absence of viral DNA replication (Roizman et al.,
1996).
7 HSV 1 DNA replication and cleavage/packaging
The linear viral DNA is circularized once the viral DNA is released into the nucleus of the infected cells. Viral DNA replication begins shortly after early genes are expressed and is detectable as early as 3 hours and continues up to fifteen hours postinfection (Roizman et al., 1963, Roizman et al., 1964; Igarashi et al., 1993). It has been hypothesized that at an early stage of viral infection, DNA synthesis initiates at origins with the circularized genome as template and proceeds in a theta mechanism
(Garber et al., 1993). At a late stage of infection, DNA synthesis switches to a rolling circle mode to generate head to tail concatemers. Finally, the head to tail concatemers are cleaved into unit length genome and packaged into performed caspids (Boeher and
Lehman, 1997).
Viral envelopment and egress
Once genome DNAs are assembled into capsids, the viral particles attach to patches of modified inner lamellae of the nuclear membranes and migrate to the inner nuclear membrane, where capsids become enveloped as they bud into the perinuclear space (Mettenleiter, 2002). Then, the viral particles fuse with the outer nuclear membrane, releasing viral nucleocapsids into the cytoplasm, where the naked nucleocapsids undergo tegumentation in the cytoplasmic compartment. The tegumented viral particles obtain re envelopment by moving into the Golgi apparatus, and Golgi apparatus guides the viral particles for egress (Skepper et al., 2001; Schwartz and
Roizman, 2001).
8 1.4. HSV 1 encodes mechanisms to alter the cellular environment in favor of viral
replication
Host protein synthesis is rapidly shut off during HSV 1 lytic infection, thereby
allowing viral mRNAs to dominate the host translation machinery (Roizman and Pellett,
2001). The host protein synthesis shut off is attributed to the complementary functions of
two viral genes, ICP27 and virion host shut off protein U L41 (vhs).
ICP27 is an immediate early multifunctional protein (Zhou et al., 2002; McCarthy
et al., 1989; Smith et al., 2005). HSV 1 ICP27 binds RNAs and shuttles between the
nucleus and the cytoplasm, allowing it to function in both places. ICP27 is a trans
activator, essential for expression for a subset of HSV 1 early and late gene expression
(McCarthy et al., 1989). ICP27 interacts with a key component of the cellular
spliceosome, SAP145 (Spliceosome associated protein). This association prevents the
formation of an active spliceosome, thereby reducing or abrogating splicing of host pre
mRNAs (Bryant et al., 2001). Unspliced transcripts are sequestered in the nucleus, which promotes turnover. ICP27 also interacts with the cellular mRNA transport factors
Aly/Ref and/or TAP1, thereby facilitating the transport of the predominant intronless
viral mRNAs from the nucleus into the cytoplasm (Chen et al., 2005; Chen et al., 2002).
Recently, it was shown that ICP27 is directly involved in promoting translation by binding components of the translation initiation machinery to promote viral gene
translation (Perkins et al., 2003; Fontaine Rodriguez et al., 2004).
The virion host shut off protein (vhs) is a HSV 1 late gene. However, because it is
a virion component, it can function early after infection (Kwong et al., 1987; Pak et al.,
9 1995; Smibert et al., 1992; Fenwick M et al. 1988, Fenwick et al., 1978). Virion host shut off protein is a nuclease (Feng et al., 2002). It has been shown to interact with the cellular translation initiation factor eIF4H and the related factor eIF4B (Feng et al., 2001;
Feng et al., 2005). It has been proposed that this interaction is essential for vhs to function. Viral host shut off protein first endonucleolytically cleaves sequences at the 5’ ends of mRNAs, followed by a 5’ to 3’ exonucleolytic degradation (Perez Parada et al.,
2004). It has been reported that vhs degrades cellular housekeeping, heat shock and viral mRNAs without selectivity (Pak et al., 1995; Smibert et al., 1992; Schek, 1985, Strom et al., 1987). However, some reports suggest that vhs may not degrade the cellular rRNAs
(Schek, 1985, Strom et al., 1987). The combined activities of ICP27 and vhs lead to an efficient shut off of host protein synthesis, which exclusively promotes viral gene expression.
1.5. HSV 1 induces interferon response during lytic infection and encodes several
mechanisms to antagonize this anti viral defense
Upon viral infection, mammalian hosts initiate an interferon response in response to HSV 1 replication. In turn, the virus adopts several mechanisms to antagonize this host’s restriction.
Interferon response
Interferons are a large family of cytokines first discovered for their ability to interfere with viral replication (Goodbourn et al., 2000). Interferons (IFNs) are divided into two major classes, type 1 and type II, based on their functions, (Joklik, 1990). Only type I interferons, which consists of IFN α and IFN β, has been demonstrated to be
10 involved in innate anti viral defense (Goodbourn et al., 2000). Once mammalian cells are exposed to viruses, virus encoded ligands interact with toll like receptors on cell surface
(Rasmussen et al., 2007; Kurt Jones et al., 2005). Interactions of viral ligands with the receptors activate the receptors. Activated receptors initiate a signaling cascade that culminates in up regulation of type I IFN α and IFN β expression. IFN β expression can
also be stimulated by dsRNAs generated during viral replication of RNA and DNA
viruses. Once IFN α and IFN β are produced, they are secreted from the infected cells.
Secreted interferons bind to their cognate receptors on the plasma membrane of the
adjacent cells. The interaction between IFNs and the receptor activates JAK and STAT by initiating phosphorylation events. Activated JAK and STAT translocate to the nucleus,
where they bind to the interferon stimulating response elements (ISRE) within the promoter of interferon stimulating genes (ISGs), thereby promoting the expression of
ISGs (deVeer et al., 2001; Le Page et al., 2000; Stark et al., 1998). Among all ISGs, the
most important are dsRNA dependent protein kinase R (PKR) (Gale et al., 1998), 2 5A
synthetase (OAS) and RNAase L (Silverman, 1997a; Silverman et al., 1997b). PKR,
which is activated by dsRNAs or PACT (Patel et al., 1998; Peter et al., 2001; Li et al.,
2006), phosphorylates the eukaryotic initiation factor eIF2 α of translation machinery
resulting in cessation of protein synthesis, thereby inhibiting viral replication. OAS
catalyzes the formation of 2 5A (Silverman, 1997a), therefore activating RNase L.
Activated RNase L cleaves cellular and viral mRNAs, thereby limiting viral replication
(Silverman et al., 1997b). Among all the three key anti viral components in the interferon
response, PKR plays the most critical role in viral defenses since inactivation of the
11 translation machinery by PKR will ultimately lead to apoptosis, a process that can clear viruses and completely prevent viruses from further infection (Mossman, 2002).
PKR also plays an important role in limiting viral replication in virus infected cells. dsRNAs, which are generated during viral replication for all viruses including RNA and DNA viruses (Schneider and Mohr, 2003), activate PKR. Activated PKR would deplete active eIF2 α, thus inhibiting cellular and viral protein synthesis, and blocking
viral replication.
Structurally, PKR is composed of two N terminal dsRNA binding motifs
(dsRBMs), one central dimerization motif and one C terminal catalytic domain
(Puthenveetil et al., 2006). Under a non inductive condition, the N and C terminal
regions interact with each other resulting in an inactive conformation with ATP binding
site embedded within the molecule (Li et al., 2006). PKR can be activated by dsRNAs or
ssRNAs with extensive secondary structures or PACT (Patel et al., 1998; Peters et al.,
2001; Mohr, 2004). dsRNAs bind to PKR through interaction between dsRNAs and the
two dsRBMs of PKR while activation of PKR by PACT is achieved by interaction of
PACT domain III with the central dimerization region of PKR (Peters et al., 2001).
Activation of PKR by PACT does not require PACT domains I and II. However, the
domains I and II of PACT enhance the interaction between the domain III of PACT and
the central region of PKR. Binding of dsRNAs or PACT to PKR disrupts the interaction between the N and C terminals of PKR. Disruption of N and C terminal interaction of
PKR facilitates exposure of the ATP binding site and the formation of the PKR
homodimer for activation (Li et al., 2006a and 2006b). TRBP (The TAR RNA binding
12 Protein) is a dsRNA binding protein and a component of RISC in RNAi pathway (St
Johnston et al., 1992; Kok et al., 2007). TRBP also enhances HIV replication via association with TAR (Dorin et al., 2003). TRBP and PACT belong to the same family of
RNA binding proteins, and both possess three dsRBMs (dsRNA binding motifs).
Moreover, the dsRBMs of TRBP shares a high degree of homology with those of PACT
(Gupta et al., 2003; St Johnston et al., 1992). However, TRBP and PACT have opposite effects on PKR activity. TRBP inhibits PKR activity through interaction between the first two dsRBDs of TRBP and the N terminal dsRBDs of PKR (Cosentino et al., 1995, Daher et al., 2001; Gupta et al., 2003).
Most pathogenic mammalian viruses encode antagonists to block the host cells’ interferon response (Gale et al., 1998). Interestingly, almost all antagonists encoded by viruses act on PKR and target it for inactivation (Chang et al., 1992, Tan et al., 1998; Roy et al., 1990, Liu et al., 1995). This also indirectly reflects the importance of PKR in anti viral defense. PKR antagonists encoded by viruses include non coded RNAs and various proteins with no similarity in sequence and structures (Mathews, 1990; Clemens et al.,
1994; Cosentino et al., 1995). They function to inhibit PKR by diverse mechanisms ranging from modulating PKR expression to interfering with binding of substrates to
PKR. For example, VA RNAs, encoded by Adenovirus negatively regulate PKR activity by preventing binding of activator dsRNAs to PKR (Mathews, 1990). Vaccinia virus E3L and reovirus ơ prevent activation of PKR by sequestering dsRNAs (Chang et al., 1992).
13 HSV 1 encodes different proteins to block the host interferon response at each stage of its replication during lytic infection
Mammalian cells mount an innate interferon response to counter viral infection
(Goodbourn et al., 2000; Joklik, 1990). However, successful mammalian viruses encode mechanisms to overcome the host interferon response (Tan et al., 1998). Research has demonstrated that several proteins encoded by HSV 1 co coordinately block the host interferon response throughout HSV 1 lytic infection (Peters et al., 2002; Mossman et al.,
2000; Mulvey et al., 2004). The host interferon response is initiated upon viral infection, but this response can immediately be overcome due to the function of an immediate early product ICP0 (Eidson et al., 2002). HSV 1 ICP0 is a multifunctional protein, produced early after HSV 1 infection, which trans activates viral gene expression, and possesses an ubiquitin ligase activity (Boutell et al., 2002; Van Sant et al., 2001). An ICP0 mutant is very sensitive to IFN treatment (Mossman et al., 2000). IFNs themselves are not harmful to viruses. The key for IFN response is the IFN initiated downstream cascade (Gale and katze, 1998). Expression of ISGs is stimulated by promyelocytic leukemia (PML) bodies.
ICP0 functions as an ubiquitin ligase to dismantle PML body structure, thereby preventing the production of IRGs and modulating the cellular environment for viral replication (Boutell et al., 2002; Van Sant et al., 2001).
At the early late stage of HSV 1 infection, one γ1 gene (early late genes) product,
γ134.5, blocks the host shut off of protein synthesis (Mulvey et al., 2004). γ134.5 binds to
the catalytic subunit of protein phosphatase 1α (PP1α) and forms γ134.5 PP1α complex,
which constitutes an active PP1α (He et al., 1997). Activated PP1α dephosphorylates the
14 inactivated eIF 2α due to phosphorylation by PKR and prevents the block to cellular protein synthesis. At a very late stage of HSV 1 infection, US11 is synthesized and works
with γ134.5 to block the shut off of protein translation. Mutation of US11 results in a 10 fold reduction in the production of viral late proteins in some cells, thereby reducing the formation of viral progeny (Mulvey et al., 2004). US11 binds to PKR and prevents the dimerization of PKR, which is required for its activation. Thus, US11 preserves viral translation rates (Peters et al., 2002).
2. RNA silencing
RNA interfence (RNAi) is a phenomenon in which small RNAs (21 25 nt) inhibit gene expression. RNAi was first discovered in transgenic plants as co suppression of the exogenous transgenes and its homologous endogenous counterparts (Napoli et al., 1990;
Matzke et al., 1989). Subsequent study in C. elegans indicated that the effector molecules
in gene silencing were 21 25 nt small RNAs (Guo et al., 1995; Tabara et al., 1998). Since
then, additional lines of evidence have demonstrated that RNAi is a highly conserved
mechanism to regulate gene expression in nearly all living organisms (Li and Ding,
2006). For the purpose of this dissertation, discussion will be limited to two categories of
interfering RNAs, small interfering RNA (siRNA) and microRNA (miRNA).
siRNAs and miRNAs are 21 25 nt long. However, they are different from each
other in their biogenesis and functions. miRNAs are generated from single stranded RNA
hairpin precursors while siRNAs are derived from dsRNAs (Baulcomble, 2004). miRNAs
can initiate gene silencing either by inhibiting translation or by inducing cleavage of their
targets depending on the level of their sequence complementarity to their targets
15 (Hutvagner and Zamore, 20002; Llave et al., 2000; Rhoades et al., 2002). Generally speaking, miRNAs induce translation inhibition in mammalian cells because of low sequence complementarities to their targets while miRNAs in plants initiate cleavage of their targets due to high sequence complementarities to their targets (Llave et al., 2000;
Rhoades et al., 2002). siRNAs have perfect homologies to their targets (Fig. 1.1). Thus, siRNAs usually initiate gene silencing through cleavage of their target mRNAs. In some species, siRNAs induce methylation of their cognate DNA and/or lead to formation of heterochromatin (Li and Ding, 2006; Wang et al., 2005; Vaucheret, 2007).
Nevertheless, siRNAs and miRNAs share many features in common. In addition to their similar size, siRNAs and miRNAs are the end products derived from cleavage of their precursor RNAs by a RNAase III like enzyme, Dicer. They have a similar chemical structure. That is they are small RNAs with 2 nt 3’ overhangs, 5’ phosphate and 3’ hydroxyl groups. Both function through a RNA induced silencing complex (RISC)
(Jones Rhoades et al., 2006; Tang, 2005). Moreover, siRNAs and miRNAs are functionally interchangeable. siRNAs can inhibit gene expression by repressing translation when imperfect target sequences are introduced into the 3’ UTRs of their target mRNAs. Likewise, miRNAs can function like siRNAs to cleave mRNAs when perfectly matched target sequences are engineered into the open reading frame (ORF) of
the target mRNAs (Doench et al., 2003; Zeng et al., 2003).
There are some characteristic features in RNAi pathways that differ among
species. A good example of these differences is that siRNAs and miRNAs in plants are
methylated by a RNA specific methyl transferase, HEN 1. HEN 1 catalyzed methylation
16 of siRNAs and miRNAs are essential for robust gene silencing in plants in that methylation of siRNAs and miRNAs prevents siRNAs from oligo uridylation, which promotes their instability (Boutet et al., 2003; Li et al., 2005;Yu et al., 2005; Park et al.,
2002; Xie et al., 2003). RNA dependent RNA polymerases (RDRP) are required for robust RNAi pathways in plants and C. elegans in that primary siRNAs can initiate mRNA cleavage, but are not sufficient to induce gene silencing. Secondary siRNAs, which are derived from dsRNAs amplified with the cleaved mRNA fragments as templates by RDRP, initiate additional rounds of cleavage on the targets, thereby ensuring effective silencing of target genes (Xie et al., 2004; Herr et al., 2005; Dalmay et al., 2000; Mourrain et al., 2000; Sijen et al., 2001; Smardon et al., 2000; Vaistij et al.,
2002). However, no RDRPs have been identified to date in mammals.
Another unique characteristic of RNAi in C.elegans and plants is that signals of
RNAi can be transferred to adjacent cells or can be spread throughout the whole
organism when exogenous genes are introduced into plants and worms or plants and
worms are infected by viruses (Voinnet, 2005; Hamilton et al., 2002; Himber et al., 2003; palauqui et al., 1997). It has been demonstrated that spread of RNAi signals into adjacent
cells or establishment of systemic silencing in plants and worms also needs the function
of RDRPs (Dunoyer et al., 2005; Himber et al., 2003; Schwach et al., 2005).
miRNAs are processed from primary miRNA precursors solely by Dicers in plants while miRNAs in animals are generated by a two step process (Fig. 1.1). Primary
miRNAs are first cleaved into 60 70 nt pre miRNAs by a processing center known as
Drosha Parsa complex. Subsequently, pre miRNAs are transported in the cytoplasm into
17 by exportin 5 (Brownawell and Macara, 2002). In the cytoplasm, pre miRNAs are processed into mature miRNAs by Dicer (Park et al., 2002; Reinhart et al; Papp et al.,
2003; Kurihara and Watanable, 2004, Hiraguri et al., 2005).
Nevertheless, siRNAs and miRNAs, collectively function to control gene expression (Agrawal et al., 2003; Li and Ding, 2006; Wang et al., 2005; Vaucheret,
2007). Research has demonstrated that interfering RNAs are the key components in regulation of development among plants, insects, worms and animals (Baulcombe, 2004;
Brodersen and Voinnet, 2006; Ding et al., 2004; Wienholds and Plasterk, 2005).
Misregulation of miRNA expression results in developmental defects in animals and plants (Vaucheret et al., 2004; Lee et al., 1993; Brennecke et al., 2003; Lecellier et al.,
2005, Wienholds and Plasterk, 2005). Inappropriate timing of miRNA expression or failure to timely express certain miRNAs leads to diseases including cancers in humans
(Calin et al., 2004; Michael et al., 2003; Takamizawa et al., 2004). Work has also shown that RNAi plays a critical role in viral defense in plants, and might be involved in defenses against viral infection in animals (Anandalakshmi et al., 1998; Bayne et al.,
2005; Bisaro, 2006; Lu and Cullen, 2004, Vanitharani et al., 2005).
3. RNA silencing and viral infection in mammalian cells
The role of RNAi in anti viral defenses in plants and in insects has been well
documented (Voinnet et al., 2003; Reed et al., 2003; Li et al., 2004). Almost all pathogenic viruses in plants encode silencing suppressors, which are essential for
effective viral replication (Li and Ding, 2006; Silhavy et al., 2002; Vargason et al., 2003).
A well known innate anti viral defense of mammalian cells is the interferon response
18 (Goodbourn et al., 2000; Honda et al., 2005). To date no naturally occurring siRNA pathway has been identified in mammalian cells. These features have led to an extensive debate about whether mammalian cells use a RNAi response to overcome viral infection.
However, an increasing number of lines of evidence suggest mammalian cells can employ RNAi as an anti vial defense strategy.
3.1. Mammalian viruses can be targets of siRNAs
Introduction of viral specific siRNAs prior to infection can greatly restrict viral replication in mammalian cells. Furthermore, siRNA mediated restriction of viral replication has been observed in cells infected with major classes of viruses including
DNA, RNA and retroviruses (Omoto et al., 2004; Qin et al., 2003; Bhuyan et al., 2004;
McCaffrey et al., 2003; Ge et al., 2003; Wilson et al., 2005; Dave et al., 2006). siRNAs that target HIV Tat or Rev reduced HIV replication 5 fold (Coburn and Cullen, 2002).
Introduction of siRNAs specific to NS5b resulted in non detectable level of NS5 protein and a 16 fold reduction in accumulation of HCV replicon RNAs (Wilson et al., 2005;
Randal et al., 2003). Expression of siRNAs directed against HBV led to a 13 fold reduction in HBV RNAs and the genomic DNA was undetectable (McCaffrey et al.,
2003). Introduction of siRNAs that target vaccinia virus E3L decreased the yield of progeny 50 fold (Dave et al., 2006). Application of siRNA specific for HSV 1 gD results in smaller plaque size, similar to that observed with gD null mutant (Bhuyan et al., 2004). siRNAs raised against nucleocasid protein (NP) or RNA transcriptase (PA) of influenza virus abrogate not only accumulation of target mRNAs but virion RNA as well (Ge et al.,
2003).
19 3.2. Mammalian viruses encode virus derived miRNAs and several virus derived miRNAs have been discovered to target viral mRNAs for cleavage
Virus derived miRNAs have been identified in several mammalian viruses. For example, five Epstein Barr virus (EBV) viral miRNAs have been reported (Pfeffer et al.,
2005). Kaposi sarcoma associated herpesvirus (KSHV), human cytomegalovirus, and herpesvirus 8 have been identified to encode eleven, nine, and nine miRNAs, respectively
(Pfeffer et al., 2004; Cai et al., 2005; Samols et al., 2005). With time, it is expected that more and more virus encoded miRNAs will be discovered. Among all virus derived miRNAs, several have been demonstrated to be used by viruses in favor of viral replication (Gupta et al., 2006; Sullivan et al., 2005). SV40 encodes miRNAs during its infection, which possesses perfect complementarity to large T antigen. Expression of these miRNAs reduces the expression of T antigen but doesn’t affect the yield of infectious virus relative to that generated by a mutant with mismatches introduced in the predicted target region. However, wild type SV40 infected cells are less sensitive to lysis
induced by cytotoxic T cells, and the wild type virus triggers less cytokine production in
cells compared with the mutant (Sullivan et al., 2005). These results demonstrate that
SV40 might use miRNAs encoded from its genome to inhibit the expression of antigens,
in order to modulate the host CTL response favorable for the virus. Depletion of
svaRNAs, which are siRNAs generated from VA RNAs during adenovirus replication, by
anti sense RNAs affects adenovirus production. This suggests that adenovirus svaRNAs play an important role in viral replication. These results also demonstrate that adenovirus
might use virus–encoded siRNAs to modulate either expression of viral genes or
20 expression of cellular genes in favor of viral replication (Aparicio et al., 2006). Latency associated transcripts (LATs) are the only gene expressed to a detectable level during
HSV 1 latency. Research has discovered that HSV 1 miRNAs encoded from LAT gene can prevent host cells from undergoing apoptosis by inhibiting the expression of pre apoptotic genes, TGF β and SMAD3 (Gupta et al., 2006). However, several virus encoded miRNAs have been demonstrated to function as inducers for cleavage of their cognate viral mRNAs, thereby resulting in inhibition of viral replication. vsiRNA#1 , vsiRNA# 2 and nef –derived miRNAs, which are encoded from HIV genome and reach detectable levels during HIV infection, target the HIV genome and induce cleavage of the Env mRNA. Thus, Env expression is repressed and HIV replication is inhibited
(Bennasser et al., 2005). Virus encoded miRNAs are also produced from EBV during latency and lytic infection. Among five EBV encoded miRNAs, miR BART2 has a perfect a match with 3’ UTR of the viral DNA polymerase (pol), and is abundantly expressed during lytic infection. Co transfection of a plasmid expressing miR BART2 with a plasmid expressing EBV pol led to the cleavage of the pol mRNA. These results suggest that EBV encoded miR BART2 could inhibit viral replication by silencing pol during lytic infecton (Pfeffer et al., 2004).
3.3. RNA silencing might be a general mechanism adopted by mammalian cells to overcome viral infection
Whether mammalian cells mount an RNAi response to viral infection is very controversial. However, an increasing number of lines of evidence indicate that mammalian cells might use RNA silencing as a general mechanism to defend viral
21 infection. First of all, it has been known that mammalian cells encode hundreds of miRNAs and several viruses have also been discovered to encode viral miRNAs
(Wienholds et al., 2005; Pfeffer et al., 2005; Walter et al., 2006; Cai et al., 2006; Cai et al., 2005; Cui et al., 2006). The functions of most cellular and virus encoded miRNAs are unknown (Wienholds et al., 2005). However, the possibility can’t be ruled out that mammalian cells might employ cellular or viral encoded miRNAs to attack viruses.
Moreover, recent research has demonstrated that mammalian cells can use either cellular miRNAs or virus encoded siRNAs to target PFV 1, EBV, SV 40 and HIV respectively
(Lecellier et al., 2005; Pfeffer et al., 2004; Omoto et al., 2004; Bennasser et al., 2005).
Thirdly, several viruses have been identified to encode silencing suppressors (Lu and
Cullen, 2004; Andersson et al., 2005; Sullivan et al., 2005; Lecellier et al., 2005;
Bennasser et al., 2005; Bennasser et al., 2006; Haasnoot et al., 2007; Triboulet et al.,
2007). For example, adenovirus encoded VA RNAs can block silencing pathway by preventing transport of pre miRNAs into the cytoplasm and inhibiting Dicer activity (Lu
and Cullen, 2004; Andersson et al., 2005). PFV encodes a silencing suppressor, Tas, to
counter the restriction induced by miR 32 by an unknown mechanism. When cells are
infected by HIV, the host uses virus encoded miRNAs to silence viral genes. In response
to the host induced gene silencing, HIV encodes Tat protein to interfere with Dicer
activity and prevent the production of mature miRNAs. Deletion or mutation resulting in
TAT or Tas compromised activity impacts PFV and HIV replication greatly (Bennasser
et al., 2005; Lecellier et al., 2005).
22 4. HSV 1 infection and RNA silencing
4.1. HSV 1 produces dsRNAs and encodes viral miRNAs during lytic infection
HSV 1 produces various dsRNAs by symmetric transcription of both strands of viral DNA during lytic infection (Jacquemont and Roizman, 1975a; Jacquemont and
Roizman, 1975b; Kozak and Roizman, 1975). dsRNAs can elicit a host IFN response.
However, HSV 1 encodes multiple functions to block or abrogate the host IFN response. dsRNAs also can activate the host RNAi pathway (Li and Ding, 2006), although there is no evidence that dsRNAs generated during HSV 1 lytic infection are involved in initiation of RNAi pathway.
Computational screening of the HSV 1 genome suggests that it can encode 13 miRNA precursors and 24 miRNAs. Among the predicted miRNA precursors and miRNAs, several pre miRNAs and one mature miRNA have been experimentally identified during lytic infection (Cui et al., 2006) even though their functions need to be elucidated.
4.2. US11 encoded by HSV 1 functions similarly to a known silencing suppressor in mammalian cells, influenza NS1 protein
US11 is a RNA binding protein encoded by HSV 1. US11 is a γ2 gene, expressed
very late during HSV 1 lytic infection (Roller and Roizman, 1992). However, US11 can
function early during HSV 1 infection since it is incorporated into virions (Roller and
Roizman, 1992). US11 is not essential for the virus to grow in tissue culture and in
animals (Roizman and Knipe, 2001). US11 consists of two major domains: the N
terminal trans activation motif and C terminal dsRNA binding domain (Maclean et al.,
23 1987; Roller et al., 1996). The C terminal domain, which is comprised of tandem RXP repeats, is involved in multiple functions of US11 (Peters et al., 2002; Roller et al., 1996;
Bryant et al., 2005; Diefenbach et al., 2002; Giraud et al., 2004; Koshizuka et al., 2001).
However, US11 is a multifunctional protein. For example, US11 can bind to single and double stranded RNAs. US11 can bind to single stranded RNAs shorter than 46 nt with high affinity (Bryant et al., 2005). It has been hypothesized that short RNA binding by
US11 is important for its regulation of viral gene expression (Atrill et al., 2002; Roller and Roizman, 1991). US11 can also bind to longer than 39 nt dsRNAs without sequence preference. However, binding of US11 to dsRNAs is less efficient compared with single stranded RNA (Khoo et al., 2002). Another function of US11 is that US11 binds to DNA via its N terminal trans activation motif, and promotes gene expression (Palu et al., 2001;
Schaerer Uthurralt et al., 1998). US11 also has been demonstrated to play an important role in blocking activation of PKR (Peters et al., 2002), and preventing HIPK2 induced cell growth arrest (Giraud et al., 2004). In addition, US11 promotes anterograde transport of unenveloped HSV 1 nucleocapsids to axons (Diefenbach et al., 2002).
HSV 1 US11 doesn’t share homology in sequence with influenza NS1 (Chien et al., 1997; Chien et al., 2004; Wang et al., 1999; Liu et al., 1997; Qian et al., 1995;
Poppers et al., 2000; Roller et al., 1996). However, US11 shares extensive similarities in functions with NS1. NS1 is a nonstructural protein encoded by influenza virus. It is essential for efficient viral growth and antagonizes host interferon response (Dauber et al., 2004). Also, it has been demonstrated to function as a silencing suppressor in plants, insects, worms and mammalian cells (Bucher et al., 2004; Li et al., 2004; Haasnoot et al.,
24 2007). US11 and NS1 are both dsRNA binding proteins (Chien et al., 1997; Roller et al.,
1996). They both can bind to PKR and block activation of PKR by PACT or dsRNAs
(Khoo et al., 2002; Li et al., 2006; Peters et al., 2002). Moreover, US11 and NS1 both block the activation of PKR by PACT without disturbing the interaction between PACT
and PKR. Also, they both directly interact with PACT (Peters et al., 2002; Li et al.,
2006), one known component of holo RISC of RNA silencing pathways in mammalian
cells (Lee et al., 2006; Kok et al., 2007). Based on similarities between NS1 and US11, it
is reasonable to predict that HSV 1 US11 might be a silencing suppressor encoded by
HSV 1 and function in suppressing silencing by a similar mechanism to NS1.
4.3. Do hosts employ RNAi to antagonize HSV 1 infection?
Whether HSV 1 infection initiates the host RNAi response and whether HSV 1
encodes silencing suppressor(s) are unknown. HSV 1 encodes miRNAs and generates
dsRNAs during lytic infection. Also, HSV 1 encodes a protein with functions similar to a
known silencing suppressor in mammalian cells. Therefore, we hypothesized that HSV 1
elicits the host RNAi pathway during its lytic infection, and in turn HSV 1 encodes
silencing suppressors to antagonize the host RNAi response for its full replication. In
addition, we further hypothesized that US11 is a silencing suppressor encoded by HSV 1.
To test our hypothesis, a transient silencing system was generated and optimized, and the
effect of HSV 1 on silencing was analyzed. Also, mutant assays and experiments with
well characterized silencing suppressor assay system in plants were conducted to
determine the possible function of US11 in suppressing silencing. To address whether
HSV 1 is the target of RNAi during lytic infection, experiments was conducted to
25 analyze the effect of knock down of Argonaute 2, the slicer of RNA induced silencing complex (RISC) by siRNAs on the yield of viral progeny.
26
FIG. 1.1. miRNA and siRNA pathways in mammalian cells. Primary transcripts of miRNAs are first cleaved into 60 70 nt pre miRNAs by a processing center known as Drosha Parsa complex in the nucleus. In the cytoplasm, pre miRNAs are processed into mature miRNAs by Dicer. Exogenously introduced RNA duplexes are cleaved into 21 25 nt RNA duplexes by Dicer. The guide strand in the RNA duplexes is incorporated into RISC, and direct RISC to target its cognate mRNA for cleavage. A: miRNA pathway. B: siRNA pathway.
27
miRNA siRNA
~70 nt Primary transcript Dicer Dicer Drosha (?) 21-25 nt 21-25 nt Pre-miRNA-like RISC (RNP) hairpin RISC (RNP)
Nucleus Cytoplasm
Translation repression (?) mRNA cleavage mRNA cleavage
A: miRNA pathway B: siRNA pathway
FIG. 1.1. miRNA and siRNA pathways in mammalian cells
28
CHAPTER 2
MATERIALS AND METHODS
Cells and viruses . Baby hamster kidney (BHK), african green monkey kidney
(Vero), and HEp2 cells were maintained in Dulbecco’s modified Eagle’s essential
medium (DMEM) supplemented with 7.5% fetal bovine serum (FBS, Atlanta Biologics,
Atlanta, GA), 100 units/ml penicillin, 100 g/ml streptomycin sulfate, 0.03% glutamine,
and 0.075% sodium bicarbonate for closed containers or 0.225% sodium bicarbonate for
open containers in a 5% CO 2 atmosphere. Human embryonic kidney (HEK) 293T cells
were grown in similar media but supplemented with 10% FBS. A derivative of Vero cells
that expresses ICP27 under the control of its own promoter (2 2 cells. Smith et al., 1992),
were maintained in 10% FBS containing DMEM supplemented with 500 g/ml G418.
HSV 1 wild type strains KOS and 17syn+ and several mutant viruses were used in this study. The phenotypes of mutant viruses are listed in Table 1.
Virus amplification. For stock preparation, viruses were propagated in Vero or
2 2 cells as appropriate using an input multiplicity of infection (m.o.i.) of ≈0.01 plaque
o forming Units (PFU) / cell. Cells were incubated at 34 C in a 5% CO 2 atmosphere and harvested when at least 90% of cells showed cytopathic effects. Harvested cells in
29 medium were disrupted by sonication, clarified by low speed centrifugation, and aliquots were stored at 80 o C. In experiments in which virus was used to infect BHK cells, stocks were prepared by propagation in BHK cells as detailed above. Virus titers were determined by plaque assay as previously described (Parris et al., 1978).
Plasmids . The enhanced green fluorescence protein (EGFP) expression plasmid, pEGFP C2, was purchased from Clontech (Mountain View, CA). In this construct (Fig.
2.1A), EGFP is expressed under the control of the human cytomegalovirus immediate early promoter (pCMV IE). Plasmid pintronEGFP (Fig 2.1B), in which the primary transcript that encodes EGFP contains a short intron (136 nt) 5’ of the open reading frame (ORF), was derived from pEGFP C2. The chimeric intron contains the 5’ donor splice site from the first intron of the human β globin gene, and the branch together with
3’ acceptor sequence from an intron preceding an immunoglobulin gene heavy chain variable region (Bothwell et al., 1981; Senapathy et al., 1990; Huang et al., 1990a; Huang et al., 1990b). The intron was derived from plasmid pRL CMV from Promega (Madson,
WI). Plasmid pRL CMV was cut by SnaBI and NheI. The resulting 560 bp fragment, which consists of a 300 bp 3’ end portion of the pCMV IE and the chimeric intron, was used to replace the 415 bp SnaBI NheI fragment of pEGFP C2.
Plasmid pUC linker, which was constructed to facilitate cloning the human U6 promoter (pHu6) into pUC19, was generated by replacing the multiple cloning site
(MCS) of pUC19 with an EcoR1 BamH1 Xba1 linker. The linker upper oligo is 5’
PAATTCGCGGATCCCGCTAGT 3’, and the linker lower oligo is: 5’ PCTAGA
CTAGCGGGATCCGCG 3’. Plasmid pUC Hu6, which possesses the Hu6 promoter in
30 the pUC19 backbone, was generated by ligating a 301 bp polymerase chain reaction
(PCR) product into the EcoRI and BamHI sites of pUC linker. The Hu6 promoter fragments corresponding to nucleotides 64 355 of the human U6 gene (GenBank accession number M14486), was amplified from HEp2 cell DNA by PCR using the upper and lower primers shown in Table 3 to generate EcoRI and BamHI sites at 5’ and 3’ ends, respectively. The PCR conditions used for the amplification are detailed in Table 4.
Plasmids pmidsEGFP and pmidsLac Z, express imperfect hairpins of EGFP and
Lac Z sequences, respectively, whereas plasmids pdsEGFP and pdsLac Z, express perfect
hairpins of EGFP and Lac Z sequences, respectively. Plasmids were constructed by sub
cloning a 78 80 bp sequence containing the appropriate inverted repeat into the BamHI
and XbaI sites downstream of the Hu6 promoter in pUC Hu6. The imperfect inverted
repeat DNA sequences were designed by utilizing the RNAioligoretriever program
(http://katahdin.cshl.org:9331/RNAi/html/rnai.html), and the perfect inverted repeat DNA
sequences were designed using Invitrogen website BLOCK IT RNAi designer
(https://rnaidesigner.invitrogen.com/rnaiexpress/). The imperfect hairpins were
transcribed using the pol III Hu6 promoter to yield a 28 nt sequence that is completely
complementary to a portion of the target mRNA, a 9 nt loop sequence, and a 28 nt sense
strand sequence in which several mismatches were introduced (Fig. 2.2A). For pmidsEGFP, the 28 nt anti sense strand sequence was completely complementary to nucleotides 121 148 in the EGFP ORF. For pmidsLac Z, the 28 nt anti sense strand sequence was complementary to nucleotides 58 85 in the Lac Z ORF. The perfect inverted hairpin transcripts have the sense strand sequences at the 5’ end of the loop and
31 the anti sense stand sequences are located at the 3’ end of the transcripts (Fig. 2.2B). In pdsEGFP, the 21 nt anti sense sequence is complementary to nucleotides 122 141 in the
EGFP ORF, and in pdsLac Z, the 19 nt anti sense sequence is complementary to nucleotides 294 312 in the Lac Z ORF. To each pUC Hu6 RNA construct, a BamHI sticky end sequence was added at the 5’ end of the repeat, and a sequence containing 5 T residues and a XbaI sticky overhang was added to 3’ end of the repeats. The penta dT sequence serves to terminate pHu6 driven transcription. The sequences of the upper and lower oligos used for constructing RNA hairpin expression plasmids are shown in Table
2.
Plasmid pcDNA US11, which expresses HSV 1 US11 under the control of the pCMV IE in mammalian cells, was constructed as follows. A 676 bp HSV 1 US11 containing fragment, which consists of US11 ORF together with 102 bp upstream and
127 bp downstream of the US11 ORF, was amplified by PCR using HSV 1 infected Vero cell DNA as template. The primer sequences and the PCR amplification parameters are shown in Tables 3 and 4, respectively. The 676 bp US11 containing fragment was sub cloned into the TA cloning vector pCR®2.1 (Invitrogen, Carlsbad, CA) to create plasmid
TA US11m. The 719 bp US11 containing fragment was released from TA US11m by
EcoRI cleavage and cloned into the EcoRI site of pcDNA3.1 ( ) (Invitrogen, Carlsbad,
CA).
Plasmids pKJB GFP, pKJB dsGFP, pKJB GUS (Kenneth Buckley, unpublished), express modified green fluorescence protein (GFP), double stranded GFP (dsGFP), and
β glucuronidase (GUS), respectively, in a plant binary vector under the control of the
32 enhanced 35S promoter. These plasmids were generated by excising the HindIII XbaI gene fragments from pRTL2 based GFP, β glucuronidase (GUS), dsGFP expression
constructs (kind gifts from James Carrington, Oregon State University. Johansen and
Carrington, 2001) and inserting them into the HindIII and XbaI sites of pKJB5033, a plant binary vector (a derivative of pBI121, Clontech, Mountain View, CA; Kenneth
Buckley, unpublished). Plasmid pKJB dsGFP contains the full length ORF of GFP, an
120 bp intron from the Arabidopsis RTM1 Col 0 (Chrisholm et al., 2000), and the entire
GFP coding region in the antisense orientation. Plasmid pBI19, which expresses
Cymbidium ringspot virus -encoded 19 kDa protein under the control of the 35S promoter in the binary vector pBIB61, was obtained from David Baulcombe (The
Sainsbury Laboratory, John Innes Centre, The United Kingdom) (Voinnet et al., 2003)
To make pBI US11 for expression of HSV 1 US11 in a plant binary vector, the
460 bp full length US11 containing fragment was amplified by PCR using TA US11m as described above as template with an upper primer containing a BspHI recognition site and a lower primer possessing an XbaI recognition site at the 5’ end, respectively. The primer sequences and the PCR amplification parameters are shown in Tables 3 and 4,
respectively. The PCR product was ligated into the BspHI and XbaI sites of pUC18 T
CAT (Kenneth Buckley, unpublished). The BspHI XbaI US11 gene fragment was
transferred to pRTL2 CAT and then to the binary vector, pBI CAT (Enami et al., 1994)
as a HindIII Xba1 fragment.
Plasmids pBI ICP0, pBI ICP4 and pBI ICP27 (Kenneth Buckley, unpublished),
which express HSV 1 ICP0, ICP4 and ICP27, respectively, in a plant binary vector under
33 the control of the enhanced 35S promoter, were generated by excising the HindIII XbaI gene fragments from pRTL2 based ICP0, ICP4 and ICP27 expression constructs
(Kenneth Buckley, unpublished) and inserting them into the HindIII and XbaI sites of pBI CAT, a plant binary vector. The cloning strategies for these constructs are summarized in Table 5.
DNA isolation. Uninfected and infected cell DNA was isolated using the
DNAeasy Tissue kit (Qiagen, Valencia, CA) according to the manufacturer’s
instructions. DNA concentrations were determined based on spectrophotometric readings
(1 OD corresponds to 50 g/ml of DNA).
Polymerase chain reaction. Polymerase chain reactions (PCR) were conducted
in a total volume of 100 l using the hot start method (94 oC, 10 min prior to addition of
Taq polymerase (Invitrogen, Carlsbad, CA). All PCR reactions except for those with
US11 contained 20 mM Tris HCl pH 8.4, 50 mM KCl, 250 M dNTP, 2.5 M upper primer, 2.5 M lower primer, 1.5 mM MgCl 2, 100 ng template DNA, and 2.5 units of Taq polymerase. The PCR reaction for US containing sequence was as described above but
also contained 5% dimethyl sulfoxide (DMSO). The PCR primers and amplification parameters for various DNA fragments are given in Tables 3 and 4, respectively.
Quantitative real time PCR. Reverse transcription was conducted using the
Superscript reverse transcriptase II kit from Invitrogen (Carlsbad, CA). The reaction was
carried out in a total volume of 20 l containing 2 g of total RNA, 25 mM Tris pH 8.3,
37.5 mM KCl, 1.5 mM MgCl 2, 0.1 M primer, 10 M DTT, 500 M dNTPs, and 200 units of reverse transcriptase. A primer specific to Ago 2 (the primer sequence is listed
34 in Table 3) was used for the cDNA synthesis of Ago 2 while random hexamers were employed for the cDNA synthesis of 18S rRNA, which was used as the loading control.
The RNA and primer were denatured at 70 oC for 10 minutes. For the cDNA synthesis of
Ago 2, mixtures containing the reverse transcription buffer, DTT, dNTPs, primer, and the denatured RNAs were incubated at 42 oC for 2 minutes. Two hundred units of reverse
transcriptase were added, and the reactions were carried out at 42 oC for an additional 30 minutes. For the cDNA synthesis of 18S rRNA, all components for reverse transcription were incubated at 48 oC for 90 minutes. Real time PCR (RT PCT) reactions were
conducted in a total volume of 20 l using Sybergreen master mix from Roche
(Pleasanton, CA ) according to the manufacturer’s instructions . Ago 2 RT PCR was
carried out using primers at a final concentration of 0.063 M under the following
conditions: 95 oC, 10 min; 40 cycles of 95 oC, 30s / 65 oC, 20s / 72 oC, 30s. 18S rRNA RT
PCR was conducted using primers at a final concentration of 0.252 M as follows: 95 oC,
10 min; 40 cycles of 95 oC, 15s / 56 oC, 9s / 72 oC, 20s. Ago 2 and 18S rRNA PCR products of known concentrations were utilized as templates to make the standard curves.
DNA fragments used for making standard curves were amplified from HEK 293T cell genomic DNA by PCR. The primer sequences and PCR amplification conditions are shown in Table 3 and 4, respectively.
DNA digestion by restriction enzymes and DNA recovery from gel. DNA
digestions by restriction enzymes were conducted by standard procedures according to
the manufacturer’s instructions. Recovery of DNA from a gel was carried out using the
QIAEX kit from Qiagen (Valencia, CA). DNA was eluted in 30 50 l of 10 mM Tris
35 HCl pH 8.5. Purified DNA was separated on a 1% agarose gel and quantified using the precision marker from Bio Rad (Hercules, CA) as standards.
Mammalian cell transfection. 2.5x10 5 BHK cells or 1.4x10 6 HEK 293T were seeded into 35 mm dishes or 7.5x10 5 BHK cells were seeded into 60 mm dishes in antibiotic free medium. The following morning, transfection was carried out in antibiotic and FBS free DMEM supplemented with 0.1 mM non essential amino acids using lipofectamine 2000 from Invitrogen (Carlsbad, CA) according to the manufacturer’s instructions. For plasmid DNA transfection in 35 mm dishes, 700 ng of total DNA was diluted into a total volume of 85 l by Opti Mem (Invitrogen, Carlsbad, CA) and was mixed with 85 l of 1:20 diluted lipofectamine 2000 in Opti Mem. For 60 mm dishes, 2.5