MOLECULAR BASIS OF ABNORMAL CONDUCTION IN MICE OVER-EXPRESSING ENDOTHELIN-1
by
Erin Elizabeth Mueller
A thesis submitted in conformity with the requirements for the degree of PhD Graduate Department of Laboratory Medicine and Pathobiology
Copyright by Erin Elizabeth Mueller (2011) MOLECULAR BASIS OF ABNORMAL CONDUCTION IN MICE OVER-EXPRESSING ENDOTHELIN-1
Erin Elizabeth Mueller Doctor of Philosophy, 2011 Department of Laboratory Medicine & Pathobiology, University of Toronto
ABSTRACT
Binary transgenic (BT) mice with doxycycline (DOX)-suppressible cardiac-specific over- expression of endothelin-1 (ET-1) exhibit progressive heart failure, QRS prolongation, and death following DOX withdrawal. However, the molecular basis and reversibility of the electrophysiological abnormalities in this model were not known. Here we assess the mechanisms underlying ET-1-mediated electrical remodelling, and its role in heart failure.
Prior attempts to prevent this model of ET-1 induced cardiomyopathy with ET receptor antagonism were not beneficial. We now propose to evaluate the effectiveness of blocking the synthesis of ET-1 with CGS 26303, a dual inhibitor of endothelin converting enzyme
(ECE) and neutral endopeptidase.
BT vs. littermate control mice were withdrawn from DOX and serially studied with ultrasound biomicroscopy, octapolar catheters, multi-electrode epicardial mapping, histopathology, Western blot, immunohistochemistry and qRT-PCR. Prolonged ventricular activation and depressed rate of ventricular activation were detected as early as 4 wks after transgene activation, when structure and function of the heart remained unaffected. By 8 wks of ET-1 over-expression, biventricular systolic and diastolic dysfunction, myocardial fibrosis, cardiomyocyte hypertrophy, prolonged ventricular activation and repolarization, depressed
ii rate of ventricular activation, and abnormal atrioventricular nodal function were observed.
Within 4 wks of ET-1 induction, reduction were observed in connexin-43 mRNA, protein,
+ + and phosphorylation, Nav1.5 mRNA and protein, Na conductance, K channel interacting protein-2 mRNA and Kv4.2 mRNA. Chromatin immunoprecipitation revealed that nuclear factor κB preferentially binds to Cx43 and Nav1.5 promoters. Importantly, the associated electrophysiological abnormalities at this time point were reversible upon suppression of
ET-1 over-expression and completely prevented the development of structural and functional remodelling. Treatment with CGS-26303 (5 mg/kg/day) failed to improve survival, or hemodynamic and contractile decline.
ET-1-mediated ventricular conduction delays correlates with gap junction and ion channel remodelling, and precedes heart failure. The sequence and reversibility of this phenotype suggest that a primary abnormality in electrical remodelling may contribute to the pathogenesis of heart failure. CGS 26303 failed to prevent this cardiomyopathic phenotype.
These data suggest that chronically high levels of bigET-1, as seen in heart failure, may induce increased ECE activity and/or non-ECE ET-1 synthesis, thus circumventing the efficacy of ECE blockade in this model.
iii ACKNOWLEDGEMENTS
Firstly, I would like to thank my supervisors, Mansoor Husain and Duncan Stewart for providing insight, focus, motivation, contined support, and positive reinforcement throughout my PhD. Secondly, I would like to thank the Department of Laboratory Medicine and Pathobiology and CLAMPS for providing a great learning environment. I would also like to thank my committee members, Peter Backx and Kumaraswamy Nanthakumar for serving as mentors, and guiding my research progress. Thank you for taking an active and enthusiastic interest in my project and for providing invaluable insights, helpful discussions, and electrophysiological expertise. In particular, thank you to Stéphane Massé from
Nanthakumar’s lab, for his continued assistance with electrophysiological experiments.
Additionally, I would like to thank my family and friends, particularly my husband, for their continued support, encouragement, and patience throughout my graduate studies.
Thank you to Peter Sabatini, Karolina Kolodziejska, Sonya Hui, Shivalika Handa, Jae Choi,
Kiwon Ban, Dorota Dajnowiec, and Dan Trcka for your support, camaraderie, and all the wonderful memories over the last 7 years.
I would like to thank all past and present members of the Husain lab, in particular, the surgical skills of Abdul Momen and Golam Kabir, mouse colony management and genotyping support of Haiyan Xiao and Changsen Wang, the cell culture and qRT-PCR expertise of Karolina Kolodziejska, general lab advice from Talat Afroze, primer design assistance and office antics of Omar El-Mounayri, the guidance and reliable advice of Hassan
Zaidi, and the superb everyday support and administrative skills of Tracey Richards.
iv I would also like to thank my MSc supervisor, Susan Howlett for instilling me with a love of science. And finally, I would like to thank the Ontario Graduate Scholarship in
Science and Technology for funding throughout my PhD program.
v TABLE OF CONTENTS
ABSTRACT ...... II
ACKNOWLEDGEMENTS ...... IV
TABLE OF CONTENTS ...... VI
LIST OF TABLES ...... XI
LIST OF FIGURES ...... XII
LIST OF APPENDICES ...... XIV
LIST OF ABBREVIATIONS ...... XV
CHAPTER 1. LITERATURE REVIEW ...... 1
1.1.1 Definition ...... 2
1.1.2 Etiology and prevalence ...... 2
1.1.3 Symptoms and classifications...... 3
1.1.4 Pathophysiology ...... 4 1.1.4.1 Neurohormonal activation ...... 5 1.1.4.1 LV remodelling ...... 7
1.1.5 Treatments ...... 9
1.2 ENDOTHELIN ...... 10
1.2.1 Distribution, regulation and synthesis of ET-1 ...... 10
1.2.2 Clearance of ET-1 ...... 11
1.2.3 ECE ...... 13
1.2.4 ET Receptors and signal transduction ...... 13
1.2.5 Transgenic mouse models: genetic manipulation of ET-1 system ...... 16
1.2.6. Role of ET-1 in inflammation, hypertrophy, and fibrosis ...... 19
vi 1.2.7 Pathophysiology of ET-1 in HF ...... 23
1.3 ELECTRICAL REMODELLING ...... 25
1.3.1 Excitation in the healthy heart ...... 25 1.3.1.1 Ionic basis of cardiac action potential ...... 26 1.3.1.2 Electrophysiological mapping ...... 26 1.3.1.3 Excitation-contraction coupling and Ca2+ cycling ...... 28 1.3.1.4 Ca2+ handling proteins and Ca2+ current ...... 28 1.3.1.5 Sodium current ...... 32 + 1.3.1.6 Transient outward K current (Ito) ...... 35 + 1.3.1.7 Delayed rectifier K current (IK) ...... 36 + 1.3.1.8 Inward rectifier K current (IK1) ...... 36 1.3.1.9 Gap junctions ...... 37
1.3.2 Electrical remodelling and HF ...... 40 1.3.2.1 Ca+ channel remodelling ...... 41 1.3.2.2 Na+ channel remodelling ...... 45 1.3.2.3 K+ channel remodelling ...... 45 1.3.2.4 Gap junction remodelling ...... 46
1.3.3 Electrical remodelling and ET-1...... 46 1.3.3.1 Regulation of Ca2+ handling by ET-1 ...... 46 1.3.3.2 Regulation of cardiac repolarization by ET-1 ...... 48 1.3.3.3 Regulation of cardiac conduction by ET-1 ...... 48
1.4 RATIONALE, HYPOTHESIS, OBJECTIVES ...... 49
1.4.1 Rationale ...... 49
1.4.2 General hypothesis ...... 50
1.4.3 Hypotheses ...... 50
1.4.4 Objectives...... 50
CHAPTER 2. PHARMACOLOGICAL FAILURE OF LONG-TERM DUAL ECE- NEP INHIBITION WITH CGS-26303 IN AN ET-1 MODEL OF CARDIOMYOPATHY...... 52
2.1 INTRODUCTION...... 53
2.2 MATERIALS & METHODS...... 55
2.2.1 Experimental animals ...... 55
vii 2.2.2 Drug administration ...... 55
2.2.3 Invasive LV hemodynamics ...... 57
2.2.4 ET-1 / BigET-1 ELISA ...... 57
2.2.5 ANP ELISA ...... 58
2.2.6 Histopathology...... 58
2.2.7 ECE activity ...... 59
2.3 RESULTS ...... 59
2.3.1 Short term treatment with CGS-26303 inhibits ECE and NEP activity...... 59
2.3.2 Long term treatment with CGS-26303 fails to prevent cardiomyopathic phenotype ...... 61
2.4 DISCUSSION ...... 66
CHAPTER 3. ET-1 INDUCED ELECTRICAL REMODELLING PRECEDES LV DYSFUNCTION IN ET-1 INDUCED CARDIOMYOPATHY ...... 70
3.1 INTRODUCTION...... 71
3.2 MATERIALS & METHODS...... 72
3.2.1 Experimental animal ...... 72
3.2.2 Surface ECG and intracardiac electrophysiological evaluation ...... 72
3.2.3 Epicardial mapping ...... 74
3.2.4 Invasive LV hemodynamics ...... 76
3.2.5 Ultrasound biomicroscopy ...... 78
3.2.6 Histopathology...... 78
3.2.7 Statistical analysis ...... 78
3.3 RESULTS ...... 79
3.3.1 Electrical defects in mice with cardiac-specific ET-1 over-expression ...... 79
3.3.2 Electrical remodelling is triggered as early as 4 wks after ET-1 over-expression . 79 viii 3.3.3 HF develops by 8 weeks after ET-1 over-expression ...... 80
3.3.4 Inhibiting ET-1 expression at the onset of electrical remodelling prevents progression to HF ...... 84
3.4 DISCUSSION ...... 86
CHAPTER 4. REDUCED CONNEXIN-43 AND SODIUM CHANNEL NAV1.5 IS ASSOCIATED WITH ET-1 INDUCED ELECTRICAL UNCOUPLING ...... 89
4.1 INTRODUCTION...... 90
4.2 MATERIALS & METHODS...... 91
4.2.1 Experimental animals ...... 91
4.2.2 RNA isolation & quantitative real-time RT-PCR analysis ...... 91
4.2.3 Western blotting ...... 91
4.2.4 Immunohistochemistry ...... 95
4.2.5 HL-1 cell culture ...... 96
4.2.6 Optical mapping ...... 96
4.2.7 Isolation of NMVM ...... 97
4.2.8 Promoter analysis...... 97
4.2.9 ChIP ...... 99
4.2.10 Isolation of adult mouse ventricular myocytes ...... 100
4.2.11 Patch clamp recordings ...... 100
4.2.12 Statistical analysis ...... 101
4.3 RESULTS ...... 101
4.3.1 ET-1 mediated electrical remodelling correlates with reduced Cx43, p-Cx43, Cx40, + Nav1.5, and Na channel conductance ...... 101
4.3.2 In vitro validation of ET-1 induced electrical remodelling ...... 108
4.3.3 ET-1 induced reductions in Cx43 and Nav1.5 may be induced by NFκB ...... 108
ix 4.4 DISCUSSION ...... 113
CHAPTER 5. SUMMARY AND FUTURE DIRECTIONS ...... 120
5.1 SUMMARY AND CONCLUSIONS ...... 121
5.2 FUTURE DIRECTIONS ...... 122
5.2.1 ET-1 and atrial electrical remodelling ...... 122
5.2.2 ET-1 and K+/Ca2+ channel remodelling ...... 123
5.2.3 Role of NFκB p50 in ET-1 induced gap junction/ion channel remodelling ...... 124
5.2.4 Polymorphisms in ET-1 signaling components ...... 124
REFERENCES ...... 125
APPENDICES ...... 148
x LIST OF TABLES
Table 1.1. Remodelling of ion channels, connexins, and Ca2+ handling proteins in the failing ventricle...... 43 Table 3.1. Temporal progression and prevention of electrical remodelling in mice over- expressing ET-1 during pacing ...... 81 Table 3.2. Progression and prevention of cardiac structural and functional abnormalities as evaluated by invasive hemodynamics ...... 82 Table 3.3. Progression and prevention of cardiac dysfunction as evaluated by ultrasound biomicroscopy ...... 83 Table 4.1. Real-time PCR Primer Sequences ...... 94 Table 4.2. Real-time PCR Primer Sequences-promoters for ChIP for NFkB binding sites ... 98 Table 4.3. Progression and prevention of molecular remodelling as evaluated by LV mRNA expression levels ...... 102
xi LIST OF FIGURES
Figure 1.1 Production and degradation of ET-1 ...... 12 Figure 1.2. ET-1 mediated signaling via Gαq/s/i ...... 14 Figure 1.3. DOX-off system of cardiac over-expression of ET-1 ...... 18 Figure 1.4. Multifaceted nature of ET-1 signaling ...... 20 Figure 1.5. Illustration of NFκB activation ...... 22 Figure 1.6. Schematic of the cardiac conduction system, the ionic currents contributing to the cardiac action potential, and the surface electrocardiogram ...... 27 Figure 1.7. Ca2+ cycling in healthy cardiac myocytes ...... 29 Figure 1.8. Regional connexin expression in the heart ...... 38 Figure 1.9. Electrical remodelling of cardiac myocytes in the failing heart ...... 42 Figure 1.10. ET-1 induced electrical remodelling in cardiac myocytes ...... 47 Figure 2.1. Schematic of ET-1 synthesis, degradation, and treatment with CGS 26303 ...... 54 Figure 2.2. Schematic of experimental design ...... 56 Figure 2.3. Ex vivo validation of CGS 26303 ...... 60 Figure 2.4. Short term treatment with CGS-26303 inhibited ECE and NEP activity ...... 62 Figure 2.5. Long term treatment with CGS-26303 fails to preserve hemodynamic and LV contractile integrity in BT mice ...... 63 Figure 2.6. Long term treatment with CGS-26303 fails to inhibit ECE and NEP activity ..... 64 Figure 2.7. Therapy with CGS-26303 does not improve survival in BT mice ...... 65 Figure 2.8. Model depicting short vs. long term treatment with dual ECE-NEP inhibitor .... 69 Figure 3.1. Schematic of experimental design ...... 73 Figure 3.2. Electrophysiological evaluation using intracardiac mapping reveals electrical defects in mice over-expressing ET-1 after 8-10 weeks of transgene induction ...... 75 Figure 3.3. Temporal progression and prevention of electrical remodeling in mice over- expressing ET-1 ...... 77 Figure 3.4. Myocardial fibrosis appears after 8 wks of ET-1 over-expression ...... 85 Figure 3.5. Model showing effects of 4 vs. 8 wks of ET-1 induction ...... 87 Figure 4.1. Schematic of experimental designs ...... 92 Figure 4.2. Reduced LV Cx43 and Nav1.5 expression in mice as early as 4 wks after ET-1 induction ...... 103 Figure 4.3. Prolonged ET-1 over-expression leads to progressive loss and lateralization of Cx43 ...... 105 Figure 4.4. Prolonged ET-1 over-expression lead to progressive loss and lateralization of p- Cx43 ...... 106 Figure 4.5. Na+ channel conductance reduced in LV myocytes isolated from mice 4wks post DOX withdrawal ...... 107 Figure 4.6. ET-1 treatment had no effect on Cx43 mRNA, protein, or p-Cx43/ Total Cx43 protein expression in HL-1 cells ...... 109 Figure 4.7. ET-1 treatment had no effect on conduction velocity in HL-1 cells ...... 110 Figure 4.8. Four weeks of ET-1 transgene induction had no affect levels of left atrial ...... 111 Cx43 or Nav1.5 mRNA expression ...... 111 Figure 4.9. ET-1 reduces Cx43 levels in NMVM ...... 112 Figure 4.10. NFκB p50 preferentially binds to sites within the Cx43 and Nav1.5 promoters in the LV of ET-1 over-expressing mice ...... 114
xii Figure 4.11. Model illustrating mechanim(s) of ET-1 induced reductions of Cx43 and Nav1.5 after 4 wks of ET-1 over-expression ...... 116
xiii LIST OF APPENDICES
Appendix 1. Myocardial ET- levels after short vs. long term CGS 26303 treatment ...... 148 Appendix 2. Reduced molecular determinants of Ito (Kv4.2 and KChIP2 mRNA expression) after 4 wks of ET-1 over-expression ...... 149 Appendix 3. Cx43 core promoter sequence ...... 150 Appendix 4. Nav1.5 core promoter sequences ...... 151 Appendix 5. NFκB p50 preferentially binds to sites within the NFκBIB promoter in the LV of ET-1 over-expressing mice ...... 152 Appendix 6. NFκB p50 preferentially binds to a site within the Tbx2 promoter in the LV of ET-1 over-expressing mice ...... 153 Appendix 7. NFκB p50 does not preferentially bind to a site within the Tbx3 promoter in the LV of ET-1 over-expressing mice ...... 154 Appendix 8. NFκB p50 does not preferentially binds to sites within the Nkx2.5 promoter in the LV of ET-1 over-expressing mice ...... 155
xiv LIST OF ABBREVIATIONS
ACE angiotensin converting enzyme AH atrial-His Ang II angiotensin II ANP atrial natriuretic protein AP action potential APD action potential duration
AV2:1 2:1 AV block cycle lengths
AVERP AV effective refractory periods
AVWENK AV Wenckebach AVN atrioventricular node bigET-1 big Endothelin-1 BNP brain natriuretic peptide BT binary transgenic 2+ Cav1.2 α1C-subunit of the L-type Ca channel CN calcineurin CV conduction velocity Cx connexin DBP diastolic blood pressure DOX doxycycline dP/dt maximum positive and negative rate of LV pressure change -dV/dt maximum negative rate of voltage change E/A ratio of peak early to atrial diastolic inflow velocities ECE endothelin converting enzyme ET-1 endothelin-1 FS fractional shortening hET-1 human ET-1 HF heart failure HR heart rate HV His-ventricular
xv HW/BW heart weight body weight ratio 2+ ICa-L L-type Ca current 2+ ICa-T T-type Ca current + IKr rapid delayed rectifier K current + IKs slow delayed rectifier K current + IK1 inward rectifier K current + Itos slow recovering transient outward K current + Itof fast recovering transient outward K current IκB inhibitor of κB IL-6 interleukin-6
IP3R inositol triphosphate receptor KChIP2 K+ channel interacting protein 2 LQT long QT syndrome LV left ventricular LVSP left ventricular systolic pressure MHC myosin heavy chain MiRP minK-related peptides MMP matrix metalloproteinase + Nav1.5 α-subunit of the cardiac Na channel NBT non-binary transgenic NCX Na+/Ca2+ exchanger NE Norepinephrine NEP neutral endopeptidase NFκB nuclear factor κB NHE Na+/H+ exchanger NMVM neonatal mouse ventricular myocytes NRVM neonatal rat ventricular myocytes p-Cx43 phosphorylated Cx43 PKC protein kinase C RAAS renin angiotensin aldosterone system RV right ventricular
xvi RyR ryanodine receptor PLB phospholamban SAN sinoatrial node SBP arterial systolic blood pressure SERCA2a sarcoplasmic reticulum Ca2+-ATPase SR sarcoplasmic reticulum TNFα tumor necrosis factor α tTA tetracycyline-transactivator VT ventricular tachycardia VF ventricular fibrillation
xvii
CHAPTER 1. LITERATURE REVIEW
1 1.1 HEART FAILURE
1.1.1 Definition
Heart failure (HF) is a syndrome where the heart does not pump adequately to meet the metabolic demands of the body. HF is typically a chronic condition that progresses slowly over time. However, rapid-onset (acute) HF may develop suddenly from a structural/functional insult or as a consequence of abrupt worsening of chronic HF. HF can result from systolic or diastolic dysfunction of either or both sides of the heart. Common risk factors for the development of HF include hypertension, myocardial infarction, coronary artery disease, damaged heart valves, kidney conditions, congenital heart defects, diabetes, arrhythmia, viral infection, anaemia, hyperthyroidism, age, obesity, a sedentary lifestyle, a family history of cardiomyopathy, stress, sleep apnea, smoking, and alcohol/drug abuse.
1.1.2 Etiology and prevalence
Cardiovascular disease is the leading cause of death in Canada, responsible for 30% of all deaths1 and affecting 1.3 million Canadians (5% of population)2. In Canada, heart disease and strokes claim a life every 7 minutes and costs the economy more than $22.2 billion every year2. In particular, HF currently affects ~500,000 Canadians with an additional 50,000 new cases diagnosed annually3, with a 50% five-year survival rate4.
Coronary artery disease and hypertension are the main causes of HF. Valve disease, cardiomyopathy, as well as infiltrative, infective, genetic, endocrine, and nutritional conditions can also trigger HF. Valve disease can result from congenital defects, infections, and coronary artery disease. Hypertrophic/dilated/restrictive/idiopathic cardiomyopathy can be induced by toxins (alcohol, cocaine, chemotherapy drugs), tachyarrythmias, infections and
2 inflammation (Chagas disease, myocarditis, pericarditis, endocarditis, sepsis), and genetics
(mutations in genes encoding sarcomeric/cytoskeletal/Ca2+ handling proteins). Infiltrative disorders ensue from amyloidosis, sarcoidosis, hemochromatosis, and connective tissue disease. Endocrine disorders are attributed with diabetes, hypo- and hyper-thyroidism, and
Cushing’s syndrome. Nutritional conditions result from cachexia, obesity, and insufficient thiamine, selenium, and carnitine. Conditions that prompt high cardiac output such as anemia, arteriovenous fistula, thyroid disease, beriberi, and pregnancy can also cause HF.
1.1.3 Symptoms and classifications
Common HF symptoms include shortness of breath, fatigue, fluid retention, dizziness, rapid or irregular heart beat as a result of reduced perfusion of various organs and compensatory mechanisms. Left sided HF primarily affects the pulmonary system, where fluid accumulation in the lungs causes shortness of breath (particularly when in a horizontal position), wheezing, and coughing. Right sided HF can occur alone or as a consequence of left sided HF; it affects systemic fluid imbalance as fluid accumulates in the veins, resulting in peripheral edema, ascites, hepatomegaly, nausea, and weight gain.
There are presently two commonly recognized HF classification systems. The New
York Heart Association classification scheme for HF is based on the ease of executing physical activity. Class I HF patients do not develop symptoms from physical activity. Class II
HF patients have no symptoms at rest, although regular physical activity is mildly limited by shortness of breath, fatigue, and palpitations. Class III HF patients also have no symptoms at rest, however, ordinary exercise is moderately limited by shortness of breath, fatigue, and palpitations. Class IV HF patients exhibit symptoms at rest and with any physical activity.
3 The American College of Cardiology and American Heart Association established a second classification scheme for HF which integrates the progression and development of the disease. The first two stages (Stage A, B) encompass those patients at risk for developing HF, and the last two stages (Stage C, D) include patients that exhibit moderate/severe HF symptoms1. Stage A designated patients lack both symptoms of HF and structural heart disease, but are at a high risk for developing HF as a consequence of coronary artery disease, hypertension, or diabetes. Patients in Stage B have no signs or symptoms of HF, despite structural heart disease as a result of a previous myocardial infarction, left ventricular hypertrophy, or asymptomatic valve disease. Stage C patients have structural heart disease with symptoms of HF such as fatigue, shortness of breath, and exercise intolerance. Stage D patients have severe end-stage HF; these patients are resistant to current pharmacological interventions and cannot perform day-to-day activities, display severe fatigue and are vulnerable to repeated and/or prolonged hospitalizations.
1.1.4 Pathophysiology
HF has been described as a cardiorenal model, as severe renal Na+ and water retention is caused by cardiac dysfunction. A hemodynamic model has also been proposed to account for the changes in blood pressure/flow in the vasculature and myocardium that occur in HF.
An alternative neurohormonal model has been described to reflect the involvement of the neurological and hormonal systems in the progression of HF. A biomolecular model of HF combines the neurohormonal models with the key molecular and cellular changes that mediate left ventricular (LV) remodelling in the progression of HF.
4 1.1.4.1 Neurohormonal activation
Initially, HF is characterized by impaired cardiac output due to acute or chronic myocardial insult. Several compensatory mechanisms such as the sympathetic nervous system, the renin angiotensin aldosterone system (RAAS), and cytokine systems are then activated, which temporarily restore cardiovascular function by increasing chronotropy, inotropy, systemic vascular resistance, and Na+ and water retention. Chronic neurohormonal and cytokine activation eventually become maladaptive, resulting in LV remodelling and cardiac decompensation (HF progression).
In HF, reduced cardiac output triggers activation of the sympathetic nervous system as inhibitory input from baroreceptors decreases and excitatory input increases. Increased circulating levels of norepinephrine (NE) ensue in HF and act on β1- and α1-adrenergic receptors to elicit increased systemic vascular resistance, release of renin, Na+ retention, chronotropy, inotropy, and lusitropy. NE also stimulates production of the vasoconstrictor endothelin-1 (ET-1), aldosterone that promotes additional Na+ and water retention, and arginine vasopressin that further increases water retention and systemic vascular resistance.
The role of ET-1 in HF will be discussed in section 1.2.7. These adaptive responses help maintain short-term cardiac output, however, at the expense of increased myocardial energy requirement, enhanced arrhythmia susceptibility, and ultimately worsened HF.
Renal renin release is activated by reduced renal perfusion, reduced renal Na+ delivery, and the sympathetic nervous system. Initially, renin cleaves four amino acids from the precursor peptide angiotensinogen in the circulation yielding angiotensin I. Two amino acids are then cleaved from angiotensin I by the membrane-bound angiotensin converting enzyme
(ACE) to yield the biologically active angiotensin II (Ang II). Alternatively, Ang II can also
5 be produced from ACE -independent mechanisms, including other proteases such as mast cell chymase. In HF, ACE mRNA, protein, and activity are increased. Ang II exerts its effects through binding to G protein coupled receptors, angiotensin type 1 and type 2 receptors.
Binding to angiotensin type 1 receptors mediates vasoconstriction, cell growth, aldosterone production, and NE release, while binding to angiotensin type 2 receptors stimulates antagonizing effects. Ang II increases systemic vascular resistance, stimulates release of aldosterone from the adrenal cortex, arginine vasopressin from the posterior pituitary, NE release, and cardiac/vascular hypertrophy.
To counteract the deleterious vasoconstrictive effects of chronically elevated levels of
NE, arginine vasopressin, ET-1, Ang II, and aldosterone, several antagonizing vasodilatory neurohormonal systems are activated in HF. These counter neurohormonal systems include the natriuretic peptides, bradykinin, adrenomedullin, and vasodilating prostraglandins. Atrial natriuretic peptides (ANP) and brain natriuretic peptides (BNP) are stimulated by atrial and ventricular stretch, respectively, in addition to Ang II and ET-1. ANP/BNP are synthesized as prepro-ANP/BNP and cleaved by corin/furin to yield inactive N-terminal fragments NT-
ANP/NT-BNP and biologically active ANP/BNP. Both natriuretic peptides are degraded by neutral endopeptidase (NEP) or are cleared by the natriuretic peptide receptor C. The half-life for ANP is 3 min, while the half-life for BNP is 20 min. These peptides bind to natriuretic peptide- A and -B receptors to exert natriuresis, vasodilation, inhibition of renin and aldosterone, and inhibition of cardiac hypertrophy. Evaluating plasma levels of BNP and NT-
BNP has proven beneficial for the diagnosis and prognosis of HF.
6 1.1.4.1 LV remodelling
In HF, LV remodelling is characterized by changes in myocyte biology, myocyte loss, non-myocyte gain, and loss of structural integrity. Alterations in myocyte biology include hypertrophy, excitation-contraction coupling, ion channels, electrical coupling, contractile proteins, cytoskeletal proteins and beta-adrenergic desensitization. Hypertrophy is an adaptive response to hemodynamic overload. Pressure overload results in concentric hypertrophy, where the addition of sarcomeres in parallel results in myocyte widening and increased LV wall thickness. Volume overload causes eccentric hypertrophy, where sarcomeres added in series results in myocyte lengthening and LV dilation. Myocyte hypertrophy leads to enlarged mitochondria and nuclei, and progressive loss and disruption of myofibrils. Abnormal contractile and regulatory proteins consist of reversion to fetal troponin-T and myosin heavy chain (MHC) isoform (loss of α-MHC, gain of β-MHC), and loss of myofilaments.
Cytoskeletal protein changes include down-regulation of titin and up-regulation of desmin, vinculin, and dystrophin. Finally, excessive β-adrenergic signalling is blunted by receptor mediated internalization and degradation. Changes in excitation-contraction coupling, Ca2+ handling, ion channels, and electrical coupling in HF will be discussed in section 1.3.2.
Myocyte loss in HF results from increased apoptosis, necrosis, and autophagy. Gain of non-myocytes such as fibroblasts and mast cells results in myocardial fibrosis and extracellular matrix degradation. Upon mechanical or neurohormonal stimulation (Ang II, aldosterone, ET-1), cardiac fibroblasts produce collagen I/III/IV, laminin, and fibronection to repair extracellular matrix. Marked collagen synthesis in HF exemplified by increased collagens I/III/IV/VI, fibronectin, laminin, and vimentin results in perivascular, interstitial, or replacement/scarring fibrosis. Progressive myocardial fibrosis in addition to reduced collagen
7 cross-linking and linkage with individual myocytes leads to myocardial stiffness, LV dilation and dysfunction, and increased propensity for lethal cardiac arrhythmias. Mast cells modify the collagen matrix by releasing the proteases tryptase and chymase, thus mediating the degradation of the extracellular matrix by activating the matrix metalloproteinases (MMP 1-
3,9). Mast cells can also produce cytokines IL-1/4/5/10, tumor necrosis factor-alpha (TNF-α), leukotrienes, and nitric oxide2. In HF, increased myocardial mast cell density correlates with increased chymase activity, MMP-2 activation, collagen degradation, and LV dilation3.
The balance between pro- and anti-inflammatory cytokines is unstable in HF, favouring pro-inflammatory cytokines such as TNF-α and interleukin-6 (IL-6)4. Cytokines are produced in the myocardium by myocytes and a variety of other cell types to initiate repair in response to injury. Chronic release of inflammatory cytokines contributes to progressive LV remodelling by provoking myocyte hypertrophy, fetal gene re-programming, stimulation of fibroblasts, increased MMP secretion from fibroblasts, increased collagen matrix degradation, myocardial fibrosis, and myocyte loss5. Substantial cross-talk exists between inflammatory cytokines and the RAAS pathway, as Ang II mediates increased TNF-α mediated by nuclear factor κB (NFκB), while inflammatory cytokines activate ACE and chymase to augment
RAAS signalling. The chronic activation of these maladaptive processes in LV remodelling leads to increased energy requirements, hypertrophy, dilation, fibrosis, and myocyte loss, and serves to fuel further LV remodelling and amplification of these maladaptive signalling systems.
8 1.1.5 Treatments
The treatment strategy is based on the severity of HF symptoms; treatments include lifestyle changes, medications to antagonize symptoms, device therapies, and surgery.
Therapy for patients in Stage A and B focuses on lifestyle changes as well as medications or device therapies to treat the underlying condition to prevent the development of HF. Lifestyle changes include achieving and maintaining a healthy weight through diet and regular exercise, low sodium diet, 2L fluid restriction, blood pressure monitoring, medication compliance, smoking cessation, and moderate alcohol consumption. Device therapies include implantation of a pacemaker for cardiac resynchronization (biventricular pacing) or a cardioverter defibrillator to combat lethal arrhythmias. A variety of pharmacological agents have been developed in order to prevent the progression and to reverse HF. These medications include
ACE inhibitors, Ang II receptor blockers, beta blockers, digoxin, diuretics, aldosterone antagonists, vasodilators, anticoagulants, and antiplatelet agents. The treatment approach for patients with Stage C HF includes lifestyle changes, a cocktail of conventional pharmacological agents, and implantation of pacemaker/ defibrillator for biventricular pacing and to ensure sustained normal cardiac rhythm. For patients with end-stage HF where standard medications have failed (Stage D), the treatment strategies include chronic infusion of vasodilators and inotropes, permanent mechanical circulatory support via implantation of a left ventricular assist device, repairing the underlying cause of HF such as a coronary bypass or a valve replacement, cardiac transplantation, and experimental surgical/medicinal approaches. Advances in blocking the hyper-activated ET-1 system in HF is examined in section 1.2.7, while possible targets for gene therapy treatment in HF will be discussed in section 1.3.2.1.
9 1.2 ENDOTHELIN
1.2.1 Distribution, regulation and synthesis of ET-1
ETs are 21 amino acid vasoconstrictive peptides involved in the regulation of vascular tone and the pathophysiology of cardiovascular disease. Three ET peptides have been identified on three separate genes, ET-1, ET-2, and ET-3. ET-1 is the main isoform with cardiovascular actions; it is produced not only by endothelial cells, but also by vascular smooth muscle cells, cardiomyocytes, fibroblasts, macrophages, and leukocytes6-8.
ET-2 is found in the ovary and intestinal epithelial cells, while ET-3 is found in endothelial cells and intestinal epithelial cells. ET-1 also plays a role in neural, pulmonary, reproductive, and renal physiology. As such, hyper-ET-1 signaling has been implicated in the pathophysiology of HF, atherosclerosis, pulmonary hypertension, asthma, cancer, diabetes, glaucoma, pain, sexual dysfunction, fibrosis, renal failure, inflammation, and cerebral vasospasm. Polymorphisms in the ET-1 promoter region are associated with cardiac hypertrophy and asthma9, 10.
ET-1 expression is primarily regulated at the transcriptional levels by various stimuli that act on elements in the regulatory region of the ET-1 gene. ET-1 production is promoted by Ang II, vasopressin, epinephrine, thrombin, low-shear stress, hypoxia, inflammatory cytokines, and insulin. The production of ET-1 is inhibited by nitric oxide, bradykinin, high- shear stress, heparin, prostaglandins, natriuretic peptides, estrogen, and progesterone.
Differential and tissue specific ET-1 expression is also regulated by mRNA instability, epigenetics, and microRNAs. The half-life for ET-1 mRNA is 15 min11, this may result from suicide motifs present at the 3’ region that affect mRNA stability by enhancing proteasomal
10 degradation12. The first intron of the ET-1 gene is subject to methylation and gene silencing in mouse dermal fibroblasts13. Aldosterone regulates ET-1 transcription via histone modification in rat inner medullary collecting duct cells14. Recently, microRNAs (miR-199, and miR-155) have been shown to negatively regulate ET-1 expression in rat liver sinusoidal epithelial cells and human microvascular epithelial cells15.
ET-1 is synthesized as preproET-1 and undergoes a series of proteolytic cleavage reactions to yield the active ET-11-21 peptide. It is initially synthesized as the precursor preproET-1(1-212), released into the cytoplasm as proET-1, and then cleaved by a furin-like endopeptidase to yield bigET-1(1-38). The final step involves the cleavage of bigET-1 at Trp21 to the mature ET-1 peptide by an endothelin-converting enzyme (ECE). Additionally, bigET-1 can also be cleaved by chymase to yield a 31 amino acid peptide, which can then be subsequently cleaved to the active ET-1 by a neutral endopeptidase (NEP) and/or ECE (Fig.
1.1)16, 17.
1.2.2 Clearance of ET-1
The half-life of ET-1 in plasma is less than 2 min due to efficient extraction in the kidney and lungs. ET-1 is subject to either receptor- or enzyme-mediated degradation. ET-1 is principally cleared by ETB receptor mediated internalization and degradation, and secondarily by enzymatic metabolism by NEP. Although the ET-1 is degraded rapidly, its biological effects last much longer due to the near irreversible binding nature of ET-1 with its receptors.
11 Ang II, vasopressin, NO, ANP, CNP cytokines, thrombin, prostacyclin, heparin shearing forces, ROS - + prepro ET-1
TY-51469, NK3201, BCEAB, TEI-F00806 Furin α1-PDX, CMK, furin prodomain
Chymase ET-1 1-31 Big ET-11-38
CGS 26303, CGS 35066, ECE PD 069185, SM-19712
NEP, ETBR cleared / ET-11-21 CGS 26303, CGS 34043, metabolized Phosphoramidon, SLV-306
BQ123, Darusentan, YM-598, ABT-627 ETAR ETBR BQ788, A-192621
Bosentan, Tezosentan, Enrasentan, LU-420627
Figure 1.1. Production and degradation of ET-1. Prepro-ET-1 is regulated at the transcription level and is reduced to BigET-11-38 by a furin-like enzyme. The majority of BigET-11-38 is then reduced to mature ET-11-21 by ECE, or to ET-11-31 by a chymase and subsequently cleaved by a metalloprotease to yield active ET-11-21. ET-1 can then exert its biological effects through binding to G protein coupled receptors (ETAR, ETBR). The production of ET-1 can be inhibited at several steps of the signaling cascade. The use of ET receptor antagonism and ECE inhibition have been evaluated in conditions with chronically high levels of ET-1.
12 1.2.3 ECE
ECE is a membrane-bound zinc metalloprotease. Zinc metalloproteases are responsible for processing and metabolizing peptide hormones, immunoregulatory proteins, and neuropeptides. Although there are 3 ECE isoforms (ECE-1-3), ECE-1 is the main functional
ECE. ECE-1 has a widespread distribution as it is highly expressed in the cardiovascular, endocrine, and reproduction systems. There are four ECE-1 splice variants (ECE1a-d) and differ in sub-cellular localization. ECE-1 is not only responsible final processing of bigET-1 to mature ET-1, but can also hydrolyze bradykinin, substance P, Ang II, and insulin. NEP and
ACE are also zinc metalloprotease. NEP is 37% homologous with ECE and metabolizes natriuretic peptides, bradykinin, and ET-1. ACE is responsible for the catalysis of angiotensin
I to Ang II.
1.2.4 ET Receptors and signal transduction
ET-1 acts locally in an autocrine and paracrine fashion through binding to the
G-protein coupled receptors ETA and ETB. ETA and ETB receptors differ in their affinity for
ETs, their distribution, and their association with various G-protein α subunits (Gαs, Gαi/o,
Gαq/11, Gα12/13) and thus signal transduction pathways (Fig. 1.2). ET receptors have a very high affinity for ET-1, resulting in a nearly irreversible coupling. Low circulating levels of ET-1 combined with high tissue ET-1 levels are attributed to strong ET-1/ET receptor binding kinetics.
ETA receptors bind to ETs with different affinities, ET-1>ET-2>ET-3; they are distributed widely throughout the cardiovascular system, pulmonary system, central nervous system, sensory nervous system, immune system, gastrointestinal system, kidney, prostate,
13 14 ↑ IP Ca PLC 3 CaM 2+ CN DAG PKC ET-1 Raf ET G A/B α q MEK Pyk2 NFAT ERK SHC Ras SOS GRB2 NF PI3K κ B c-Src ET-1
ETB G RAP Akt α i cAMP IKKs AC PKA ↑ Ca ET-1
2+ ET
G A α s Figure 1.2. ET-1 mediated signaling via Gαq/s/i. Gαq activation triggers PLC to produce 2+ intracellular messengers IP3 and DAG. IP3 elicits the release of SR Ca stores via the IP3 receptor. The rise in intracellular Ca2+ activates CaM mediated activation of CN, enabling the nuclear translocation of NFAT to induce changes in gene transcription. DAG stimulates PKC to activate Raf, which in turn leads to the initiation of ERKs via MEKs, which regulates gene expression by activating transcription factors. Gαq mediated activation of Pyk2 also leads to initiation of the ERK/MEK cascade by activating the SHC/GRB2/SOS complex to stimulate Ras, which leads to the subsequent activation of Raf-MEK-ERK. Ras mediates activation of Akt via PI3K, enabling the phosphorylation of IKKs and subsequent nuclear translocation of NFκB to trigger changes in gene transcription. PKC also mediates activation of NFκBvia inhibition of IKKs. Gαs activates AC to produce cAMP, enabling activation of PKA and Rap. Rap activates the Raf-MEK-ERK pathway. PKA acts on a variety of proteins to stimulate the release of Ca2+ from the SR and the influx of Ca2+ across the plasma membrane, among others. Gαi signalling inhibits AC, thus blunting cAMP levels and PKA-mediated signalling. Gαi also activates c-Src, which triggers the MEK pathway via activation of the SHC/GRB2/SOS complex. PLC= phospholipase C, IP3=inositol trisphosphate, DAG = diacylglycerol, CaM = calmodulin, CN = calcineurin, NFAT = nuclear factor of activated T- cells, PKC = protein kinase C, MEK = mitogen-activated protein kinase kinases, ERK = extracellular signal-regulated kinases, PYK2 =proline-rich tyrosine kinase-2, GRB2 = growth factor receptor-bound protein-2, SOS = son of sevenless, Ras = rat sarcoma, PI3K =phosphoinositide 3-kinase, IKK = inhibitor of κB kinase, NFκB = nuclear factor-κB, AC = adenylyl cyclase, cAMP = cyclic adenosine 3,5-monophosphate, PKA = protein kinase A, RAP = ras-related protein, SR = sarcoplasmic reticulum
15 ovary, and pancreas. ETA receptors are up-regulated by hypoxia, cyclosporine, epidermal growth factor, basic fibroblast growth factor, cAMP, and estrogen, and are down-regulated by
ET-1, Ang II, platelet-derived growth factor, and transforming growth factor. ETA receptors are coupled to Gαs, Gαq/11, and Gα12, and generally induce vasoconstriction, mitogenesis, angiogenesis, matrix formation, inflammation, apoptosis, and electrical remodeling18-20.
Selective ETA receptor antagonists have been discovered: ZD4054, atrasentan, darusentan, macitentan, ambrisentan, and sitaxsentan.
ETB receptors bind to all ETs with equal affinity and are distributed less extensively; they are found in the cardiovascular system, the pulmonary system, neurons, bone, pancreas, and kidney. ETB receptors are up-regulated by C-type natriuretic peptide and Ang II, and down-regulated by cAMP and catecholamines. ETB receptors are coupled to Gαi/o, Gαq/11, Gα13 and generally mediate vasodilation, natriuresis, ET-1 clearance, vasoconstriction, and anti- apoptosis21-23. Agonists (sarafotoxin 6c and IRL1620) and selective antagonists (BQ788,
A192621, RES7011, and IRL2500) have been discovered for the ETB receptor. Several non- selective ET-1 receptor antagonists have also been developed: bosentan, tezosentan, enrasentan, and LU-420627.
1.2.5 Transgenic mouse models: genetic manipulation of ET-1 system
The ET-1 system is necessary for normal embryonic development, more specifically in the development of tissues derived from embryonic neural crest. ET-1/ETA receptor activity is essential to normal cranial and cardiovascular development resulting from impaired neural crest cell communication. ET-1 knockout mice die at birth due to craniofacial abnormalities resulting from respiration failure24. They also display cardiovascular, thyroid, and thymus
16 malformations25, 26. Mice with cardiac specific deletion of ET-1 have a reduced hypertrophic response and with age develop dilated cardiomyopathy, increased fibrosis and apoptosis, and
27, 28 impaired NFκB activation . ETA receptor-deficient mice develop craniofacial and cardiovascular malformations similar to the ET-/- phenotype29.
Over-expression of human ET-1 led to high transgene levels in the brain, lung, and kidney; these mice developed renal cysts, fibrosis, glomerulosclerosis and pulmonary fibrosis and inflammation30, 31, while over-expression of human ET-2 led to glomerulosclerosis32.
Endothelium specific over-expression of ET-1 led to elevated tissue and plasma levels of ET-1, vascular remodelling, and endothelial dysfunction33. Cardiac specific over-expression of human ET-1 led to an inflammatory cardiomyopathy characterized by increased expression of inflammatory cytokines, NFκB nuclear translocation, LV dilation and contractile dysfunction and death (Fig. 1.3)34.
ET-3/ETB receptor activity is essential to normal epidermal melanocyte and enteric neuron development. Disruptions in either ET-3 or ETB receptor genes result in aganglionic megacolon and pigmentary disorders35, while ET-3 over-expression results in hyperpigmentation. Endothelial specific deletion of ETB receptors results in endothelial dysfunction, impaired nitric oxide release, elevated plasma ET-1 levels, and resistance to high-salt-diet-induced hypertension36.
ECE-1 knockout mice exhibit similar development defects as those seen in ET-1 and
ETAR knockout mice, as well as those seen in ET-3 or ETB receptor knockout mice. The majority of ECE-1 knockout mice die in utero due to severe cardiac abnormalities. The surviving mice exhibit craniofacial and cardiac abnormalities similar to those observed in both
37 -/- ET-1 and ETA receptor knockout mice . ECE-1 mice also lack epidermal melanocytes
17 αMHC promoter tTA
+ DOX
ppET-1 pBi β-gal
Yang et al, Circulation, 2004
Figure 1.3. DOX-off system of cardiac over-expression of ET-1. Mice harboring the tetracycyline transactivatior (tTA) under the control of the α-myosin heavy chain promoter were crossed with a line harboring a human ET-1 transgene under control of a tTA-responsive promoter, and thus using a DOX-off system of conditional cardiac-specific over-expression of human ET-1. 18 and enteric neurons, a phenotype that parallels that seen in ET-3 or ETB receptor knockout mice. Mice lacking ECE-1 can produce substantial levels of ET-1. ECE-2 knockout mice develop normally, however double ECE-1-/-/ECE-2-/- mice exhibit a more severe ECE-1-/- embryonic phenotype and persistent mature ET-1 levels38. Thus, it is apparent that other non-
ECE proteases can also generate mature ET-1 from bigET-1. Chymase, NEP, and MMP-2 are likely candidates, as they can also metabolize bigET-1. Tissue specific distribution of ECE, and consequently ET-1 production are important in normal development, as developmental defects persist in these mice despite retaining the ability to synthesize ET-1.
1.2.6. Role of ET-1 in inflammation, hypertrophy, and fibrosis
In the heart, ET-1 contributes to inflammation, hypertrophy, fibrosis, and electrical remodelling (Fig. 1.4). ET-1 acts as a pro-inflammatory cytokine by priming neutrophils and stimulating the release elastase from neutrophils and histamine from mast cells39-41. ET-1 stimulates NFκB dependent IL-6 release from vascular smooth muscle cells and interleukins and adhesion molecules from leukocytes42, 43. ET-1 also induces monocytes to produce inflammatory cytokines and chemokines; CD40 production is mediated by NFκB, while macrophage inflammatory protein-1β is dependent on hypoxia-inducible factor-1α, AP-1 and
NFκB44-46.
NFκB is a transcription factor that responds to a number of extracellular stimuli (pro- inflammatory cytokines, pro-apoptotic/necrotic, viral/bacterial antigens). NFκB functions as a homo- or hetero-dimer of structurally similar subunits: p50, p52, p65/RelA, RelB, and c-rel.
The N-terminus of all 5 NFκB subunits contains a conserved DNA binding domain, a dimerization domain, and a nuclear localization signal. RelA, RelB, and c-rel have
19 Endothelial Cell Vasodilation ↑ ET-1 Clearance ETB
Vasoconstriction Vascular Smooth Proliferation Muscle Cell Migration ETA ETB
↑ Adhesion Macrophage ↑ Migration ↑ Cytokines
ETA ETB
ET-1
ETA ETB ↑ Collagen Fibroblast ↑ Fibrosis
ETA ETB Cardiomyocyte Hypertrophy Electrical Remodelling
Figure 1.4. Multifaceted nature of ET-1 signaling. Depending on the target cell type, ET-1 stimulates vasoconstriction, vasodilation, inflammation, fibrosis, hypertrophy, and electrical remodelling.
20 47, 48 muscle cells and epithelial cells through ETA receptor mediated mechanisms . In fibroblasts, ET-1 induces chemotaxis, proliferation, collagen production, and inhibition of
49-51 MMP expression through both ETA and ETB receptor dependant mechanisms , as well as transactivation domains in their C-terminus. The other NFκB proteins, p50 and p52, are synthesized as precursors p105 and p100, respectively. These precursors contain ankyrin repeats at their C-terminus that enable them to act as inhibitors of κB (IκB) proteins. Cleavage and proteasomal degradation of the p105 and p100 yield mature p50 and p52. Unlike the other NFκB proteins, p50 and p52 have transrepression domains in their C-terminus. However, they can also mediate transactivation by dimerization with RelA, RelB or c-rel. Inactive
NFκB is sequestered in the cytoplasm by its interaction with an IκB protein. The IκB family consists of IκBα, IκBβ, IκBγ, IκBε, Bcl-3, p105 and p100. All IκB proteins contain ankyrin repeats that enable them to interact with NFκB dimers. This interaction inhibits the nuclear translocation of NFκB by masking their nuclear localization signal. A variety of external stimuli cause phosphorylation of two residues of the IκB by IκB kinase (IKK).
Phosphorylation enables dissociation and subsequent proteasomal degradation of IκB, thus relieving the inhibition of NFκB. This enables NFκB translocation to the nucleus where it binds to specific DNA binding sites in order to transcriptionally repress or activate genes involved in cell proliferation, survival, differentiation, immunity and inflammation (Fig 1.5).
Heightened NFκB activation is associated with cancer, autoimmune-, neurodegenerative-, and cardiovascular-diseases such as atherosclerosis, hypertrophy, and HF52-54. ET-1 can activate
NFκB by PKC, PI3K/Akt, ERK1/2, and p38 MAPK dependent mechanisms (Fig. 1.2). Lack of NFκB p50 has been shown to improve survival and LV remodeling in a model of TNFα- induced cardiomyopathy and after myocardial infarction55, 56.
21 ET-1 A ET
P P proteasome IκBα degradation
P P IκBα IκBα NFκBa IKK p65 p50 p65 p50 p65 p50
NFκBi
transcriptional repression / activation p65 p50
Figure 1.5. Illustration of NFκB activation. In the cytoplasm, NFκB is kept in the inactive state whilst bound to the inhibitory protein IκBα. When activated by various extracellular stimuli, such as ET-1, IKK phosphorylates IκBα, leading to the dissociation and subsequent proteasomal degradation of IκBα, thereby leaving NFκB free to translocate to the nucleus to transcriptionally repress or activate target genes. NFκBi= inactive, NFκBa= active 22 As a pro-fibrotic factor, ET-1 regulates the expression and degradation of several components of the extracellular matrix. ET-1 induces remodelling of the extracellular matrix by stimulating the synthesis and release of collagens and fibronectin from vascular smooth stimulates the differentiation of fibroblasts to contractile myofibroblasts through the ETA receptor mediated PI3K/Akt pathway57. ET-1 also induces the differentiation of epithelial cells to fibrotic mesenchymal cells58.
ET-1 acts as a pro-hypertrophic factor by inducing hypertrophic gene reprogramming via activation of the transcription factors NFκB, NFAT, and zinc finger protein 260. ET-1 induces cardiomyocyte hypertrophy by triggering a rise in intracellular Ca2+ through activation of NHE and reverse mode NCX, elevated intracellular Ca2+ enables activation of calcineurin and subsequent dephosphorylation and nuclear translocation of NFAT59. ET-1 also triggers hypertrophy via the calcineurin/NFAT pathway by inducing nuclear Ca2+ release by
60 perinuclear IP3R . ET-1 has been shown to stimulate cardiomyocyte hypertrophy through activation of ERK, activation of NFκB by p38 MAPK, and activation of the zinc finger protein 260 by PKC.61-63 The role of ET-1 in electrical remodelling will be discussed in section 1.3.3.
1.2.7 Pathophysiology of ET-1 in HF
ET-1, bigET-1, ECE-1, ETA receptors are elevated in human and animal models of
64-67 HF . In addition, ETA and ETB receptor binding is increased, and ETB receptors are downregulated in HF68, 69. Levels of plasma ET-1 and bigET-1 also correlate with disease severity and survival in HF due to increased ET-1 production in the circulation and myocardium66, 70. Blocking ET-1 signaling for the treatment of HF is of great interest, as
23 ET-1 signaling is hyper-activated in HF and contributes to increased systemic vascular resistance, cardiac hypertrophy and fibrosis, inflammation and arrhythmia predisposition.
Inhibiting ET-1 signaling via receptor antagonism has not proven beneficial in the treatment of clinical HF. Initially, ET-1 receptor blockade looked like a promising avenue for the treatment of HF as many experimental models of HF showed improved survival, hemodynamics and ventricular remodelling with both non-selective ET-1 receptor blockade
71-73 and ETA receptor blockade . Also, preliminary small-scale clinical trials with acute doses of bosentan, darusentan, BQ-123, and tezosentan showed short-term hemodynamic benefit in patients with HF74-77. However, the subsequent RITZ (Randomized Intravenous TeZosentan) trial showed no therapeutic benefit on mortality or HF progression, and was associated with adverse side effects such as elevated levels of liver transaminases. The VERITAS-1 and -2
(value of endothelin receptor inhibition with tezosentan in acute HF study) trials were discontinued after a year due to lack of improvement78. Four large-scale clinical trials did not show improvement in HF status, mortality, or hospitalization. The REACH-1 (randomized endothelin antagonism in chronic HF) study was discontinued early due to worsened HF and development of adverse side effects such as high levels of liver transaminases, anaemia, and fluid retention with treatment of high-dose bosentan79. Next, ENABLE-1 and -2 (endothelin antagonist bosentan for lowering cardiac events in HF) studies showed treatment with low- dose bosentan lead to early worsening of HF, abnormal liver function, fluid retention, and no survival benefit80. Treatment with enrasentan in the ENCOR (enrasentan cooperisedative randomized evaluation) study resulted in higher rates of HF and mortality. Lastly, the EARTH
(endothelin A receptor antagonist trial in HF) trial showed no benefit to survival or HF
24 progression with darusentan treatment81. The disappointing outcome of ET-1 receptor antagonism for the treatment of HF may reflect a problem with dosage, receptor selectivity of the drug, timing of treatment, or adverse effects due to combination therapy with existing treatments. However, ET-1 receptor blockade has been effective in the treatment of clinical pulmonary arterial hypertension.
Blocking ET-1 synthesis with the use of ECE inhibitors has also been evaluated in order to blunt ET-1 over-production in various disease states. Many ECE inhibitors are also dual ECE/NEP or triple ECE/NEP/ACE inhibitors. Using non selective ECE inhibitors would simultaneously block the synthesis of potent vasoconstrictors ET-1 and Ang II, while promoting the beneficial vasodilator actions of natriuretic peptides and bradykinin by inhibiting their degradation. In experimental models of HF, dual ECE/NEP inhibitors have been beneficial in increasing cardiac output, diuresis, and reducing cardiac/vascular remodelling and secretion of neurohormones82-86. The use of the dual ECE/NEP inhibitor SLV
306 is currently being tested in a phase II clinical trial for the treatment of HF.
1.3 ELECTRICAL REMODELLING
1.3.1 Excitation in the healthy heart
Cardiac excitation and conduction depend on the flux of ions across the cell membrane, efficient Ca2+ cycling, myocyte architecture, and electrical coupling between myocytes. Here, we describe the ion channels, Ca2+ handling proteins, and gap junctions that facilitate cardiac impulse generation and propagation.
25 1.3.1.1 Ionic basis of cardiac action potential
Electrical impulses in the heart are initiated by the pacemaker cells of the sinoatrial node (SAN), propagate through the right and left atria, across the atrioventricular node (AVN) to the His-bundle, and finally, travel through the Purkinje fibers (Fig. 1.6A). Coordinated propagation of the electric impulse is coupled to the rhythmic contraction of the heart. The cardiac action potential (AP) is shaped by the intricate balance between inward depolarizing currents and outward repolarizing currents across the cell membrane (Fig. 1.6B). The shape of the AP varies with cell type and is composed of 4 phases. At rest, the transmembrane potential
+ is -80mV. During phase 0, the cell is rapidly depolarized by inward Na current (INa). Here, the amount of INa is proportional to the maximum rate of voltage change (dV/dt).
Depolarization of the membrane then triggers activation of Ca2+ and K+ currents. The brief
+ repolarization in phase 1 is caused by the activation of the transient outward K current (Ito).
In atrial myocytes, the ultrarapid delayed rectifier K+ current also plays a role in phase 1. Next,
2+ + the plateau phase is maintained by inward L-type Ca current (ICa-L) and outward K currents.
Phase 3 repolarization is influenced by the progressive activation of the rapid delayed rectifier
+ (IKr) and the slow delayed rectifier K current (IKs). The final repolarizing phase is generated
+ by the inward rectifier K current (IK1).
1.3.1.2 Electrophysiological mapping
Various electrophysiological techniques have been developed to characterize cardiac electrical activity at the organism, tissue, cell, and channel levels. The electrocardiogram
(ECG) is used to map the electrical activity through all regions of the heart at the organism level (Fig. 1.6C). Intracardiac mapping is used to locate regions of electrical disturbance and
26 A SA node His Bundle
Bundle branches
AV node
Purkinje fibers
I I B to Ca-L 1 2 IKr, IKs
3
IK1 INa 0 4
R C
T P
PR Q interval QRSS interval QT interval
Figure 1.6. Schematic of the cardiac conduction system, the ionic currents contributing to the cardiac action potential, and the surface electrocardiogram. (A) Spread of excitation throughout the heart. (B) Ionic currents underlying the four phases of a typical ventricular action potential. (C) Various parameters of the surface electrocardiogram; PR = time from earliest-atrial to -ventricular activation, QRS = ventricular depolarization time, QT = ventricular depolarization and repolarization time.
27 identify conduction anomalies between the atria and His-bundle, or between the His-bundle and the ventricles. Optical mapping with voltage-sensitive fluorescent dies and epicardial mapping with microelectrodes can be used to study the propagation of electrical activity throughout the tissue or cardiomyocyte mono-layer. Patch-clamp can be used to study the AP waveform, whole-cell currents, and individual ion channel recordings.
1.3.1.3 Excitation-contraction coupling and Ca2+ cycling
Cardiac contraction is activated by a rise in intracellular free Ca2+. To work effectively, Ca2+ homeostasis in cardiac myocytes is maintained on a beat to beat basis (Fig.
1.7). Excitation-contraction coupling is the process that links depolarization of the cell membrane to contraction of the myofilaments. During an AP, depolarization of the cell membrane causes an influx of Ca2+ into the cytoplasm via voltage-gated Ca2+ channels in the plasma membrane. This local rise of Ca2+ triggers the release of Ca2+ stored in the sarcoplasmic reticulum (SR) into the cytoplasm via the ryanodine receptor (RyR2) to activate the contractile machinery. The amplitude of contraction is dependent on the level of Ca2+ that is in the vicinity of the myofilaments. Relaxation occurs due to repolarization of the plasma membrane and a rapid reduction in intracellular Ca2+ levels. This decline in intracellular Ca2+ is mediated principally by the sequestration of Ca2+ into the SR via the SR Ca2+-ATPase
(SERCA2a) and the efflux of Ca2+ from the cell by the Na+/Ca2+ exchanger (NCX1).
1.3.1.4 Ca2+ handling proteins and Ca2+ current
The SR regulates efficient contraction and relaxation of the contractile machinery on a beat to beat basis by controlling the release and sequestration of Ca2+. The two types of Ca2+
28 Na+ Ca2+ Na+ Na+ ATP NHX NCX ase K+ H+ K+ Ca2+
Ca2+ Ca2+
RyR IP3R
Ca2+ Ca2+ Myofilaments SERCA PLB SR
GJ
Figure 1.7. Ca2+ cycling in healthy cardiac myocytes. Ca2+ handling is tightly controlled on a beat to beat basis; it provides the link provides between excitation of the cell membrane and contraction of the myofilaments. Depolarization of the cell membrane triggers an influx of Ca2+ into cell via the L-Type Ca2+ channel. This local rise in Ca2+ causes the release of SR Ca2+ stores into the cytoplasm via the RyR to activate the contractile machinery. Relaxation occurs when Ca2+ exits the cytoplasm principally by the re-uptake of Ca2+ into the SR by SERCA, or is extruded via NCX. GJ = gap junction 29 release channels on the SR are the RyR2 and the inositol triphosphate receptor (IP3R). IP3R2
(gene ITPR2) are expressed at low abundance in the heart and mediate IP3 induced release of
Ca2+; their role in excitation-contraction coupling is not known. RyR2 (gene RYR2) is the dominant Ca2+ release channel in the heart and plays key role in excitation-contraction coupling87, 88. These channels are tetrameric proteins, with Ca2+ activation and inactivation sites, as well as several regulatory sites. RyR2 are found in close proximity to the L-type Ca2+ channels in the cell membrane for efficient excitation-contraction coupling. They are found in a macromolecular complex with kinases, kinase anchoring proteins, phosphatases, and FK-
506 binding proteins, which regulate channel activity89. FK-506 binding proteins function to stabilize RyR, and inhibit diastolic Ca2+ release from the SR90. Mutations in RyR2 have been found in patients with catecholaminergic polymorphic ventricular tachycardia and more recently, long QT syndrome (LQT)91.
During diastole, Ca2+ is primarily sequestered back into the SR through SERCA2a, or is extruded from the cell through the NCX1. NCX1 (gene SLC8A1) normally operates in forward mode, exchanging one intracellular Ca2+ ion for three extracellular Na+ ions, resulting in a net inward current. However, NCX1 activity is reversible and its direction depends on the electrochemical ion gradient. Reverse mode supports Ca2+ entry and Na+ extrusion when high
+ intracellular Na levels are generated from rapid inward INa during AP depolarization, or by the Na+/H+ exchanger (NHE1). NCX1 is localized to T-tubules in a macromolecular complex; it is regulated by Ca2+, Na+, pH, phosphorylation, phosphatidylinositol bisphosphate and several interacting proteins such as phospholemman, CN, and 14-3-3 proteins92. SERCA2a
(gene ATP2A2) is responsible for reducing intracellular Ca2+ during relaxation by restoring the
SR stores for subsequent Ca2+ release during the next beat. SERCA activity is regulated by
30 phospholamban (PLB; gene PLN). PLB inhibits SERCA2a activity in its unphosphorylated state. Phosphorylation induces a conformational change in PLB and relieves its inhibition of
SERCA, and thereby increases the Ca2+ pump rate and the reuptake of Ca2+ into the SR93. The inhibition of SERCA is restored upon dephosphorylation of PLB by SR associated phosphatases94. PLB mutations have been found in patients with familial dilated cardiomyopathy95-97.
In the heart, there are two types of voltage-gated Ca2+ channels, T-type and L-type
Ca2+ channels. T-type Ca2+ channels exhibit a small conductance and activate at low voltages.
ICa-T is carried by the α subunits Cav3.1 (gene CACNA1G) and Cav3.2 (gene CACNA1H).
Their role in excitation-contraction coupling is not clear, as they are expressed in the working myocardium during development, but are restricted to the cardiac conduction system in adulthood and are re-expressed during cardiac pathological conditions98, 99.
2+ 2+ The L-type Ca channel is the main Ca channel in working cardiac myocytes, ICa-L provides the main influx of Ca2+ which triggers excitation-contraction coupling. L-type Ca2+ channels exhibit a large conductance and activate at high voltages. Cav1.2 (gene CACNA1C) is the dominant α pore forming subunit in the heart and is composed of 4 homologous domains of 6 transmembrane α helices that contain the voltage/Ca2+ sensor, gating mechanism, and regulatory sites. Cav1.2 co-assembles with a β subunit and an α2δ subunit. Cavβ subunits
(Cavβ1-4, gene CACNB1-4) and α2δ subunits (α2δ1-4, gene CACNA2D1-4) regulate Cav1.2 expression and function. Channel inactivation is voltage and Ca2+ dependent, as calmodulin
2+ 2+ enhances inactivation of ICa-L by sensing the local accumulation of Ca . L-type Ca channels are modulated by kinases, phosphatases, sorcin, and cytoskeletal ahnak protein and are found in T-Tubules adjacent to RyR2 in the SR. Recently, the K+ channel interacting protein 2
31 (KChIP2) has been shown to interact with the N-termini of Cav1.2 and positively regulate ICa-
100 2+ L . Several L-type Ca channel channelopathies have recently been discovered. Loss of function mutations in CACNA1C and CACNB2b are linked to sudden cardiac death and
Brugada syndrome101, 102. Gain of function mutations in CACNA1C are associated with
Timothy syndrome (a multisystem disorder exhibiting congenital heart disease), LQT, and lethal arrhythmias103.
1.3.1.5 Sodium current
INa generates the depolarizing current for phase 0 of the cardiac AP and contributes to its propagation throughout the myocardium. Nine functional α-subunit of voltage-gated Nav channels (Nav1.1-1.9) have been discovered, which differ in channel kinetics and response to neurotoxins. The majority of neuronal Nav channels (Nav1.1-1.3, 1.6-1.7) and skeletal Nav channels (Nav1.4) are sensitive to the neurotoxin tetrodotoxin, while the α-subunit of the
+ cardiac voltage gated Na channel Nav1.5 (gene SCN5A) and neuronal Nav1.8 are mostly resistant. Although Nav1.5 is the main Nav channel in the heart, several other skeletal (Nav1.4) and neuronal Nav isoforms (Nav1.1-1.3, 1.6-1.8) have also been found in the heart. More specifically, Nav1.1 has been found in the SAN, His bundle, Purkinje fibers PF, and ventricles;
Nav1.2 in the His bundle, Purkinje fibers, and ventricles; Nav1.3 in SAN, AVN, and ventricles; Nav1.4 mRNA in SAN, AVN, atrium, and ventricles; Nav1.6 in SAN and
104, 105 ventricles; Nav1.7 mRNA in AVN, and and finally Nav1.8 in atrium . Various studies have shown that tetrodotoxin-sensitive Nav channels account for 5-10% of INa in ventricular
106 107 myocytes , and Nav1.1 and Nav1.3 have been linked with SAN automaticity . Also, a
32 Nav1.8 variant has been linked with prolonged cardiac conduction (P wave/ PR/QRS intervals) and increased susceptibility to heart block and ventricular arrhythmias108.
Nav1.5 is a 220 kDa protein comprised of 4 homologous domains each containing 6 transmembrane segments, 3 intracellular linking domains, and cytoplasmic N- and C-termini.
β-subunits (β1-β4; gene SCN1B-SCN4B) are 30-35 kDa proteins with 1 transmembrane, spanning domains that interact with Nav1.5 to regulate channel function, density, and location.
Several proteins have been shown to interact with and regulate the expression and function of
Nav1.5, including ankyrin-G, α1-syntrophin, multicopy suppressor of gsp1, Nedd-like enzymes, calmodulin kinase II, protein tyrosine phosphatase H1, 14-3-3η, caveolin-3, fibroblast growth factor homologous factor 1B, calmodulin, glycerol-3-phosphate dehydrogenase like protein, telethonin, and plakophilin-2. Recently, NFκB p50 has been linked with transcriptional repression of SCN5A109.
Nav1.5 is essential to ventricular development, as well as initiation and propagation of the cardiac electrical impulse. Mice lacking Nav1.5 develop defects in ventricular morphogenesis and die in utero by E11.5110. Heterozygous SCN5A mice exhibit delayed atrial,
AVN, and ventricular conduction, reduced Na+ channel conductance, and increased susceptibility to ventricular arrhythmias110. Older SCN5A +/- mice develop extensive ventricular conduction delays, fibrosis, and disturbed expression of connexin 43 (Cx43)111.
Mutations in SCN5A have been discovered in patients with various cardiac disorders.
112 Gain of function mutations generally increase late INa and are linked with congenital LQT3 .
Loss of function mutations decrease INa and are linked with Brugada syndrome, cardiac conduction disease, Lenegre disease, congenital AV block, sudden infant death syndrome, and
33 sick sinus syndrome113-118. SCN5A variants have also been linked with atrial fibrillation and dilated cardiomyopathy119, 120.
Several mutations in proteins that regulate the function of Nav1.5 have also been discovered in patients with arrhythmias. Mutations in caveolin-3 (gene CAV3) have been linked with congenital LQT9 and sudden infant death syndrome121, 122, while mutations in α1- syntrophin (gene SNTA1) are associated with congenital LQT12123, 124. Mutations in all four of the Nav1.5 accessory β-subunits have been identified; SCN1B with Brugada syndrome type 5, cardiac conduction disease, and atrial fibrillation125, 126; SCN2B with atrial fibrillation126;
SCN3B with Brugada syndrome type 7127; and SCN4B with congenital LQT10128.
While the above studies have linked abnormalities in Na+ channels to rhythm disorders,
Na+ channels blockers have also been used to treat various arrhythmias. Na+ channel blockers are classified as class I antiarrhythmic agents (class Ia, Ib, Ic), with each sub-class differing in degree of blockade, and effects on phase 0 depolarization and APD. As changes in phase 0 depolarization do not always affect APD, shortened APD may reflect inhibition of Na+ currents operational in later stages of repolarization. Class Ia agents are moderate Na+ channel blockers used to treat atrial fibrillation/flutter, supraventricular tachycardia (SVT), and ventricular tachycardia (VT). These agents moderately reduce phase 0 depolarization and prolong APD. Class Ib agents are weak Na+ channel blockers used to treat VT; they marginally affect phase 0 depolarization and shorten APD. While class Ic agents are robust
Na+ channel blockers used to treat life-threatening SVT and VT, they markedly depress phase
0 depolarization and have no appreciable effect on APD.
34 + 1.3.1.6 Transient outward K current (Ito)
+ Ito is a rapidly activating and inactivating voltage-gated K current that contributes to the early phase of repolarization in working myocytes. It is comprised of two distinct components, a slow recovering component (Ito,s) carried by the Kv1.4 (gene KCNA4) α subunit, and a fast recovering component (Ito,f) carried Kv4.2 (gene KCND2) and Kv4.3 (gene KCND3)
129 α subunits. In mice, Kv4.2 is critical for functional Ito in the working myocardium . Classical
+ voltage-gated K channels are composed of a tetramer of Kvα subunits each contains 6 transmembrane segments (S1-S6), a voltage sensor (S4), a pore region (selectivity filter) between S5 and S6, and cytoplasmic N- and C-termini. The pore region confers K+ selectivity and the N-terminus contains the tetramerization domain for Kvα subunit assembly. Kvα subunits associate with several accessory proteins: Kv channel interacting proteins (KChIPs),
MinK-related peptides (MiRP), and Kvβ subunits. KChIP tetramers associate with the N- termini of Kv4α subunits and affect channel expression and kinetics. MinK is a single transmembrane spanning accessory subunit that regulates Kvα channel trafficking and kinetics.
Kvβ tetramers interact with the N-termini of Kvα subunits and regulate channel trafficking and kinetics.
KChIP2, MiRP1, MiRP2, Kvβ and diaminopeptidyl transferase-like protein-6 regulate
2+ Kv4α channels. KChIP2 (gene Kcnip2) is a Ca binding protein that is essential to murine
130 Itof . Recent in vitro studies suggest that INa and Ito are structurally and functionally coupled via accessory subunits such as KChIP2131. Several protein kinases such as PKA, PKC, ERK, and calmodulin kinase II modulate Kv1.4 and Kv4α subunits. Phosphorylation by p90 ribosomal S6 kinase, c-Src, and G-protein-coupled kinase-2 has been shown to modulate Itof and membrane trafficking132-134. Cytoskeleton proteins filamin and α-actinin, scaffolding
35 proteins post-synaptic density protein and synapse-associated protein 97, and syntaxin 1A
135 associate with and regulate Ito channels . To date, a gain of function mutation in MiRP2
(gene KCNE3) has been linked with Brugada syndrome136.
+ 1.3.1.7 Delayed rectifier K current (IK)
IK plays a role during late repolarization of the AP and maintaining the AP duration
(APD). It is composed of a slowly activating component (IKs) carried by the α protein
KvLQT1 (gene KCNQ1) and a rapidly activating component (IKr) carried by the α protein
HERG (gene KCNH2). KvLQT1 functionally form tetramers and associates with the β-subunit
MinK (gene KCNE1) in a 4:2 ratio, while HERG co-assembles with the β-subunit MiRP1
(gene KCNE2). Mutations in KCNE1 are linked with LQT5 and familial atrial fibrillation137,
138 139 , and mutations in KCNE2 also correlate with atrial fibrillation . IKs is modulated by PKA,
CaM, Nedd4-2, and PIP2. IKr is regulated by the membrane protein KCR1 and rho-GTPase activating protein 6. KvLQT1 and HERG channels are functionally and structurally linked140.
Several loss of function mutations in KCNQ1 and KCNH2 are associated with LQT1 and
LQT2 respectively141-143. In contrast, gain of function mutations in KCNQ1 are linked with atrial fibrillation and short QT syndrome type 2144, 145, while KCNH2 mutations are associated with short QT syndrome type 1146.
+ 1.3.1.8 Inward rectifier K current (IK1)
IK1 is carried mainly by Kir2.1 (gene KCNJ2) and is important during the final phase of AP repolarization as well as for stabilizing the resting membrane potential. IK1 is characterized by a smaller outward K+ current at depolarized membrane potentials (0 mV)
36 and by a larger outward K+ current at more negative membrane potentials approaching -96 mV (equilibrium potential for K+) due to a voltage-dependent block of outward current by
2+ intracellular polyamines and Mg . A functional IK1 channel is composed of a tetramer of
Kir2.1 channels, each comprised of a pore region and 2 transmembrane spanning domains.
Kir2.1 channels are regulated by PIP2. Several Kir2.1 channelopathies have been discovered.
Gain of function mutations are linked with familial atrial fibrillation and short QT syndrome type 3147, 148, whereas loss of function mutations are associated with catecholaminergic polymorphic ventricular tachycardia 3 and LQT7-related Andersen-Tawil syndrome 1149, 150.
1.3.1.9 Gap junctions
Gap junctions mediate electrical and metabolic coupling between cells. In the heart, these channels enable propagation of the action potential and the diffusion of ions, second messengers and small metabolites less than 1000 Da. Gap junction channels are formed by the docking of two hemichannels found on adjacent cells. Hemichannels are formed from the oligomerization of 6 connexin proteins. Each connexin is composed of 4 transmembrane α- helices, 2 extracellular loops, a cytoplasmic loop, and cytoplasmic N- and C- termini. Channel function is regulated by Ca2+, pH, voltage, and phosphorylation. The C-terminal domain contains numerous regulatory sites for phosphorylation and protein-protein interactions.
The mammalian heart contains Cx30.2 (gene GJD3), Cx40 (gene GJA5), Cx43 (gene
GJA1), and Cx45 (gene GJA7) (Fig 1.8). Cx43 is the principal Cx in the heart; it is expressed in all working cardiomyocytes, bundle branches and Purkinje fibers (Fig 1.8A). Cx40 is located in atrial myocytes, His bundle, bundle branches, and Purkinje fibers (Fig 1.8B), whereas Cx45 and Cx30.2 are only found in the specialized cells of the conduction system
37 A Cx43
B Cx40
Cx45/ C Cx30.2
Figure 1.8. Regional connexin expression in the heart. (A) Cx43 is expressed in the atria, ventricles, and His-Purkinje system. (B) Cx40 is mainly expressed in the atria. (C) Cx45 and Cx30.2 are expressed throughout the specialized tissues of the conduction system. 38 (Fig 1.8C). As the half-life for Cx43 is less than 5 hrs, the life cycle of Cx43 is tightly controlled by several kinases151. Cx43 is subject to both lysosomal and proteasomal degradation152. Cx43 phosphorylation regulates Cx43 trafficking to the cell membrane, channel assembly, gating, and turnover. PKC-induced phosphorylation of p-Ser368 reduces unitary channel conductance153, while Src-induced phosphorylation of Tyr265/247 induces reduced gap junction communication154 , CK1-induced phosphorylation of Ser325/328/320 regulates gap junction assembly 155, PKA-induced phosphorylation of Ser364/365 increases gap junction assembly by inducing Cx43 trafficking 156, 157, and MAPK-induced phosphorylation of Ser255/279/282 reduces gap junction communication, likely via reduced open channel time158.
Cx43 is normally found at intercalated disks in a multi-protein complex, interacting with various structural proteins such as zona occcludens-1, cadherins, catenins, microtubules, and tubulins159. Interaction with zona occcludens-1at Pro375/377 regulates gap junction size and localization at intercalated disks160, while binding of a Cx43 interacting protein of 85kDa
(CIP85) to residues 253-256 induces Cx43 turnover via the lysosomal pathway161. The T-box transcription factor Tbx2 and Tbx3, and Nkx2.5 have been shown to negatively regulate Cx43 transcription162, 163.
Cx43 is a high conductance channel essential to normal cardiac development and propagation of the electrical impulse in the working ventricular myocardium. Mice lacking
Cx43 develop ventricular conduction delays and arrhythmias and die perinatally due to cardiac malformations of the RV outflow tract164, 165. Neonatal mouse ventricular myocytes
(NMVM) from Cx43-/- mice exhibit 25 fold slower ventricular conduction166. Heterozygous
Cx43 mice express 50% less Cx43 protein and exhibit slowed ventricular conduction and increased susceptibility for spontaneous arrhythmias167, 168. Cardiac specific deletion of Cx43
39 results in delayed ventricular conduction and sudden cardiac death within 2 months169.
Inducing deletion of Cx43 post-natally results in slowed ventricular conduction and death during bradyarrhythmia170. Chimeric Cx43 mice display heterogeneous Cx43 expression pattern in the heart, delayed conduction, and reduced contractility171.
Cx40 is a high conductance channel required for impulse propagation in the atrial and conduction system. During development, Cx40 is expressed strongly in the entire working myocardium and is restricted to the atria and conduction system in adulthood. Studies on mice lacking Cx40 have generally revealed an increased susceptibility to atrial arrhythmias, and delayed conduction at all levels of the conduction system (SAN, intra-atrial, AVN, right bundle branch, ventricular)172-175.
Cx45 and Cx30.2 are low conductance channels involved in propagation of the electrical impulse in the specialized cells of the conduction system. Cx30.2 plays a role in delaying the cardiac electrical impulse in the AVN to ensure coordinated activation of the ventricles as mice lacking Cx30.2 have increased AVN conductance176. Cx45 is essential during early cardiogenesis. During development, Cx45 is expressed in all regions of the heart, however, it is down-regulated and restricted to cells of the conduction system in adulthood.
Mice lacking Cx45 develop AVN block, several cardiac and vascular defects, severe apoptosis and die of HF in utero around E10177, 178. Mice with cardiac restricted deletion of Cx45 develop a similar phenotype as Cx45-/- mice and also die in utero around E10179.
1.3.2 Electrical remodelling and HF
Impaired cardiac conduction, membrane repolarization, automaticity, intracellular Ca2+ handling, and myocardial architecture contribute to electrical remodelling in HF. More
40 specifically, remodelling of ion channels, connexins, and proteins involved in intracellular calcium cycling contribute to increased APD, heterogeneity of APD, prolonged QT, and susceptibility to lethal arrhythmias in HF (Fig. 1.9; Table 1.1).
1.3.2.1 Ca+ channel remodelling
Excitation-contraction coupling and intracellular Ca2+ handling are severely compromised in HF due to altered ICa-L, ICa-T, SERCA2a, PLB, NCX1, RyR2, and IP3R function (Table 1.1). The Ca2+ transient amplitude and rate of decay are diminished in HF due to abnormal SERCA2a activity. SERCA2a expression and function are reduced in HF, leading to defective sequestration of Ca2+ into the SR180-182. Reduced PLB expression and function, as well as increased PLB dephosphorylation in HF, also contribute to impaired SERCA2a activity183-185. Interestingly, mutations in PLB causing dysfunctional Ca2+ sequestration have been identified in patients with HF96. Increased forward mode NCX1 may act to compensate for reduced SERCA2a, as NCX1 expression and activity is increased in HF, and results in a net increase in inward current during the plateau phase of the AP186, 187. An increase in late depolarizing current would impair repolarization and lead to AP prolongation and/or early after depolarizations. The trigger and gain of excitation-contraction coupling are reduced in
HF due to remodelled ICa-L and RyR2 function. RyR2 expression and function are reduced and
RyR2 phosphorylation is increased182, 188. Hyperphosphorylation of RyR2 results in defective
Ca2+ release from the SR, increased diastolic Ca2+ leak, and dissociation of FK-506 binding proteins. Diastolic Ca2+ leak could generate Ca2+ waves and cause delayed after
2+ depolarizations. IP3R are also increased in HF and may contribute to further altered Ca release from the SR189. Phosphorylation of L-type Ca2+ channel is increased, while its
190-192 expression, ICa-L and T-tubule density are reduced in HF . Reduced ICa-L inactivation may
41 ↓INa ↓INa-K ↑INHE ↓IK1, IK, Ito ↓ICa-L, ↑ICa-T ↑INCX
Na+ Ca2+ Na+ Na+ ATP NHE NCX ase K+ H+ K+ Ca2+ Ca2+ Ca2+
↓Cx43 P P 2+ ↓[Ca ]i
↓RyR ↑IP3R
Ca2+ Ca2+ ↓SERCA P ↓Cx43~P PLB P SR
Cx43 misslocalization
Figure 1.9. Electrical remodelling of cardiac myocytes in the failing heart. Electrical coupling between cells is severely impaired in HF as the expression and phosphorylation of + Cx43 is reduced, and Cx43 is extensively misslocalized. Meanwhile, several K currents (IK1, 2+ IK, Ito, INa-K), INa, and Ca currents/channels (ICa-L, RyR, SERCA) are reduced, while other currents/channels (ICa-T, INHX, INCX, IP3R) are increased. Contraction of the myofilaments is 2+ 2+ diminished as impaired Ca cycling leads to reduced [Ca ]i available to activate myocardial contraction. 42 Table 1.1. Remodelling of ion channels, connexins, and Ca2+ handling proteins in the failing ventricle
Protein Gene Changes in Heart Failure REF Current 193-195 INa Nav1.5 SCN5A ↓F, ↓M, ↓P, ↑NaL h,e 190-192 ICa-L Cav1.2 CACNA1C ↓F, ↓P, ↑~P e 196 ICa-T Cav3.1/ Cav3.2 CACNA1G/H ↑F h,e 197-199 Ito,f Kv4.2/Kv4.3 KCND2/3 ↓F, ↓M, ↓P e 197, 200 Ito,s Kv1.4 KCNA4 ↓F, ↓M h,e 201, 202 IKr HERG KCNH2 ↔F h,e 202, 203 IKs KvLQT1 KCNQ1 ↓F h,e 201, 202 IK1 Kir2.1 KCNJ2 ↓F Connexins Cx43 GJA1 ↓M, ↓P ↓~P, ↑ lateralization h,e 204-206 Ca2+ handling NCX SLC8A1 ↑F, ↑M, ↑P h,e 186, 187 proteins SERCA2a ATP2A2 ↓F, ↓M, ↓P h,e 180-182 RyR2 RYR2 ↓F, ↓M, ↓P, ↑~P h,e 182, 188 h 189 IP3R2 ITPR2 ↑M, ↑ P PLB PLN ↓F, ↓M ↓~P, h,e 183-185 F=function, M=mRNA expression, P=protein expression, ~P=phosphorylation, h= human HF, e=experimental HF
43 lead to persistent late ICa-L and thus increased APD as a result of abnormal dephosphorylation and open channel probability. Also, ICa-L displays a blunted response to continued β- adrenergic stimulation in HF. Prolonged APD may also predispose to reactivation of ICa-L and consequently early after depolarizations. Of note, mice with cardiac specific over-expression
207 of Cav1.2 develop HF . ICa-T is re-expressed in the failing heart and could contribute to increased spontaneous depolarisations and altered excitation contraction coupling196. The balance between protein kinase and phosphatase activity is altered in HF and impairs excitation contraction coupling and Ca2+ homeostasis.
As several cardiomyopathies have been linked with mutations in genes encoding sarcomeric, cytoskeletal, and Ca2+ handling proteins, efforts aimed at re-establishing the wild- type proteins are therapeutically attractive. Gene therapy has emerged as a potential therapeutic tool to treat HF. SERCA2a is a likely candidate to improve cardiac contractility and Ca2+ handling in HF, as restoring SERCA2a activity by increasing SERCA2a levels and/or relieving the inhibition of SERCA2a mediated by PLB has proven beneficial in experimental models of HF. 208-211 Recently, the efficacy and safety of myocardial gene targeted increase of SERCA2a (MYDICAR) in patients with phase III or IV HF was evaluated in the phase II clinical trial CUPID (Ca2+ up-regulation by percutaneous administration of gene therapy in cardiac disease). MYDICAR treatment has successfully reduced and delayed
LV assist device implantation or cardiac transplantation, and improved exercise tolerance, HF symptoms, echocardiographic measures, and NT-proBNP levels212.
44 1.3.2.2 Na+ channel remodelling
HF is associated with reduced INa, Nav1.5 mRNA and protein, increased non-
193-195 functional C-terminal splice variants, and increased late INa (Table 1.1). Interestingly, mutations in SCN5A have been discovered in patients with HF, where impaired INa leads to
2+ + 213 abnormal Ca and Na homeostasis and subsequent mechanical dysfunction . As rapid INa is essential to normal initiation and propagation of the AP, reduced peak INa in addition to increased late INa would result in impaired repolarization, prolonged APD, slowed conduction, and increased susceptibility to arrhythmias.
1.3.2.3 K+ channel remodelling
+ HF is associated with abnormal repolarization due to reduced K currents (Ito, IKs, IK1) and increased late depolarizing currents (ICa-L, INa). The most consistent ion channel remodelling in HF is reduced Ito. Transcriptional repression plays a role in regulation of Itof as the Kv4α subunits Kv4.2 and Kv4.3 in addition to its regulator accessory subunit KChIP2 are reduced at the mRNA and protein levels in human and experimental models of HF197-199, 214.
197, 200 Likewise, Kv1.4 mRNA and Itos is reduced in HF . IKs is also reduced in HF, while levels of KvLQT1 mRNA and protein have not been reliably different. However, recently, reduced
214, 215 KCNE1 mRNA as well as a KCNE1 variant have been linked with HF . Alterations in IKr function or expression of HERG, or its accessory subunit MiRP1, have not been associated
198, 201 with HF . Finally, IK1 is also reduced in HF, however the molecular correlates are unknown as changes in Kir2.1 mRNA/protein levels have been inconsistent201, 202. This K+ ion channel remodelling contributes to abnormal repolarization, prolonged APD, and development of early after depolarizations in HF.
45 1.3.2.4 Gap junction remodelling
The abundance, distribution, and phosphorylation of Cx43 are severely diminished in
HF. Cx43 mRNA and protein expression is reduced, and Cx43 dephosphorylation and lateralization are increased204-206. Cx43, normally localized at the intercalated disk, is lateralized and spread uniformly around the cell membrane. Also, the association of Cx43 with zonula occludens-1 is increased in HF and correlates with mislocalization of Cx43216.
Unlike Cx43 remodelling in HF, changes in Cx40 and Cx45 levels that accompany HF have been inconsistent205, 217, 218. Loss of Cx43 at the intercalated disk would lead to cellular uncoupling and contribute to conduction slowing and asynchronous contraction.
1.3.3 Electrical remodelling and ET-1
ET-1 induces electrical remodelling by modulating repolarizing K+ current, Ca2+ current, gap-junctional intracellular communication, and Ca2+ handling proteins (Fig. 1.10).
1.3.3.1 Regulation of Ca2+ handling by ET-1
2+ In the heart, ET-1 modulates Ca homeostasis by altering ICa-L, ICa-T, NHE activity,
2+ 59, 219-222 reverse mode NCX activity, and diastolic Ca release via the IP3R . In human atrial myocytes, ET-1 stimulates ICa-L via the ETBR when baseline current density is low and
219 inhibits ICa-L via the ETAR when initial current density in high . ET-1 induces ICa-T in healthy and failing adult rat ventricular myocytes220. In neonatal rat ventricular myocytes (NRVM), 24 hrs of 5nM ET-1 exposure induces an increase in NHE activity and subsequent increase in reverse mode NCX activity59. In a cardiomyopathic rat model, dual ETR blockade normalized the increased diastolic Ca2+ leak attributed to increased RyR2 and decreased FK-506 binding
46 ↓ ↑ Cx43 / GJIC ↑I ↓I , I , I ↑INHX NCXrev ↓ICa-L, ↑ICa-T K1 K to
+ H Na+ Ca2+
NHX NCX
Na+ Ca2+ K+ Na+ Ca2+ Na+ Ca2+ Ca2+ Ca2+ Ca2+
RyR IP3R
Ca2+ Ca2+ SERCA PLB SR
Cx43
Figure 1.10. ET-1 induced electrical remodelling in cardiac myocytes. ET-1 modulates the shape and propagation of the cardiac action potential by ion channel / gap junction remodelling. ET-1 disrupts electrical coupling by increasing or decreasing Cx43 and gap junctional intracellular communication. ET-1 triggers an increase in diastolic Ca2+ leak via 2+ IP3R on the SR, increases intracellular Ca levels by stimulating NHX activity and thus triggering reverse mode NCX, and reduces ICa-L, Ito, IK , and IK1 and increases ICa-T. 47 proteins221. Lastly, ET-1 induced diastolic Ca2+ leak and spontaneous Ca2+ release events is
2+ 222 dependent on SR Ca release by IP3R2 .
1.3.3.2 Regulation of cardiac repolarization by ET-1
ET-1 alters repolarizing K+ currents in human atrial myocytes, Xenopus oocytes, neonatal rat ventricular mycoytes, and in a cardiomyopathic hamster model223-226. ET-1 elicites a PKC-dependent reduction in IK1 via phosphorylation of Kir2.2 channels in Xenopus oocytes expressing the ETAR with the determinants of IK1 (Kir2.1, Kir2.2, Kir2.3) and in
223 human atrial cardiomyocytes . Similarly, ET-1 induces a decrease in Ito carried by Kv1.4 or
Kv4.3 by increased PKC/calmodulin kinase II mediated phosphorylation in Xenopus
227 oocytes . ET-1 also triggers a ETAR/PKC dependent biphasic response (a transient increase
225 followed by a decrease) on IKs in Xenopus oocytes . In a cadiomyopathic hamster model, electrical remodelling characterized by action potential prolongation and reduced ICa-L, Ito, IK,
226 and IK1 was ameliorated with ETAR blockade . In NRVM, 1-3 days of 100nM ET-1
224 exposure resulted in prolonged APD, increased INCX, and reduced Ito and IK .
1.3.3.3 Regulation of cardiac conduction by ET-1
ET-1 has been shown to alter Cx43 expression and gap-junctional intracellular communication in neonatal rat ventricular myocytes, ovarian carcinoma cell lines, cortical astrocytes, and osteoblatic cells228-232. In NRVM, 24 hrs of 10-1000nM ET-1 treatment caused an ETAR/ERK dependent increase in phosphorylation and expression of Cx43 accompanied with increased gap junctional conductance228. However, in another study, NRVM cultured with 50nM ET-1 for 24 hrs induced a reduction in conduction velocity, with a 40% increase in
48 Cx43 protein (revealed by western blot), despite a 30% reduction in Cx43 expression via immunofluorescence230. In ovarian carcinoma cells, ET-1 induced reduction in gap-junctional
229 intracellular communication and Cx43 expression is dependent on ETAR/c-Src . Culturing cortical astrocytes with 2-10nM ET-1 for 1-7 days caused an ETBR dependent reduction in gap-junctional intracellular communication and Cx43 expression231. Finally, osteoblastic cells cultured with 10nM ET-1 for 2-12 days resulted in reduced mRNA and protein expression of
Cx43 and gap-junctional intracellular communication232.
1.4 RATIONALE, HYPOTHESIS, OBJECTIVES
1.4.1 Rationale
Endothelins are vasoconstrictive peptides involved in the regulation of vascular tone and pathophyiology of cardiovascular disease. ET-1 can also act as a pro-inflammatory cytokine and fibrotic factor. In vitro studies have shown ET-1 induces electrical remodelling of gap junctions, Ca2+ handling proteins, and ion channels. Our mouse model with conditional cardiac-specific over-expression of human ET-1 will be used to investigate whether ET-1 is acting primarily as a cytokine mediating inflammation and fibrosis or as a modulator of ion channel/electrical properties. This model provides the opportunity to assess the role of ET-1 in electrical remodelling in vivo and its importance to HF initiation and progression, to determine if ET-1 induced electrical remodelling alone can trigger HF development, and to elucidate how ET-1 induces cardiac ion channel or gap junction remodelling. Previous attempts to prevent this model of ET-1 induced cardiomyopathy using selective and non-selective ET receptor antagonists have not been effective. In this model of ET-1 over-expression, the ability of ET receptor antagonists to inhibit the ET-1 cascade may be limited in states of high
49 endogenous levels of ET-1, as in HF, due to robust receptor binding kinetics. We propose to evaluate the use of dual ECE/NEP inhibition to prevent this lethal phenotype.
1.4.2 General hypothesis: Temporal characterization of electrical remodelling will enable prevention and progression of cardiomyopathy.
1.4.3 Hypotheses
1. Inhibition of ET-1 synthesis using an ECE inhibitor (CGS-26303) will effectively
prevent the ET-1 induced cardiomyopathy.
2. ET-1 induces electrical remodeling by disruption of Connexin-43 and Nav1.5 via
NFκB transcriptional repression.
3. This model will be reversible by the cessation of ET-1 over-expression at the onset of
electrical remodelling.
1.4.4 Objectives
1. To describe the temporal progression of the ET-1 induced electrical remodelling
a. Characterize the electrical defects using surface ECG, octapolar mapping and
programmed stimulation
b. Characterize the progression of electrical remodelling using epicardial mapping
c. Characterize the progression of structural and functional remodelling using
ultrasound biomicroscopy and invasive hemodynamics
50 2. To determine the molecular mechanism(s) leading to ET-1 induced electrical remodelling
a. Identify potential mechanim(s) of ET-1 induce electrical remodelling via western blot
and qRT-PCR for gap junctions and ion channels
b. Confirm molecular mechanism(s) of ET-1 induce electrical remodelling with an in
vitro system
c. Determine if ET-1 induced NFκB activation inhibits Cx43 and Nav1.5 transcription
3. To determine if this cardiomyopathic phenotype can be prevented by inhibiting ET-1 over-
expression
a. Determine if inhibition of ET-1 synthesis using the ECE inhibitor CGS 26303 will
prevent this model
b. Determine if this model can be prevented by inhibition of ET-1 over-expression by re-
introducing DOX at the onset of ET-1 induced electrical remodelling
51
CHAPTER 2. PHARMACOLOGICAL FAILURE OF LONG-TERM DUAL ECE-NEP
INHIBITION WITH CGS-26303 IN AN ET-1 MODEL OF CARDIOMYOPATHY
52 2.1 INTRODUCTION
The ET-1 signaling cascade is hyper-activated in HF; ET-1, BigET-1, ECE-1, and ETA are elevated in human and animal models of HF64-67, 233. Zinc metalloproteases regulate the production and degradation of ET-1. ECE is the principal enzyme responsible for the final rate-limiting step of the synthesis of active ET-1 from its precursor BigET-1, while NEP contributes to the enzymatic degradation of ET-1 (Fig. 2.1). To investigate the role of ET-1 in the pathophysiology of cardiovascular disease, we developed a mouse model of temporal and regional regulation of ET-1. Our lab generated transgenic mice with conditional cardiac- specific over-expression of human big-endothelin-1 (hET-1) by crossing mice harboring the tetracycyline transactivator (tTA) under the control of the α-myosin heavy chain promoter, with a line harboring ET-1 regulated by a tTA-responsive, and thus doxycycline (DOX)- regulated (DOX-off), transgene for hET-134. Previous reports in our lab have shown that this model is associated with an inflammatory cardiomyopathy characterized by increased cytokines, LV dilatation, and contractile dysfunction leading to HF and death 34. Selective
ETA antagonists and combined ETA/ETB antagonists have been developed to treat HF with inconsistent results79. Previous attempts to prevent this model of ET-1-induced cardiomyopathy using selective and non-selective ET receptor antagonists have not been effective34. In this model of ET-1 over-expression, the ability of ET receptor antagonists to inhibit the ET-1 cascade may be limited by high endogenous ET-1 levels, as occurs in HF, and robust receptor-binding kinetics. CGS 26303 is a dual ECE/NEP inhibitor that inhibits ECE with an IC50 of 410 nM. Short-term treatment with CGS 26303 in models of HF and diabetes has improved LV hemodynamics and contractile function, and reduced cardiac fibrosis and hypertrophy83, 84, 234. Therefore, we have hypothesized that inhibition of ET-1
53 prepro ET-1
Furin-like enzyme
Chymase ET-11-31 Big ET-11-38
ECE CGS 26303
IC50 (ECE) = 410 nM IC50 (NEP) = 1 nM NEP, ET R cleared / B ET-11-21 inactivated
ETARETBR
Figure 2.1. Schematic of ET-1 synthesis, degradation, and treatment with CGS 26303. The inactive ET-1 precursor preproET-1 is cleaved by furin-like enzyme to generate the 38 amino acid peptide BigET-1. BigET-1 is then either converted to the mature 21 amino acid peptide ET-1 via ECE or is converted to an intermediary 31 amino acid peptide by chymase, and subsequently cleaved to ET-1 by ECE, NEP, or another protease. ET-1 is either cleared by the ETBR or is inactivated by NEP. Preventing the synthesis of mature ET-1 via dual ECE/NEP blockade with CGS 26303 may be a more effective than ET receptor antagonism in conditions with chronically high levels of ET-1.
54 synthesis using CGS-26303, a dual inhibitor of ECE/NEP, as opposed to blocking ET-1 at the receptor level, will be more effective at treating this model of ET-1-induced cardiomyopathy.
2.2 MATERIALS & METHODS
2.2.1 Experimental animals. Experiments conformed to protocols approved by the
University Health Network Animal Use and Care Committee and were conducted in accordance with guidelines established by the Canadian Council on Animal Care. Binary transgenic mice (BT:ET+tTA+) were administered DOX (200 mg/L; Sigma-Aldrich, St. Louis,
MO) in drinking water from conception until 8 wks age. Experiments were conducted in mice maintained on DOX, withdrawn from DOX to induce gene expression, or withdrawn from
DOX and treated with CGS-26303 for 12 wks. Levels of bigET-1 and ANP were assessed after 4 wks of treatment. After the treatment period, LV invasive hemodynamics was followed by assessing inflammatory infiltration, ECE activity, levels of myocardial bigET-1 and plasma
ANP (Fig. 2.2).
2.2.2 Drug administration. Mice were anaesthetized with ketamine (100mg/kg; MTC
Pharmaceuticals, Cambrige, ON) and xylazine (10 mg/kg; Bayer Inc., Etobicoke, ON), osmotic mini-pumps (model 2004; Alzet, Cupertino, CA) delivering CGS-26303 (5 mg/kg/day; Novartis, Dorval, QC) dissolved in 0.25M NaHCO3 were implanted subcutaneously in BT mice every 4 wks for the treatment period.
55 hemodynamics, histopathology, ECE activity, ET-1/BigET-1/ANP ELISA’s ET-1/BigET-1/ANP ELISA’s
Birth 8 wks 12 wks 20 wks 12 wks ET-1 off (+DOX) 8 wks ET-1 off (+ DOX) ON DOX
12 wks ET-1 on (-DOX) OFF DOX
12 wks ET-1 on + CGS 26303 (-DOX) CGS 26303
Figure 2.2. Schematic of experimental design. Mice were kept on DOX from conception until 8 wks of age, then either maintained on DOX, taken off DOX, or taken off DOX and treated with CGS-26303 for 12 wks. Levels of myocardial ET-1, bigET-1 and plasma ANP were measured by ELISA 4 wks later. After the treatment period, LV hemodynamic measurements were followed by histopathology, ECE activity, and ELISA’s for myocardial bigET-1 and plasma ANP.
56 2.2.3 Invasive LV hemodynamics. The mice were anesthetized with Isofluorane (1.5% -
2.5%) and kept on a heating pad to maintain body temperature. The ventral aspect of the neck was shaved; the mice were placed in a supine position. Using a dissecting microscope (MZ6
Leica, Heerbrugg, Switzerland), the right common carotid artery was exposed via a midline incision on the ventral side of the neck. The middle segment of the common carotid artery was dissected and two ligatures with 7-0 silk, and proximal and distally placed around it.
Temporary occlusion of the common carotid artery was achieved with a gentle traction. An incision hole is made between the two ligatures of the artery, through which a Millar micro-tip transducer (1.4 F sensor, 2F catheter; Millar Instruments Inc., Houston, TX) was passed through the common carotid artery and into the LV cavity to measure arterial and LV pressure tracings. From these tracings HR and ±dP/dT (peak positive and negative rate of LV pressure change) were calculated. All data were analyzed using computer based acquisition system
(Sonometrics, London, ON).
2.2.4 ET-1 / BigET-1 ELISA. Ventricles were snap frozen, homogenized in 10 times wt/vol ice cold buffer (10 mM NaCl, 10% glycerol, 1% Triton X-100, 50 mM HEPES, 1mM EDTA,
0.01 PMSF, 4.8μg/mL aprotinin, 4.8μg/mL leupeptin), centrifuged at 20,000g for 20min at
4oC, and filtered through a YM-10 membrane for 3h at 3000g at 4oC (Millipore Canada Ltd,
Etobicoke, ON). The filtrate was then used for precipitation and quantification using a
BigET-1 ELISA kit (ALPCO Diagnostics, Salem, NH). More specifically, the samples, standards and control sample (human ET-1 / BigET-1) were added to wells pre-coated with polyclonal sheep anti ET-1 / BigET-1 Ab. A monoclonal anti ET-1 / BigET-1 Ab conjugated to horse radish peroxidase was then added to the wells and subsequently incubated for 4 hrs at
57 RT in the dark. Next, the plate was incubated for 30 min at RT in the dark with TMB substrate solution. The reaction was stopped with acidic stopping solution and the absorbance was measured at 450nm. The colour intensity is proportional to the amount of ET-1 / BigET-1 in the samples. Sample concentrations were determined from relative standard calibration curves generated with human ET-1 / BigET-1 samples. Levels of ET-1 peptide are found in
Appendix 1.
2.2.5 ANP ELISA. Blood (~500μl) was collected in pre-cooled tubes coated with EDTA
(VWR), stored on ice until centrifuged at 13,000g for 6min at 4oC. Plasma was separated and stored at -80oC until assayed for levels of ANP using an ELISA kit (Cayman Chemical; Ann
Arbor, MI) that is based on the competition for binding sites of anti-rat ANP antibodies between free ANP and rat ANP tracer (linked to acetylcholinesterase). More specifically, the samples, standards and control samples (rat ANP) were incubated with ANP tracer and rabbit anti-rat ANP Ab in wells pre-coated with mouse IgG against rabbit overnight at 4oC. The plate was incubated for 30 min at RT in the dark with Ellman’s Reagent (acetylcholinesterase substrate), followed by measuring the absorbance at 450nm. The colour intensity is proportional the amount of tracer complexed in the well and is inversely proportional to the amount of free ANP in the well. Sample concentrations were determined from relative standard calibration curves generated with rat ANP samples.
2.2.6 Histopathology. Hearts were perfusion fixed with 4% paraformaldehyde, paraffin- embedded, sectioned (5-6μm), and stained with hematoxylin-eosin. Three sections per heart
58 were scored (0-4) for cell infiltration by a blinded observer as follows: absence (0), mild (1), mild-moderate (2), moderate (3), and extensive (4) infiltration or necrosis.
2.2.7 ECE activity. Ventricles were snap frozen, homogenized in ice cold buffer (5%
IGEPAL, 0.1M MES, and 0.2M NaCl, pH 6.0), stored at 4oC for 1 h, and centrifuged at
20,000g for 15min at 4oC. Supernatant (50μg protein) was incubated with 20μM of fluorogenic ECE substrate (Mca-RPPGFSAFK(Dnp)-OH; R&D systems, Minneapolis, MN) in 100μL of reaction mixture (0.1mol/L MES, and 0.2 mol/L NaCl, pH 6.0) for 1h at 37 °C.
The rate of the reaction was analyzed by reading excitation at 320nm and emission at 405nm every 5 min for 1h. An in vitro validation of CGS-26303 was performed by determining ECE activity in myocardial proteins isolated from a C57BL/6 mouse with an increasing gradient of
CGS-26303 (Fig. 2.3).
2.3 RESULTS
2.3.1 Short term treatment with CGS-26303 inhibits ECE and NEP activity. To determine if ECE inhibition could prevent the cardiomyopathic phenotype of mice over-expressing ET-1,
BT mice were treated with the dual ECE/NEP inhibitor CGS-26303 for 12 wks. All mice were maintained on DOX until 8 wks of age. Following this, groups of mice were either maintained on DOX, withdrawn from DOX, or withdrawn from DOX and treated with CGS-26303 for 12 wks (Fig. 2.2). To confirm the ability of CGS-26303 to inhibit myocardial ECE, CGS-26303 dose-dependently blocked the ex vivo ECE activity of myocardial protein extracts from a
C57BL/6 mouse (Fig. 2.3). To assay if CGS- 26303 was inhibiting ECE/NEP activity in vivo, myocardial bigET-1 and plasma ANP levels were
59 60 B A activity ( with anincreasinggradient Figure 2.3. Change in Fluorescence/min ECE activity -0.5 100 -20 0.0 0.5 1.0 1.5 2.0 2.5 3.0 20 40 60 80 0 B 10203040500 ) of myocardial proteins is ) ofmyocardial Ex vivo validation ofCGS26303. of CGS 26303 (A) and dose-dependent CGS 26303(A)and of olated from aC57BL/6mouse. Time (min) ECE activity recorded every4min foranhour ECE activity reductioninrateofECE 10 5 2.5 1.25 0.625 0 0.125 0 10 5 2.5 0.625 g g g g g g g g g g g g assessed after 4 wks of treatment. As expected, inhibition of ECE/NEP with CGS-26303 treatment caused elevated levels of bigET-1 and ANP (Fig. 2.4A,B), indicating that CGS-
26303 was preventing conversion of bigET-1 to ET-1 and inhibiting ANP degradation.
2.3.2 Long term treatment with CGS-26303 fails to prevent cardiomyopathic phenotype.
At the end of the 12 wks treatment period, invasive hemodynamic analysis was performed to determine if long-term ECE/NEP inhibition would preserve hemodynamic and contractile function and/or exhibit any potential survival benefit. Consistent with previous results34, BT mice withdrawn from DOX developed a significant decline in systolic and diastolic blood pressures (Fig. 2.5A) and in LV contractile function (Fig. 2.5B), with a significant increase in inflammatory cell infiltration (Fig. 2.6D). Animals treated with CGS-26303 also manifest the deterioration in hemodynamic and LV contractile parameters observed in BT mice withdrawn from DOX (Figs. 2.5A,B); in other words, treatment with CGS-26303 did not result in any discernable hemodynamic or contractile benefit. Similarly, treatment with CGS-26303 did not prevent inflammatory cell infiltration (Fig. 2.6D). Finally, no significant survival benefit was observed in mice treated with CGS-26303 (Fig. 2.7).
To examine if CGS-26303 continued to inhibit endogenous ECE/NEP activity throughout the entire study period and limit ET-1 production and ANP metabolism, ECE activity as well as myocardial tissue levels of bigET-1 and plasma levels of ANP were assayed
(Figs. 2.6A,B,C). As expected, DOX withdrawal led to significantly increased levels of bigET-1 (Fig. 2.6A), and increased levels of ANP and ECE activity (Figs. 2.6B,C). However, unlike the results observed after 4 wks of treatment, 12 wks of CGS 26303 treatment no longer prevented the hydrolysis of bigET-1 or the metabolism of ANP (Figs.
61 62 plasma ANP( with CG weeks oftreatment Figure2.4. Shorttermtreatment with AB
Big ET-1 (fmol/ng) 20 40 60 0 B ). *=P<0.05. * * S-26303 led to an accumulation of myocardial bigET-1of myocardial S-26303 ledtoanaccumulation and CGS 26303 (ET-1 on+treatment) OFF DOX (ET-1 on) ON DOX (ET-1 off) CGS-26303 inhibitedECE
ANP (pg/ml) 200 400 600 0 and NEPactivity. * Four 63 B A derivatives oftheLV pressure. **=P<0.01 pressure, LVSP =LVsystolic blood pressure, or LVhemodynamic dysfunction. SB contractile arterial/LV pressures ( integrity inBTcontractile mice Figure2.5. Longtermtreatment with CGS- mm Hg 100 20 40 60 80 0
mm Hg/s ** 1000 2000 3000 B B LVSP DBP SBP A ** ) andLV( contractility 0 . Miceover-expressing hET-1 for12wks hadreduced ** dP/dt+ ** CGS 26303 (ET-1 on+treatment) OFF DOX (ET-1 on) ON DOX (ET-1 off) 26303 failstopreservehemodynamic andLV B dP/dt = peak positive and negative first dP/dt =peakpositiveand negative P/DBP = arterial systolic/diastolic blood P/DBPsystolic/diastolic arterial = ). Treatmentwith CGS-26303didnotprevent ** ** dP/dt- ** ** ** 64 inflammatory infiltration ( Myocardial bigET-1 levels( Figure2.6. Longtermtreatment with CGS- C AB
Big ET-1 (fmol/ng) Change in Fluorescence/min 10 20 30 0 0 1 2 3 4 5 6 * D ** * A ) in BTafter 12wks mice*=P<0.05, of treament.**=P<0.01 ), plasma ANP levels( CGS 26303 (ET-1 on+treatment) OFF DOX (ET-1 on) ON DOX (ET-1 off) 26303 fails to inhibit ECE and NEP26303 failstoinhibitECE activity. D
B ANP (pg/ml) 1000 1200 ), rateof ECEactivity (
Inflammatory Score 200 400 600 800 0 0 1 2 3 4 ** ** C ), and 100
on DOX (n=9) 90
80
off DOX % Survival (n=11) CGS 26303 70 (n=12)
60 40 50 60 70 80 90 Days Post DOX Removal
Figure 2.7. Therapy with CGS-26303 does not improve survival in BT mice. Kaplan- Meier survival curves in BT mice. Mice were maintained on DOX until 8 weeks of age (Day 0), then either continued on DOX, withdrawn from DOX, or withdrawn from DOX and treated with CGS-26303. 65 2.6A,B). Surprisingly, CGS-26303 treatment resulted in further increases in endogenous ECE activity (Fig. 2.6C). Consistent with this, long term treatment with CGS-26303 failed to restrict ET-1 synthesis, ANP metabolism and ECE activity.
2.4 DISCUSSION
Effectively blunting the ET-1 signaling cascade with ET receptor antagonists has not been successful. Antagonizing ET-1 signaling via ECE inhibition, thereby preventing the synthesis of mature ET-1, was thought to represent a better a treatment strategy. The dual
ECE-NEP inhibitor CGS-26303 has proven to be beneficial in many short-term studies; improving systolic blood pressure and heart to weight ratio in a rat model of diabetes234; decreasing preload and afterload, increasing cardiac output, and reducing LV hypertrophy, dilatation, and cardiac fibrosis; and improving systolic blood pressure, LV fractional shortening, LV perivascular fibrosis, and reducing mRNA levels of collagen type I/ III and heart to body weight ratio and levels of ET-1 in rat models of HF83, 84. However, whether long term treatment with CGS-26303 is effective in states of chronically high levels of ET-1, as in clinical HF, is unknown. In our study, we wanted to determine if treatment with CGS-26303 could prevent our ET-1-induced model of cardiomyopathy.
ECE inhibition failed to prevent our ET-1 induced model of cardiomyopathy. This may have resulted from indirect effects of ECE/NEP inhibition, or the production of active
ET-1 by CGS-26303-insensitive ECE activity, or failure of CGS-26303 to provide effective
ECE/NEP inhibition after 12 wks of treatment.
Although ECE is the main enzyme involved in ET-1 synthesis, chymases and other metalloenzymes are able to hydrolyze bigET-1 into active ET-1235. It is possible that other
66 enzymes compensate for the lack of ECE activity, particularly in conditions of high bigET-1 levels; this would result in elevated levels of ET-1 and continued pathophysiological responses. Whether or not these alternate methods of ET-1 production played a role our model was beyond the scope of this study.
As CGS-26303 is a more potent inhibitor of NEP (IC50=1nM) than ECE-1
(IC50=410nM), and NEP is involved in an alternate route of ET-1 production and is also responsible for ET-1 metabolism 235, 236, altering NEP activity could significantly alter the balance between ET-1 production and degradation. As NEP activity was not inhibited in CGS-
26303 treated mice (Fig. 2.6B), NEP could have played a role in alternative ET-1 synthesis, and thus limit the effectiveness ECE inhibition by CGS-26303 in this model.
Dose, tissue absorption, and myocardial bigET-1 accumulation may have contributed to the lack of effectiveness of CGS-26303. The mice received CGS-26303 via mini-pumps at
5mg/kg/day, a dose that prevented ECE and/or NEP activity after 4 wks of treatment in this study and others237. Scar tissue may have hampered the tissue absorption of the drug, as fresh mini-pumps were re-implanted every 4 wks into the same subcutaneous area for the duration of the study. In human and bovine endothelial cells treated with CGS-26303, high levels of bigET-1 triggered an increase in ECE-1 mRNA, protein and promoter activity238. This study suggests that chronic treatment with CGS-26303 may lead to reduced responsiveness.
Therefore, it is possible that 12 wks of CGS-26303 treatment and subsequent reduced therapeutic response in our study was caused by the increase in ECE activity (Fig. 2.6C) triggered by the accumulation of bigET-1.
In conclusion, we have shown that long-term treatment with CGS-26303 in conditions with high endogenous levels of bigET-1, as seen in our model of ET-1 induced
67 cardiomyopathy, is unable to effectively inhibit ECE. These data suggest that chymases and/or other metalloproteases act as alternate methods of ET-1 production, and that the accumulation of bigET-1 may lead to increased CGS-26303-insensitive ECE activity, circumventing the efficacy of CGS-26303 (Fig. 2.8). Further studies are necessary to determine if a more selective ECE inhibitor or a combination of ECE inhibition/ET-1 receptor blockade would be a more effective treatment strategy.
Acknowledgments: I would like to thank Dr. Abdul Momen (Husain Lab) and Dr. Golam
Kabir (Lewar Centre) for acquiring the invasive LV hemodynamic data, Dr. Almuktafi Sadi for scoring the cell infiltration data, and Novartis (Summit, NJ) for generously supplying the
CGS-26303.
68 A BigET-1 ANP BigET-1 ANP BigET-1 ANP ANP BigET-1 BigET-1 BigET-1 BigET-1 BigET-1 BigET-1 ANP CGS 26303 ET-1 CGS 26303 ET-1 CGS 26303 A B ECE-1 ECE-1 ECE-1
ET ECE-1 ECE-1 ET
BigET-1 B ANP ET-1 ET-1 BigET-1 ET-1 ET-1 ET-1 BigET-1 ET-1 ANP BigET-1 ANP ET-1 ET-1 ET-1 CGS 26303 CGS 26303 CGS 26303 ET-1 ET-1 ET-1 A ECE-1 ECE-1 B ECE-1 ECE-1 ECE-1 ET ECE-1 ECE-1 ET ECE-1 ECE-1 ECE-1 ECE-1 ↑ ECE activity & ET-1 production
↑ ECE-1 mRNA
Figure 2.8. Model depicting short vs. long term treatment with dual ECE-NEP inhibitor. (A) Four weeks of CGS-26303 treatment led to inhibition of ECE and NEP activity, resulting in high levels of BigET-1 and ANP peptides. (B) Twelve weeks of CGS-26303 treatment led to an accumulation of BigET-1 peptide that triggered an increase in expression and activity of ECE, thus ultimately restoring the production of chronically high levels of mature ET-1. 69
CHAPTER 3. ET-1 INDUCED ELECTRICAL REMODELLING PRECEDES LV
DYSFUNCTION IN ET-1 INDUCED CARDIOMYOPATHY
70 3.1 INTRODUCTION
Mutations in genes encoding ion channels are consistently linked with various rhythm disorders such as BS and LQT, while mutations in genes encoding sarcomeric and cytoskeletal proteins are typically associated with contractile dysfunction and HF development. However, mutations in the Na+ channel SCN5A, the K+ channel β-subunit
KCNE1, and the SERCA2a regulatory protein PLN have also been associated with myocardial dysfunction and HF96, 213, 215. Thus, it appears abnormal Ca2+ handling and ion channel function alone can predispose/trigger HF development.
ET-1 is a potent vasoconstrictive peptide that is implicated in the pathogenesis of several cardiovascular diseases such as HF and atherosclerosis239. ET-1 acts in an autocrine or paracrine fashion to cause inflammation, fibrosis, cardiac hypertrophy and electrical remodelling240. ET-1 induces electrical remodelling by modulating repolarizing K+ currents,
Ca2+ currents, gap junctions intracellular communication, and Ca2+ handling proteins59, 220, 223,
228, 230. Our model of conditional cardiac specific over-expression of ET-1 is associated with an inflammatory cardiomyopathy characterized by increased cytokines, LV dilatation, contractile dysfunction, progressive widening of QRS, HF and death following DOX withdrawal34. What is not known is whether ET-1 acts primarily as a cytokine mediating inflammation and fibrosis or as a modulator of ion channel/electrical properties. We posit that this model provides a unique opportunity to assess the role of electrical remodelling in the initiation and progression of HF.
The first objective of this chapter is to describe the temporal progression of the ET-1 induced electrical remodelling by using surface ECG, octapolar mapping, and programmed stimulation to characterize the electrical defects; using epicardial mapping to characterize the
71 progression of electrical remodelling; and using ultrasound biomicroscopy and invasive hemodynamics to characterize the progression of structural and functional remodelling. The second objective of this chapter is to determine if this model can be prevented by inhibition of
ET-1 over-expression by re-introducing DOX at a stage when only electrophysiological abnormalities are manifest.
3.2 MATERIALS & METHODS
3.2.1 Experimental animal. Experiments conformed to protocols approved by the University
Health Network Animal Use and Care Committee and were in accordance with guidelines of the Canadian Council on Animal Care. BT and NBT mice were administered DOX (200 mg/L) in drinking water from conception until weaning (3 wks old). Experiments were conducted in mice withdrawn from DOX for 4 wks (group I), 8 wks (group II), or after 4 wks of DOX removal with DOX re-administered for an additional 4 wks (group III, Fig. 3.1).
Following acquisition of electrophysiological, hemodynamic, ultrasound biomicroscopy, or epicardial mapping data, mice were sacrificed by cervical dislocation. Hearts were excised, rinsed in PBS and snap frozen for RNA/protein extraction for qRT-PCR and western blot analysis, or perfusion-fixed for histopathology and immunohistochemistry.
3.2.2 Surface ECG and intracardiac electrophysiological evaluation. Mice were anesthetized with i.p. Ketamine 100mg/kg (MTC Pharmaceuticals, Cambridge, ON) and
Xylazine 10 mg/kg (Bayer Inc., Etobicoke, ON) and kept on a heating pad to maintain body temperature. Using a dissecting microscope (MZ6 Leica, Heerbrugg, Switzerland), the external jugular vein was isolated, and two ligatures were placed at the distal area of the
72 epicardial mapping, hemodynamics and UBM, histopathology
intra-cardiac and epicardial mapping, 4 wks hemodynamics and UBM, Group I Histopathology\ 4 wks ET-1 on (- DOX)
ET-1 off 8 wks (+ DOX) Group II 8 wks ET-1 on Birth (- DOX)
8 wks Group III 0 wks 4 wks ET-1 on 4 wks ET-1 off (- DOX) (+ DOX)
Weaning epicardial mapping, (3 wks of age) hemodynamics and UBM, histopathology
Figure 3.1. Schematic of experimental design. Mice were kept on DOX from conception until 3 wks of age, then either withdrawn from DOX for 4 wks (Group I), for 8 wks (Group II), or withdrawn from DOX for 4 wks followed by DOX re-administration for an additional 4 wks (Group III). After the treatment periods, terminal experiments (intra-cardiac/epicardial mapping, ultrasound biomicroscopy, or LV invasive hemodynamics) were followed by histopathology.
73 isolated vessel. The vessel was tied off at the proximal ligature and tied down to expose the area between the two ligatures. A small incision was made between the two ligatures of the external jugular vein. A 2-French octapolar electrode catheter (NuMED Inc., Hopkinton, NY) was introduced into the hole, and passed into the right atrium, across the tricuspid valve, and into the right ventricle. The distal ligature was then tied off around the catheter. Surface electrocardiograms (lead II) were simultaneously recorded along with intracardiac electrograms from the 8 electrodes spanning the atrium, His bundle, and ventricle (Fig. 3.2A).
Atrial-His (AH), His-ventricular (HV), RR, PR, QRS, and RV-LV intervals (from the onset of
RV activation in intracardiac electrograms to the end of the QRS complex in the surface ECG) were calculated from these recordings. AV Wenckebach (AVWENK), 2:1 AV block cycle lengths (AV2:1), and AV effective refractory periods (AVERP) were acquired during right atrial pacing. AVWENK was obtained by pacing with 12 decremental atrial driving stimuli, beginning at a cycle length 20 ms less than the RR interval. Decremental pacing was continued until
AV2:1 developed. Next, AVERP was acquired by pacing with 12 atrial driving stimuli, at a cycle length of 20 ms less than RR interval, and adding a 9th decremental stimulus until ventricular activation was blocked. VT/ ventricular fibrillation (VF) induction was examined via right ventricular over-drive pacing and right ventricular pacing with 12 basic stimuli followed by up to 3 extra decremental test steps. Heart weight to body weight ratio (HW/BW) was calculated as a measure of hypertrophy.
3.2.3 Epicardial mapping. Mice were anesthetized with Isoflurane (1.5%) and ventilated with air. Body temperature was maintained by a heating pad. Thoracotomy was performed to enable the application of a flexible 64 micro-electrode array (4x16) with an inter-electrode
74 A BT NBT V V
A H A H
B Genotype HW / BW AH HV PR QRS RV-LV (mg/g) (ms) BT (n=8) 6.40.5 * 62.13.5 ** 13.71.3 79.13.2 ** 17.62.2 ** 16.71.6 ** NBT (n=7) 4.90.2 45.93.8 11.41.1 62.34.7 9.30.4 11.10.8
C Genotype AVWENK AV2:1 AVERP
(ms) BT (n=7) 85.93.0 ** 64.83.2 ** 62.63.8 ** NBT (n=10) 68.12.1 51.91.9 45.12.3
Figure 3.2. Electrophysiological evaluation using intracardiac mapping reveals electrical defects in mice over-expressing ET-1 after 8-10 weeks of transgene induction. (A) Representative His bundle electrograms in BT vs. NBT mice. (B) Baseline conduction intervals, surface electrocardiogram parameters, HW/BW, and RV-LV conduction times in BT vs. NBT mice. (C) AVWENK, AV2:1, and AVERP in BT vs. NBT mice during RA pacing. *=P<0.05, **=P<0.01.
75 spacing of 800 µm on the epicardial surface (Fig. 3.3A). The array was positioned around the heart in 2 orientations (Fig. 3.3B,C). Unipolar electrograms were acquired with custom made software at 5k samples/s per channel, resulting in a time resolution of 0.2 ms, filtered with a high- and low-pass filters of 0.5Hz and 1kHz, and amplified with a gain of 500 using
MEA1060 (Multi Channel Systems, Reutlingen, Germany). The sampling frequency was sufficient to determine local activation time and generate accurate activation maps. Custom made software (designed by Stéphane Massé; Nanthakumar lab) was used to measure atrial- to-ventricular activation time (from onset of right atrial activation to onset of ventricular activation evaluated from one heart beat; Fig. 3.3B); ventricular activation time (from earliest- to-latest ventricular activation evaluated from one heart beat) and ventricular activation with repolarization time (from earliest ventricular activation to latest ventricular repolarization acquired from one heart beat; Fig. 3.3C). Estimates of ventricular repolarization were based on previous studies that found activation recovery intervals (interval between the minimum derivative of the QRS and maximum derivative of the T wave in unipolar electrograms) were related to transmembrane APD241. Matlab (version 2007b) was used to calculate the maximum negative rate of change of voltage in ventricular electrograms from one heart beat (-dV/dt), and to produce isochronal activation maps to illustrate the spread of ventricular activation from earliest-to-latest activation (blue-red) for one heart beat. The moment of local activity was determined as the time at which the electrogram signal increased significantly above background noise.
3.2.4 Invasive LV hemodynamics. As found in section 2.2.3.
76 BT A E NBT 1 2 3 4 5 6 7 8 9 101112131415 ** 1 80 2 3 60 4 40
BC 20 Activation Time (ms) 0 Earliest Atrial-to-Ventricular Earliest Atrial-to-Ventricular RV LV 20 RV LV RV LV ** 15
10 **
BT Ventricular D 5 1 2 3 4 5 6 7 8 9 101112131415
1 Activation Time (ms) 2 0 3 50 4 ** 40 30 ** 20
NBT 10 123456789101112131415 1 Ventricular Activation & Ventricular Activation Repolarisation Time (ms) Repolarisation 0 2 3 100 * ** 4 80
60
40 -dV/dt (V/s) Activation time (ms) 20
0 5 10 15 20 25 I II III Figure 3.3. Temporal progression and prevention of electrical remodeling in mice over- expressing ET-1. Illustration of 4x16 micro-electrode array (A), and placement of array while recording epicardial electrograms (B,C). (D) Ventricular isochronal activation maps in BT vs. NBT mice in group II accompanied by representative epicardial electrograms from micro-electrodes located at 4.5 and 4.14. (E) Earliest atrial-to-ventricular activation time, ventricular activation time, ventricular activation with repolarization time, and -dV/dt measured in sinus rhythm in BT and NBT mice in group I (BT: n=14, NBT: n=24), II (BT: n=21 NBT: n=42), and III (BT: NBT: n=7). *=P<0.05 **=P<0.01. 77 3.2.5 Ultrasound biomicroscopy. A Vevo 770 (VisualSonics Inc., Toronto, ON) ultrasound biomicroscope with a transducer frequency of 30 MHz was used to acquire M-mode and
Doppler recordings in mice anesthetized with 1.5% isoflurane. M-mode was used to evaluate the change in LV diameter between systole and diastole to determine fractional shortening
(FS%). Doppler was used to assess the velocity of blood flow in the main pulmonary artery and aorta, and the ratio between early (E: early diastolic filling) and late (A: atrial contraction) ventricular filling velocity at the mitral valve (LV E/A) and at the tricuspid valve
(RV E/A).
3.2.6 Histopathology. 4µm sections from perfusion-fixed paraffin-embedded hearts at the level of the papillary muscle were stained with Celestin blue for 5min, counterstained in hematoxylin, and stained in Picro-Sirius Red for 30 min to colour all collagen fibres red.
Fibrosis was quantified in three endocardial areas of the LV free wall from each section with
Aperio ImageScope using the v9 algorithm (version 10.2.2.2319; Aperio Technologies) to quantify the area of positively stained pixels. Cardiomyocyte cross-sectional area was measured at the level of the nucleus using Infinity Analyze version 5.0.2 (Lumenera
Corporation, Ottawa, ON) as a measure of cellular hypertrophy.
3.2.7 Statistical analysis. Data are presented as mean + SEM. ANOVA, and t-tests were performed using SPSS version 12.0 (Chicago, IL, USA).
78 3.3 RESULTS
3.3.1 Electrical defects in mice with cardiac-specific ET-1 over-expression. All experimental groups studied and assays undertaken are summarized in Fig. 3.1. To explore the electrophysiological basis for the QRS prolongation noted in our ET-1 over-expression model34, intracardiac mapping with an octapolar catheter via transjugular insertion to the RV was performed in BT and NBT controls 8 wks after withdrawal from DOX at weaning (Fig.
3.2A). Confirming previous findings, PR, QRS, and HW/BW were increased in BT vs. NBT mice (Fig. 3.2B). Invasive His bundle electrograms revealed BT mice have slowed AH conduction, without affecting HV intervals (Fig. 3.2B). Prolonged QRS in BT mice without significant changes in HV conduction were explained by prolonged RV-LV conduction time in BT vs. NBT littermates (Fig. 3.2B). To investigate the basis of prolonged AH times in BT mice, we performed right atrial pacing and determined that AVWENK, AV2:1, and AVERP cycle lengths were prolonged in BT mice (Fig. 3.2C). These data suggest that the extensive AV nodal and inter-ventricular conduction abnormalities are associated with chronic cardiac ET-1 over-expression.
3.3.2 Electrical remodelling is triggered as early as 4 wks after ET-1 over-expression.
Catheter size limitations in our system restrict intracardiac mapping to mice greater than 20 g body weight. As such, this technique was not applicable in younger animals. Instead, a flexible multi-electrode array was wrapped around the heart enabling epicardial mapping and characterization of the progression of specific electrophysiology parameters in ET-1 over- expressing mice as young as 4 wks post weaning (Fig. 3.3). Earliest atrial-to-ventricular activation time, ventricular activation time, ventricular activation and repolarization time,
79 and -dV/dt were studied in sinus rhythm and during pacing. Significant ventricular conduction delays were observed as early as 4 wks post DOX withdrawal (Group I). Both ventricular activation time (9.40.3 vs. 8.30.3 ms, P0.01) and ventricular activation with repolarization time (23.30.8 vs. 17.60.3 ms, P<0.01) were prolonged and -dV/dt was reduced (80.32.5 vs.
89.63.2 V/s, P<0.05) in BT vs. NBT mice in sinus rhythm (Fig. 3.3E) and after pacing for
160 ms (Table 3.1).
Consistent with data obtained from intracardiac catheters, BT mice 8 wks after DOX withdrawal (Group II) manifest more substantive abnormalities. Earliest atrial-to-ventricular activation time (76.87.6 vs. 48.22.0 ms, P<0.01), ventricular activation time (15.51.4 vs.
8.40.3 ms, P<0.01), as well as ventricular activation and repolarization time (37.73.5 vs.
19.30.5 ms, P<0.01) were all prolonged, and -dV/dt (25.24.4 vs. 88.22.7 V/s, P<0.01) was reduced, in BT vs. NBT mice in sinus rhythm (Figs. 3.3D,E) and after pacing for 160 ms
(Table 3.1). Neither VT nor VF was observed in any mice tested. Together, these results suggested that ET-1 mediates a progressive decline in ventricular conduction.
3.3.3 HF develops by 8 weeks after ET-1 over-expression. Ultrasound biomicroscopy and
LV hemodynamics were used to study heart function in mice 4-8 wks post-DOX withdrawal.
SBP, LVSP, dP/dt+, and dP/dt- were assessed by Millar catheters (Table 3.2), while peak velocity of blood flow in the main pulmonary artery and aorta, peak RV and LV E/A ratios and FS% were evaluated by ultrasound biomicroscopy (Table 3.3). No obvious structural/functional differences were observed in BT mice after 4 wks of ET-1 over- expression (Group I). By contrast, and consistent with ‘clinical’ evidence of HF, BT mice exhibited severe structural and functional abnormalities by 8 wks of transgene induction
80 Table 3.1. Temporal progression and prevention of electrical remodelling in mice over- expressing ET-1 during pacing Group I Group II Group III Parameter NBT BT NBT BT NBT BT (n=7) (n=18) (n=9) (n=28) (n=7) (n=7)
V Activation (ms) 27.6±3.2** 19.6±1.3 44.2±13.5* 17.6±0.5 18.0±1.0 18.4±0.8
V Activation & 30.9±1.3** 25.7±0.3 50.6±8.8** 26.6±0.5 26.0±0.9 26.4±1.2 Repolarization (ms)
-dV/dt (V/s) 66.2±3.2* 87.9±5.8 28.3±4.7** 76.6±4.7 105.2±9.1 105.3±8.7
*=P<0.05, **=P<0.01, V= ventricular
81 Table 3.2. Progression and prevention of cardiac structural and functional abnormalities as evaluated by invasive hemodynamics Group I Group II Group III Parameter BT NBT BT NBT BT NBT (n=5) (n=10) (n=6) (n=4) (n=3) (n=4) HW/BW 4.78±0.19 4.91±0.10 8.24±0.66* 5.83±0.23 7.47±0.95 6.50±0.33 (mg/g) SBP 99.6±4.7 91.9±2.1 78.7±1.5** 96.9±3.3 99.7±2.5 107.0±4.7 (mmHg) LVSP 108.6±8.5 94.9±3.2 66.5±7.1* 94.2±2.0 110.6±1.3 110.7±5.2 (mmHg)
+dP/dt (mmHg/s) 2255±170 2572±146 1214±222** 2778±180 2452±128 2548±96
-dP/dt (mmHg/s) 2703±207 2872±145 1578±246** 3198±42 3422±298 3585±183
*=P<0.05, **=P<0.01, HW/BW = heart weight body weight ratio, SBP = arterial systolic blood pressure, LVSP
= LV systolic blood pressure, dP/dt = peak positive and negative first derivatives of the LV pressure
82 Table 3.3. Progression and prevention of cardiac dysfunction as evaluated by ultrasound biomicroscopy Group I Group II Group III Parameter BT NBT BT NBT BT NBT (n=6) (n=6) (n=6) (n=6) (n=4) (n=4) Peak Velocity of Main Pulmonary 702±14 735±41 404±38** 686 ± 68 815±45 742±36 Artery (mm/s) Peak Velocity 945±39 790±70 655±91** 944±35 980±28 1057±82 of Aorta (mm/s)
RV E/A 0.60±0.03 0.67±0.12 6.54±0.97* 0.59±0.02 0.68±0.05 0.68±0.01
LV E/A 1.68±0.09 1.59±0.15 10.77±2.17** 1.55±0.08 2.02±0.23 1.60±0.13
FS% 28.2±0.7 29.4±1.4 14.4±2.4** 27.0±1.7 26.3±1.1 24.8±2.1
*=P<0.05, **=P<0.01, RV = right ventricle, E/A = ratio of peak early to atrial diastolic inflow velocities, FS = fractional shortening
83 (Group II, Tables 3.2,3.3). LV systolic dysfunction was exemplified by reduced systolic BP
(78.71.5 vs. 96.12.4 mmHg, P<0.01), peak velocity of aortic flow (65591 vs. 94334 mm/s, P<0.01), FS% (14.42.4 vs. 27.01.7, P<0.01), and dP/dt+ (1214222 vs. 2728137 mmHg/s, P<0.01) (Tables 3.2,3.3). LV diastolic dysfunction was manifest as reduced dP/dt-
(1578246 vs. 319824 mmHg/s, P<0.01), and elevated peak LV E/A ratio (10.82.2 vs.
1.50.1, P<0.01) (Tables 3.2, 3.3). Significant RV systolic (reduced flow in the main pulmonary artery; 40438 vs. 68668 mm/s, P<0.01) and diastolic dysfunction (elevated peak
RV E/A ratio; 6.51.0 vs. 0.60.0, P<0.01) was also observed (Table 3.3). Consistent with these results, histopathology of heart sections from mice 4, and 8 wks post ET-1 over- expression showed that fibrosis (6.4±0.5 vs. 1.1±0.1 %, P<0.01) and hypertrophy (3793±74 vs.
3540±69 µm2, P<0.01) were present only after 8 wks of ET-1 over-expression (Fig. 3.4; BT: n=223 vs. NBT: n=244 cells).
3.3.4 Inhibiting ET-1 expression at the onset of electrical remodelling prevents progression to HF. To determine if inhibiting synthesis of ET-1 at the onset of ET-1-induced electrical remodelling will be effective in preventing the lethal phenotype, DOX was re- introduced 4 wks after transgene induction and maintained for 4 wks. At the end of this period, epicardial mapping, ultrasound biomicroscopy, hemodynamics, and histopathology were used to evaluate the effects of therapy. Re-introducing DOX at the onset of electrical remodelling completely prevented the development of the electrical, structural and functional decline seen with age-matched BT mice maintained off DOX (Figs. 3.2-3.4, Tables 3.1-3.3). These data suggest that in this unique model, electrical remodelling precedes overt manifestations of HF and that the latter may be prevented by reversal of the former.
84 85 B A mice in groups I-III (n=4-5 per genotype per group).**=P<0.01 in groupsI-III (n=4-5 pergenotype mice picrosirius red-stainedheartsections ( Representative Figure 3.4. Myocardial fibrosis appear III II I
% Fibrosis 0 2 4 6 TNBT BT IIII II I 50 µm s after 8wks of ET-1 over-expression ** A ) and % fibrosis( ) and B ) BTfrom andNBT 50 µm . 3.4 DISCUSSION
Cardiac electrical remodelling has traditionally been considered a consequence of
HF242. Here, we present evidence that cardiac-specific over-expression of the vasoactive agent ET-1 induces a progressive systemic cardiac conduction defect prior to the development of HF. We have shown that as little as 4 wks of ET-1 excess in the heart can trigger slowed ventricular conduction, while the overall structure and contractile function of the heart remains essentially normal. If the ET-1 over-expression is left ‘on’, the scope and severity of the cardiac electrical dysfunction progress and overt HF develops by 8 wks of ET-1 over-expression. Importantly, turning ‘off’ ET-1 over-expression at the onset of electrical remodelling was able to reverse the electrical dysfunction and prevent the development of HF.
Electrical remodelling as a trigger for HF development as yet has not been firmly established. Studies have suggested that left bundle branch block may mediate LV dysfunction242, however, the molecular mechanism is unknown. Gap junction/ion channel remodelling leading to mechanical dysfunction in the heart represents a novel concept in the pathogenesis of HF. As electrical remodelling precedes structural and functional remodelling
(Fig. 3.5), and as these events were reversible by suppressing ET-1 over-expression, our model supports the view that electrical remodelling can contribute to HF. The alternative interpretation is that ET-1 induces electrical remodelling first, and subsequently causes cardiac structural and functional deterioration through an entirely unrelated mechanism. While
ET-1-induced cytokine expression may also play a role in the pathogenesis of HF in our model34, the fact that the molecular changes described here preceded any evidence of contractile dysfunction obtained using highly sensitive measures argues against later-stage inflammation being the only mechanism involved.
86 ET-1 ET-1 ET-1 A ET-1 ET-1 ET-1 ET-1 ET-1 ET-1 ET-1 ET-1 A B ET ET
Ventricular Delay Reduced –dV/dt
B ET-1 ET-1 ET-1 ET-1 ET-1 ET-1 ET-1 ET-1 ET-1 ET-1 ET-1 A B ET ET
Cell hypertrophy Fibrosis Inflammation Hemodynamic & Contractile decline AV delay Ventricular Delay Reduced –dV/dt
Figure 3.5. Model showing effects of 4 vs. 8 wks of ET-1 induction. Electrical remodeling, as seen in Group I mice (A), precedes structural/functional deterioration, as seen in Group II mice (B). 87 Recently, mutations in Scn5a have been described leading to dilated cardiomyopathy with atrial/ventricular arrhythmia and impaired Ca2+ and Na+ homeostasis with mechanical dysfunction213. Additionally, mice expressing a mutant form of Csx/Nkx2.5 under the -MHC promoter develop conduction defects with down-regulation of Cx40/Cx43 and HF243.
Although not emphasized in their report, the sequence of events again suggests that conduction defects develop prior to any structural remodelling.
Acknowledgments: I would like to thank Stéphane Massé (Nanthakumar lab) for providing technical assistance during the epicardial mapping experiments, the Pathology Department at the Hospital for Sick Children for performing the picrosirius red staining, as well as Dr. Abdul
Momen (Husain lab) and Dr. Yu-Qing Zhou (TCP Mouse Imaging Centre) for acquiring the invasive LV hemodynamic and ultrasound biomicroscopy data respectively.
88
CHAPTER 4. REDUCED CONNEXIN-43 AND SODIUM CHANNEL NAV1.5 IS
ASSOCIATED WITH ET-1 INDUCED ELECTRICAL UNCOUPLING
89 4.1 INTRODUCTION
The findings of the previous chapter indicate that our mouse model of ET-1 induced cardiomyopathy has a progressive ventricular conduction delay that precedes structural or
2+ 2+ contractile dysfunction. As ET-1 can modulate Ca currents (ICa-L, ICa-T), Ca handling
+ 59, 219-226, 228-232 proteins (NHE, NCX, IP3R), K currents (IK1, Ito, IKs), and gap junctions (Cx43) , we hypothesized that ET-1 induced conduction disturbances in our model will correlate with remodelled gap junctions and ion channels. Indeed, here we present data revealing that high levels of myocardial ET-1 leads to reduced LV Cx43, Cx40 and Nav1.5 mRNA and protein, and Na+ channel conductance. Tbx2, Tbx3, and Nkx2.5 have been shown to mediate
162, 163 transcriptional repression of Cx43 , while NFκB has been shown to modulate INa and Ito by repressing SCN5A and KChIP2 expression109, 244. As NFκB has previously been shown to be activated in our mouse model34, and can act as a transcriptional repressor109, we posited that NFκB was mediating the ET-1 induced electrical remodelling in our model.
The objectives of this chapter are 1) to determine the potential mechanism(s) of ET-1 induced electrical remodelling via western blot and qRT-PCR for gap junction and ion channels; 2) to confirm the molecular mechanism(s) of ET-1 induced electrical remodelling with an in vitro system; 3) to determine if ET-1 induced NFκB activation is responsible for transcriptional repression of Cx43 and Nav1.5; 4) to determine if this model can be prevented by inhibition of ET-1 over-expression by re-introducing DOX at the onset of ET-1 induced electrical remodelling.
90 4.2 MATERIALS & METHODS
4.2.1 Experimental animals. Experiments were conducted in mice withdrawn from DOX for
4 wks (group I), 8 wks (group II), or after 4 wks of DOX removal with DOX re-administered for an additional 4 wks (group III). Hearts were used for qRT-PCR, western blot, and immunohistochemistry in groups I, II and III, while Na+ channel conductance and ChIP with
NFκB-p50 Ab were evaluated on group I mice (Fig. 4.1A). In vitro validation of ET-1 induced electrical remodelling was assessed in HL-1 cells and neonatal mouse ventricular myocytes (Fig. 4.1B,C).
4.2.2 RNA isolation & quantitative real-time RT-PCR analysis. RNA from the LV was extracted using ice-cold TRIzol reagent (Invitrogen, Burlington, ON), DNased and reverse- transcribed with Superscript III (Invitrogen). cDNA was subjected to real-time PCR using the
ABI Prism 7900 sequence detection system version 2.3 (Applied Biosystems, Streetsville,
ON) with SYBR green. Mouse-specific primers for GAPDH, IL-6, Nav1.5, Cx40, Cx43, Cx45,
Cav1.2, SERCA2a, Kv1.4, Kv1.5, Kv2.1, Kv4.2, KChIP2, and human primers for ET-1 were used 34, 245-247 (Table 4.1). Relative standard calibration curves were generated for each primer set with cDNA produced from one mouse heart. The mRNA level of each gene was normalized to that of GAPDH. All samples for each primer set were run together in duplicates.
4.2.3 Western blotting. LV tissue was homogenized in ice cold 1% SDS, 5 mM EDTA, 1mM
PMSF, 1X protease inhibitor cocktail, and 1X phosphatase inhibitor (Sigma-Aldrich, Oakville,
ON). 20 µg of protein extract was run on 4-12% SDS-PAGE, transferred to PVDF
91 A In vivo Ventricular
qRT-PCR and western blot for Cx43 and Nav1.5, Cx43 and p-Cx43 immunohistochemistry, Na channel conductance and cell capacitance, promoter analysis & ChIP with NFκB Abs
qRT-PCR and western blot for Cx43 and Na 1.5, 4 wks v Group I Cx43 and p-Cx43 immunohistochemistry, 4 wks ET-1 on (- DOX) ET-1 off 8 wks (+ DOX) Group II 8 wks ET-1 on Birth (- DOX) 8 wks Group III 0 wks 4 wks ET-1 on 4 wks ET-1 off (- DOX) (+ DOX)
Weaning qRT-PCR and western blot (3 wks of age) for Cx43 and Nav1.5, Cx43 and p-Cx43 immunohistochemistry, B In vitro Atrial
d0 d0.5 d1.5 d2.5 d3.5
72 hrs ET-1 exposure qRT-PCR and 24 hrs western blot for ET-1 exposure Cx43, optical mapping C In vitro Ventricular d0 d1 d2
24 hrs qRT-PCR for Cx43, Na 1.5, Ca 1.2 ET-1 exposure v v 92 Figure 4.1. Schematic of experimental designs. A. Mice were kept on DOX from conception until 3 wks of age, then either withdrawn from DOX for 4 wks (Group I), for 8 wks (Group II), or withdrawn from DOX for 4 wks followed by DOX re-administration for an additional 4 wks (Group III). Western blot, immunohistochemistry and qRT-PCR for Cx43 and Nav1.5 were performed on LV tissue samples from mice in all groups. Na channel conductance, cell capacitance, promoter analysis, ChIP with NFκB p50 Ab, and qRT-PCR for NFκB binding sites of various promoter sequences were performed in mice in Group I. HL-1 cells (B) or NMVM (C) cultured with ET-1 (10, 100 nM) underwent qRT-PCR and western blot for Cx43 and/or Nav1.5 , and optical mapping.
93 Table 4.1. Real-time PCR Primer Sequences Name Sequence Reference hET-1 pF 5’-GCTCGTCCCTGATGGATAAA-3’ 34 hET-1 pR 5’-CTGTTGCCTTTGTGGGAAGT-3’ 34 GAPDH pF 5’-GCATGGCCTTCCGTGTTC-3’ 34 GAPDH pR 5’-ATGTCATCATACTTGGCAGGTTTC-3’ 34 Cx40 pF 5’-TCGTCCAGAGCCTCACTCCTC-3’ 245 Cx40 pR 5’-GCCAGAGCGTCTGGATTCTTC-3’ 245 Cx43 pF 5’-TTGACTTCAGCCTCCAAGG-3’ 245 Cx43 pR 5’-AATGAAGAGCACCGACAGC-3’ 245 Cx45 pF 5’-CACTTGGAACACACCCTCTGCTC-3’ 245 Cx45 pR 5’-GGGAGGTGTTCCTCGTGGCT-3’ 245 Cav1.2 pF 5’-GAGTACTGCAGTGAGCCCAGCCTGCTC-3’ Cav1.2 pR 5’-GGCAGAGCGAAGGAAACTCCTCTTTGG-3’ IL-6 pF 5’-GAGGATACCACTCCCAACAGACC-3’ 246 IL-6 pR 5’-AAGTGCATCATCGTTGTTCATACA-3’ 246 245 Nav1.5 pF 5’-GAAGAAGCTGGGCTCCAAGA-3’ 245 Nav1.5 pR 5’-CATCGAAGGCCTGCTTGGT-3’ SERCA2a pF 5’-TGAGACGCTCAAGTTTGTGG-3’ 247 SERCA2a pR 5’-ATGCAGAGGGCTGGTAGATG-3’ 247 Kv1.4 pF 5’- TATGCCGAAGCCCGAGAG-3’ Kv1.4 pR 5’- CATGTGCTGTTATTTGTGTGGC-3’ Kv1.5 pF 5’- TTATTCTTATGGCTGACGAGTGCAT-3’ Kv1.5 pR 5’- CCCCCCCAAGACTTCATAATTC-3’ Kv2.1 pF 5’- CACACAGCAATAGCGTTCAACTT-3’ Kv2.1 pR 5’- AGGCGTAGACACAGTTCGGC-3’ Kv4.2 pF 5’- GTGTCGGGAAGCCATAGAGGC-3’ Kv4.2 pR 5’- TTACAAGGCAGACACCCTGA-3’ KChIP2 pF 5’- GGCTGTATCACGAAGGAGGAA-3’ KChIP2 pR 5’- CCGTCCTTGTTTCTGTCCATC-3’
94 membrane, blocked in 5% non-fat dry milk in TBS-T (Tris base, NaCl, 0.1% Tween-20, pH
7.6) for 1 h and incubated overnight at 4oC in TBS-T with 5% BSA containing primary rabbit
Abs against Cx43 and p-Cx43 (Ser368; Cell Signaling, Danvers, MA), Cx45 (Invitrogen),
Cx40 (Millipore, Billerica, MA), Nav1.5 (Sigma-Aldrich), and Cav1.2 (Alomone Laboratories,
Jerusalem, Israel), or a primary mouse Ab against SERCA2a (Novus Biologicals, Littleton,
CO, USA). Immunoreactivity was detected with chemiluminescence (Perkin Elmer,
Woodbridge, ON), using a horseradish-peroxidase-conjugated secondary goat anti-rabbit Ab
(Pierce, Pierce, Nepean, ON) in 5% non-fat dry milk in TBS-T for 30 min. Densitometry was performed using Quantity One (Bio-Rad, Hercules, CA). GAPDH was used as a loading control to normalize protein samples. All samples from each group were run together.
4.2.4 Immunohistochemistry. 4µm sections from perfusion-fixed paraffin-embedded hearts at the level of the papillary muscle underwent antigen retrieval by boiling in 10 mM Na citrate buffer (pH 6.0) for 20 min and blockade of endogenous peroxidase activity with 3% H2O2 for
10 min. Sections were blocked for 1 h in 5% normal goat serum, incubated overnight at 4oC with primary rabbit anti-Cx43 or p-Cx43 Abs (Cell Signalling), and incubated at RT for 30 min each with a biotinylated goat anti-rabbit secondary Ab (Vector Labs, Burlington, ON), and an ABC reagent (Vector labs). Staining, visualized with DAB substrate (Vector labs), was followed by counterstaining with hematoxylin. Ten images from each section were analyzed with Aperio ImageScope software using the v9 algorithm (version 10.2.2.2319; Aperio
Technologies) to quantify the area of positively stained pixels.
95 o 4.2.5 HL-1 cell culture. HL-1 cells were cultured at 37 C with 5% CO2 in Claycomb media
(Sigma-Aldrich; supplemented with 10% FBS, 0.1mM Norepinephrine, 2mM L-Glutamine, and 100U/ml:100μg/ml Penicillin/Streptomycin) on plates coated with fibronectin (12.5μg/ml in 0.02% gelatin). Cells were cultured for 24 or 72 hrs in media supplemented with 0, 10, or
100 nM ET-1 (Sigma-Aldrich). Microscopy was used to confirm contractile activity and optical mapping was used to record electrical activity of the monolayer. Protein from cells was extracted in ice-cold lysis buffer ((mmol/L) 25 Tris pH 7.5, 1 Dithiothreitol, 150 NaCl, 1
PMSF, 1 NaF, 1 Na3VO4, 0.4% NP-40, 0.4% Triton-X-100, 2x complete protease inhibitor cocktail) and stored at -80oC until used in western blotting. RNA was extracted and treated as previously described in section 4.2.2.
4.2.6 Optical mapping. HL-1 cells were pre-loaded with 2.5μM di-ANNEPS 4 (Invitrogen) for 15 min at 37oC, washed and signals recorded in fresh Tyrodes solution. The plate was placed on a heated stage under a microscope fitted to a high speed camera system (Ultima;
BrainVision, Tokyo, Japan). During the acquisition of optical mapping data, the setup was maintained in the dark, a green halogen light (530nm) was shined on the monolayer, and the emitted red fluorescent light (600nm) was recorded from the monolayer through a red filter.
The optical data was digitized with a 14-bit resolution and transformed into pseudo-unipolar electrograms by averaging the pixel intensity over a 5x5 grid. Pseudo-bipolar electrograms were then generated by taking the difference between two pseudo-unipolar electrograms. The spatial resolution of the camera was 6,250 pixels/cm2 (at an optical zoom of 0.6). The mean conduction velocity (CVx, CVy, CVt) was determined with Matlab (version 2007b) and individual experiments were normalized to signal rate and to background (without treatment).
96 4.2.7 Isolation of NMVM. NMVM were isolated from 1-2 day old mice 248. Briefly, mice were decapitated, ventricles quickly excised and minced into 3-4 pieces, washed and incubated in ice-cold digestion solution [(mmol/L) 137 NaCl, 5.36 KCl, 0.81 MgSO4, 5.55
Dextrose, 0.44 KH2PO4, 0.34 Na2HPO4, 20 HEPES, 0.07 CaCl2, 0.02 Gentimicin, 0.02%
Trypsin, pH 7.5] for 15 hours at 4oC with light shaking. The remaining tissue was serially digested at 37oC with light shaking in fresh aliquots of digestion buffer supplemented with
150 μg/ml Collagenase II (Worthington Biochemical Corporation, Lakewood, NJ) in 5 min intervals for 50-60 min. The supernatant was collected and added to FBS, and spun at 4oC for
5 min @ 1000 rpm. To remove fibroblasts, the pellet was resuspended in DMEM/F12
(supplemented with 10% FBS and 100U/ml:100μg/ml Penicillin/Streptomycin), plated in a
o 10cm dish, and incubated at 37 C for 1 h with 5% CO2. The cell suspension was removed,
o counted, plated to 100% confluency and maintained at 37 C with 5% CO2 in DMEM/F12
(supplemented with 10% FBS and 100U/ml:100μg/ml Penicillin/Streptomycin). Contractile activity was monitored with microscopy. RNA from cells exposed to 10 or 100 nM ET-1
(Sigma-Aldrich) for 24 h were extracted and treated as previously described.
4.2.8 Promoter analysis. Transcription factor binding sites within -1000 to +1000 of the transcriptional start site of the Cx43 and Nav1.5 (A and B) promoters were analysed using
MatInspector (Genomatix). Clustal analysis was then used to determine if the transcription factor binding sites were conserved between various species. Primers were designed to target the NFκB binding sites within the Cx43, Nav1.5 (A and B), NFκBIB, Tbx2, Tbx3 and Nkx2.5 promoters (Table 4.2). Binding to the NFκBIB promoter was used as a positive control.
97 Table 4.2. Real-time PCR Primer Sequences-promoters for ChIP for NFkB binding sites Name Sequence Cx43 (1) pF 5’-ACTGCCCGTGGTCATCTCCTG-3’ Cx43 (1) pR 5’-TGTAGTTTCAATGTGCTGACGAGAAGG-3’ Cx43 (2) pF 5’-AAACGCTTTTACGAGGTATCAGCAC-3’ Cx43 (2) pR 5’-AGGAGAGTTCGGGCTCTCAGAC-3’ Cx43 (3) pF 5’-CCGCTGAGAGTGCAACAGGTAAAAG-3’ Cx43 (3) pR 5’-TGGCGACTACAGAAAAGTGAAGTTAGGC-3’ Nav1.5 (1) pF 5’-CCACCTGTCACATTTCCCGTCTTTAG-3’ Nav1.5 (1) pR 5’-GTGCCCAACTGTGTAGACCTCCATC-3’ Nav1.5 (2) pF 5’-AGCCCCCGCAGCCACTATC-3’ Nav1.5 (2) pR 5’-CGCGGCGATCAGAGAGGAC-3’ Nav1.5 (3) pF 5’-CAGATCTGCGAGTGTGCCTTGTC-3’ Nav1.5 (3) pR 5’-CAGAGCGCATAGACACAGGAGGAG-3’ Tbx2 pF 5’-TGTCAATGCTTTGCACTTGG-3’ Tbx2 pR 5’-CTGGAAAGCGCAGAGGAC-3’ Tbx3 pF 5’-CAGCGGGCAGAAAGATTG-3’ Tbx3 pR 5’-GCTCGCGTAGCTCTGAAGG-3’ Nkx2.5 (1) pF 5’-GGTGGCCGAATACCAAATATC-3’ Nkx2.5 (1) pR 5’-GGGCCTCTCTGGCTTTACTC-3’ Nkx2.5 (2) pF 5’-GGAAGAGGTCTGGGATAGGG-3’ Nkx2.5 (2) pR 5’-CTCGCTCGGTTCGATGTTG-3’ NFkBIB pF 5’-CGAGCGAATGTCCACCTC-3’ NFkBIB pR 5’-CAGTGCTTCCGCCCTATC-3’ Tbx = T-box transcription factor, Nkx2.5 = NK2 transcription factor related, locus 5 (cardiac-specific homeobox), NFκBIB = NFκB inhibitor beta
98 4.2.9 ChIP. Frozen tissue was ground finely with a mortar and pestle and fixed with 1% formaldehyde in PBS at RT for 10 min on a rotator. Tissue fixation was stopped with 10X
Glycine. Cells were centrifuged at 1,900 rpm for 5 min at 4oC, washed in PBS (supplemented with 0.5% PMSF) and centrifuged again at 1,900 rpm for 5 min at 4oC. The cells were then resuspended in 1ml ice-cold lysis buffer (supplemented with 0.5% protease inhibitor cocktail and 0.5% PMSF), dounced homogenized 30 times (on ice for 30 s between sets of 10), sonicated for 15 s with a hand-held sonicator to aid in nuclei release, and centrifuged at 5,000 rpm for 10min at 4oC. The nuclear pellet was resuspended in 350μl of shearing buffer
(supplemented with 0.5% protease inhibitor cocktail) and the DNA was sheared by sonicating in a water bath for 40 min (30 s on, 30 s off) at 4oC. The sheared DNA was centrifuged at
15,000 rpm for 12min at 4oC. Shearing efficiency was determined by running phenol chloroform extracted DNA on 2% agarose gel. ChIP reactions were performed with NFκB p50 Ab (Abcam, Cambridge, MA) using the ChIP-IT Express Magnetic Chromatin
Immunoprecipitation Kit (Active Motif, Carsbad, CA). Briefly, immunoprecipitation reactions consisting of 1µg sheared DNA, 25µl of protein-G magnetic beads, 1µl of protease inhibitor cocktail, and 2µg of NFκB p50 Ab were incubated on a rotator for 4 hrs at 4oC. Next, the magnetic beads were washed,the DNA eluted, and cross-links reversed. Then, the samples were heated to 95oC for 15min and incubated with Proteinase K for 1hr at 37oC. The DNA from these samples was then purified using a MinElute Kit and used for quantification of
NFκB binding sites within various promoters using qRT-PCR. Sheared DNA was used as input controls for each primer set for qRT-PCR reactions.
99 4.2.10 Isolation of adult mouse ventricular myocytes. Endo-cardiomyocytes from mice in
Group I were isolated as described previously 249. Briefly, hearts from mice anesthetised with isoflurane were rapidly removed and retrogradely perfused with Ca2+ free Tyrode’s solution
[(mmol/L) 137 NaCl, 5.4 KCl, 1.0 MgCl2, 0.33 NaH2PO4, 10 D-glucose, 10 HEPES, pH 7.4] at 37ºC through the aorta for 3-4 min, then perfused with 1.0 mg/mL Collagenase II
(Worthington Biochemical Corporation, Lakewood, NJ) for 10-12 min. A thin layer of endocardium was removed from the left ventricular fee wall, dissociated and stored in Krebs- bicarbonate solution at 4ºC [(mmol/L) 120 potassium glutamate, 20 KCl, 20 HEPES, 1.0
MgCl2, 10 D-glucose, 0.5 K-EGTA, and 0.1% bovine serum albumin].
4.2.11 Patch clamp recordings. Isolated myocytes were voltage-clamped by Dr. Jie Liu
(Backx lab) with patch pipettes (1.3-2.3 MΩ) filled with (mmol/L) 1 CaCl2, 135 CsCl, 5 NaCl,
1 MgCl2, 4 MgATP, 10 HEPES, and 10 EGTA (pH 7.2) and superfused with solution containing (mmol/L) 2.5 NaCl, 130 CsCl, 1 MgCl2, 1 CaCl2, 5 HEPES, and 10 D-glucose (pH
7.35), supplemented with 10µM Nifedipine to block L-type Ca2+ channel and 40 µM NiCl to block T-type Ca2+ channel. Serial resistance and cell capacitance were compensated by 90%.
The recording protocol consisted of 50ms test steps from –80 mV to +50 mV in increments of
10 mV. Data were analyzed with Clampfit 9. Na+ current I-V curve were plotted and fit with the following function in which Vm is membrane potential, Vrev is Na current reversal
+ potential, Gmax is whole cell Na channel conductance, Vhalf is Na channel half activation voltage, k is slope:
Y=(Vm - Vrev) * Gmax * (-1 / (1 + exp((Vm - Vhalf) / k)) + 1)
100 4.2.12 Statistical analysis. Data are presented as mean±SE. Comparisons between BT vs.
NBT in groups I, II, or III and between cells exposed to varying amounts of ET-1(HL-1 or
NMVM) were done by Student’s t-tests using SPSS v12 (SPSS, Chicago, IL).
4.3 RESULTS
4.3.1 ET-1 mediated electrical remodelling correlates with reduced Cx43, p-Cx43, Cx40,
+ Nav1.5, and Na channel conductance. To define the molecular basis for ET-1 induced electrical remodelling, we examined the mRNA/protein expression levels of genes involved in action potential generation and propagation through the myocardium (Table 4.3, Fig. 4.2).
Western blot analysis revealed that total Cx43 protein, p-Cx43 to total Cx43 protein ratio, and
Cx40 protein was reduced by 93%, 69%, and 36% respectively in BT vs. NBT mice as early as 4 wks post ET-1 over-expression (Group I, Figs. 4.2D,E,F,H). qRT-PCR showed that high levels of hET-1 (transgene) mRNA expression also correlated with significantly reduced mRNA levels of Cav1.2 (72%), Cx40 (63%), Cx43 (64%) and Nav1.5 (30%) by 4 wks of transgene induction (Group I, Table 4.3). At 8 wks of ET-1 over-expression, Cav1.2, Cx40,
Cx43, Cx45 and Nav1.5 mRNA expression were reduced by 72%, 69%, 88%, 61%, and 64% respectively (Group II, Table 4.3), with the p-Cx43 to total Cx43 protein ratio, Cav1.2, Cx40, and Nav1.5 protein levels being 54%, 69%, 54%, and 71% lower in BT vs. NBT mice (Group
II, Figs. 4.2B,D,E-H). Development of HF also correlated with increased IL-6 mRNA expression, reduced Cx45 mRNA expression with no appreciable difference at the protein level, and reduced SERCA2a mRNA and protein expression (Table 4.3, Figs. 4.2A,C,H).
101 Table 4.3. Progression and prevention of molecular remodelling as evaluated by LV mRNA expression levels Group I Group II Group III Parameter BT NBT BT NBT BT NBT (n=7) (n=8) (n=6) (n=7) (n=7) (n=8) 160±36** 48±13** hET-1 1.00±0.58 2.35±1.06 1849±776* 2.91±1.00 (x103) (x103)
IL-6 1.89±0.52 1.00±0.27 12.17±1.79** 2.35±0.47 2.62±0.55 1.25±0.56
SERCA2a 0.32±0.08* 1.00±0.22 0.10±0.02** 0.52±0.12 0.69±0.12 0.94±0.13
Cav1.2 0.28±0.10** 1.00±0.16 0.20±0.01** 0.70±0.05 0.73±0.06 0.78±0.05
Cx40 0.63±0.11 1.00±0.18 0.48±0.08** 1.03±0.12 0.59±0.09 0.75±0.07
Cx45 0.73±0.20 1.00±0.14 0.38±0.09** 0.99±0.16 0.63±0.03 0.73±0.06
Cx43 0.36±0.15* 1.00±0.22 0.13±0.02** 1.01±0.13 0.77±0.14 1.02±0.17
Nav1.5 0.70±0.09** 1.00±0.05 0.36±0.05** 1.00±0.03 0.91±0.09 1.09±0.07
*=P<0.05, **=P<0.01
102 103 *=P<0.05, **=P<0.01. blots ( ( induction. Figure4.2. ReducedLV Cx43andNa C B A D E
), p-Cx43/TotalCx43 ( Cx40 Cx45 Cav1.2 SERCA2a 0.0 0.5 1.0 1.5 2.0 2.5 3.0 0.0 0.2 0.4 0.6 0.8 1.0 0.0 0.5 1.0 1.5 2.0 2.5 3.0 0.0 0.2 0.4 0.6 0.8 1.0 1.2 H ) of LV ofBT andNBTwithin mice ** Densitometry analysis ofSERCA2a( Densitometry IIII II I F ** * * ), andNa v 1.5 ( ** v 1.5 expression in mice as early as 4wks after1.5 expressionET-1as early inmice G ) protein expression, and representative western ) proteinexpression,andrepresentative groups I,II,andIII(BT:NBT:n=4-6). SERCA2a G F E H Ca Na p-Cx43 A Nav1.5 Cx43 Cx40 Cx45 ), Ca 0.0 0.2 0.4 0.6 0.8 1.0 v
v phospho-Cx43/ Total-Cx43 Cx43 1.2 0 1 2 3 4 0 1 2 3 4 1.5 v 1.2 ( TNBT BT ** * IIII II I B IIII II I ), Cx45 ( ), Cx45 NBT TNBT BT C * * ), Cx40( D BT ), Cx43 ** NBT BT Immunohistochemistry was performed to explore the nature of disordered Cx43 expression. In agreement with Western blot data, Cx43 and p-Cx43 staining were greatly reduced in BT mice after only 4 wks of ET-1 over-expression as compared to NBT controls
(Cx43: 3.7±0.3 vs. 9.9±1.1 %, P<0.01; p-Cx43: 2.2±0.3 vs. 7. 8±0.6 %, P<0.01) and further reduced after 8 wks of ET-1 over-expression (Cx43: 0.2±0.0 vs. 7.9±0.2 %, P<0.01; p-Cx43:
0.2±0.0 vs. 6.3±0.3 %, P<0.01) (Figs. 4.3,4.4). Furthermore, improper localization (i.e. lateralization) of Cx43 and p-Cx43 was observed in BT mice at the earliest stage (4 wks,
Group I), which became most severe with more prolonged ET-1 over-expression (8 wks,
Group II) (Figs. 4.3A,4.4A).
+ To determine the functional consequence of reduced Nav1.5 expression, Na current was recorded in LV myocytes isolated from mice 4 wks post DOX withdrawal (Group I). Na+ channel conductance was reduced (0.17±0.01 vs. 0.21±0.01 s, P<0.05) with no difference in cell capacitance (133.94±8.50 vs. 126.50±7.37 pF, P=NS) in BT (n=18) vs. NBT (n=24) (Fig.
4.5).
To explore the molecular determinants of ET-1 induced delay in repolarization time seen in Group I mice (Fig. 3.3E), we examined the mRNA expression of several K+ channels that play a role in action potential repolarization (Kv4.2, Kv2.1, Kv1.4, Kv1.5, KChIP2;
+ Appendix 2). The K channels involved in Ito (Kv4.2, KChIP2) were reduced in BT vs. NBT mice (Appendix 2).
104 105 per genotype per group).**=P<0.01. per genotype heart sections( C and lateralized reduced expression caused Cx43. Figure4.3. ProlongedET-1 over-expression lead B A Four weeks ofET-1 over-expression led to III II I A
) and % of Cx43 staining( % of Cx43 staining 10 0 2 4 6 8 TNBT BT ** IIII II I 50 µm B x43 staining. Representative Cx43 stainingof x43 staining.Representative ) in BT andNBTgroups from mice I-III (n=2-4 ** reducedCx43staining,while8wksofover- s toprogressiveof loss andlateralization ** NBT BT 50 µm BT NBT A I
50 µm 50 µm II
III
** BT B 8 ** NBT 6
4
2 % p-Cx43 p-Cx43 staining %
0 I II III
Figure 4.4. Prolonged ET-1 over-expression lead to progressive loss and lateralization of p-Cx43. Diminished cardiac p-Cx43 staining after 4-8 wks of ET-1 over-expression and complete miss-localization of p-Cx43 staining after 8 wks of transgene expression. Representative p-Cx43 staining of hearts sections (A) and % of p-Cx43 staining (B) in BT and NBT mice from groups I-III (n=2-5 per genotype per group) **=P<0.01. 106 107 LV myocytesisolated from BT (n=18) conductance ( withdrawal.post DOX Figure 4.5. Na B + ), andNa channel conductancereduced inLV m C B A ( + CURTESY OFLAB BACKX current elicited from a 50 ms test step from -80 to-40mVtest stepfroma 50msfrom current elicited ( Na channel conductance (s) Cell Capacitance (pF) 0.00 0.05 0.10 0.15 0.20 0.25
Current (pA/pF) 100 120 140 20 40 60 80 -4 -3 -2 -1 0 0 vs . NBT (n=24) mice in groupI.*=P<0.05, . NBT**=P<0.01 (n=24) mice * ** ) Cell capacitance ( ) Cellcapacitance yocytes isolatedfrom mice4wks NBT BT A ), Na + channel C ) of 4.3.2 In vitro validation of ET-1 induced electrical remodelling. To confirm our in vivo experiments, HL-1 cells, a mouse atrial cell line, were treated for 24 or 72 hrs with ET-1 (10 or 100 nM) and assessed by western blotting, qRT-PCR, and optical mapping. Application of exogenous ET-1 (10 or 100 nM) had no effect on Cx43 mRNA, protein, p-Cx43/total Cx43 protein expression, or conduction velocity (Fig. 4.6, 4.7). As our in vivo electrical remodelling data supports a ventricular phenotype and HL-1 cells are derived from left atrial cells, we next evaluated whether ET-1 over-expression in the left atria of Group I mice also correlated with remodeled Cx43 and Nav1.5 (Fig. 4.8). Unlike LV tissue, high levels of hET-1 did not correspond with reduced levels of Cx43 or Nav1.5 (Fig. 4.8). Therefore, exogenous ET-1 application may not have led to remodeled Cx43/Nav1.5 and associated reductions in conduction velocity in HL-1 cells as atrial cells may respond differently to chronically high levels ET-1 as opposed to ventricular cells. Also, indirect factors involved in ET-1 induced electrical remodelling may be missing from the in vitro milieu.
Next, NMVM were used to confirm the ability of ET-1 to reduce Cx43 levels. Indeed,
24 hrs of exogenous ET-1 (10 and 100 nM) caused reduced Cx43 mRNA expression in neonatal mouse ventricular myocytes in vitro (Fig. 4.9A). However, 100 nM ET-1 caused increased levels of Nav1.5 and Cav1.2 mRNA expression (Figs. 4.9B,C). This in vitro ventricular phenotype may differ to the in vivo ventricular phenotype as the duration of ET-1 treatment was severally limited by the lifespan of healthy contractile NMVM.
4.3.3 ET-1 induced reductions in Cx43 and Nav1.5 may be induced by NFκB. To access the role of transcription factors in transcriptional repression of Cx43 and Nav1.5, potential
108 109 protein ( protein expression inHL-1cells. Figure4.6. ET-1 treatment hadnoeffecton C B A
p-Cx43/ Total Cx43 Cx43 Cx43 mRNA C 0.0 0.2 0.4 0.6 0.8 1.0 1.2 1.4 0.0 0.5 1.0 1.5 2.0 2.5 3.0 0.0 0.5 1.0 1.5 2.0 ) levelsafter24or72hrs ofET-1 24 hrs 72 hrs 72 24 hrs 4hs72hrs 24 hrs 4hs72hrs 24 hrs Cx43 mRNA ( (10 or100nM)exposure inHL-1cells. Cx43mRNA,protein, or p-Cx43/ Total Cx43 A ), protein ( ), protein B ), and p-Cx43/ ), andTotalCx43 110 Figure4.7. ET-1 treatment hadnoeffecton ( tracing ofHL-1cellsculturedwithoutET-1.optical mapping Representative CV D C B A C ), and CV ), and CVt CVy CVx 0.000 0.002 0.004 0.006 0.008 0.000 0.002 0.004 0.006 0.008 0.000 0.002 0.004 0.006 0.008 t ( D ) treated withET-1 (10 or 4hs72hrs 24 hrs 4hs72hrs 24 hrs 24 hrs 72 hrs 72 24 hrs 100nM)for24or72hrs. conductionvelocityinHL-1cells. A x ( B ), Cv . y 111 from left atrial tissue from mice in Group I. **=P<0.01 Cx43 or Na Figure4.8. Fourweeks ofET-1 transgeneinduc v 1.5 mRNA expression. C B A
hET-1 mRNA Na 1.5 mRNA Cx43 mRNA 10 12 14 16 18 v 10 12 14 0 2 4 6 8 0 2 4 6 8 0 2 4 6 8 Cx43 ( A ), Na ** tion had noaffectlevelsofleftatrial v 1.5 ( B ), andhET-1 ( C NBT BT ) mRNAexpression 112 (n=5 pergroup).*=P<0.05, **=P<0.01 100 nM)onexpressionlevels ofCx43( Figure4.9. ET-1 reduces Cx43levels inNMVM. C B A
Cav1.2 mRNA Nav1.5 mRNA Cx43 mRNA 0.0 0.2 0.4 0.6 0.8 1.0 1.2 0.0 0.2 0.4 0.6 0.8 1.0 1.2 0.0 0.2 0.4 0.6 0.8 1.0 1.2 1.4 A ) Na * v 1.5 ( * ** * B Effectsof 24hET-1 exposure(10,or ) andCa v 1.2 ( C ) mRNAin NMVMs 100 nM 10 nM 0 nM transcription factor binding sites within the core promoters of Cx43 and Nav1.5 were evaluated with Genomatix-MatInspector. The Cx43 promoter contains 4 NFκB, 2 Tbx, and 4
Nkx2.5 binding sites (Appendix 3). The Nav1.5 has two promoter regions, one contains 3
NFκB, 1 Tbx, and 1 Nkx2.5 binding sites, while the other contains 1 NFκB, 5 Tbx, and 4
Nkx2.5 binding sites (Appendix 4). The potential transcription factor binding sites were located in highly conserved areas (confirmed in 10 species using Clustal). As we previously showed NFκB is activated in this mouse model and several NFκB binding sites are present in both the Cx43 and Nav1.5 promoters, we used ChIP with NFκBp50 Ab to quantify the binding of NFκB to sites within the Cx43 and Nav1.5 promoters using qRT-PCR. As a control, we examined NFκB binding to NFκBIB. Indeed, NFκB preferentially bound to sites within in the
NFκBIB promoter (Appendix 5). Interestingly, we also found that NFκB preferentially bound to sites within the Cx43, and Nav1.5 promoters (Figs. 4.10). Also, as we previously found a 16 fold increase in Tbx2 in mice over-expressing ET-1 and found NFκB binding sites in the promoters of Tbx2, Tbx3, and Nkx2.5, we proceeded to quantify NFκB binding to sites within these promoters (Appendices 6-8). We found NFκB preferentially bound to a site within the
Tbx2 promoter (Appendix 6), however, NFκB did not preferentially bind to sites within the
Tbx3 or Nkx2.5 promoters (Appendices 7-8). It appears NFκB may directly mediate the ET-1 induced transcriptional repression of Cx43 and Nav1.5, or indirectly via Tbx2.
4.4 DISCUSSION
Our study has shown that as little as 4 wks of ET-1 excess in the heart can trigger
+ reduced Cx43 and Nav1.5 expression, reduced Na channel conductance, and slow
113 114 A B LV tissue from BT vs. NBT mice from Group I. sites within theCx43( intheLV ofET-1 over-expressingpromoters mice. Figure 4.10. NF Nav1.5 Promoter A Cx43 Promoter st 1st NF B binding site 1 NFB binding site 100 120 10 20 30 40 20 40 60 80 0 0 κ B p50 preferentiallyB binds to siteswithin theCx43andNa A ) and Na ) and
v Nav1.5 Promoter A Cx43 Promoter 1.5 ( nd 2nd NF B binding site 2 NFB binding site 100 120 140 160 100 150 200 250 20 40 60 80 50 0 0 B ) promoters from a ChIPa from) promoters NF using an qRT-PCR results for theNF
Nav1.5 Promoter B Cx43 Promoter 3rd NF B binding site NF B binding site 2000 4000 6000 8000
100 150 200 250 50 0 0 κ B p50 on Ab v 1.5 κ B binding NBT BT ventricular conduction, while the overall structure and contractile function of the heart remain essentially normal. The cardiac voltage-gated sodium channel Nav1.5 and the dominant gap junction channel in the working ventricular myocardium Cx43 are the key determinants of electrical impulse propagation250. Our study suggests that cardiac over-expression of ET-1 leads to impaired conduction via NFκB p50 mediated Cx43 and Nav1.5 remodelling (Fig.
4.11). Although a recent in vitro study found that ET-1 led to increased levels of Cx43 protein in neonatal rat ventricular myocytes, they, like us, also found reduced intensity and expression of Cx43 associated with reduced conduction velocity230. In astrocytes, ET-1 causes reduced
Cx43 expression and gap-junctional intercellular communication associated with activated
231 ETB receptors . Also, a study recently showed that a loss of Cx43 protein in rabbit LV myocytes similar to that shown in our model (40-70%) was associated with markedly reduced cell coupling251.
In addition, studies have shown that TNFα, NHE1, and activated c-Src may be linked with impaired Cx43 activity. TNFα has been shown to reduce Cx43 promoter activity in a rat myoblast cell line252, NHE1 was shown to negatively regulate Cx43 expression through a
JNK1/2 dependent pathway in neonatal rat ventricular myocytes253, and activated c-Src has been shown to reduce gap-junctional intercellular communication via tyrosine phosphorylation of Cx43254. In human ovarian carcinoma cells, ET-1 mediated gap junction uncoupling and reduced Cx43 expression is linked with increased tyrosine phosphorylation by
229 255 c-Src via activated ETAR . As ET-1 stimulates TNFα in macrophages and activates
115 116 reduced levelsofCx43/Na transcription ofCx43and Na Na Figure 4.11. Model illustrating mechanim(s) ↓ Cx43-p v ↓ 1.5 after4 wks ofET-1 over-expression. Cx43 ET-1 ET-1 ET-1 ↓ Na v 1.5 and electrical uncoupling. 1.5 andelectrical v ET-1 v 1.5 andincreasestranscription 1.5 ( ↓ I Na ET-1 )
ETA ET-1 ET-1NF mediated of ET-1 inducedreductions ofCx43and ET-1 NF κ ET-1 of Tbx2, ultimately leading to leading ultimately of Tbx2, B ET-1 κ B activation inhibits B activation ETB Na ↓ K Cx43,Cx40, v v 4.2, KChIP2 ET-1 ET-1 1.5, Ca v 1.2, ET-1 the NHE159 and c-Src256 in neonatal rat ventricular myocytes, it is possible that TNFα, NHE1 or c-Src mediate the gap junction remodelling observed in our ET-1 over-expressing mice.
Cx43 is normally located at the intercalated disk in a multi-protein complex with
N-cadherin and Nav1.5 in ventricular myocytes, presumably working in collaboration for effective electrical coupling between cardiomyocytes. However, in human and animal models of HF, Cx43 mRNA and protein expression is reduced, and Cx43 dephosphorylation and lateralization are increased204. Unlike the reduced Cx43 levels seen in human HF, changes in
Cx45 levels that accompany HF have been inconsistent 205, 217. Purkinje fibers isolated from a canine model of ventricular tachy-pacing induced HF exhibited delayed His-Purkinje conduction, decreased mRNA and protein expression of Nav1.5 and Cx43, reduced Cx43 phosphorylation, and increased lateralization of Cx43218. Studies have shown the association of Cx43 with zonula occludens-1 is increased in human HF216 and Cx43 lateralization and subsequent loss of Cxs from the intercalated disk is linked with increased association of zonula occludens-1 with activated c-Src257. However, in these studies, changes in Cx43 expression and localization were observed after HF developed. Indeed, we believe the current study represents the first report of how these changes in Cx43 localization can precede HF, and how their reversal may prevent progression to HF. However, down-regulation of Cx43 alone may be insufficient to cause HF as mice with cardiac-restricted deletion of Cx43 develop impaired ventricular conduction, spontaneous arrhythmias, and sudden cardiac death, but not overt HF169. Taken together, these data lead us to propose that electrical remodelling leading to HF require both reduced expression and/or phosphorylation of Cx43 as well as impaired Nav1.5 function at the intercalated disk.
117 Na+ channel α and β subunits are localized to t-tubules and the intercalated disk.
Nav1.5 channels located at the intercalated disk are thought to play a key role in propagation of the action potential between cells, whereas Na+ channels in t-tubules are involved in linking depolarization of the cell membrane with contraction. Interestingly, only tyrosine
258 phophorylated β1-subunits are found with Nav1.5 at the intercalated disk , and normal functioning Nav1.5 requires dystrophin at the intercalated disk as dystrophin-deficient mice
259 have severely compromised levels of Nav1.5 expression and increased QRS duration . HF is also associated with reduced INa, downregulation of native Nav1.5 mRNA, an upregulation of
195 2 non-functional C-terminal splice variants, and reduced Nav1.5 protein . Mutations in
Scn5a gene have been linked with impaired conduction and are associated with Lenègre disease, the Brugada syndrome, and LQT260. Indeed, SCN5A+/- mice develop impaired conduction, fibrosis, and diminished and disturbed distribution of Cx43111. A link between
ET-1 over-expression and Nav1.5 downregulation was hypothesized based on our knowledge of ET-1 acting via NFκB-mediated transcription61, and a report of NFκB p50 binding to and repressing activity of the SCN5a promoter109. Our study provides additional support that
NFκB p50 mediates ion channel remodelling by transcriptional repression of SCN5a. In addition, our study suggests that NFκB p50 acts as novel mediator of gap junction remodeling through transcriptional repression of Cx43.
In conclusion, our study suggests that in the heart, ET-1 leads to impaired ventricular conduction via NFκB p50 mediated gap junction/ion channel remodelling. The sequence and reversibility of this cardiomyopathy phenotype suggests that a primary abnormality in electrophysiology may trigger subsequent ventricular dysfunction and may represent a therapeutic target in HF. This conceptual paradigm deserves closer examination in human HF,
118 particularly in conditions where early ‘electrical’ interventions may be tested for their ability to prevent the progression to, or possibly even reverse, the manifestations of ventricular dysfunction.
Acknowledgments: I would like to thank Stéphane Massé for providing technical assistance during the optical mapping experiments, Dr. Jie Liu (Backx Lab) for isolating the adult mouse ventricular myocytes and acquiring the patch-clamp recordings, Talat Afroze (Husain Lab) for supplying the Cav1.2 primers, and Dr. Kyoung-Han Kim (Backx Lab) for supplying the Kv1.4,
Kv1.5, Kv2.1 Kv4.2 and KChIP2 primers.
119
CHAPTER 5. SUMMARY AND FUTURE DIRECTIONS
120 5.1 SUMMARY AND CONCLUSIONS
In this thesis, we aimed to 1) describe the temporal progression of the ET-1 induced electrical remodeling, 2) determine the molecular mechanism(s) leading to ET-1 induced electrical remodeling, and 3) determine if this cardiomyopathic phenotype can be prevented by inhibiting ET-1 over-expression. We hypothesized that 1) inhibition of ET-1 synthesis using the ECE inhibitor CGS-26303 will effectively prevent the ET-1 induced cardiomyopathy, 2) ET-1 induces electrical remodeling by disruption of Connexin-43 and
Nav1.5, via NFκB transcriptional repression, and 3) this model will be reversible by the cessation of ET-1 over-expression at the onset of electrical remodelling.
Serial evaluation of mice with chronic cardiac over-expression of ET-1 revealed that electrical remodelling precedes structural and functional remodelling. ET-1 induced electrical remodelling manifests initially (4 wks post transgene induction) as a ventricular phenotype, mediating prolonged ventricular activation and reduced ventricular conduction. At the molecular level, the electrical remodelling is associated with abnormal gap junctions and ion channels, exemplified by reduced p-Cx43, Cx43 mRNA and protein, Nav1.5 mRNA and
+ protein, Na channel conductance, Kv4.2 and KChIP2 mRNA, as well as NFκB p50 preferentially binding to Cx43 and Nav1.5 promoters. Connecting abnormal clinical electrophysiological phenotypes with underlying molecular mediators may be beneficial for identifying targets for individual therapeutic strategies.
Persistent transgene induction (8 wks) eventually triggers biventricular systolic and diastolic dysfunction, myocardial fibrosis, cardiomyocyte hypertrophy, prolonged ventricular activation and repolarization, reduced ventricular conduction, and abnormal AV nodal function. Inhibiting continued ET-1 over-expression at the onset of electrical remodelling
121 reversed the ventricular conduction delay and associated molecular mediators as well as prevented the development of structural and functional remodelling. The sequence and reversibility of this phenotype provides further evidence that a primary abnormality in electrical remodelling may contribute to the pathogenesis of HF. Identifying the molecular mediators that contribute to HF initiation and progression may facilitate early detection and prevention of clinical HF.
Dual ECE/NEP inhibition with CGS-26303 (5 mg/kg/day) failed to improve survival, or preserve hemodynamic and contractile integrity in this model. Our data suggest that high levels of bigET-1, as seen in HF, may trigger increased ECE activity and/or non-ECE ET-1 synthesis, thus circumventing the efficacy of ECE blockade. Although negative, these results provide further information of the use ECE/NEP inhibition with CGS 26303 in conditions of chronic ET-1 expression. Preventing ET-1 production at an early stage may be more effective than ECE blockade, namely to evade the potential deleterious effects of bigET-1 accumulation as well as the synthesis of mature ET-1 from non-ECE proteases.
5.2 FUTURE DIRECTIONS
5.2.1 ET-1 and atrial electrical remodelling
In our model, ET-1 initially triggers a ventricular phenotype characterized by impaired conduction and gap junction/ ion channel remodelling. The ET-1 induced atrial electrical phenotype characterized by prolonged AH and AV conduction develops post structural and functional remodelling. The reason for this differential atrial response is unknown, however,
Cx43 remodelling is not apparent in left atrial tissue samples from Group I mice or in HL-1 cells. Similarly, Cx43-/-, Cx43+/-, and cardiac specific Cx43-/- mice develop ventricular
122 conduction delays and arrhythmias with no discernable atrial phenotype. It would be beneficial to determine whether atrial myocytes lack NFκB p50 activation, and thus deficient transcriptional repression of gap junctions and ion channels. Ascertaining the mechanism(s) that underlie the ET-1 induced AV nodal conduction delay by examining the ionic currents and expression of gap junctions and ion channels in AV nodal cells isolated from Group II mice would be useful.
5.2.2 ET-1 and K+/Ca2+ channel remodelling
Preliminary investigation revealed 4 weeks of ET-1 over-expression in Group I mice led to reduced LV Kv4.2 and KChIP2 mRNA (Apendix 2). Additional characterization of
ET-1 induced K+ channel remodelling at the protein level is required to determine if the reduction at the mRNA level translates into reductions at the protein level. As Kv4.2 and
KChIP2 are the main molecular determinants of Ito, and recent studies have shown that Ito and
INa are functionally and structurally coupled via an interaction between Navβ1 and Kv4α
131 subunits , and KChIP2 has been shown to modulate ICa-L through binding to Cav1.2, evaluating Ito, ICa-L, and INa-L, in ventricular myocytes isolated from Group I mice may be informative. A recent study suggests that in cardiac disease, NFκB modulates reduced Ito via down-regulation of KChIP2244. As NFκB is activated in our mouse model and may be responsible for ET-1 induced repression of Cx43 and Nav1.5 expression, evaluating whether
NFκB plays a role in down-regulating Kv4.2 and KChIP2 expression in Group I mice would be useful. Furthermore, preliminary promoter analysis with MatInspector showed that both the
Kv4.2 promoter and KChIP2 promoter contains an NFκB binding site.
123 5.2.3 Role of NFκB p50 in ET-1 induced gap junction/ion channel remodelling
109 NFκB p50 mediates transcriptional repression of Nav1.5 and contributes to ET-1 induced electrical remodelling in our model by participating in the transcription repression of
Cx43 and Nav1.5. Thus, evaluating whether NFκB p50 inhibition could prevent ET-1 induced electrical remodelling and/or HF development could provide valuable insight. Inhibiting
NFκB p50 in our model can be accomplished via administration of an NFκB p50 inhibitor peptide that inhibits the nuclear translocation of NFκB p50261. Conversely, investigating the effects of increased NFκB p50 in NMVM on ionic currents (Ito, INa) and expression of Cx43,
Nav1.5, Kv4.2 and KChIP2 would be beneficial.
5.2.4 Polymorphisms in ET-1 signaling components
Given our observation that ET-1 plays a role in electrical remodelling and the pathophysiology of HF, it may be useful to determine if polymorphisms in the key genes involved in ET-1 signaling (preproET-1, ECE-1, ETA, and ETB) are associated with familial cardiomyopathy and or inherited arrhythmias. If polymorphisms in these genes are found to correlate with familial conditions of these sorts, further investigations into the functional relevance of ET-1 signaling may be indicated. For example, attempts to modify ETA/B receptor activation with commercially available agents may be considered in these otherwise untreatable and typically progressive conditions.
124 REFERENCES
1. Jessup M, Abraham WT, Casey DE, Feldman AM, Francis GS, Ganiats TG, et al. 2009 focused update: ACCF/AHA Guidelines for the Diagnosis and Management of Heart Failure in Adults: a report of the American College of Cardiology Foundation/American Heart Association Task Force on Practice Guidelines: developed in collaboration with the International Society for Heart and Lung Transplantation. Circulation 2009;119:1977-2016.
2. Levick SP, Melendez GC, Plante E, McLarty JL, Brower GL, Janicki JS. Cardiac mast cells: the centrepiece in adverse myocardial remodelling. Cardiovasc Res 2011;89:12- 19.
3. Stewart JA, Jr., Wei CC, Brower GL, Rynders PE, Hankes GH, Dillon AR, et al. Cardiac mast cell- and chymase-mediated matrix metalloproteinase activity and left ventricular remodeling in mitral regurgitation in the dog. J Mol Cell Cardiol 2003;35:311-319.
4. Deswal A, Petersen NJ, Feldman AM, Young JB, White BG, Mann DL. Cytokines and cytokine receptors in advanced heart failure: an analysis of the cytokine database from the Vesnarinone trial (VEST). Circulation 2001;103:2055-2059.
5. Mann DL. Inflammatory mediators and the failing heart: past, present, and the foreseeable future. Circ Res 2002;91:988-998.
6. Yanagisawa M, Kurihara H, Kimura S, Tomobe Y, Kobayashi M, Mitsui Y, et al. A novel potent vasoconstrictor peptide produced by vascular endothelial cells. Nature 1988;332:411-415.
7. Roubert P, Viossat I, Lonchampt MO, Chapelat M, Schulz J, Plas P, et al. Endothelin receptor regulation by endothelin synthesis in vascular smooth muscle cells: effects of dexamethasone and phosphoramidon. J Vasc Res 1993;30:139-144.
8. Suzuki T, Kumazaki T, Mitsui Y. Endothelin-1 is produced and secreted by neonatal rat cardiac myocytes in vitro. Biochem Biophys Res Commun 1993;191:823-830.
9. Castro MG, Rodriguez-Pascual F, Magan-Marchal N, Reguero JR, Alonso-Montes C, Moris C, et al. Screening of the endothelin1 gene (EDN1) in a cohort of patients with essential left ventricular hypertrophy. Ann Hum Genet 2007;71:601-610.
10. Zhu G, Carlsen K, Carlsen KH, Lenney W, Silverman M, Whyte MK, et al. Polymorphisms in the endothelin-1 (EDN1) are associated with asthma in two populations. Genes Immun 2008;9:23-29.
11. Inoue A, Yanagisawa M, Takuwa Y, Mitsui Y, Kobayashi M, Masaki T. The human preproendothelin-1 gene. Complete nucleotide sequence and regulation of expression. J Biol Chem 1989;264:14954-14959.
125 12. Mawji IA, Robb GB, Tai SC, Marsden PA. Role of the 3'-untranslated region of human endothelin-1 in vascular endothelial cells. Contribution to transcript lability and the cellular heat shock response. J Biol Chem 2004;279:8655-8667.
13. Vallender TW, Lahn BT. Localized methylation in the key regulator gene endothelin-1 is associated with cell type-specific transcriptional silencing. FEBS Lett 2006;580:4560-4566.
14. Stow LR, Gumz ML, Lynch IJ, Greenlee MM, Rudin A, Cain BD, et al. Aldosterone modulates steroid receptor binding to the endothelin-1 gene (edn1). J Biol Chem 2009;284:30087-30096.
15. Yeligar S, Tsukamoto H, Kalra VK. Ethanol-induced expression of ET-1 and ET-BR in liver sinusoidal endothelial cells and human endothelial cells involves hypoxia- inducible factor-1alpha and microrNA-199. J Immunol 2009;183:5232-5243.
16. D'Orleans-Juste P, Plante M, Honore JC, Carrier E, Labonte J. Synthesis and degradation of endothelin-1. Can J Physiol Pharmacol 2003;81:503-510.
17. Honore JC, Plante M, Bkaily G, Rae GA, D'Orleans-Juste P. Pressor and pulmonary responses to ET-1(1-31) in guinea-pigs. Br J Pharmacol 2002;136:819-828.
18. Takuwa Y, Kasuya Y, Takuwa N, Kudo M, Yanagisawa M, Goto K, et al. Endothelin receptor is coupled to phospholipase C via a pertussis toxin-insensitive guanine nucleotide-binding regulatory protein in vascular smooth muscle cells. J Clin Invest 1990;85:653-658.
19. Eguchi S, Hirata Y, Imai T, Marumo F. Endothelin receptor subtypes are coupled to adenylate cyclase via different guanyl nucleotide-binding proteins in vasculature. Endocrinology 1993;132:524-529.
20. Kawanabe Y, Okamoto Y, Hashimoto N, Masaki T. Molecular mechanisms for activation of voltage-independent Ca2+ channels by endothelin-1/endothelin-A receptors. J Cardiovasc Pharmacol 2004;44 Suppl 1:S219-223.
21. Eguchi S, Hirata Y, Marumo F. Endothelin subtype B receptors are coupled to adenylate cyclase via inhibitory G protein in cultured bovine endothelial cells. J Cardiovasc Pharmacol 1993;22 Suppl 8:S161-163.
22. Masaki T, Miwa S, Sawamura T, Ninomiya H, Okamoto Y. Subcellular mechanisms of endothelin action in vascular system. Eur J Pharmacol 1999;375:133-138.
23. Gohla A, Offermanns S, Wilkie TM, Schultz G. Differential involvement of Galpha12 and Galpha13 in receptor-mediated stress fiber formation. J Biol Chem 1999;274:17901-17907.
126 24. Kurihara Y, Kurihara H, Suzuki H, Kodama T, Maemura K, Nagai R, et al. Elevated blood pressure and craniofacial abnormalities in mice deficient in endothelin-1. Nature 1994;368:703-710.
25. Kurihara Y, Kurihara H, Oda H, Maemura K, Nagai R, Ishikawa T, et al. Aortic arch malformations and ventricular septal defect in mice deficient in endothelin-1. J Clin Invest 1995;96:293-300.
26. Kurihara Y, Kurihara H, Maemura K, Kuwaki T, Kumada M, Yazaki Y. Impaired development of the thyroid and thymus in endothelin-1 knockout mice. J Cardiovasc Pharmacol 1995;26 Suppl 3:S13-16.
27. Zhao XS, Pan W, Bekeredjian R, Shohet RV. Endogenous endothelin-1 is required for cardiomyocyte survival in vivo. Circulation 2006;114:830-837.
28. Shohet RV, Kisanuki YY, Zhao XS, Siddiquee Z, Franco F, Yanagisawa M. Mice with cardiomyocyte-specific disruption of the endothelin-1 gene are resistant to hyperthyroid cardiac hypertrophy. Proc Natl Acad Sci U S A 2004;101:2088-2093.
29. Clouthier DE, Hosoda K, Richardson JA, Williams SC, Yanagisawa H, Kuwaki T, et al. Cranial and cardiac neural crest defects in endothelin-A receptor-deficient mice. Development 1998;125:813-824.
30. Hocher B, Thone-Reineke C, Rohmeiss P, Schmager F, Slowinski T, Burst V, et al. Endothelin-1 transgenic mice develop glomerulosclerosis, interstitial fibrosis, and renal cysts but not hypertension. J Clin Invest 1997;99:1380-1389.
31. Hocher B, Schwarz A, Fagan KA, Thone-Reineke C, El-Hag K, Kusserow H, et al. Pulmonary fibrosis and chronic lung inflammation in ET-1 transgenic mice. Am J Respir Cell Mol Biol 2000;23:19-26.
32. Hocher B, Liefeldt L, Thone-Reineke C, Orzechowski HD, Distler A, Bauer C, et al. Characterization of the renal phenotype of transgenic rats expressing the human endothelin-2 gene. Hypertension 1996;28:196-201.
33. Amiri F, Virdis A, Neves MF, Iglarz M, Seidah NG, Touyz RM, et al. Endothelium- restricted overexpression of human endothelin-1 causes vascular remodeling and endothelial dysfunction. Circulation 2004;110:2233-2240.
34. Yang LL, Gros R, Kabir MG, Sadi A, Gotlieb AI, Husain M, et al. Conditional cardiac overexpression of endothelin-1 induces inflammation and dilated cardiomyopathy in mice. Circulation 2004;109:255-261.
35. Baynash AG, Hosoda K, Giaid A, Richardson JA, Emoto N, Hammer RE, et al. Interaction of endothelin-3 with endothelin-B receptor is essential for development of epidermal melanocytes and enteric neurons. Cell 1994;79:1277-1285.
127 36. Bagnall AJ, Kelland NF, Gulliver-Sloan F, Davenport AP, Gray GA, Yanagisawa M, et al. Deletion of endothelial cell endothelin B receptors does not affect blood pressure or sensitivity to salt. Hypertension 2006;48:286-293.
37. Yanagisawa H, Yanagisawa M, Kapur RP, Richardson JA, Williams SC, Clouthier DE, et al. Dual genetic pathways of endothelin-mediated intercellular signaling revealed by targeted disruption of endothelin converting enzyme-1 gene. Development 1998;125:825-836.
38. Yanagisawa H, Hammer RE, Richardson JA, Emoto N, Williams SC, Takeda S, et al. Disruption of ECE-1 and ECE-2 reveals a role for endothelin-converting enzyme-2 in murine cardiac development. J Clin Invest 2000;105:1373-1382.
39. Hafstrom I, Ringertz B, Lundeberg T, Palmblad J. The effect of endothelin, neuropeptide Y, calcitonin gene-related peptide and substance P on neutrophil functions. Acta Physiol Scand 1993;148:341-346.
40. Halim A, Kanayama N, el Maradny E, Maehara K, Terao T. Activated neutrophil by endothelin-1 caused tissue damage in human umbilical cord. Thromb Res 1995;77:321-327.
41. Uchida Y, Ninomiya H, Sakamoto T, Lee JY, Endo T, Nomura A, et al. ET-1 released histamine from guinea pig pulmonary but not peritoneal mast cells. Biochem Biophys Res Commun 1992;189:1196-1201.
42. Zhang JS, Tan YR, Xiang Y, Luo ZQ, Qin XQ. Regulatory peptides modulate adhesion of polymorphonuclear leukocytes to bronchial epithelial cells through regulation of interleukins, ICAM-1 and NF-kappaB/IkappaB. Acta Biochim Biophys Sin (Shanghai) 2006;38:119-128.
43. Browatzki M, Schmidt J, Kubler W, Kranzhofer R. Endothelin-1 induces interleukin-6 release via activation of the transcription factor NF-kappaB in human vascular smooth muscle cells. Basic Res Cardiol 2000;95:98-105.
44. McMillen MA, Huribal M, Cunningham ME, Kumar R, Sumpio BE. Endothelin-1 increases intracellular calcium in human monocytes and causes production of interleukin-6. Crit Care Med 1995;23:34-40.
45. Browatzki M, Pfeiffer CA, Schmidt J, Kranzhofer R. Endothelin-1 induces CD40 but not IL-6 in human monocytes via the proinflammatory transcription factor NF-kappaB. Eur J Med Res 2005;10:197-201.
46. Gonsalves C, Kalra VK. Endothelin-1-induced macrophage inflammatory protein- 1beta expression in monocytic cells involves hypoxia-inducible factor-1alpha and AP- 1 and is negatively regulated by microRNA-195. J Immunol 2010;185:6253-6264.
128 47. Marini M, Carpi S, Bellini A, Patalano F, Mattoli S. Endothelin-1 induces increased fibronectin expression in human bronchial epithelial cells. Biochem Biophys Res Commun 1996;220:896-899.
48. Rizvi MA, Katwa L, Spadone DP, Myers PR. The effects of endothelin-1 on collagen type I and type III synthesis in cultured porcine coronary artery vascular smooth muscle cells. J Mol Cell Cardiol 1996;28:243-252.
49. Peacock AJ, Dawes KE, Shock A, Gray AJ, Reeves JT, Laurent GJ. Endothelin-1 and endothelin-3 induce chemotaxis and replication of pulmonary artery fibroblasts. Am J Respir Cell Mol Biol 1992;7:492-499.
50. Shi-Wen X, Denton CP, Dashwood MR, Holmes AM, Bou-Gharios G, Pearson JD, et al. Fibroblast matrix gene expression and connective tissue remodeling: role of endothelin-1. J Invest Dermatol 2001;116:417-425.
51. Hafizi S, Wharton J, Chester AH, Yacoub MH. Profibrotic effects of endothelin-1 via the ETA receptor in cultured human cardiac fibroblasts. Cell Physiol Biochem 2004;14:285-292.
52. Freund C, Schmidt-Ullrich R, Baurand A, Dunger S, Schneider W, Loser P, et al. Requirement of nuclear factor-kappaB in angiotensin II- and isoproterenol-induced cardiac hypertrophy in vivo. Circulation 2005;111:2319-2325.
53. Frantz S, Fraccarollo D, Wagner H, Behr TM, Jung P, Angermann CE, et al. Sustained activation of nuclear factor kappa B and activator protein 1 in chronic heart failure. Cardiovasc Res 2003;57:749-756.
54. Hamid T, Guo SZ, Kingery JR, Xiang X, Dawn B, Prabhu SD. Cardiomyocyte NF- kappaB p65 promotes adverse remodelling, apoptosis, and endoplasmic reticulum stress in heart failure. Cardiovasc Res 2011;89:129-138.
55. Kawamura N, Kubota T, Kawano S, Monden Y, Feldman AM, Tsutsui H, et al. Blockade of NF-kappaB improves cardiac function and survival without affecting inflammation in TNF-alpha-induced cardiomyopathy. Cardiovasc Res 2005;66:520- 529.
56. Frantz S, Hu K, Bayer B, Gerondakis S, Strotmann J, Adamek A, et al. Absence of NF-kappaB subunit p50 improves heart failure after myocardial infarction. FASEB J 2006;20:1918-1920.
57. Shi-Wen X, Chen Y, Denton CP, Eastwood M, Renzoni EA, Bou-Gharios G, et al. Endothelin-1 promotes myofibroblast induction through the ETA receptor via a rac/phosphoinositide 3-kinase/Akt-dependent pathway and is essential for the enhanced contractile phenotype of fibrotic fibroblasts. Mol Biol Cell 2004;15:2707- 2719.
129 58. Jain R, Shaul PW, Borok Z, Willis BC. Endothelin-1 induces alveolar epithelial- mesenchymal transition through endothelin type A receptor-mediated production of TGF-beta1. Am J Respir Cell Mol Biol 2007;37:38-47.
59. Dulce RA, Hurtado C, Ennis IL, Garciarena CD, Alvarez MC, Caldiz C, et al. Endothelin-1 induced hypertrophic effect in neonatal rat cardiomyocytes: involvement of Na+/H+ and Na+/Ca2+ exchangers. J Mol Cell Cardiol 2006;41:807-815.
60. Higazi DR, Fearnley CJ, Drawnel FM, Talasila A, Corps EM, Ritter O, et al. Endothelin-1-stimulated InsP3-induced Ca2+ release is a nexus for hypertrophic signaling in cardiac myocytes. Mol Cell 2009;33:472-482.
61. Hirotani S, Otsu K, Nishida K, Higuchi Y, Morita T, Nakayama H, et al. Involvement of nuclear factor-kappaB and apoptosis signal-regulating kinase 1 in G-protein- coupled receptor agonist-induced cardiomyocyte hypertrophy. Circulation 2002;105:509-515.
62. Liang F, Lu S, Gardner DG. Endothelin-dependent and -independent components of strain-activated brain natriuretic peptide gene transcription require extracellular signal regulated kinase and p38 mitogen-activated protein kinase. Hypertension 2000;35:188- 192.
63. Komati H, Maharsy W, Beauregard J, Hayek S, Nemer M. ZFP260 is an inducer of cardiac hypertrophy and a nuclear mediator of endothelin-1 signaling. J Biol Chem 2011;286:1508-1516.
64. Pieske B, Beyermann B, Breu V, Loffler BM, Schlotthauer K, Maier LS, et al. Functional effects of endothelin and regulation of endothelin receptors in isolated human nonfailing and failing myocardium. Circulation 1999;99:1802-1809.
65. Kobayashi T, Miyauchi T, Sakai S, Kobayashi M, Yamaguchi I, Goto K, et al. Expression of endothelin-1, ETA and ETB receptors, and ECE and distribution of endothelin-1 in failing rat heart. Am J Physiol 1999;276:H1197-1206.
66. Wei CM, Lerman A, Rodeheffer RJ, McGregor CG, Brandt RR, Wright S, et al. Endothelin in human congestive heart failure. Circulation 1994;89:1580-1586.
67. Margulies KB, Hildebrand FL, Jr., Lerman A, Perrella MA, Burnett JC, Jr. Increased endothelin in experimental heart failure. Circulation 1990;82:2226-2230.
68. Arai M, Yoguchi A, Iso T, Takahashi T, Imai S, Murata K, et al. Endothelin-1 and its binding sites are upregulated in pressure overload cardiac hypertrophy. Am J Physiol 1995;268:H2084-2091.
69. Zolk O, Quattek J, Sitzler G, Schrader T, Nickenig G, Schnabel P, et al. Expression of endothelin-1, endothelin-converting enzyme, and endothelin receptors in chronic heart failure. Circulation 1999;99:2118-2123.
130 70. Pacher R, Stanek B, Hulsmann M, Koller-Strametz J, Berger R, Schuller M, et al. Prognostic impact of big endothelin-1 plasma concentrations compared with invasive hemodynamic evaluation in severe heart failure. J Am Coll Cardiol 1996;27:633-641.
71. Iwanaga Y, Kihara Y, Inagaki K, Onozawa Y, Yoneda T, Kataoka K, et al. Differential effects of angiotensin II versus endothelin-1 inhibitions in hypertrophic left ventricular myocardium during transition to heart failure. Circulation 2001;104:606-612.
72. Mulder P, Richard V, Derumeaux G, Hogie M, Henry JP, Lallemand F, et al. Role of endogenous endothelin in chronic heart failure: effect of long-term treatment with an endothelin antagonist on survival, hemodynamics, and cardiac remodeling. Circulation 1997;96:1976-1982.
73. Mulder P, Boujedaini H, Richard V, Henry JP, Renet S, Munter K, et al. Long-term survival and hemodynamics after endothelin-a receptor antagonism and angiotensin- converting enzyme inhibition in rats with chronic heart failure: monotherapy versus combination therapy. Circulation 2002;106:1159-1164.
74. Cowburn PJ, Cleland JG, McArthur JD, MacLean MR, McMurray JJ, Dargie HJ. Short-term haemodynamic effects of BQ-123, a selective endothelin ET(A)-receptor antagonist, in chronic heart failure. Lancet 1998;352:201-202.
75. Kiowski W, Sutsch G, Hunziker P, Muller P, Kim J, Oechslin E, et al. Evidence for endothelin-1-mediated vasoconstriction in severe chronic heart failure. Lancet 1995;346:732-736.
76. Spieker LE, Mitrovic V, Noll G, Pacher R, Schulze MR, Muntwyler J, et al. Acute hemodynamic and neurohumoral effects of selective ET(A) receptor blockade in patients with congestive heart failure. ET 003 Investigators. J Am Coll Cardiol 2000;35:1745-1752.
77. Torre-Amione G, Young JB, Colucci WS, Lewis BS, Pratt C, Cotter G, et al. Hemodynamic and clinical effects of tezosentan, an intravenous dual endothelin receptor antagonist, in patients hospitalized for acute decompensated heart failure. J Am Coll Cardiol 2003;42:140-147.
78. Teerlink JR, McMurray JJ, Bourge RC, Cleland JG, Cotter G, Jondeau G, et al. Tezosentan in patients with acute heart failure: design of the Value of Endothelin Receptor Inhibition with Tezosentan in Acute heart failure Study (VERITAS). Am Heart J 2005;150:46-53.
79. Mylona P, Cleland JG. Update of REACH-1 and MERIT-HF clinical trials in heart failure. Cardio.net Editorial Team. Eur J Heart Fail 1999;1:197-200.
80. Kalra PR, Moon JC, Coats AJ. Do results of the ENABLE (Endothelin Antagonist Bosentan for Lowering Cardiac Events in Heart Failure) study spell the end for non- selective endothelin antagonism in heart failure? Int J Cardiol 2002;85:195-197.
131 81. Anand I, McMurray J, Cohn JN, Konstam MA, Notter T, Quitzau K, et al. Long-term effects of darusentan on left-ventricular remodelling and clinical outcomes in the EndothelinA Receptor Antagonist Trial in Heart Failure (EARTH): randomised, double-blind, placebo-controlled trial. Lancet 2004;364:347-354.
82. Mellin V, Jeng AY, Monteil C, Renet S, Henry JP, Thuillez C, et al. Triple ACE-ECE- NEP inhibition in heart failure: a comparison with ACE and dual ECE-NEP inhibition. J Cardiovasc Pharmacol 2005;46:390-397.
83. Mulder P, Barbier S, Monteil C, Jeng AY, Henry JP, Renet S, et al. Sustained improvement of cardiac function and prevention of cardiac remodeling after long-term dual ECE-NEP inhibition in rats with congestive heart failure. J Cardiovasc Pharmacol 2004;43:489-494.
84. Emoto N, Raharjo SB, Isaka D, Masuda S, Adiarto S, Jeng AY, et al. Dual ECE/NEP inhibition on cardiac and neurohumoral function during the transition from hypertrophy to heart failure in rats. Hypertension 2005;45:1145-1152.
85. Tabrizchi R. SLV-306. Solvay. Curr Opin Investig Drugs 2003;4:329-332.
86. Wada A, Tsutamoto T, Ohnishi M, Sawaki M, Fukai D, Maeda Y, et al. Effects of a specific endothelin-converting enzyme inhibitor on cardiac, renal, and neurohumoral functions in congestive heart failure: comparison of effects with those of endothelin A receptor antagonism. Circulation 1999;99:570-577.
87. Fleischer S, Ogunbunmi EM, Dixon MC, Fleer EA. Localization of Ca2+ release channels with ryanodine in junctional terminal cisternae of sarcoplasmic reticulum of fast skeletal muscle. Proc Natl Acad Sci U S A 1985;82:7256-7259.
88. Pessah IN, Waterhouse AL, Casida JE. The calcium-ryanodine receptor complex of skeletal and cardiac muscle. Biochem Biophys Res Commun 1985;128:449-456.
89. Marks AR, Marx SO, Reiken S. Regulation of ryanodine receptors via macromolecular complexes: a novel role for leucine/isoleucine zippers. Trends Cardiovasc Med 2002;12:166-170.
90. Korzick DH. Regulation of cardiac excitation-contraction coupling: a cellular update. Adv Physiol Educ 2003;27:192-200.
91. Priori SG, Napolitano C, Tiso N, Memmi M, Vignati G, Bloise R, et al. Mutations in the cardiac ryanodine receptor gene (hRyR2) underlie catecholaminergic polymorphic ventricular tachycardia. Circulation 2001;103:196-200.
92. Lytton J. Na+/Ca2+ exchangers: three mammalian gene families control Ca2+ transport. Biochem J 2007;406:365-382.
93. Tada M. Calcium cycling proteins of the cardiac sarcoplasmic reticulum. Circ J 2003;67:729-737.
132 94. Frank KF, Bolck B, Erdmann E, Schwinger RH. Sarcoplasmic reticulum Ca2+- ATPase modulates cardiac contraction and relaxation. Cardiovasc Res 2003;57:20-27.
95. Posch MG, Perrot A, Geier C, Boldt LH, Schmidt G, Lehmkuhl HB, et al. Genetic deletion of arginine 14 in phospholamban causes dilated cardiomyopathy with attenuated electrocardiographic R amplitudes. Heart Rhythm 2009;6:480-486.
96. Schmitt JP, Kamisago M, Asahi M, Li GH, Ahmad F, Mende U, et al. Dilated cardiomyopathy and heart failure caused by a mutation in phospholamban. Science 2003;299:1410-1413.
97. Haghighi K, Kolokathis F, Gramolini AO, Waggoner JR, Pater L, Lynch RA, et al. A mutation in the human phospholamban gene, deleting arginine 14, results in lethal, hereditary cardiomyopathy. Proc Natl Acad Sci U S A 2006;103:1388-1393.
98. Qu Y, Boutjdir M. Gene expression of SERCA2a and L- and T-type Ca channels during human heart development. Pediatr Res 2001;50:569-574.
99. Martinez ML, Heredia MP, Delgado C. Expression of T-type Ca(2+) channels in ventricular cells from hypertrophied rat hearts. J Mol Cell Cardiol 1999;31:1617-1625.
100. Thomsen MB, Wang C, Ozgen N, Wang HG, Rosen MR, Pitt GS. Accessory subunit KChIP2 modulates the cardiac L-type calcium current. Circ Res 2009;104:1382-1389.
101. Antzelevitch C, Pollevick GD, Cordeiro JM, Casis O, Sanguinetti MC, Aizawa Y, et al. Loss-of-function mutations in the cardiac calcium channel underlie a new clinical entity characterized by ST-segment elevation, short QT intervals, and sudden cardiac death. Circulation 2007;115:442-449.
102. Cordeiro JM, Marieb M, Pfeiffer R, Calloe K, Burashnikov E, Antzelevitch C. Accelerated inactivation of the L-type calcium current due to a mutation in CACNB2b underlies Brugada syndrome. J Mol Cell Cardiol 2009;46:695-703.
103. Splawski I, Timothy KW, Decher N, Kumar P, Sachse FB, Beggs AH, et al. Severe arrhythmia disorder caused by cardiac L-type calcium channel mutations. Proc Natl Acad Sci U S A 2005;102:8089-8096; discussion 8086-8088.
104. Facer P, Punjabi PP, Abrari A, Kaba RA, Severs NJ, Chambers J, et al. Localisation of SCN10A gene product Na(v)1.8 and novel pain-related ion channels in human heart. Int Heart J 2011;52:146-152.
105. Haufe V, Chamberland C, Dumaine R. The promiscuous nature of the cardiac sodium current. J Mol Cell Cardiol 2007;42:469-477.
106. Maier SK, Westenbroek RE, Schenkman KA, Feigl EO, Scheuer T, Catterall WA. An unexpected role for brain-type sodium channels in coupling of cell surface depolarization to contraction in the heart. Proc Natl Acad Sci U S A 2002;99:4073- 4078.
133 107. Maier SK, Westenbroek RE, Yamanushi TT, Dobrzynski H, Boyett MR, Catterall WA, et al. An unexpected requirement for brain-type sodium channels for control of heart rate in the mouse sinoatrial node. Proc Natl Acad Sci U S A 2003;100:3507-3512.
108. Chambers JC, Zhao J, Terracciano CM, Bezzina CR, Zhang W, Kaba R, et al. Genetic variation in SCN10A influences cardiac conduction. Nat Genet 2010;42:149-152.
109. Shang LL, Sanyal S, Pfahnl AE, Jiao Z, Allen J, Liu H, et al. NF-kappaB-dependent transcriptional regulation of the cardiac scn5a sodium channel by angiotensin II. Am J Physiol Cell Physiol 2008;294:C372-379.
110. Papadatos GA, Wallerstein PM, Head CE, Ratcliff R, Brady PA, Benndorf K, et al. Slowed conduction and ventricular tachycardia after targeted disruption of the cardiac sodium channel gene Scn5a. Proc Natl Acad Sci U S A 2002;99:6210-6215.
111. van Veen TA, Stein M, Royer A, Le Quang K, Charpentier F, Colledge WH, et al. Impaired impulse propagation in Scn5a-knockout mice: combined contribution of excitability, connexin expression, and tissue architecture in relation to aging. Circulation 2005;112:1927-1935.
112. Wang Q, Shen J, Splawski I, Atkinson D, Li Z, Robinson JL, et al. SCN5A mutations associated with an inherited cardiac arrhythmia, long QT syndrome. Cell 1995;80:805- 811.
113. Chen Q, Kirsch GE, Zhang D, Brugada R, Brugada J, Brugada P, et al. Genetic basis and molecular mechanism for idiopathic ventricular fibrillation. Nature 1998;392:293- 296.
114. Tan HL, Bink-Boelkens MT, Bezzina CR, Viswanathan PC, Beaufort-Krol GC, van Tintelen PJ, et al. A sodium-channel mutation causes isolated cardiac conduction disease. Nature 2001;409:1043-1047.
115. Schott JJ, Alshinawi C, Kyndt F, Probst V, Hoorntje TM, Hulsbeek M, et al. Cardiac conduction defects associate with mutations in SCN5A. Nat Genet 1999;23:20-21.
116. Wang DW, Viswanathan PC, Balser JR, George AL, Jr., Benson DW. Clinical, genetic, and biophysical characterization of SCN5A mutations associated with atrioventricular conduction block. Circulation 2002;105:341-346.
117. Wang DW, Desai RR, Crotti L, Arnestad M, Insolia R, Pedrazzini M, et al. Cardiac sodium channel dysfunction in sudden infant death syndrome. Circulation 2007;115:368-376.
118. Benson DW, Wang DW, Dyment M, Knilans TK, Fish FA, Strieper MJ, et al. Congenital sick sinus syndrome caused by recessive mutations in the cardiac sodium channel gene (SCN5A). J Clin Invest 2003;112:1019-1028.
134 119. Darbar D, Kannankeril PJ, Donahue BS, Kucera G, Stubblefield T, Haines JL, et al. Cardiac sodium channel (SCN5A) variants associated with atrial fibrillation. Circulation 2008;117:1927-1935.
120. McNair WP, Ku L, Taylor MR, Fain PR, Dao D, Wolfel E, et al. SCN5A mutation associated with dilated cardiomyopathy, conduction disorder, and arrhythmia. Circulation 2004;110:2163-2167.
121. Vatta M, Ackerman MJ, Ye B, Makielski JC, Ughanze EE, Taylor EW, et al. Mutant caveolin-3 induces persistent late sodium current and is associated with long-QT syndrome. Circulation 2006;114:2104-2112.
122. Cronk LB, Ye B, Kaku T, Tester DJ, Vatta M, Makielski JC, et al. Novel mechanism for sudden infant death syndrome: persistent late sodium current secondary to mutations in caveolin-3. Heart Rhythm 2007;4:161-166.
123. Ueda K, Valdivia C, Medeiros-Domingo A, Tester DJ, Vatta M, Farrugia G, et al. Syntrophin mutation associated with long QT syndrome through activation of the nNOS-SCN5A macromolecular complex. Proc Natl Acad Sci U S A 2008;105:9355- 9360.
124. Wu G, Ai T, Kim JJ, Mohapatra B, Xi Y, Li Z, et al. alpha-1-syntrophin mutation and the long-QT syndrome: a disease of sodium channel disruption. Circ Arrhythm Electrophysiol 2008;1:193-201.
125. Watanabe H, Koopmann TT, Le Scouarnec S, Yang T, Ingram CR, Schott JJ, et al. Sodium channel beta1 subunit mutations associated with Brugada syndrome and cardiac conduction disease in humans. J Clin Invest 2008;118:2260-2268.
126. Watanabe H, Darbar D, Kaiser DW, Jiramongkolchai K, Chopra S, Donahue BS, et al. Mutations in sodium channel beta1- and beta2-subunits associated with atrial fibrillation. Circ Arrhythm Electrophysiol 2009;2:268-275.
127. Hu D, Barajas-Martinez H, Burashnikov E, Springer M, Wu Y, Varro A, et al. A mutation in the beta 3 subunit of the cardiac sodium channel associated with Brugada ECG phenotype. Circ Cardiovasc Genet 2009;2:270-278.
128. Medeiros-Domingo A, Kaku T, Tester DJ, Iturralde-Torres P, Itty A, Ye B, et al. SCN4B-encoded sodium channel beta4 subunit in congenital long-QT syndrome. Circulation 2007;116:134-142.
129. Guo W, Jung WE, Marionneau C, Aimond F, Xu H, Yamada KA, et al. Targeted deletion of Kv4.2 eliminates I(to,f) and results in electrical and molecular remodeling, with no evidence of ventricular hypertrophy or myocardial dysfunction. Circ Res 2005;97:1342-1350.
135 130. Kuo HC, Cheng CF, Clark RB, Lin JJ, Lin JL, Hoshijima M, et al. A defect in the Kv channel-interacting protein 2 (KChIP2) gene leads to a complete loss of I(to) and confers susceptibility to ventricular tachycardia. Cell 2001;107:801-813.
131. Deschenes I, Armoundas AA, Jones SP, Tomaselli GF. Post-transcriptional gene silencing of KChIP2 and Navbeta1 in neonatal rat cardiac myocytes reveals a functional association between Na and Ito currents. J Mol Cell Cardiol 2008;45:336- 346.
132. Lu Z, Abe J, Taunton J, Lu Y, Shishido T, McClain C, et al. Reactive oxygen species- induced activation of p90 ribosomal S6 kinase prolongs cardiac repolarization through inhibiting outward K+ channel activity. Circ Res 2008;103:269-278.
133. Gomes P, Saito T, Del Corsso C, Alioua A, Eghbali M, Toro L, et al. Identification of a functional interaction between Kv4.3 channels and c-Src tyrosine kinase. Biochim Biophys Acta 2008;1783:1884-1892.
134. Ruiz-Gomez A, Mellstrom B, Tornero D, Morato E, Savignac M, Holguin H, et al. G protein-coupled receptor kinase 2-mediated phosphorylation of downstream regulatory element antagonist modulator regulates membrane trafficking of Kv4.2 potassium channel. J Biol Chem 2007;282:1205-1215.
135. Niwa N, Nerbonne JM. Molecular determinants of cardiac transient outward potassium current (I(to)) expression and regulation. J Mol Cell Cardiol 2010;48:12-25.
136. Delpon E, Cordeiro JM, Nunez L, Thomsen PE, Guerchicoff A, Pollevick GD, et al. Functional effects of KCNE3 mutation and its role in the development of Brugada syndrome. Circ Arrhythm Electrophysiol 2008;1:209-218.
137. Lai LP, Su MJ, Yeh HM, Lin JL, Chiang FT, Hwang JJ, et al. Association of the human minK gene 38G allele with atrial fibrillation: evidence of possible genetic control on the pathogenesis of atrial fibrillation. Am Heart J 2002;144:485-490.
138. Splawski I, Tristani-Firouzi M, Lehmann MH, Sanguinetti MC, Keating MT. Mutations in the hminK gene cause long QT syndrome and suppress IKs function. Nat Genet 1997;17:338-340.
139. Yang Y, Xia M, Jin Q, Bendahhou S, Shi J, Chen Y, et al. Identification of a KCNE2 gain-of-function mutation in patients with familial atrial fibrillation. Am J Hum Genet 2004;75:899-905.
140. Ehrlich JR, Pourrier M, Weerapura M, Ethier N, Marmabachi AM, Hebert TE, et al. KvLQT1 modulates the distribution and biophysical properties of HERG. A novel alpha-subunit interaction between delayed rectifier currents. J Biol Chem 2004;279:1233-1241.
136 141. Chouabe C, Neyroud N, Guicheney P, Lazdunski M, Romey G, Barhanin J. Properties of KvLQT1 K+ channel mutations in Romano-Ward and Jervell and Lange-Nielsen inherited cardiac arrhythmias. EMBO J 1997;16:5472-5479.
142. Peroz D, Dahimene S, Baro I, Loussouarn G, Merot J. LQT1-associated mutations increase KCNQ1 proteasomal degradation independently of Derlin-1. J Biol Chem 2009;284:5250-5256.
143. Sanguinetti MC, Curran ME, Spector PS, Keating MT. Spectrum of HERG K+- channel dysfunction in an inherited cardiac arrhythmia. Proc Natl Acad Sci U S A 1996;93:2208-2212.
144. Chen YH, Xu SJ, Bendahhou S, Wang XL, Wang Y, Xu WY, et al. KCNQ1 gain-of- function mutation in familial atrial fibrillation. Science 2003;299:251-254.
145. Bellocq C, van Ginneken AC, Bezzina CR, Alders M, Escande D, Mannens MM, et al. Mutation in the KCNQ1 gene leading to the short QT-interval syndrome. Circulation 2004;109:2394-2397.
146. Cordeiro JM, Brugada R, Wu YS, Hong K, Dumaine R. Modulation of I(Kr) inactivation by mutation N588K in KCNH2: a link to arrhythmogenesis in short QT syndrome. Cardiovasc Res 2005;67:498-509.
147. Xia M, Jin Q, Bendahhou S, He Y, Larroque MM, Chen Y, et al. A Kir2.1 gain-of- function mutation underlies familial atrial fibrillation. Biochem Biophys Res Commun 2005;332:1012-1019.
148. Priori SG, Pandit SV, Rivolta I, Berenfeld O, Ronchetti E, Dhamoon A, et al. A novel form of short QT syndrome (SQT3) is caused by a mutation in the KCNJ2 gene. Circ Res 2005;96:800-807.
149. Plaster NM, Tawil R, Tristani-Firouzi M, Canun S, Bendahhou S, Tsunoda A, et al. Mutations in Kir2.1 cause the developmental and episodic electrical phenotypes of Andersen's syndrome. Cell 2001;105:511-519.
150. Eckhardt LL, Farley AL, Rodriguez E, Ruwaldt K, Hammill D, Tester DJ, et al. KCNJ2 mutations in arrhythmia patients referred for LQT testing: a mutation T305A with novel effect on rectification properties. Heart Rhythm 2007;4:323-329.
151. Solan JL, Lampe PD. Connexin43 phosphorylation: structural changes and biological effects. Biochem J 2009;419:261-272.
152. Laing JG, Tadros PN, Westphale EM, Beyer EC. Degradation of connexin43 gap junctions involves both the proteasome and the lysosome. Exp Cell Res 1997;236:482- 492.
137 153. Lampe PD, TenBroek EM, Burt JM, Kurata WE, Johnson RG, Lau AF. Phosphorylation of connexin43 on serine368 by protein kinase C regulates gap junctional communication. J Cell Biol 2000;149:1503-1512.
154. Lin R, Warn-Cramer BJ, Kurata WE, Lau AF. v-Src phosphorylation of connexin 43 on Tyr247 and Tyr265 disrupts gap junctional communication. J Cell Biol 2001;154:815-827.
155. Cooper CD, Lampe PD. Casein kinase 1 regulates connexin-43 gap junction assembly. J Biol Chem 2002;277:44962-44968.
156. TenBroek EM, Lampe PD, Solan JL, Reynhout JK, Johnson RG. Ser364 of connexin43 and the upregulation of gap junction assembly by cAMP. J Cell Biol 2001;155:1307-1318.
157. Paulson AF, Lampe PD, Meyer RA, TenBroek E, Atkinson MM, Walseth TF, et al. Cyclic AMP and LDL trigger a rapid enhancement in gap junction assembly through a stimulation of connexin trafficking. J Cell Sci 2000;113 ( Pt 17):3037-3049.
158. Cottrell GT, Lin R, Warn-Cramer BJ, Lau AF, Burt JM. Mechanism of v-Src- and mitogen-activated protein kinase-induced reduction of gap junction communication. Am J Physiol Cell Physiol 2003;284:C511-520.
159. Giepmans BN. Gap junctions and connexin-interacting proteins. Cardiovasc Res 2004;62:233-245.
160. Palatinus JA, O'Quinn MP, Barker RJ, Harris BS, Jourdan J, Gourdie RG. ZO-1 determines adherens and gap junction localization at intercalated disks. Am J Physiol Heart Circ Physiol 2011;300:H583-594.
161. Lan Z, Kurata WE, Martyn KD, Jin C, Lau AF. Novel rab GAP-like protein, CIP85, interacts with connexin43 and induces its degradation. Biochemistry 2005;44:2385- 2396.
162. Teunissen BE, Jansen AT, van Amersfoorth SC, O'Brien TX, Jongsma HJ, Bierhuizen MF. Analysis of the rat connexin 43 proximal promoter in neonatal cardiomyocytes. Gene 2003;322:123-136.
163. Boogerd KJ, Wong LY, Christoffels VM, Klarenbeek M, Ruijter JM, Moorman AF, et al. Msx1 and Msx2 are functional interacting partners of T-box factors in the regulation of Connexin43. Cardiovasc Res 2008;78:485-493.
164. Reaume AG, de Sousa PA, Kulkarni S, Langille BL, Zhu D, Davies TC, et al. Cardiac malformation in neonatal mice lacking connexin43. Science 1995;267:1831-1834.
165. Vaidya D, Tamaddon HS, Lo CW, Taffet SM, Delmar M, Morley GE, et al. Null mutation of connexin43 causes slow propagation of ventricular activation in the late stages of mouse embryonic development. Circ Res 2001;88:1196-1202.
138 166. Beauchamp P, Choby C, Desplantez T, de Peyer K, Green K, Yamada KA, et al. Electrical propagation in synthetic ventricular myocyte strands from germline connexin43 knockout mice. Circ Res 2004;95:170-178.
167. Thomas SA, Schuessler RB, Berul CI, Beardslee MA, Beyer EC, Mendelsohn ME, et al. Disparate effects of deficient expression of connexin43 on atrial and ventricular conduction: evidence for chamber-specific molecular determinants of conduction. Circulation 1998;97:686-691.
168. Guerrero PA, Schuessler RB, Davis LM, Beyer EC, Johnson CM, Yamada KA, et al. Slow ventricular conduction in mice heterozygous for a connexin43 null mutation. J Clin Invest 1997;99:1991-1998.
169. Gutstein DE, Morley GE, Tamaddon H, Vaidya D, Schneider MD, Chen J, et al. Conduction slowing and sudden arrhythmic death in mice with cardiac-restricted inactivation of connexin43. Circ Res 2001;88:333-339.
170. Eckardt D, Theis M, Degen J, Ott T, van Rijen HV, Kirchhoff S, et al. Functional role of connexin43 gap junction channels in adult mouse heart assessed by inducible gene deletion. J Mol Cell Cardiol 2004;36:101-110.
171. Gutstein DE, Morley GE, Vaidya D, Liu F, Chen FL, Stuhlmann H, et al. Heterogeneous expression of Gap junction channels in the heart leads to conduction defects and ventricular dysfunction. Circulation 2001;104:1194-1199.
172. Kirchhoff S, Nelles E, Hagendorff A, Kruger O, Traub O, Willecke K. Reduced cardiac conduction velocity and predisposition to arrhythmias in connexin40-deficient mice. Curr Biol 1998;8:299-302.
173. Bagwe S, Berenfeld O, Vaidya D, Morley GE, Jalife J. Altered right atrial excitation and propagation in connexin40 knockout mice. Circulation 2005;112:2245-2253.
174. Tamaddon HS, Vaidya D, Simon AM, Paul DL, Jalife J, Morley GE. High-resolution optical mapping of the right bundle branch in connexin40 knockout mice reveals slow conduction in the specialized conduction system. Circ Res 2000;87:929-936.
175. Hagendorff A, Schumacher B, Kirchhoff S, Luderitz B, Willecke K. Conduction disturbances and increased atrial vulnerability in Connexin40-deficient mice analyzed by transesophageal stimulation. Circulation 1999;99:1508-1515.
176. Kreuzberg MM, Schrickel JW, Ghanem A, Kim JS, Degen J, Janssen-Bienhold U, et al. Connexin30.2 containing gap junction channels decelerate impulse propagation through the atrioventricular node. Proc Natl Acad Sci U S A 2006;103:5959-5964.
177. Kruger O, Plum A, Kim JS, Winterhager E, Maxeiner S, Hallas G, et al. Defective vascular development in connexin 45-deficient mice. Development 2000;127:4179- 4193.
139 178. Kumai M, Nishii K, Nakamura K, Takeda N, Suzuki M, Shibata Y. Loss of connexin45 causes a cushion defect in early cardiogenesis. Development 2000;127:3501-3512.
179. Nishii K, Kumai M, Egashira K, Miwa T, Hashizume K, Miyano Y, et al. Mice lacking connexin45 conditionally in cardiac myocytes display embryonic lethality similar to that of germline knockout mice without endocardial cushion defect. Cell Commun Adhes 2003;10:365-369.
180. Studer R, Reinecke H, Bilger J, Eschenhagen T, Bohm M, Hasenfuss G, et al. Gene expression of the cardiac Na(+)-Ca2+ exchanger in end-stage human heart failure. Circ Res 1994;75:443-453.
181. O'Rourke B, Kass DA, Tomaselli GF, Kaab S, Tunin R, Marban E. Mechanisms of altered excitation-contraction coupling in canine tachycardia-induced heart failure, I: experimental studies. Circ Res 1999;84:562-570.
182. Shao Q, Ren B, Saini HK, Netticadan T, Takeda N, Dhalla NS. Sarcoplasmic reticulum Ca2+ transport and gene expression in congestive heart failure are modified by imidapril treatment. Am J Physiol Heart Circ Physiol 2005;288:H1674-1682.
183. Mishra S, Gupta RC, Tiwari N, Sharov VG, Sabbah HN. Molecular mechanisms of reduced sarcoplasmic reticulum Ca(2+) uptake in human failing left ventricular myocardium. J Heart Lung Transplant 2002;21:366-373.
184. Netticadan T, Temsah RM, Kawabata K, Dhalla NS. Sarcoplasmic reticulum Ca(2+)/Calmodulin-dependent protein kinase is altered in heart failure. Circ Res 2000;86:596-605.
185. Gupta RC, Mishra S, Mishima T, Goldstein S, Sabbah HN. Reduced sarcoplasmic reticulum Ca(2+)-uptake and expression of phospholamban in left ventricular myocardium of dogs with heart failure. J Mol Cell Cardiol 1999;31:1381-1389.
186. Xiong W, Tian Y, DiSilvestre D, Tomaselli GF. Transmural heterogeneity of Na+- Ca2+ exchange: evidence for differential expression in normal and failing hearts. Circ Res 2005;97:207-209.
187. Flesch M, Schwinger RH, Schiffer F, Frank K, Sudkamp M, Kuhn-Regnier F, et al. Evidence for functional relevance of an enhanced expression of the Na(+)-Ca2+ exchanger in failing human myocardium. Circulation 1996;94:992-1002.
188. Marx SO, Reiken S, Hisamatsu Y, Jayaraman T, Burkhoff D, Rosemblit N, et al. PKA phosphorylation dissociates FKBP12.6 from the calcium release channel (ryanodine receptor): defective regulation in failing hearts. Cell 2000;101:365-376.
189. Go LO, Moschella MC, Watras J, Handa KK, Fyfe BS, Marks AR. Differential regulation of two types of intracellular calcium release channels during end-stage heart failure. J Clin Invest 1995;95:888-894.
140 190. Takahashi T, Allen PD, Lacro RV, Marks AR, Dennis AR, Schoen FJ, et al. Expression of dihydropyridine receptor (Ca2+ channel) and calsequestrin genes in the myocardium of patients with end-stage heart failure. J Clin Invest 1992;90:927-935.
191. Balijepalli RC, Lokuta AJ, Maertz NA, Buck JM, Haworth RA, Valdivia HH, et al. Depletion of T-tubules and specific subcellular changes in sarcolemmal proteins in tachycardia-induced heart failure. Cardiovasc Res 2003;59:67-77.
192. Aimond F, Alvarez JL, Rauzier JM, Lorente P, Vassort G. Ionic basis of ventricular arrhythmias in remodeled rat heart during long-term myocardial infarction. Cardiovasc Res 1999;42:402-415.
193. Zicha S, Maltsev VA, Nattel S, Sabbah HN, Undrovinas AI. Post-transcriptional alterations in the expression of cardiac Na+ channel subunits in chronic heart failure. J Mol Cell Cardiol 2004;37:91-100.
194. Valdivia CR, Chu WW, Pu J, Foell JD, Haworth RA, Wolff MR, et al. Increased late sodium current in myocytes from a canine heart failure model and from failing human heart. J Mol Cell Cardiol 2005;38:475-483.
195. Shang LL, Pfahnl AE, Sanyal S, Jiao Z, Allen J, Banach K, et al. Human heart failure is associated with abnormal C-terminal splicing variants in the cardiac sodium channel. Circ Res 2007;101:1146-1154.
196. Nuss HB, Houser SR. T-type Ca2+ current is expressed in hypertrophied adult feline left ventricular myocytes. Circ Res 1993;73:777-782.
197. Gidh-Jain M, Huang B, Jain P, el-Sherif N. Differential expression of voltage-gated K+ channel genes in left ventricular remodeled myocardium after experimental myocardial infarction. Circ Res 1996;79:669-675.
198. Kaab S, Dixon J, Duc J, Ashen D, Nabauer M, Beuckelmann DJ, et al. Molecular basis of transient outward potassium current downregulation in human heart failure: a decrease in Kv4.3 mRNA correlates with a reduction in current density. Circulation 1998;98:1383-1393.
199. Zicha S, Xiao L, Stafford S, Cha TJ, Han W, Varro A, et al. Transmural expression of transient outward potassium current subunits in normal and failing canine and human hearts. J Physiol 2004;561:735-748.
200. Rose J, Armoundas AA, Tian Y, DiSilvestre D, Burysek M, Halperin V, et al. Molecular correlates of altered expression of potassium currents in failing rabbit myocardium. Am J Physiol Heart Circ Physiol 2005;288:H2077-2087.
201. Li GR, Lau CP, Ducharme A, Tardif JC, Nattel S. Transmural action potential and ionic current remodeling in ventricles of failing canine hearts. Am J Physiol Heart Circ Physiol 2002;283:H1031-1041.
141 202. Li GR, Lau CP, Leung TK, Nattel S. Ionic current abnormalities associated with prolonged action potentials in cardiomyocytes from diseased human right ventricles. Heart Rhythm 2004;1:460-468.
203. Tsuji Y, Zicha S, Qi XY, Kodama I, Nattel S. Potassium channel subunit remodeling in rabbits exposed to long-term bradycardia or tachycardia: discrete arrhythmogenic consequences related to differential delayed-rectifier changes. Circulation 2006;113:345-355.
204. Severs NJ, Bruce AF, Dupont E, Rothery S. Remodelling of gap junctions and connexin expression in diseased myocardium. Cardiovasc Res 2008;80:9-19.
205. Dupont E, Matsushita T, Kaba RA, Vozzi C, Coppen SR, Khan N, et al. Altered connexin expression in human congestive heart failure. J Mol Cell Cardiol 2001;33:359-371.
206. Akar FG, Nass RD, Hahn S, Cingolani E, Shah M, Hesketh GG, et al. Dynamic changes in conduction velocity and gap junction properties during development of pacing-induced heart failure. Am J Physiol Heart Circ Physiol 2007;293:H1223-1230.
207. Muth JN, Bodi I, Lewis W, Varadi G, Schwartz A. A Ca(2+)-dependent transgenic model of cardiac hypertrophy: A role for protein kinase Calpha. Circulation 2001;103:140-147.
208. del Monte F, Williams E, Lebeche D, Schmidt U, Rosenzweig A, Gwathmey JK, et al. Improvement in survival and cardiac metabolism after gene transfer of sarcoplasmic reticulum Ca(2+)-ATPase in a rat model of heart failure. Circulation 2001;104:1424- 1429.
209. Miyamoto MI, del Monte F, Schmidt U, DiSalvo TS, Kang ZB, Matsui T, et al. Adenoviral gene transfer of SERCA2a improves left-ventricular function in aortic- banded rats in transition to heart failure. Proc Natl Acad Sci U S A 2000;97:793-798.
210. Iwanaga Y, Hoshijima M, Gu Y, Iwatate M, Dieterle T, Ikeda Y, et al. Chronic phospholamban inhibition prevents progressive cardiac dysfunction and pathological remodeling after infarction in rats. J Clin Invest 2004;113:727-736.
211. Hoshijima M, Ikeda Y, Iwanaga Y, Minamisawa S, Date MO, Gu Y, et al. Chronic suppression of heart-failure progression by a pseudophosphorylated mutant of phospholamban via in vivo cardiac rAAV gene delivery. Nat Med 2002;8:864-871.
212. Jessup M, Greenberg B, Mancini D, Cappola T, Pauly DF, Jaski B, et al. Calcium Upregulation by Percutaneous Administration of Gene Therapy in Cardiac Disease (CUPID): a phase 2 trial of intracoronary gene therapy of sarcoplasmic reticulum Ca2+-ATPase in patients with advanced heart failure. Circulation 2011;124:304-313.
142 213. Nguyen TP, Wang DW, Rhodes TH, George AL, Jr. Divergent biophysical defects caused by mutant sodium channels in dilated cardiomyopathy with arrhythmia. Circ Res 2008;102:364-371.
214. Soltysinska E, Olesen SP, Christ T, Wettwer E, Varro A, Grunnet M, et al. Transmural expression of ion channels and transporters in human nondiseased and end-stage failing hearts. Pflugers Arch 2009;459:11-23.
215. Fatini C, Sticchi E, Marcucci R, Verdiani V, Nozzoli C, Vassallo C, et al. S38G single-nucleotide polymorphism at the KCNE1 locus is associated with heart failure. Heart Rhythm 2010;7:363-367.
216. Bruce AF, Rothery S, Dupont E, Severs NJ. Gap junction remodelling in human heart failure is associated with increased interaction of connexin43 with ZO-1. Cardiovasc Res 2008;77:757-765.
217. Yamada KA, Rogers JG, Sundset R, Steinberg TH, Saffitz JE. Up-regulation of connexin45 in heart failure. J Cardiovasc Electrophysiol 2003;14:1205-1212.
218. Maguy A, Le Bouter S, Comtois P, Chartier D, Villeneuve L, Wakili R, et al. Ion channel subunit expression changes in cardiac Purkinje fibers: a potential role in conduction abnormalities associated with congestive heart failure. Circ Res 2009;104:1113-1122.
219. Boixel C, Dinanian S, Lang-Lazdunski L, Mercadier JJ, Hatem SN. Characterization of effects of endothelin-1 on the L-type Ca2+ current in human atrial myocytes. Am J Physiol Heart Circ Physiol 2001;281:H764-773.
220. Izumi T, Kihara Y, Sarai N, Yoneda T, Iwanaga Y, Inagaki K, et al. Reinduction of T- type calcium channels by endothelin-1 in failing hearts in vivo and in adult rat ventricular myocytes in vitro. Circulation 2003;108:2530-2535.
221. Zhang Y, Huang ZJ, Dai DZ, Feng Y, Na T, Tang XY, et al. Downregulated FKBP12.6 expression and upregulated endothelin signaling contribute to elevated diastolic calcium and arrhythmogenesis in rat cardiomyopathy produced by l-thyroxin. Int J Cardiol 2008;130:463-471.
222. Li X, Zima AV, Sheikh F, Blatter LA, Chen J. Endothelin-1-induced arrhythmogenic Ca2+ signaling is abolished in atrial myocytes of inositol-1,4,5-trisphosphate(IP3)- receptor type 2-deficient mice. Circ Res 2005;96:1274-1281.
223. Kiesecker C, Zitron E, Scherer D, Lueck S, Bloehs R, Scholz EP, et al. Regulation of cardiac inwardly rectifying potassium current IK1 and Kir2.x channels by endothelin-1. J Mol Med 2006;84:46-56.
224. Puglisi JL, Yuan W, Timofeyev V, Myers RE, Chiamvimonvat N, Samarel AM, et al. Phorbol ester and endothelin-1 alter functional expression of Na+/Ca2+ exchange, K+,
143 and Ca2+ currents in cultured neonatal rat myocytes. Am J Physiol Heart Circ Physiol 2011;300:H617-626.
225. Lin C, Nagai M, Ishigaki D, Hayasaka K, Endoh M, Ishii K. Cross-talk between beta(1)-adrenoceptors and ET(A) receptors in modulation of the slow component of delayed rectifier K(+) currents. Naunyn Schmiedebergs Arch Pharmacol 2005;371:133-140.
226. Matsumoto Y, Aihara H, Yamauchi-Kohno R, Reien Y, Ogura T, Yabana H, et al. Long-term endothelin a receptor blockade inhibits electrical remodeling in cardiomyopathic hamsters. Circulation 2002;106:613-619.
227. Hagiwara K, Nunoki K, Ishii K, Abe T, Yanagisawa T. Differential inhibition of transient outward currents of Kv1.4 and Kv4.3 by endothelin. Biochem Biophys Res Commun 2003;310:634-640.
228. Polontchouk L, Ebelt B, Jackels M, Dhein S. Chronic effects of endothelin 1 and angiotensin II on gap junctions and intercellular communication in cardiac cells. Faseb J 2002;16:87-89.
229. Spinella F, Rosano L, Di Castro V, Nicotra MR, Natali PG, Bagnato A. Endothelin-1 decreases gap junctional intercellular communication by inducing phosphorylation of connexin 43 in human ovarian carcinoma cells. J Biol Chem 2003;278:41294-41301.
230. Reisner Y, Meiry G, Zeevi-Levin N, Barac DY, Reiter I, Abassi Z, et al. Impulse conduction and gap junctional remodelling by endothelin-1 in cultured neonatal rat ventricular myocytes. J Cell Mol Med 2009;13:562-573.
231. Rozyczka J, Figiel M, Engele J. Chronic endothelin exposure inhibits connexin43 expression in cultured cortical astroglia. J Neurosci Res 2005;79:303-309.
232. Niger C, Geneau G, Fiorini C, Defamie N, Pointis G, Mesnil M, et al. Endothelin-1 inhibits human osteoblastic cell differentiation: influence of connexin-43 expression level. J Cell Biochem 2008;103:110-122.
233. Morawietz H, Szibor M, Goettsch W, Bartling B, Barton M, Shaw S, et al. Deloading of the left ventricle by ventricular assist device normalizes increased expression of endothelin ET(A) receptors but not endothelin-converting enzyme-1 in patients with end-stage heart failure. Circulation 2000;102:III188-193.
234. Tikkanen I, Tikkanen T, Cao Z, Allen TJ, Davis BJ, Lassila M, et al. Combined inhibition of neutral endopeptidase with angiotensin converting enzyme or endothelin converting enzyme in experimental diabetes. J Hypertens 2002;20:707-714.
235. D'Orleans-Juste P, Houde M, Rae GA, Bkaily G, Carrier E, Simard E. Endothelin-1 (1-31): from chymase-dependent synthesis to cardiovascular pathologies. Vascul Pharmacol 2008;49:51-62.
144 236. Trapani AJ, Beil ME, Cote DT, de Lombaert S, Erion MD, Gerlock TE, et al. Pharmacologic profile of CGS 24128, a potent, long-acting inhibitor of neutral endopeptidase 24.11. J Cardiovasc Pharmacol 1994;23:358-364.
237. Henry PJ, Carr MJ, Goldie RG, Jeng AY. The role of endothelin in mediating virus- induced changes in endothelinB receptor density in mouse airways. Eur Respir J 1999;14:92-97.
238. Raoch V, Martinez-Miguel P, Arribas-Gomez I, Rodriguez-Puyol M, Rodriguez-Puyol D, Lopez-Ongil S. The peptidase inhibitor CGS-26303 increases endothelin converting enzyme-1 expression in endothelial cells through accumulation of big endothelin-1. Br J Pharmacol 2007;152:313-322.
239. Schiffrin EL. Beyond blood pressure: the endothelium and atherosclerosis progression. Am J Hypertens 2002;15:115S-122S.
240. Yang LL, Arab S, Liu P, Stewart DJ, Husain M. The role of endothelin-1 in myocarditis and inflammatory cardiomyopathy: old lessons and new insights. Can J Physiol Pharmacol 2005;83:47-62.
241. Haws CW, Lux RL. Correlation between in vivo transmembrane action potential durations and activation-recovery intervals from electrograms. Effects of interventions that alter repolarization time. Circulation 1990;81:281-288.
242. Liu L, Tockman B, Girouard S, Pastore J, Walcott G, KenKnight B, et al. Left ventricular resynchronization therapy in a canine model of left bundle branch block. Am J Physiol Heart Circ Physiol 2002;282:H2238-2244.
243. Kasahara H, Wakimoto H, Liu M, Maguire CT, Converso KL, Shioi T, et al. Progressive atrioventricular conduction defects and heart failure in mice expressing a mutant Csx/Nkx2.5 homeoprotein. J Clin Invest 2001;108:189-201.
244. Panama BK, Latour-Villamil D, Farman GP, Zhao D, Bolz SS, Kirshenbaum LA, et al. Nuclear Factor {kappa}B Downregulates the Transient Outward Potassium Current Ito,f Through Control of KChIP2 Expression. Circ Res 2011.
245. Kasi VS, Xiao HD, Shang LL, Iravanian S, Langberg J, Witham EA, et al. Cardiac- restricted angiotensin-converting enzyme overexpression causes conduction defects and connexin dysregulation. Am J Physiol Heart Circ Physiol 2007;293:H182-192.
246. Zaheer A, Sahu SK, Wu Y, Zaheer A, Haas J, Lee K, et al. Diminished cytokine and chemokine expression in the central nervous system of GMF-deficient mice with experimental autoimmune encephalomyelitis. Brain Res 2007;1144:239-247.
247. Gros R, Afroze T, You XM, Kabir G, Van Wert R, Kalair W, et al. Plasma membrane calcium ATPase overexpression in arterial smooth muscle increases vasomotor responsiveness and blood pressure. Circ Res 2003;93:614-621.
145 248. Kim KH, Oudit GY, Backx PH. Erythropoietin protects against doxorubicin-induced cardiomyopathy via a phosphatidylinositol 3-kinase-dependent pathway. J Pharmacol Exp Ther 2008;324:160-169.
249. Liang W, Oudit GY, Patel MM, Shah AM, Woodgett JR, Tsushima RG, et al. Role of Phosphoinositide 3-Kinase {alpha}, Protein Kinase C, and L-Type Ca2+ Channels in Mediating the Complex Actions of Angiotensin II on Mouse Cardiac Contractility. Hypertension 2010;56:422-429.
250. Kucera JP, Rohr S, Rudy Y. Localization of sodium channels in intercalated disks modulates cardiac conduction. Circ Res 2002;91:1176-1182.
251. Ai X, Zhao W, Pogwizd SM. Connexin43 knockdown or overexpression modulates cell coupling in control and failing rabbit left ventricular myocytes. Cardiovasc Res 2010;85:751-762.
252. Fernandez-Cobo M, Gingalewski C, Drujan D, De Maio A. Downregulation of connexin 43 gene expression in rat heart during inflammation. The role of tumour necrosis factor. Cytokine 1999;11:216-224.
253. Stanbouly S, Kirshenbaum LA, Jones DL, Karmazyn M. Sodium hydrogen exchange 1 (NHE-1) regulates connexin 43 expression in cardiomyocytes via reverse mode sodium calcium exchange and c-Jun NH2-terminal kinase-dependent pathways. J Pharmacol Exp Ther 2008;327:105-113.
254. Toyofuku T, Yabuki M, Otsu K, Kuzuya T, Tada M, Hori M. Functional role of c-Src in gap junctions of the cardiomyopathic heart. Circ Res 1999;85:672-681.
255. Ruetten H, Thiemermann C. Endothelin-1 stimulates the biosynthesis of tumour necrosis factor in macrophages: ET-receptors, signal transduction and inhibition by dexamethasone. J Physiol Pharmacol 1997;48:675-688.
256. Kovacic B, Ilic D, Damsky CH, Gardner DG. c-Src activation plays a role in endothelin-dependent hypertrophy of the cardiac myocyte. J Biol Chem 1998;273:35185-35193.
257. Kieken F, Mutsaers N, Dolmatova E, Virgil K, Wit AL, Kellezi A, et al. Structural and molecular mechanisms of gap junction remodeling in epicardial border zone myocytes following myocardial infarction. Circ Res 2009;104:1103-1112.
258. Malhotra JD, Thyagarajan V, Chen C, Isom LL. Tyrosine-phosphorylated and nonphosphorylated sodium channel beta1 subunits are differentially localized in cardiac myocytes. J Biol Chem 2004;279:40748-40754.
259. Gavillet B, Rougier JS, Domenighetti AA, Behar R, Boixel C, Ruchat P, et al. Cardiac sodium channel Nav1.5 is regulated by a multiprotein complex composed of syntrophins and dystrophin. Circ Res 2006;99:407-414.
146 260. Royer A, van Veen TA, Le Bouter S, Marionneau C, Griol-Charhbili V, Leoni AL, et al. Mouse model of SCN5A-linked hereditary Lenegre's disease: age-related conduction slowing and myocardial fibrosis. Circulation 2005;111:1738-1746.
261. Lin YZ, Yao SY, Veach RA, Torgerson TR, Hawiger J. Inhibition of nuclear translocation of transcription factor NF-kappa B by a synthetic peptide containing a cell membrane-permeable motif and nuclear localization sequence. J Biol Chem 1995;270:14255-14258.
147 AB20 8
15 6
10 4
5 2 ET-1 peptide (fmol/ng) ET-1 peptide (fmol/ng)
0 0
ON DOX (ET-1 off) OFF DOX (ET-1 on) CGS 26303 (ET-1 on + treatment)
Appendix 1. Myocardial ET- levels after short vs. long term CGS 26303 treatment. Expression of ET-1 peptide after 4 (A) and 12 (B) weeks post ECE inhibitor treatment.
148 12 100 * BT A D NBT 10 80
8 60 6 4.2 mRNA 2.1 mRNA 40 v v 4 K K
20 2
0 0
60 1.4 * B E 50 1.2
1.0 40
0.8 30
1.4 mRNA 0.6 v 20 K
0.4 mRNA KChIP2 10 0.2
0.0 0
12 C 10
8
6 1.5mRNA v 4 K
2
0
Appendix 2. Reduced molecular determinants of Ito (Kv4.2 and KChIP2 mRNA expression) after 4 wks of ET-1 over-expression. Expression of Kv2.1 (A), Kv1.4 (B), Kv1.5 (C), Kv4.2 (D), and KChIP2 (E) mRNA in Group I mice. *=P<0.05
149 GTTCACCTTGTCTCCCCCCCCATTTTTATTTATTGTAATATTATTATTATTATCATTATTATTTAGGAA ATGTGACCTAAAAGGGACATCTTCTCACTGCCCGTGGTCATCTCCTGAAGGAATGACCCATCCAAC AGTTTTTTTTTTTAATCTGTGAGGAGTCACAGCCCCGCAGTAGCTGACGTACATCTAGAGCTATTTC TTACTTTTTTTCCCCTTCTCGTCAGCACATTGAAACTACAACTTTATCTTGACCAGGTTGCTTCTTCTGC CTGCTCAGCTCCACGCTCGCCAGCCTCCACTCCACCTCCTCCCCGCCTTTTCTTCCTCCCTCCCCTTT CTCCTAGCCCCTCCTTCCAGTTGAGTCAGTGGCTTGAAACTTTTAAAAGCTCTGTGCTCCAAGTTAA AAAACGCTTTTACGAGGTATCAGCACTTTTCTTTCATTGGGGGAAAGGCGTGAGGGAAGTACCCAAC AGCAGCAGACTTTGAAACTTTAAACAGACAGGTCTGAGAGCCCGAACTCTCCTTTTCCTTTGACTTCA GCCTCCAAGGAGTTCCACCACTTTGGCGTGCCGGCTTCACTTTCATTAAGTGAAAGAGTAAGTTTTG AAAAAAAGAAAAACCCACTTTACCTAGTAGCGTCTCTTTCTGTAAGGGAAACTCTTCTATGCTTTGT AAATGCGTTGCGTCTTTGACTTAGGATACTGTAAGTAGAACGACGATCTTCAAAGTGCCTTTGTCAT TTCCACGTGCTGAGTTTGATTTGGGTTTGTTTAAAAAGTTCCGCTGAGAGTGCAACAGGTAAAAGGCT CAAACTTTTTCCAACTAGAGTGAAGGAAGGACCAAGTTACTAAACTTAGTTCTTTGTTATGGAGCC TAACTTCACTTTTCTGTAGTCGCCAATGGAGAAGGTGTTGCGGGGGTGGGGGTGATGGGGGGGCACCT CAGTCAACTTTGCTTAGCCTGCTTCCTATAGTGCTGGACACTACACGCTTCTTTT
Appendix 3. Cx43 core promoter sequence. Cx43 promoter (-411 to +589 from the transcriptional start site) showing the NFκB binding sites in bold and the accompanying forward and reverse primers.
150 A CCGCGCCGCCCGCCGAGCCCGGGAGCCCGAGCGGAGCGGCGGAGCCGAGACGGCGGCGGCGCCCG TGGGATGTGGGGATCGCGCCCCCGGGGCCGCTGAGCCTGCGCCCGCTGCCCCAAGCCCTACGCCGA ACCGAGCCCGCGCCGCGCTGCAGCCGCCCACCCCTAGGCGCGGGCCGGGGACTAGCAGGTGAGCG ATCATCCCCCGTGTCCCGCAGTCCCCCGCTCCCCTCTGTCCGCCGCCGCCGCCCAACTTTCCTCCCCG ATGGCCCGGAGCCCCCCGGCCGGGTCCCCAGCCCCCGCAGCCACTATCCCCGAGGGGGGAGGGGCG GGAGAGGCGCAGGTGGCCCGGGCCGGGGTTCCCCTGGTCCTCTCTGATCGCCGCGGGTCTCCTCCC GTCCCCTCTCCTTCCGGGTTCCCCGTGCGCTGTCGAGGGCCGGGGGATGGGGAGATTCGGCCCCGG CTCCGGGACCATCGCTGGCGCAGGCTCGCCGAGGGGCTGAGATTGGGACCCGGATTCCCGAGGCC GGAGACCCCAAGGTCAGAGCAGCGACAAGGCGCGCGGAGAATGTAGCTCTTGAGAGCTGGGGGTG AAAGGGCTGAGCGGGCACTGACCAGGGCTAGGGAGCAGGCCGAGCGCTTCTTTTCCCTGGGCCCC GGGGGTGGAGGAACCAGGCACCTGGGCTATGCCCTGGGTTAGACGAGATCTCTGCACCCTAGGAA GGAATCTGTGCGCTCTATTGGGGGTCAGATCTGCGAGTGTGCCTTGTCTTTGGGAGCTCCCACCACG CCAAGATCTTGGTGCCCTGTTGTCGCCTTGAAGCGGTCGCATCTCCTCCTGTGTCTATGCGCTCTGAG AGGGGAGAGGTCTCTGGACATGGAAATTCGGGAGAATTCTCTGCCCTCCTTGCTTTGACCTGTACA GACTCGCGCACCCGGACAGGAGAGAGAGGAGGTCCCGGACCTCTGCGGTATTTGATCGTCTTTGGA GGTGCCCTGAG B GTCACAGAAGCTTATAGGGGTCACTAATGACATGCCCCATGGAGTGAGCTCAGGGCAAAGCCCTTG GCTGACAGGAAGAGAGTGTGTCCCTGGCAGACATCTTCAGCAGGTGTCCAGTCTGCCCTCTTGAGC CGGTGCCCAGCCATTCCCGGTTTTGATGTGGTAATTAGCGGTGCAGCCTCCTGGCTTGGTGTCATAG TCAGGAGCCCTCTGGCCACATCCTGTTTTGGTGAGCCTGACAGAAATGCATTCTTCTGCCTTGCTGT CATAGACAGAGTGTGTTCGCACCAGGTTCTGAATCTTTTGAGGCCACCAGGGGCCACATTCTCCCT GTTTGACGTCACACACATATGCCTGTTGGAAGTCCTCTTCACCAGTGGTCACCGCCTTCCGGTGCTG GGGGGGAAAGAAAAAACAACCCTTGGGGTTTGCGCTTGTATGTCCCCTTTTATGGGAGAAGAGGG GACGGTGTGATGAGCCAGAGACCCACCTGTCACATTTCCCGTCTTTAGAATCAGTCTAGCTAGGGACG GTGCTGCACTCAGGGGATCCCTATGAGATCCTCAGATGGAGGTCTACACAGTTGGGCACACCAGAT GCCAACATCTGGATGCTAGTTCTTGTGTTCCTGTCCGGCCGGCCGTTGCTGAAAACCCTGGATCCCT TGGGGGGCAAATGCTGCCTCCAGTTGCTGCCTCTATGCCTCAGGTTTGATTTGCACCTCTTGTGTGA GGGCATGGGGATTGTGGGGGCACTGGACACCACTCAGGCTGGGAATGTTCCCTGGAGAGGGGGGG TGGGACCCTGTCCCGTGCAGGGCCAAATCCTGACGTATGCATGCTTCACCTTTTAATTGGAGAAAA GCCCTTCTGTTTGAGTCTGGGATAAAATGAACGGCATCTCTTCCCATCCCTGCCCTGTGGAGGCCAG GGAGCCGGTTGTGGTGGAAATGTCTTAAAGGGGGTCAGTTGAAGTGTTTTTACTTTTGTGTGTGGT GGAC
Appendix 4. Nav1.5 core promoter sequences.Nav1.5 promoters (-91 to +909, and -343 to +657 respectively from the transcriptional start site) showing the NFκB binding sites in bold and the accompanying forward and reverse primers. 151 A GGACCACTTAGCAACACCCCTCCGAATCCCACTCCCTTCAGGTAGATCCTGTCTCCCGCCCCACCGA GCCTACCCTCGGGCCCCGGGGCCTGCAGCCCAAAGCCAGGCCCCGGCGCGGCCCGACCCTCCCACC CTCCCAACAGGGCCCCTAACTCACGGTCCGGCTCGGCCATGGGAACGGGGTGGGGGCCCTCGGGA CTGTCACCGACTGCTCTGTCCCGTGACGGCAGCGGAAACAAGAAGAGGCCGAGATAGGATAGAGA ACTACAACTCCCGGCAGGCAATGCGATCCCCATAACCGCTTTCGTACAATGTGCCTCTCATGTTATC AAACTACAAATCCCAAAAAGCCTGGCGCCGGCGGCCATATTGATAAAGGGCGTCTGGAAAATGTG GGGAAACTCAGCGAGCGAATGTCCACCTCATTTTTCTGATTGGCTGTGGTGCAGTACAGGGGCGGGG TGTAGCTATTTAAAACATTTTGATTGGGTATATGAGGGGGCGTGTTGGGGAATTCCCGATAGGGCG GAAGCACTGGAGCTCATCGCAGAGCCCAGCGACAGGCAGGCGACCACAGGGGGCCACCCGAGGTG GCTGGGGCCATGGCCGGGGTCGCGTGCTTGGGGAAAACTGCGGATGCCGATGAATGGTGCGACAG CGGCCTGGGCTCTCTAGGTCCCGACGCAGCGGCTCCCGGAGGACCAGGTCTGGGCGCAGAGCTTGG CCCAGAGCTGTCGTGGGCGCCCTTAGTCTTTGGCTACGTCACTGAGGATGGGGACACGTGAGTAAA CCTTAAATTACTAGACTGAGCCCTGGGATCTTACCTGAGTCCCCTTTAGCCTACGATTCCTGTGACT TCGTATCGTCTCGTTCCTAACTCTTGATTTCCGATGCTGGACTTCCTGGCCCTTAACCCCCAAACACT AAATTGTGAGACTGGTACGCTTTCACACAGTCAAGTGTCTCACCTTTTTTGAACTCTATAAATTTGA GCTCCTGA
BT B 0.10 NBT
0.08
0.06
B binding site 0.04 NFkBIB Promoter NF 0.02
0.00
Appendix 5. NFκB p50 preferentially binds to sites within the NFκBIB promoter in the LV of ET-1 over-expressing mice. A. NFκBIB promoter sequence (-500 to +500 from the transcriptional start site) showing the NFκB binding sites in bold with the accompanying forward and reverse primers. B. The qRT-PCR results for the NFκB binding site within the NFκBIB promoter from a ChIP using an NFκB p50 Ab on LV tissue from BT vs. NBT mice from Group I.
152 A CCGTTCCCGCCCGTGCCGGCCCCATCAGGGTTCTGCCATGGCTCCCCACTCACCGGCTCCGGACACC TGATTCGGCTCCGGGACCTCGGCCGCCCGAGCCTCCTGATTTGCCCGCCCACCGGCCTCGCTTTCCA GTGCCCGCAGCCTCCCTCTGAAGTGCATGGACCCGGGGCGGTGACCGGGAGTGGGGTGGGAGGCC AGGCTGGGTCGCAGGCAAGAGCGGCCGGGCCTCCCGGCGCGGGAGGGAAAGGGCGCCCCCTCTCC TCTCCGGAACGTGTCAATGCTTTGCACTTGGGGCCGGCATGCGGCTAGGGGGTCCTTCCCCAAGGC CCCGGGACCCGGGCGCCCCCTGCCTCAGGCCCTTACGGCGGGTCAGATCGGTCCTCTGCGCTTTCCA GCCCTCGCCCAGGCAGCGGCGGGCGCGGGCGGCGAGGTGGGGGCCAGGCCAGGGGGAGGGGTCTC GGGGCCCGCTGGCCCGTCATTGGTTAATATTTTATTCTGTTGACATGTTTTCTTACTGCTGAGGCTTC CGACACCTTCTCCCTGGCCTCCCCTCCCGTCCAGAGCTTGGCCTGAGCTGTCAAAACCCCGCCCCCG GAGACCCACAATTGGTCCAAAAAGCGTAAAATCAGCAATCAAGGGGGGCCTGGCTCGTTAGCGCA GGGGATCCGAACAGGGCAGGACATGTGAGATAGTCACAGTTTTCCAGAGATCAGGACAAGATCTA ACCAGTCGCGCGTGGTCCCCGGCGCCGGAGCCGGCCAGCCCAGCCCAGCCCAGCCCAGCCCAGCCC CGCGCAGCGCCCCCTCCGCCCCCGCGTCCAGAGCCCTGCGCCCCTTGAGGTGCGCGGGACGGGGAG CCGGGAGAAGCCGCTGCCGCGCCCGCCGCCCGGGCCGTCCGTCCTCCGCGCGCGCCGCCGCCCGGG CCGGGGGTCCGAGGCGCGCGCCCCCGGCCCCGGCCCCGGCTCCCAGGAGCCTGGGCCGGATGTCCC GATGAGAGA
0.16 BT B NBT 0.14
0.12
0.10
0.08
B binding site 0.06 Tbx2 Promoter
NF 0.04
0.02
0.00
Appendix 6. NFκB p50 preferentially binds to a site within the Tbx2 promoter in the LV of ET-1 over-expressing mice. A. Tbx2 promoter sequence (-500 to +500 from the transcriptional start site) showing the NFκB binding sites in bold and the accompanying forward and reverse primers. B. The qRT-PCR results for the NFκB binding site within the Tbx2 promoter from a ChIP using an NFκB p50 Ab on LV tissue from BT vs. NBT mice from Group I.
153 A CTGGCCCGGAGGTGAGGGCAAAGGCTCTCAGGAGACAGGCCCGCAGTTCCAGGCGCTCACTTGTTT CAGCTGCTTCGTTCTCTCTACACCCACACCCCCATCCGGGTGGAACACTGGTGTCGTCATCCGAATG GAAGAGGAGCTGGGCTCAAAAGGGTCAGTAAATACATTTTTTAAAAAAAAAAGGAGCGAGCCGAG CGTAGACTGGGCCAGGCGCGCAGGCCTTGAATGCATTTGCGTGGTTTATTTTTCCGCGTGGGGGCT CGGTCTCAGTATGTCGGCGCGCGTTCGGGCCCAGAATCCCAAGGGGCATTTGGGTCTCTGCACGTG GCTGCGGGTGGGGAGCAGGCAGCGGGCAGAAAGATTGGTGGGATCCCCTGCGCTAGTGGCTCGGG AATCCGAAGCACCCGGGCGCAGGAGCTAGAGGATCTGACTCAGAGGTGGCTGGGCGGTTCCATG TGGGGCTCCCTTCAGAGCTACGCGAGCCTGGAGCTTTTGTTAAGGCTTATTGGCCGAAAGAGAGGTT CGGCGGCCAGCTCGGCTAGCCCGGGGCCCGGGAAAGGGAAGAAGCTGCAGATCCGCACAAGAGA AGCGGCCGCGGGCTTGAACTGTAGCGCTCGGAGCGCGCGAGAGGCGAGCGCCCCTGCCCGGCGCC TCGGAAGCCGGGCAAGCTGCCTGGCTCCCGCCCTCGCTCCCTCCCCCTTCCTCCCTGGCCCAGCCTC CTCCCCGGATCCCCCGGCTTGGATGGCTGAGGCCTTTCAGACGTAGGCTGAGCTGAGGAGCCGCGG CGAGCTCTCAGGCTGCTGCGAACTCTCTTCTGGATCAGCCACCTAGAGGCGACTTTGGTGAGCGCG CGGCGCCCTGGTGGCTCCCCGCCCTCCCCTCTGATCATGTTGACATAAACGCAGGACAGGCCGTAG TACCGCGCGGCGCAGCGACGTTCCAGTTTCCGACACCTTCTTTTTATAACTCGGCTCTATTCCCCCA GCACTCGACCTGT
BT B 0.10 NBT
0.08
0.06
B binding site 0.04 Tbx3 Promoter NF 0.02
0.00
Appendix 7. NFκB p50 does not preferentially bind to a site within the Tbx3 promoter in the LV of ET-1 over-expressing mice. A. Tbx3 promoter sequence (-764 to +236 from the transcriptional start site) showing the NFκB binding sites in bold and the accompanying forward and reverse primers. B. The qRT-PCR results for the NFκB binding site within the Tbx3 promoter from a ChIP using an NFκB p50 Ab on LV tissue from BT vs. NBT mice from Group I.
154 A TCCTTTGTGCCAAAAGAGAGGAGTCTGGGGACCGGGTTGTGATTTTGAGATGCGATGCTGCGGATC CCAGGAGCTGGGGTTGGCTTTGTTTTTCTAGTACAATCTCCAGGCAGGATCAGGCAGAAATTCCTTT CTGGGAACTGTTGGGAAATACGGAACGAATAAAGACACTGAGAAGTGAAGAGCAGGCTTCCGAAG GTGGCCGAATACCAAATATCTCAGAGTAGGGAGAGGGGCTCCTGGCCAGCTCACAGAAGGAGCAGG GAAGTCCCAGGCCCAGATCCTGTGCTGAGTAAAGCCAGAGAGGCCCAATGGTTTCTGCGAGTTAGA GGACGTTCCTAGGTTTTCCCTGGGAGCAGAGAGAAGGTCCAGGAACATTGGAGAAGGACTGGAGG AGGATTAGAACTTATTGCTACCAACCGGAATCCCGCAGGGCTGGTGTAGAGGCCTCTGTCCTCCTC CGGGTACTGGGAAGTCCAGAAGCCATGCCAACATCAGCTGACCACCCGAGGGACAAACCGGAGTA TTCCTAATGTAATTCACTCCGAGCATCCTCATGACTTTATTTTCTTTGCAGCCAGAAAAGCTAAAGC TAAATCCCAGACTGTTAAGAGAACGCTAACTATCCGGGGAAGAGGTCTGGGATAGGGCGCCCGAGA TTTCTCTTGTTTTGTTTTGTCCAAGCCACTTAGGCATTTCCCAGATGCGCAATTGCGCCAACATCGA ACCGAGCGAGCCCGTGCACTCGGCGATTAGCTTAAGCGGAGCTGGGTGTCCGGCATAGGACCAGAG TGATACTCCCTGCCACCCCTACAAGGGCCCTGAGGTCCCCGGCCCGCCGCTCTAACCCGCCACCTCT CTGCCTCTCTTCCCCTTCAGAGCTGTGCGCGCTGCAGAAGGCAGTGGAGCTGGACAAAGCCGAGAC GGATGGCGCCGAGAGACCACGCGCACGGCGGCGATCAAGCAACAGCGGTACCTGTCGGCGCCAGA GCGCGACCAG
BT 0.04 0.10 BCNBT
0.08 0.03
0.06 0.02 B binding site B binding B binding site B binding
0.04 NF NF Nkx2.5 Promoter Nkx2.5 Promoter Nkx2.5 st 0.01 nd 1 2 0.02
0.00 0.00
Appendix 8. NFκB p50 does not preferentially bind to sites within the Nkx2.5 promoter in the LV of ET-1 over-expressing mice. A. Nkx2.5 promoter (-879 to +121 from the transcriptional start site) showing the NFκB binding sites in bold and the accompanying forward and reverse primers. qRT-PCR results for 1st (B), and 2nd (C) NFκB binding sites within the Nkx2.5 promoter from a ChIP using an NFκB p50 Ab on LV tissue from BT vs. NBT mice from Group I.
155