Linux Network Administrators Guide Linux Network Administrators Guide
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
UNIX Cheat Sheet – Sarah Medland Help on Any Unix Command List a Directory Change to Directory Make a New Directory Remove A
THE 2013 INTERNATIONAL WORKSHOP ON STATISTICAL METHODOLOGY FOR HUMAN GENOMIC STUDIES UNIX cheat sheet – Sarah Medland Help on any Unix command man {command} Type man ls to read the manual for the ls command. which {command} Find out where a program is installed whatis {command} Give short description of command. List a directory ls {path} ls -l {path} Long listing, with date, size and permisions. ls -R {path} Recursive listing, with all subdirs. Change to directory cd {dirname} There must be a space between. cd ~ Go back to home directory, useful if you're lost. cd .. Go back one directory. Make a new directory mkdir {dirname} Remove a directory/file rmdir {dirname} Only works if {dirname} is empty. rm {filespec} ? and * wildcards work like DOS should. "?" is any character; "*" is any string of characters. Print working directory pwd Show where you are as full path. Copy a file or directory cp {file1} {file2} cp -r {dir1} {dir2} Recursive, copy directory and all subdirs. cat {newfile} >> {oldfile} Append newfile to end of oldfile. Move (or rename) a file mv {oldfile} {newfile} Moving a file and renaming it are the same thing. View a text file more {filename} View file one screen at a time. less {filename} Like more , with extra features. cat {filename} View file, but it scrolls. page {filename} Very handy with ncftp . nano {filename} Use text editor. head {filename} show first 10 lines tail {filename} show last 10 lines Compare two files diff {file1} {file2} Show the differences. sdiff {file1} {file2} Show files side by side. Other text commands grep '{pattern}' {file} Find regular expression in file. -
Introduction to Linux – Part 1
Introduction to Linux – Part 1 Brett Milash and Wim Cardoen Center for High Performance Computing May 22, 2018 ssh Login or Interactive Node kingspeak.chpc.utah.edu Batch queue system … kp001 kp002 …. kpxxx FastX ● https://www.chpc.utah.edu/documentation/software/fastx2.php ● Remote graphical sessions in much more efficient and effective way than simple X forwarding ● Persistence - can be disconnected from without closing the session, allowing users to resume their sessions from other devices. ● Licensed by CHPC ● Desktop clients exist for windows, mac, and linux ● Web based client option ● Server installed on all CHPC interactive nodes and the frisco nodes. Windows – alternatives to FastX ● Need ssh client - PuTTY ● http://www.chiark.greenend.org.uk/~sgtatham/putty/download.html - XShell ● http://www.netsarang.com/download/down_xsh.html ● For X applications also need X-forwarding tool - Xming (use Mesa version as needed for some apps) ● http://www.straightrunning.com/XmingNotes/ - Make sure X forwarding enabled in your ssh client Linux or Mac Desktop ● Just need to open up a terminal or console ● When running applications with graphical interfaces, use ssh –Y or ssh –X Getting Started - Login ● Download and install FastX if you like (required on windows unless you already have PuTTY or Xshell installed) ● If you have a CHPC account: - ssh [email protected] ● If not get a username and password: - ssh [email protected] Shell Basics q A Shell is a program that is the interface between you and the operating system -
Unix/Linux Command Reference
Unix/Linux Command Reference .com File Commands System Info ls – directory listing date – show the current date and time ls -al – formatted listing with hidden files cal – show this month's calendar cd dir - change directory to dir uptime – show current uptime cd – change to home w – display who is online pwd – show current directory whoami – who you are logged in as mkdir dir – create a directory dir finger user – display information about user rm file – delete file uname -a – show kernel information rm -r dir – delete directory dir cat /proc/cpuinfo – cpu information rm -f file – force remove file cat /proc/meminfo – memory information rm -rf dir – force remove directory dir * man command – show the manual for command cp file1 file2 – copy file1 to file2 df – show disk usage cp -r dir1 dir2 – copy dir1 to dir2; create dir2 if it du – show directory space usage doesn't exist free – show memory and swap usage mv file1 file2 – rename or move file1 to file2 whereis app – show possible locations of app if file2 is an existing directory, moves file1 into which app – show which app will be run by default directory file2 ln -s file link – create symbolic link link to file Compression touch file – create or update file tar cf file.tar files – create a tar named cat > file – places standard input into file file.tar containing files more file – output the contents of file tar xf file.tar – extract the files from file.tar head file – output the first 10 lines of file tar czf file.tar.gz files – create a tar with tail file – output the last 10 lines -
CSC 405 Computer Security Linux Security
CSC 405 Computer Security Linux Security Alexandros Kapravelos [email protected] Unix / Linux • Started in 1969 at AT&T / Bell Labs • Split into a number of popular branches – BSD, System V (commercial, AT&T), Solaris, HP-UX, AIX • Inspired a number of Unix-like systems – Linux, Minix • Standardization attempts – POSIX, Single Unix Specification (SUS), Filesystem Hierarchy Standard (FHS), Linux Standard Base (LSB), ELF OS Security • Kernel vulnerability – usually leads to complete system compromise – attacks performed via system calls Kernel vulnerabilities Kernel vulnerabilities Kernel exploitation research is active Unleashing Use-Before-Initialization Vulnerabilities in the Linux Kernel Using Targeted Stack Spraying • reliably exploiting uninitialized uses on the kernel stack has been considered infeasible • code executed prior to triggering the vulnerability must leave an attacker-controlled pattern on the stack • a fully automated targeted stackspraying approach for the Linux kernel that reliably facilitates the exploitation of uninitialized uses • published in NDSS 2017 source: https://www.cc.gatech.edu/~klu38/publications/ubi-ndss17.pdf Unix • Code running in user mode is always linked to a certain identity – security checks and access control decisions are based on user identity • Unix is user-centric – no roles • User – identified by username (UID), group name (GID) – typically authenticated by password (stored encrypted) • User root – superuser, system administrator – special privileges (access resources, modify OS) – cannot -
Student Number: Surname: Given Name
Computer Science 2211a Midterm Examination Sample Solutions 9 November 20XX 1 hour 40 minutes Student Number: Surname: Given name: Instructions/Notes: The examination has 35 questions on 9 pages, and a total of 110 marks. Put all answers on the question paper. This is a closed book exam. NO ELECTRONIC DEVICES OF ANY KIND ARE ALLOWED. 1. [4 marks] Which of the following Unix commands/utilities are filters? Correct answers are in blue. mkdir cd nl passwd grep cat chmod scriptfix mv 2. [1 mark] The Unix command echo HOME will print the contents of the environment variable whose name is HOME. True False 3. [1 mark] In C, the null character is another name for the null pointer. True False 4. [3 marks] The protection code for the file abc.dat is currently –rwxr--r-- . The command chmod a=x abc.dat is equivalent to the command: a. chmod 755 abc.dat b. chmod 711 abc.dat c. chmod 155 abc.dat d. chmod 111 abc.dat e. none of the above 5. [3 marks] The protection code for the file abc.dat is currently –rwxr--r-- . The command chmod ug+w abc.dat is equivalent to the command: a. chmod 766 abc.dat b. chmod 764 abc.dat c. chmod 754 abc.dat d. chmod 222 abc.dat e. none of the above 2 6. [3 marks] The protection code for def.dat is currently dr-xr--r-- , and the protection code for def.dat/ghi.dat is currently -r-xr--r-- . Give one or more chmod commands that will set the protections properly so that the owner of the two files will be able to delete ghi.dat using the command rm def.dat/ghi.dat chmod u+w def.dat or chmod –r u+w def.dat 7. -
Environment Variable and Set-UID Program Lab 1
SEED Labs – Environment Variable and Set-UID Program Lab 1 Environment Variable and Set-UID Program Lab Copyright © 2006 - 2016 Wenliang Du, All rights reserved. Free to use for non-commercial educational purposes. Commercial uses of the materials are prohibited. The SEED project was funded by multiple grants from the US National Science Foundation. 1 Overview The learning objective of this lab is for students to understand how environment variables affect program and system behaviors. Environment variables are a set of dynamic named values that can affect the way running processes will behave on a computer. They are used by most operating systems, since they were introduced to Unix in 1979. Although environment variables affect program behaviors, how they achieve that is not well understood by many programmers. As a result, if a program uses environment variables, but the programmer does not know that they are used, the program may have vulnerabilities. In this lab, students will understand how environment variables work, how they are propagated from parent process to child, and how they affect system/program behaviors. We are particularly interested in how environment variables affect the behavior of Set-UID programs, which are usually privileged programs. This lab covers the following topics: • Environment variables • Set-UID programs • Securely invoke external programs • Capability leaking • Dynamic loader/linker Readings and videos. Detailed coverage of the Set-UID mechanism, environment variables, and their related security problems can be found in the following: • Chapters 1 and 2 of the SEED Book, Computer & Internet Security: A Hands-on Approach, 2nd Edition, by Wenliang Du. -
SETUID Programming Due: February 15, 2017
CSC 482/582 Assignment #3 (100 points) SETUID Programming Due: February 15, 2017 1 Introduction The learning objective of this assignment is for students to understand how environment variables affect program and system behaviors. Environment variables are a set of dynamic named values that can affect the way running processes will behave on a computer. They are used by most operating systems, including Unix and Windows. Although environment variables affect program behaviors, how they achieve that is not well understood by many programmers. Therefore, if a program uses environment variables, but the programmer do not know that they are used, the program may have vulnerabilities. In this assignment, students will learn how environment variables work, how they are propogated from parent process to child, and how they affect system/program bahivors. We are particularly interested in how environment variables affect the behavior of SETUID programs, which are usually privileged programs. SETUID is an important security mechanism in Unix operating systems. When a regular program is run, it runs with the privilege of the user executing that program. When a SETUID program is run, it runs with the privilege of the program file owner. For example, if the program’s owner is root, then when anyone runs this program, the program gains root’s privileges during its execution. SETUID allows us to perform essential tasks, such as changing passwords, but vulnerabilities in SETUID programs can allow an adversary to perform local privilege escalation. While the SETUID concept is limited to Unix, the problems of dangerous environment variables and local privilege escalation exists on all operating systems. -
Least Privilege and Privilege Separation
CSE 127: Computer Security Least privilege and privilege separation Deian Stefan Slides adopted from John Mitchell, Dan Boneh, and Stefan Savage This week… • How to build secure systems ➤ Least privilege and privilege separation ➤ Sandboxing and isolation • Key is underlying principles not mechanisms ➤ We’re going to look at systems techniques ➤ Other ways to achieve similar goals: language-based Principles of secure design • Principle of least privilege • Privilege separation • Defense in depth ➤ Use more than one security mechanism ➤ Fail securely/closed • Keep it simple Principles of secure design • Principle of least privilege • Privilege separation • Defense in depth ➤ Use more than one security mechanism ➤ Fail securely/closed • Keep it simple Principle of Least Privilege Defn: A system should only have the minimal privileges needed for its intended purposes • What’s a privilege? ➤ Ability to access (e.g., read or write) a resource Principle of Least Privilege Defn: A system should only have the minimal privileges needed for its intended purposes • What’s a privilege? ➤ Ability to access (e.g., read or write) a resource Principle of Least Privilege Defn: A system should only have the minimal privileges needed for its intended purposes • What’s a privilege? ➤ Ability to access (e.g., read or write) a resource What’s the problem with this defn? • Talking about a huge, monolith system is not really useful • Why? Network Network User input User device File system File system Breaking a system into components • Compartmentalization and isolation ➤ Separate the system into isolated compartments ➤ Limit interaction between compartments • Why is this more meaningful? Network Network User input User device File system File system How dow we break things apart? Map compartment to user ids! • Recall: permissions in UNIX granted according to UID ➤ A process may access files, network sockets, …. -
Linux Networking Cookbook.Pdf
Linux Networking Cookbook ™ Carla Schroder Beijing • Cambridge • Farnham • Köln • Paris • Sebastopol • Taipei • Tokyo Linux Networking Cookbook™ by Carla Schroder Copyright © 2008 O’Reilly Media, Inc. All rights reserved. Printed in the United States of America. Published by O’Reilly Media, Inc., 1005 Gravenstein Highway North, Sebastopol, CA 95472. O’Reilly books may be purchased for educational, business, or sales promotional use. Online editions are also available for most titles (safari.oreilly.com). For more information, contact our corporate/institutional sales department: (800) 998-9938 or [email protected]. Editor: Mike Loukides Indexer: John Bickelhaupt Production Editor: Sumita Mukherji Cover Designer: Karen Montgomery Copyeditor: Derek Di Matteo Interior Designer: David Futato Proofreader: Sumita Mukherji Illustrator: Jessamyn Read Printing History: November 2007: First Edition. Nutshell Handbook, the Nutshell Handbook logo, and the O’Reilly logo are registered trademarks of O’Reilly Media, Inc. The Cookbook series designations, Linux Networking Cookbook, the image of a female blacksmith, and related trade dress are trademarks of O’Reilly Media, Inc. Java™ is a trademark of Sun Microsystems, Inc. .NET is a registered trademark of Microsoft Corporation. Many of the designations used by manufacturers and sellers to distinguish their products are claimed as trademarks. Where those designations appear in this book, and O’Reilly Media, Inc. was aware of a trademark claim, the designations have been printed in caps or initial caps. While every precaution has been taken in the preparation of this book, the publisher and author assume no responsibility for errors or omissions, or for damages resulting from the use of the information contained herein. -
Secure Automation: Achieving Least Privilege with SSH, Sudo and Setuid Robert A
Secure Automation: Achieving Least Privilege with SSH, Sudo and Setuid Robert A. Napier – Cisco Systems ABSTRACT Automation tools commonly require some level of escalated privilege in order to perform their functions, often including escalated privileges on remote machines. To achieve this, developers may choose to provide their tools with wide-ranging privileges on many machines rather than providing just the privileges required. For example, tools may be made setuid root, granting them full root privileges for their entire run. Administrators may also be tempted to create unrestricted, null-password, root-access SSH keys for their tools, creating trust relationships that can be abused by attackers. Most of all, with the complexity of today’s environments, it becomes harder for administrators to understand the far-reaching security implications of the privileges they grant their tools. In this paper we will discuss the principle of least privilege and its importance to the overall security of an environment. We will cover simple attacks against SSH, sudo and setuid and how to reduce the need for root-setuid using other techniques such as non-root setuid, setgid scripts and directories, sudo and sticky bits. We will demonstrate how to properly limit sudo access both for administrators and tools. Finally we will introduce several SSH techniques to greatly limit the risk of abuse including non-root keys, command keys and other key restrictions. Introduction to files writable only by a particular group. For exam- ple, in FreeBSD programs that read system memory Since its introduction in 1995 by Tatu Ylonen, are setgid to a special kmem group. -
Command $Line; Done
http://xkcd.com/208/ >0 TGCAGGTATATCTATTAGCAGGTTTAATTTTGCCTGCACTTGGTTGGGTACATTATTTTAAGTGTATTTGACAAG >1 TGCAGGTTGTTGTTACTCAGGTCCAGTTCTCTGAGACTGGAGGACTGGGAGCTGAGAACTGAGGACAGAGCTTCA >2 TGCAGGGCCGGTCCAAGGCTGCATGAGGCCTGGGGCAGAATCTGACCTAGGGGCCCCTCTTGCTGCTAAAACCAT >3 TGCAGGATCTGCTGCACCATTAACCAGACAGAAATGGCAGTTTTATACAAGTTATTATTCTAATTCAATAGCTGA >4 TGCAGGGGTCAAATACAGCTGTCAAAGCCAGACTTTGAGCACTGCTAGCTGGCTGCAACACCTGCACTTAACCTC cat seqs.fa PIPE grep ACGT TGCAGGTATATCTATTAGCAGGTTTAATTTTGCCTGCACTTGGTTGGGTACATTATTTTAAGTGTATTTGACAAG >1 TGCAGGTTGTTGTTACTCAGGTCCAGTTCTCTGAGACTGGAGGACTGGGAGCTGAGAACTGAGGACAGAGCTTCA >2 TGCAGGGCCGGTCCAAGGCTGCATGAGGCCTGGGGCAGAATCTGACCTAGGGGCCCCTCTTGCTGCTAAAACCAT >3 TGCAGGATCTGCTGCACCATTAACCAGACAGAAATGGCAGTTTTATACAAGTTATTATTCTAATTCAATAGCTGA >4 TGCAGGGGTCAAATACAGCTGTCAAAGCCAGACTTTGAGCACTGCTAGCTGGCTGCAACACCTGCACTTAACCTC cat seqs.fa Does PIPE “>0” grep ACGT contain “ACGT”? Yes? No? Output NULL >1 TGCAGGTTGTTGTTACTCAGGTCCAGTTCTCTGAGACTGGAGGACTGGGAGCTGAGAACTGAGGACAGAGCTTCA >2 TGCAGGGCCGGTCCAAGGCTGCATGAGGCCTGGGGCAGAATCTGACCTAGGGGCCCCTCTTGCTGCTAAAACCAT >3 TGCAGGATCTGCTGCACCATTAACCAGACAGAAATGGCAGTTTTATACAAGTTATTATTCTAATTCAATAGCTGA >4 TGCAGGGGTCAAATACAGCTGTCAAAGCCAGACTTTGAGCACTGCTAGCTGGCTGCAACACCTGCACTTAACCTC cat seqs.fa Does PIPE “TGCAGGTATATCTATTAGCAGGTTTAATTTTGCCTGCACTTG...G” grep ACGT contain “ACGT”? Yes? No? Output NULL TGCAGGTTGTTGTTACTCAGGTCCAGTTCTCTGAGACTGGAGGACTGGGAGCTGAGAACTGAGGACAGAGCTTCA >2 TGCAGGGCCGGTCCAAGGCTGCATGAGGCCTGGGGCAGAATCTGACCTAGGGGCCCCTCTTGCTGCTAAAACCAT >3 TGCAGGATCTGCTGCACCATTAACCAGACAGAAATGGCAGTTTTATACAAGTTATTATTCTAATTCAATAGCTGA -
File Security and Permissions
File Security and Permissions File Permissions (1) u With respect to a particular file, Unix divides the set of all users on a system into three categories: – user vThe owner of the file. – group users vMost of you are in the group 2ndyr vUsed for easier administration of access control. vNormally only the superuser can set up groups. vUsers can be in more than one group. – others vEveryone else. File Permissions (2) u Permissions can be viewed with the ls -l command obelix[1] > ls -l total 1247 -rw------- 1 csnow 1117 Jul 23 15:49 bad.cpp drwx--x--x 2 csnow 2048 Jul 17 10:13 bibd/ drwxr-xr-x 2 csnow 512 Aug 27 23:18 cache/ -rw------- 1 csnow 2081 Jul 23 15:49 tst2.s -rw-r-xr-- 1 csnow 1275 Jul 23 15:49 vecexpr.cpp r read permission -rw-r-xr-- w write permission x execute permission File type - = file d = directory User Group Other l=symbolic link Permissions Permissions Permissions File Permissions (3) u Permissions are changed with the chmod command. u There are two syntaxes you can use: chmod DDD file [file ...] – DDD are 3 octal digits representing bits of protection – rwx rwx rwx can be thought of as 111 111 111 in binary rw- r-- r-- 110 100 100 6 4 4 chmod 644 file File Permissions (4) u chmod [ugoa][+-=][rwx] file [...] – This is the “symbolic” method. – chmod u+rwx file gives the User Read, Write, and eXecute – chmod g+rx file gives the Group Read and eXecute – chmod o-rwx file removes R, W, and X from Others – chmod a+x file gives All eXecute permission – chmod g=r file gives Group Read permission and makes sure it has nothing