View metadata, citation and similar papers at core.ac.uk brought to you by CORE

provided by Elsevier - Publisher Connector

Journal of Immunological Methods 365 (2011) 58–66

Contents lists available at ScienceDirect

Journal of Immunological Methods

journal homepage: www.elsevier.com/locate/jim

Research paper A platform for complementation and characterization of familial haemophagocytic lymphohistiocytosis 3 mutations

Edo Elstak, Arjan de Jong, Peter van der Sluijs ⁎

Department of Cell Biology, University Medical Center Utrecht, 3584 CX Utrecht, The Netherlands

article info abstract

Article history: Mutations in UNC13D cause the severe immune disorder familial haemophagocytic Received 14 September 2010 lymphohistiocytosis type 3 (FHL3). The gene product munc13-4 is expressed in hematopoietic Received in revised form 3 December 2010 – Accepted 13 December 2010 cells and is essential for degranulation. Little information is available on genotype phenotype Available online 21 December 2010 relationships of UNC13D mutations. Some mutants may have residual functionality which qualifies them as promising targets for attempts to enhance function pharmacologically. A Keywords: problem for such analysis is the scarcity of patient material. We established assays in the RBL-2H3 Haemophagocytic lymphohistiocytosis cell line to assess functionality of lentivirally transduced munc13-4 mutants. The basic principle of Munc13-4 which is to silence endogenous rat munc13-4 and replace it with siRNA resistant YFP-tagged Degranulation human variants. Localization, degranulation, and membrane binding kinetics can now easily be RBL-2H3 analyzed quantitatively. Such a system might also be useful to screen small molecular weight compounds for their ability to rescue degranulation in cells with reduced functional munc13-4. © 2010 Elsevier B.V. Open access under the Elsevier OA license.

1. Introduction been used extensively as a (mast cell) model for degranulation (Kapp-Barnea et al., 2003; Nomura et al., 2009; Tadokoro et al., FHL is a genetically heterogeneous disorder, characterized by 2010), and the functional analysis of ectopically expressed defective cytotoxic T lymphocyte (CTL) and natural killer (NK) perforin mutations (Risma et al., 2006). The cells exhibit cell activity, and hypercytokinaemia (Arico et al., 1988; Henter properties common to basophils and mast cells; both degranulate et al., 1991; Filipovich, 2006). FHL is fatal unless treated by after dimerization of the IgE bound FcεRI by multivalent antigens immune suppression and hematopoietic stem cell transplanta- (Kepley et al., 1998; Gilfillan and Tkaczyk, 2006). Proximal tion (Cesaro et al., 2008; Ohga et al., 2010). FHL links to five signalling of the receptor leads to activation of PKC and elevated genetic origins: chromosome 9, PRF1, UNC13D, STX11 and levels of Ca2+. Secretory lysosomes release their content by non- STX11BP2 (Stepp et al., 1999; Feldmann et al., 2003; zur Stadt polarized compound exocytosis that is microtubule dependent et al., 2005, 2009). Mutations in UNC13D are classified as FHL3 and regulated by rab27a/b (Rohlich et al., 1971; Roa et al., 1997; and the protein munc13-4 is necessary for maturation of lytic Smith et al., 2003; Nomura et al., 2009). Many components of the granules and for their docking at the immunological synapse signalling and fusion machinery are shared with CTL. The (Feldmann et al., 2003; Menager et al., 2007). degranulation pathway of RBL-2H3 cells therefore provides a Munc13-4 involvement in secretory lysosome release has relevant immunological model system to study the functionality been established in neutrophils, platelets,NKcells,CTL,andRBL- of munc13-4 and FHL3 mutants. 2H3 cells (Feldmann et al., 2003; Shirakawa et al., 2004; Neeft Mutations in UNC13D are scattered over the entire gene et al., 2005; Pivot-Pajot et al., 2008). The RBL-2H3 cell line has sequence and do not seem to cluster in specificareas(Santoro et al., 2006; Rudd et al., 2008). They cause single amino acid substitutions, frame shifts, deletions and premature stop codons Abbreviations: FHL, familial haemophagocytic lymphohistiocytosis. and might be responsible for the different onset and outcome of ⁎ Corresponding author. Dept of Cell Biology, UMC Utrecht, NL-3584 CX Utrecht, The Netherlands. Tel.: +31 88 7557578; fax: +31 30 2541797. FHL3. This diversity impairs prediction of disease severity by gene E-mail address: [email protected] (P. van der Sluijs). analysis. Thorough analysis of patient material is often hampered

0022-1759 © 2010 Elsevier B.V. Open access under the Elsevier OA license. doi:10.1016/j.jim.2010.12.009 E. Elstak et al. / Journal of Immunological Methods 365 (2011) 58–66 59 by availability. Limited data exists on munc13-4 mutants that CAAGAAAGCTGGGTCCTACGGTGCCGGCCGCAAGGC (r) were goes beyond expression at mRNA and protein levels, and derives used for YFP on the N-terminus, and GGGGACAAGTTTGTA- mainly from the JINX mouse (Crozat et al., 2007). We therefore CAAAAAAGCA GGC TTCATGGCGA CACTCCTCTCCCATCC (f), and established a robust knock-in system in which silencing of GGGGACCACTTTGTACAAG AAAGCTGGGTCTTACTTGTA- endogenous munc13-4 is combined with stable lentiviral CAGCTCGTCCATGC for YFP at the C-terminus. All constructs transduction of YFP-tagged munc13-4 constructs. Advantages obtained through PCR were verified by sequencing. VSV-G of this platform include the application of versatile cell assays to pseudotyped lentivirus was prepared in low passage number quantitative (residual) munc13-4 function, and to rank severity HEK293T cells. To this aim 3×106 cells were seeded in a 10 cm of FHL3 mutations. It also offers the possibility to test small dish and transfected the next day with 16 μg1/1.1ratioofpLNT– molecular weight compounds for their ability to restore secretory SFFV–WPRE–cDNA, the packaging plasmid psPAX2 and pMD2.G lysosome degranulation in FHL3. using calcium phosphate transfection. After 18 h medium was replaced with 6 ml fresh medium. Twenty four hours later, virus 2. Materials and methods was harvested and new medium added for a final period of 24 h. Virus containing supernatants were stored at 4 °C, pooled and 2.1. Antibodies and reagents filtered through 0.2 μm.Virusstockswereconcentrated100fold by centrifugation for 2 h at 25,000 rpm in a SW-28 rotor. The Antibodies were obtained from the indicated sources: p80 concentration procedure removed HEK293T medium which was mouse hybridoma 5G10 (J. Bonifacino, NIH Bethesda), mouse detrimental to normal RBL-2H3 growth. Virus was resuspended anti serotonin (DAKO), mouse anti rat CD63 (BD Biosciences), in 0.01 volume RBL-2H3 medium supplemented with 20 mM mouse IgE anti DNP clone SPE-7 and corresponding antigen HSA- Hepes pH 7.6, aliquotted and stored at −80 °C. Virus efficiency DNP (Sigma), mouse anti GFP (Roche), conjugated secondary was determined by titration on HEK293T and RBL-2H3 cells antibodies (Jackson Immuno Research Laboratories). The rabbit through fluorescence microscopy and western blot detection. antibody against munc13-4 has been described (Neeftetal., 2005). Following plasmids were generously provided by indi- 2.4. Generation and maintenance of stable RBL-2H3 lines cated colleagues: peYFP-N1-Munc13-4 cDNA (V.Gerke, ZMBE Münster), pLNT-SFFV-WPRE-Gateway (G. Griffiths, CIMR Cam- RBL-2H3 cells stably expressing lentiviral constructs were bridge), lentiviral helper plasmids psPAX2 and pMD2.G made by infecting a 50% confluent 10 cm dish with 10 μlof (A. Mertens UMC Utrecht). cDNAs encoding human munc13-4 concentrated virus in the presence of 6 μgml−1 polybrene in and munc13-4-Δ608-611 were generated previously in this lab 10 ml medium. Medium was replaced after 24 h and cells were (Neeftetal.,2005). allowed to expand for another 24 h. Cells were then cultured and evaluated for expression. Typical transduction efficiencies were 2.2. Cell culture 70%. Cells were collected after two weeks for FACS sorting and we sorted a 99% positive cell population of at least 5×105 cells using The RBL-2H3 cell line was generously provided by Ronit Sagi a FACSAria (BD). Cells were then transferred to 10 cm dishes for Eisenberg (Tel Aviv University) and cloned by limited dilution to maintenance culture. Lentiviruses reverse transcribe their RNA obtain clones in which β-hexosaminidase secretion could be and integrate the newly made DNA into the chromatin stimulated to yield at least 30% release. The cells were cultured in (Bukrinsky et al., 1993). In our hands selection or resorting was DMEM containing 1 mg ml−1 glucose, 10% heat-inactivated FCS not needed within 2 months after transduction, since expression (Bodinco), 100 Uml−1 penicillin, 100 μgml−1 streptomycin, levels remained constant during this period. If expression drops 2mM L-glutamine, 50 nM 2-mercaptoethanol and passaged 3 however, cells can easily be sorted as above to enrich for times a week 1/20. Degranulation of RBL-2H3 cells is influenced transfectants with higher expression. by FCS and care was taken to obtain a batch that did not affect degranulation. HEK293T were cultured in DMEM (Invitrogen) 2.5. Western blot and siRNA 5mgml−1 glucose, 10% heat-inactivated fetal calf serum (Sigma), 100 Uml−1 penicillin, 100 μgml−1 streptomycin and For Western blot, 1×106 RBL-2H3 cells were lysed in 250 μl 2mML-glutamine. 1% Triton X-100, 100 mM NaCl, 50 mM Tris–HCl pH 7.6. Lysates were cleared by centrifugation and collected in 5× Laemmli 2.3. Lentivirus preparation buffer containing 10% SDS, 50% glycerol, 0.625 M Tris–HCl pH 6.8, 250 mM DTT 0.01% Bromophenol blue. Samples were YFP-tagged munc13-4 cDNAs were extended with attB electrophoresed through 7.5% SDS-PAA gels and blotted on sites for cloning in pDONr201 (Invitrogen). After amplifica- Immobilon-FL PVDF (Millipore). Blots were analyzed for tion inserts were transferred to the lentiviral plasmid pLNT– munc13-4, YFP and actin using primary antibodies described SFFV–WPRE–Gateway (Demaison et al., 2002)usingLR above. Secondary alexa680 or IrDye800 fluorescent antibodies Clonase II (Invitrogen). This lentiviral plasmid was developed were used for detection in the Odyssey imaging system (Li-Cor). to induce gene expression in hematopoietic cells using a Antibody incubations were typically 45 min, followed by three spleen focus forming virus (SFFV) promoter, Woodchuck washing steps in blocking buffer (Li-Cor). siRNA depletion of hepatitis virus posttranscriptional regulatory element endogenous rat munc13-4 in RBL-2H3 cells was done through a (WPRE), central polypurine tract (cPPT) and appended with sequence targeting the ORF of rat munc13-4; GGAACAA- a gateway cloning cassette between the long terminal repeats GAUUUUUCACAAtt (Applied Biosystems). The siRNA was (LTR). Primers GGGGACAAGTTTGTACAAAAAAGCAGGCTT- introduced using AMAXA nucleofection (Lonza), 100 μl buffer CATGGTGAGCAAGGGCGAGGAGCTG (f), GGGGACCACTTTGTA- T, protocol X-001 according to manufacturers' instructions. 60 E. Elstak et al. / Journal of Immunological Methods 365 (2011) 58–66

1×106 cells were transfected with 20 μl20μMoligo loss of fluorescence using a ROI of the whole cell. The signal of the (400 pmol), seeded in 2 ml full medium in a 6 cm dish and dye FM4-64 was used to distinguish activated from resting cells. grown for 48 h, knock-down efficiency was typically over 90%. Very little FM4-64 is found intracellularly in a resting cell, while in activated cells fusion of vesicles and subsequent membrane 2.6. Immunofluorescence microscopy closure at the plasma membrane permit the dye to enter. Recovery curves were drawn in Excel, and fitted to a mono Transfected RBL-2H3 cells were grown on coverslips, fixed exponential equation from which recovery parameters were for 20 min at room temperature using 3% paraformaldehyde calculated with Origin 6.1 (OriginLab). and blocked in 0.5% BSA, 0.1% saponin in PBS. Cells were subsequently incubated with primary and fluorescently 3. Results labelled secondary antibody for 45 min. Unbound antibodies were removed by washing with blocking buffer. Coverslips 3.1. Preparation of cell lines were washed and mounted using Prolong gold (Invitrogen). Imaging was performed on a Zeiss LSM 510 confocal The involvement of munc13-4 in degranulation has been microscope equipped with a Ar/Kr laser for 488 nm and a firmly established in a number of haematopoietic cell lines. We He–Ne laser for 543 nm, using a Plan-Apochromat 63×/1.40 originally detected high levels of munc13-4 in RBL-2H3 cells and oil objective. Microscope parameters were set to detect showed that it has a positive role on stimulus induced optimal signals below the saturation limits. Quantitation of degranulation (Neeft et al., 2005). Given the ease of culturing overlapping signals in different channels was done with the and experimental manipulation, we used the RBL-2H3 as a model colocalization tool of ImageJ and expressed as Pearson's cell line for characterization of munc13-4. To establish the coefficient (Bolte and Cordelieres, 2006). analytical methods we chose three constructs: YFP-Munc13-4, Munc13-4-YFP and YFP-Munc13-4Δ608-611 (YFP-Δ608-611). 2.7. Degranulation assay The latter represents a FHL3 mutant which contains an in frame internal deletion of 3 amino acids and was used here for proof of RBL-2H3 cells (2×106) were washed in 1 ml DMEM principle purposes because it exhibits a robust morphological containing 1% FCS (SDMEM) and incubated for 30 min at phenotype (Neeft et al., 2005). Fluorescent protein tags may 37 °C in 0.5 ml SDMEM containing 50 ng ml−1 IgE anti DNP. interfere with functionality of proteins and it has not been RBL-2H3 loaded with IgE anti DNP can be activated by rigorously established whether N- or C-terminal fusion proteins multivalent DNP–HSA conjugate. Cells were washed, and of munc13-4 and YFP are functionally equivalent (Neeft triplicate samples of 150 μl were incubated for 1 h at 37 °C in et al., 2005; Stevens et al., 2005). We therefore prepared N- and SDMEM containing 500 ng ml−1 DNP–HSA. Incubations with C-terminally YFP-tagged wild type munc13-4 constructs to HSA (spontaneous release), and 0.2% TX-100 (total lysis) were directly test their behavior in several assays reporting on used as negative and positive control, respectively. 50 μl munc13-4 features. supernatant was harvested and added to 50 μl2mM Reproducibility in single cell assays can be improved by p-nitrophenyl-N-acetyl-β-D-glucosaminide (Sigma) for 1 h at generating stable cell lines with high transfection efficiency and 37 °C in a 96-well plate. β-hexosaminidase activity was uniformexpressiononapercellbasis.Sinceelectroporationand determined colorimetrically at 405 nm after adding 150 μl cationic lipid transfection methods did not meet these criteria, 0.1 M carbonate buffer pH 10. Alternatively, degranulation we cloned munc13-4 cDNAs in the pLNT–SFFW–WPRE lenti- was induced by 100 nM phorbol 12-myristate 13-acetate (PMA, viral expression plasmid (Fig. 1A). This plasmid enables Sigma) and 1 μM ionomycin (Calbiochem) with DMSO as genomic integration in non-dividing cells and makes use of a negative control and β-hexosaminidase release was assayed viral promoter that ensures expression in hematopoietic cells as above. (Bukrinsky et al., 1993; Demaison et al., 2002). VSV-G pseudotyped lentiviral vectors were created in HEK293-T cells 2.8. Fluorescence recovery after photobleaching (FRAP) and concentrated 100 times for infection of RBL-2H3. Expres- sing populations were enriched by sorting using FACSaria to FRAP was determined on live cells using a Zeiss LSM510 obtain a 99% positive cell population. Integration of sequences microscope with live cell imaging chamber at 37 °C and 5% CO2. into a host genome can impair function of the gene at the RBL-2H3 grown on 25 mm coverslips were transferred to integration site (Wentzensen et al., 2004). To minimize imaging chambers filled with 750 μlSDMEMforFRAPexperi- potential effects of clonal expansion of a single interrupted ments. Activation of cells was done by adding 250 μlSDMEM, gene, we sorted at least 5×105 cells. The stable introduction of 4 μM ionomycin, 400 nM PMA, 800 nM FM4-64 to the live cell munc13-4 constructs did not affect cell growth. Transfection imaging chamber. Cells were activated pharmacologically to efficiency was above 93% after one month of culturing without induce a faster and more homogeneous response. Imaging was selection drug (Fig. 1B). started 90 s after the addition of the drugs, when most cells We checked expression of munc13-4 in the sorted cell lines showed first signs of degranulation. Frames were recorded in the by Western blot (Fig. 2A). YFP-tagged munc13-4 forms run at red (560 nm long pass) and green (505–530 nm band pass) 140 kDa. For YFP-munc13-4 we detected a degradation band that channel every 3 s. Bleach settings were 8 pulses of the 488 ran close to the position of endogenous munc13-4 at 110 kDa. laserline at max laser power after the first 5 frames. Cells were The expression levels of munc13-4-YFP and YFP-Δ608-611 were imaged for 3 min after bleaching. Recovery was determined as somewhat lower than of YFP-munc13-4 suggesting that they the recovery of the fluorescence in the region of interest have a higher turnover rate than YFP-munc13-4. Attempts to corrected for the background signals outside the cells and for enhance their expression using more virus and FACS enrichment E. Elstak et al. / Journal of Immunological Methods 365 (2011) 58–66 61

Fig. 1. Cloning strategy and sorting of stable RBL-2H3 cell lines. Layout of the lentiviral plasmid pLNT showing regulatory elements, the Gateway cloning site and the three cDNAs that were introduced for stable cell line generation (A). Transfected and sorted cells were evaluated with FACS after a month to test stability of expression. Fluorescent signals in FL-1 (530 nm) of nontransfected cells RBL-2H3 (blue), intermediate expression of munc13-4-YFP (black) and YFP-Δ608-611 (green) and high expression of YFP-munc13-4 (red) (B).

had minimal effect as seen in the FACS diagrams (Fig. 1B). The lysosomes, while serotonin is stored within the lumen of different results obtained with the YFP tag on N- or C-terminus of secretory lysosomes. Quantitation of colocalization with ImageJ munc13-4 therefore suggested that C-terminal tagging increased showed that nearly all (85±4%) of CD63-labeled structures turn-over of munc13-4. We showed before that YFP-Δ608-611 were positive for YFP-munc13-4 (Fig. 2B), which implies that does not bind membranes because its conformation is altered munc13-4 is located on a subset of lysosomes in RBL-2H3 cells. which also might reduce its stability (Neeftetal.,2005). The secretory lysosomes in RBL-2H3 that labeled for serotonin are all positive for YFP-munc13-4 (Fig. 2C). The munc13-4-YFP 3.2. Localization of munc13-4 construct also localized to CD63 and serotonin structures, but intensity of the signal was lower as was expected from the

YFP-munc13-4 and His6munc13-4 localize to secretory expression data (Fig. 1B) and the extent of colocalization was lysosomes after transfection of RBL-2H3 cells by electroporation slight less (68±6%) than for YFP-munc13-4. We did not (Neeft et al., 2005). The observation that munc13-4-YFP observe differences in the ratio of membrane-bound versus consistently gave a somewhat lower expression than YFP- cytoplasmic fluorescence signals between the munc13-4 con- munc13-4 (Fig. 2A), suggested that the C-terminal tag might structs with the tag at N or C-terminus. We also used lentiviral interfere with the function of munc13-4. Earlier studies found expression to assess the distribution of YFP-Δ608-611. The FHL3 munc13-1-GFP to localize to the plasma membrane of adrenal mutant distributed exclusively in the cytoplasm, and was not medulla chromaffin cells. Munc13-1-GFP also supports the found on the CD63 and serotonin positive structures, in priming of large dense core vesicle for exocytosis (Ashery et al., agreement with our previous results using transient transfec- 2000; Madison et al., 2005), but since the Sindbis system drives tion (Neeft et al., 2005). very high expression, partial loss of function might be compensated for by overexpression. To begin to address the 3.3. Rescue assay β-hexosaminidase comparative functionality of N-, or C-terminally tagged munc13-4, we assessed their intracellular distribution. The Stimulated release of β-hexosaminidase from secretory transduced RBL-2H3 cell lines were prepared for fluorescence granules is a sensitive read-out of degranulation efficiency. microscopy and labeled for CD63, and serotonin (Neeft et al., Our experimental strategy to use the RBL-2H3 cell line for 2005). The first represents a typical membrane marker for complementation experiments of degranulation relied on the 62 E. Elstak et al. / Journal of Immunological Methods 365 (2011) 58–66

Fig. 2. Expression and localization of munc13-4 constructs in RBL-2H3. RBL-2H3 cells stably transduced with lentiviruses and sorted for YFP-signal were used for Western blot detection of munc13-4 and actin. Open and closed arrow heads indicate positions of ectopically expressed and endogenous munc13-4, respectively. The asterisk marks a degradation product of YFP-munc13-4 close to the endogenous munc13-4 (A). Confocal images of exogenous munc13-4 (green) localization in RBL-2H3 labeled for rat CD63 (red). Scale bars are 5 μm (B). Confocal images of exogenous munc13-4 (green) localization in RBL-2H3 labeled for serotonin (red). Scale bars are 5 μm, and images are from a single optical section (C).

ability to express siRNA resistant munc13-4 constructs and munc13-4 with YFP at the C-terminus was ~50% less effective. then to selectively knock down endogenous munc13-4. Cells expressing munc13-4-YFP released β-hexosaminidase to a Because human munc13-4 and rat munc13-4 (rmunc13-4) lesser extent than cells treated with a scrambled siRNA. Thus sequences are 86% identical, they very likely serve identical even though there was more munc13-4-YFP than endogenous functions. The region in rmunc13-4 that is targeted by the levels in the control cells, degranulation nevertheless was siRNA, has 3 mismatches with the corresponding sequence in impaired (Fig. 2A), strongly suggesting that positioning of the munc13-4, rendering the latter resistant to the siRNA. Indeed, YFP-tag at the C-terminus affected the function of the protein. while knock-down efficiency of rmunc13-4 is 90% using The FHL3 mutant YFP-Δ608-611 failed to rescue the secretion Amaxa electroporation (Fig. 3A), YFP-hmunc13-4 expression defect since the extent of β-hexosaminidase release was was not affected by the siRNA, nor was knock-down of statistically not different from cells with silenced munc13-4 rmunc13-4 diminished when a full length hmunc13-4 (Fig. 3B). In summary the complementation of degranulation construct was expressed (Fig. 3A). Transduction with the assay in RBL-2H3 cells faithfully recapitulated the secretion munc13-4 constructs yielded uniform expression (Fig. 1B). phenotype of FHL3 mutations in cytotoxic lymphocytes. Over 99% of the cells in the lentivirally transduced RBL-2H3 RBL-2H3 cells can also be triggered to degranulate by cell lines expressed the transfected cDNA product, ensuring ionomycin and PMA. This treatment elevates intracellular that results of bulk assays are not obscured by contamination calcium and activates PKC, independent of FcεRI signaling with non-transfected cells. We then determined degranulation pathways. We performed the degranulation assays using efficiency of RBL-2H3 cells with silenced munc13-4. The cells this experimental regimen and found that cells released were activated with IgE anti DNP/DNP-HSA, and β-hexosamin- more β-hexosaminidase than after triggering via FcεRI (cf idase was measured colorometrically in medium and in the cells. siRNA bars in Fig. 3B and C). Evidently PMA/ionomycin The release of β-hexosaminidase was diminished by 80% (Fig. 3B) releases β-hexosaminidase not only from stores that are showing that munc13-4 is essential for degranulation in RBL-2H3 regulated via FcεRI signaling and munc13-4. In agreement cells. In cells expressing YFP-munc13-4 we obtained a complete with this notion, the effect of munc13-4 knock down is similar rescue of the β-hexosaminidase secretion defect. In contrast as in Fig. 3B, but a substantial fraction of β-hexosaminidase can E. Elstak et al. / Journal of Immunological Methods 365 (2011) 58–66 63 still be released from the cells by PMA/ionomycin (Fig. 3C). This sated for. Again we observed that the FHL3 mutant did not has also been observed in mast cells isolated from VAMP8 rescue. Thus both activation methods can be used in the knock-out mice, and suggests that munc13-4 regulates secre- complementation assay. The physiological pathway via the tion of a subset of secretory granules in RBL-2H3 (Puri and FcεRI however has the advantage that it can better resolve Roche, 2008). Under these conditions munc13-4-YFP rescued differences because functionality of munc13-4 constructs. secretion equally well as YFP-munc13-4, suggesting that loss of munc13-4 function due to the C-terminal tag can be compen- 3.4. Fluorescence recovery after photobleaching

Munc13-4 was initially purified from cytosol but localizes to granules in microscopy assays (Neeft et al., 2005). The MHD domains of munc13-4 are for required membrane-attachment, which might be co-regulated by the Ca2+ containing C2B domain that associates specifically with PIP and PIP2 lipids (Shin et al., 2010). Because munc13-4 also lacks a membrane anchor, it likely behaves as a peripheral membrane protein that can be exchanged from membranes to the cytoplasm. The dynamics of this process can be regulated through signaling pathways and associations with other proteins. We investigat- ed the exchange rates of munc13-4 using fluorescent recovery after photobleaching (FRAP). With FRAP we can bleach YFP- munc13-4 that is on membranes and record the kinetics and level of recovery onto membranes. Recovery occurs when molecules that are released from the membrane are exchanged with those of the cytosol. We adjusted the LSM live cell microscopys system to image at 1.5 s per frame, and collected YFP (green) and FM4-64 (red) signals in subsequent frames. The munc13-4 signal on the larger granules (N0.5 μm) could be easily detected using low laser power and resolution settings. These structures display limited mobility which renders them less likely to move out of the region of interest during imaging. In the stable cell lines without rmunc13-4, distinct granular structures were bleached and recovery of fluorescent signal on these structures was measured. Two parameters can be derived; first the percentage of recovery, which indicates the fraction of freely exchangeable molecules on the membrane and second the halftime of recovery, the time when half of the intensity is recovered, representing the on/off rate. In resting RBL-2H3 cells, YFP-munc13-4 recovery is 76±3% with a halftime of recovery (t1/2) of 54±1 s (Fig. 4A–C), indicating a transient binding with high exchange rates of munc13-4. Munc13-4-YFP recovered to 79±1% with a t1/2 of 48±3 s (Fig. 4A, B, D). The higher exchange rate of munc13-4-YFP compared to YFP-munc13-4, likely reflects less tight binding to the membrane induced by the C-terminal YFP-tag. Activation of RBL-2H3 leads to fusion of secretory lysosomes with the plasma membrane. If munc13-4 is involved in the

Fig. 3. Rescue of secretion in RBL-2H3 after knock-down of endogenous munc13-4. RBL-2H3 cells stably transfected with lentivirus and sorted for munc13-4 were treated with a siRNA targeting munc13-4 or control siRNA. Cell lysates were used for Western blot detection of munc13-4 and actin. Quantification showed that the siRNA gave 90% knock down of rat munc13-4. Open and closed arrow heads denote ectopically expressed and endoge- nous munc13-4. The dot next to the YFP-munc13-4 lane indicates a degradation product with mobility close to that of endogenous munc13-4 (A). β-hexosaminidase secretion after activation of RBL-2H3 by FcεRI crosslinking was measured in control, knock down and rescue conditions. The extent of released β-hexosaminidase is expressed as % of the total amount of β-hexosaminidase that is present in the cells. Samples are averages of four independent experiments, *pb0.05, ** pb0.005 (B). β-hexosaminidase secretion after activation of RBL-2H3 by ionomycin and PMA was measured in control, knock down and rescue conditions. Samples are averages of two independent experiments (C). 64 E. Elstak et al. / Journal of Immunological Methods 365 (2011) 58–66

Fig. 4. FRAP on munc13-4 in RBL-2H3 shows munc13-4 binding after activation. YFP-positive secretory lysosomes were bleached as described in the Materials and methods section and recovery of fluorescence was measured over time to evaluate protein exchange on the membrane of secretory lysosomes. FRAP experiments were performed on resting and degranulating cells. Activated cells were identified by intracellular FM4-64 staining as described in the Materials and methods section. Recovery percentages for YFP-munc13-4, munc13-4-YFP and YFP-Δ608-611(A), halftime of recovery for YFP-munc13-4, munc13-4-YFP and YFP-Δ608-611 (B). Recovery curves of YFP-munc13-4 (C) and munc13-4-YFP (D) in resting and activated cells. RBL-2H3 YFP-munc13-4 cells labeled with FM4-64 dye in resting and activated state (E). Error bars denote SEM of three independent experiments. Scale bars are 5 μm. process of trans SNARE complex formation, it might become inserts in the plasma membrane but does not transverse it more tightly bound to membranes. Cells were activated using (Fig. 4E top). Upon activation, secretory lysosomes fuse with ionomycin and PMA, which orchestrates a highly synchronized the plasma membrane and as a consequence of which, become secretory response. Cells were co-incubated with FM4-64 accessible to FM4-64 (Fig. 4E, bottom). We found that recovery during activation because it allows for the positive identifica- was reduced to 60±1% (YFP-munc13-4) and 59±7% tion of an activated cell during image collection. The lipid dye (munc13-4-YFP), which implies that an increased fraction of E. Elstak et al. / Journal of Immunological Methods 365 (2011) 58–66 65 the munc13-4 molecules can no longer be exchanged from References membranes (Fig. 4A, C, D). The t1/2 is increased to 60±2 s (YFP-munc13-4) and 63±5 s (munc13-4-YFP), suggesting Arico, M., Nespoli, L., Maccario, R., Montagna, D., Bonetti, F., Caselli, D., Burgio, G.R., 1988. Natural cytotoxicity impairment in familial haemophagocytic tighter binding of munc13-4 with the secretory lysosome lymphohistiocytosis. Arch. Dis. Child. 63, 292. membrane. The difference in t1/2 of YFP-munc13-4 and Ashery, U., Varoqueaux, F., Voets, T., Betz, A., Thakur, P., Koch, H., Neher, E., munc13-4-YFP is diminished after activation (Fig. 4B), which Brose, N., Rettig, J., 2000. Munc13-1 acts as a priming factor for large β dense-core vesicles in bovine chromaffin cells. EMBO J. 19, 3586. agrees well with changes seen on -hexosaminidase release. Bolte, S., Cordelieres, F.P., 2006. A guided tour into subcellular colocalization The FHL3 mutant YFP-Δ608-611 did not localize to membranes analysis in light microscopy. J. Microsc. 224, 213. and recovery resembles that of a cytosolic molecule with free Bukrinsky, M.I., Haggerty, S., Dempsey, M.P., Sharova, N., Adzhubel, A., Spitz, diffusion, resulting in diffusion like kinetics that approach L., Lewis, P., Goldfarb, D., Emerman, M., Stevenson, M., 1993. A nuclear localization signal within HIV-1 matrix protein that governs infection of effective diffusion models (Fig. 4A, B) (Sprague et al., 2004). non-dividing cells. Nature 365, 666. Cesaro, S., Locatelli, F., Lanino, E., Porta, F., Di Maio, L., Messina, C., Prete, A., Ripaldi, M., Maximova, N., Giorgiani, G., Rondelli, R., Arico, M., Fagioli, F., 4. Discussion 2008. Hematopoietic stem cell transplantation for hemophagocytic lymphohistiocytosis: a retrospective analysis of data from the Italian FHL3 is a severe genetic disorder caused by mutations in Association of Pediatric Hematology Oncology (AIEOP). Haematologica 93, 1694. UNC13D which codes for an essential factor in degranulation Cetica, V., Pende, D., Griffiths, G.M., Arico, M., 2010. Molecular basis of familial of cytotoxic lymphocytes (Feldmann et al., 2003). A hallmark hemophagocytic lymphohistiocytosis. Haematologica 95, 538. of the disease is the uncontrolled proliferation of activated Crozat, K., Hoebe, K., Ugolini, S., Hong, N.A., Janssen, E., Rutschmann, S., Mudd, S., Sovath, S., Vivier, E., Beutler, B., 2007. Jinx, an MCMV lymphocytes and histiocytes that invade healthy organs as susceptibility phenotype caused by disruption of Unc13d: a mouse liver, spleen and brain. FHL3 usually presents before the age model of type 3 familial hemophagocytic lymphohistiocytosis. J. Exp. of 2 and is fatal unless treated. UNC13D is a large 4.4 kb gene Med. 204, 853. Demaison,C.,Parsley,K.,Brouns,G.,Scherr,M.,Battmer,K.,Kinnon,C.,Grez,M., with 32 exons, in which over 50 mutations have been Thrasher, A.J., 2002. High-level transduction and gene expression in reported (Cetica et al., 2010). A number of which encode hematopoietic repopulating cells using a human immunodeficiency [correc- point mutants or truncated forms of munc13-4. Information tion of imunodeficiency] virus type 1-based lentiviral vector containing an – internal spleen focus forming virus promoter. Hum. Gene Ther. 13, 803. on large scale phenotype genotype correlations is not Feldmann,J.,Callebaut,I.,Raposo,G.,Certain,S.,Bacq,D.,Dumont,C.,Lambert,N., available, and we know little about the properties of the Ouachee-Chardin,M.,Chedeville,G.,Tamary,H.,Minard-Colin,V.,Vilmer,E., mutants that are expressed. This is in part caused by the Blanche, S., Le Deist, F., Fischer, A., de Saint Basile, G., 2003. Munc13-4 is fi fi essential for cytolytic granules fusion and is mutated in a form of familial dif culty in obtaining suf cient material from the young and hemophagocytic lymphohistiocytosis (FHL3). Cell 115, 461. oftentimes very sick patients for research. Filipovich, A.H., 2006. Hemophagocytic lymphohistiocytosis and related The RBL-2H3 cell line already showed its potential as a disorders. Curr. Opin. Allergy Clin. Immunol. 6, 410. fi model for the molecular analysis of ectopically expressed Gil llan, A.M., Tkaczyk, C., 2006. Integrated signalling pathways for mast-cell activation. Nat. Rev. Immunol. 6, 218. perforin (FHL2) mutations (Shiver et al., 1992; Risma et al., Henter, J.I., Elinder, G., Soder, O., Hansson, M., Andersson, B., Andersson, U., 2006; Voskoboinik and Trapani, 2006; Voskoboinik et al., 1991. Hypercytokinemia in familial hemophagocytic lymphohistiocytosis. 2007). We extended its utility and here developed a simple Blood 78, 2918. Kapp-Barnea, Y., Melnikov, S., Shefler, I., Jeromin, A., Sagi-Eisenberg, R., 2003. complementation assay to study the requirements of Neuronal calcium sensor-1 and phosphatidylinositol 4-kinase beta munc13-4 in degranulation. The method relied on the stable regulate IgE receptor-triggered exocytosis in cultured mast cells. J. expression of YFP-munc13-4 constructs using lentiviral Immunol. 171, 5320. Kepley, C.L., Wilson, B.S., Oliver, J.M., 1998. Identification of the Fc epsilonRI- transduction in combination with siRNA of endogenous activated tyrosine kinases Lyn, Syk, and Zap-70 in human basophils. J. Allergy munc13-4. We showed here that the assay can be used for Clin. Immunol. 102, 304. the quantitative analysis of FHL3 mutants in secretory Madison, J.M., Nurrish, S., Kaplan, J.M., 2005. UNC-13 interaction with syntaxin is required for synaptic transmission. Curr. Biol. 15, 2236. lysosome degranulation. Other fundamental aspects of Menager, M.M., Menasche, G., Romao, M., Knapnougel, P., Ho, C.H., Garfa, M., munc13-4 function can also be investigated conveniently by Raposo, G., Feldmann, J., Fischer, A., de Saint Basile, G., 2007. Secretory using this model system examples including its role in cytotoxic granule maturation and exocytosis require the effector protein hMunc13-4. Nat. Immunol. 8, 257. maturation of secretory lysosomes (Menager et al., 2007) Neeft,M.,Wieffer,M.,deJong,A.S.,Negroiu,G.,Metz,C.H.,vanLoon,A.,Griffith, J., and the function of munc13-4 in complex with its upstream Krijgsveld, J., Wulffraat, N., Koch, H., Heck, A.J., Brose, N., Kleijmeer, M., van der regulator rab27 in the degranulation process. Sluijs, P., 2005. Munc13-4 is an effector of rab27a and controls secretion of The RBL-2H3 assay also provides incentives for the develop- lysosomes in hematopoietic cells. Mol. Biol. Cell 16, 731. Nomura, H., Ohtsuka, T., Tadokoro, S., Tanaka, M., Hirashima, N., 2009. ment of screens with small compound libraries to search for Involvement of ELKS, an active zone protein, in exocytotic release from drugs that can overcome degranulation defects caused by RBL-2H3 cells. Cell. Immunol. 258, 204. expressed FHL3 mutants. These could be of biomedical utility Ohga, S., Kudo, K., Ishii, E., Honjo, S., Morimoto, A., Osugi, Y., Sawada, A., Inoue, M., Tabuchi, K., Suzuki, N., Ishida, Y., Imashuku, S., Kato, S., Hara, T., 2010. for designing novel therapeutic modalities towards FHL3. Hematopoietic stem cell transplantation for familial hemophagocytic lymphohistiocytosis and Epstein–Barr virus-associated hemophagocytic lymphohistiocytosis in Japan. Pediatr. Blood Cancer 54, 299. Acknowledgments Pivot-Pajot, C., Varoqueaux, F., de Saint Basile, G., Bourgoin, S.G., 2008. Munc13-4 regulates granule secretion in human neutrophils. J. Immunol. 180, 6786. We would like to thank G. Spierenburg (Dept. Immunology, Puri, N., Roche, P.A., 2008. Mast cells possess distinct secretory granule subsets whose exocytosis is regulated by different SNARE isoforms. Proc. UMC Utrecht) for cell sorting. The study was in part funded by the Natl Acad. Sci. USA 105, 2580. Dutch Cancer Society Koningin Wilhelmina Fonds (PvdS). The Risma, K.A., Frayer, R.W., Filipovich, A.H., Sumegi, J., 2006. Aberrant imaging facilities were financed by the Netherlands Organization maturation of mutant perforin underlies the clinical diversity of hemophagocytic lymphohistiocytosis. J. Clin. Invest. 116, 182. for Medical Research (ZonMW) and the University Medical Roa, M., Paumet, F., Le Mao, J., David, B., Blank, U., 1997. Involvement of the Center Utrecht. ras-like GTPase rab3d in RBL-2H3 mast cell exocytosis following 66 E. Elstak et al. / Journal of Immunological Methods 365 (2011) 58–66

stimulation via high affinity IgE receptors (Fc epsilonRI). J. Immunol. 159, Stepp, S.E., Dufourcq-Lagelouse, R., Le Deist, F., Bhawan, S., Certain, S., 2815. Mathew, P.A., Henter, J.I., Bennett, M., Fischer, A., de Saint Basile, G., Rohlich, P., Anderson, P., Uvnas, B., 1971. Electron microscope observations Kumar, V., 1999. Perforin gene defects in familial hemophagocytic on compounds 48–80-induced degranulation in rat mast cells. Evidence lymphohistiocytosis. Science 286, 1957. for sequential exocytosis of storage granules. J. Cell Biol. 51, 465. Stevens, D.R., Wu, Z.X., Matti, U., Junge, H.J., Schirra, C., Becherer, U., Wojcik, S.M., Rudd, E., Bryceson, Y.T., Zheng, C., Edner, J., Wood, S.M., Ramme, K., Gavhed, Brose, N., Rettig, J., 2005. Identification of the minimal protein domain S., Gurgey, A., Hellebostad, M., Bechensteen, A.G., Ljunggren, H.G., Fadeel, required for priming activity of Munc13-1. Curr. Biol. 15, 2243. B., Nordenskjold, M., Henter, J.I., 2008. Spectrum, and clinical and Tadokoro, S., Nakanishi, M., Hirashima, N., 2010. Complexin II regulates functional implications of UNC13D mutations in familial haemophagocytic degranulation in RBL-2H3 cells by interacting with SNARE complex lymphohistiocytosis. J. Med. Genet. 45, 134. containing syntaxin-3. Cell. Immunol. 261, 51. Santoro, A., Cannella, S., Bossi, G., Gallo, F., Trizzino, A., Pende, D., Dieli, F., Voskoboinik, I., Trapani, J.A., 2006. Addressing the mysteries of perforin Bruno, G., Stinchcombe, J.C., Micalizzi, C., De Fusco, C., Danesino, C., function. Immunol. Cell Biol. 84, 66. Moretta, L., Notarangelo, L.D., Griffiths, G.M., Arico, M., 2006. Novel Voskoboinik, I., Sutton, V.R., Ciccone, A., House, C.M., Chia, J., Darcy, P.K., Munc13-4 mutations in children and young adult patients with Yagita, H., Trapani, J.A., 2007. Perforin activity and immune homeostasis: haemophagocytic lymphohistiocytosis. J. Med. Genet. 43, 953. the common A91V polymorphism in perforin results in both presynaptic Shin,O.H.,Lu,J.,Rhee,J.S.,Tomchick,D.R.,Pang,Z.P.,Wojcik,S.M.,Camacho-Perez, and postsynaptic defects in function. Blood 110, 1184. M., Brose, N., Machius, M., Rizo, J., Rosenmund, C., Sudhof, T.C., 2010. Munc13 Wentzensen, N., Vinokurova, S., von Knebel Doeberitz, M., 2004. Systematic C2B domain is an activity-dependent Ca2+ regulator of synaptic exocytosis. review of genomic integration sites of human papillomavirus genomes in Nat. Struct. Mol. Biol. 17, 280. epithelial dysplasia and invasive cancer of the female lower genital tract. Shirakawa, R., Higashi, T., Tabuchi, A., Yoshioka, A., Nishioka, H., Fukuda, M., Kita, Cancer Res. 64, 3878. T., Horiuchi, H., 2004. Munc13-4 is a GTP-Rab27-binding protein regulating zur Stadt, U., Schmidt, S., Kasper, B., Beutel, K., Diler, A.S., Henter, J.I., Kabisch, dense core granule secretion in platelets. J. Biol. Chem. 279, 10730. H., Schneppenheim, R., Nurnberg, P., Janka, G., Hennies, H.C., 2005. Shiver, J.W., Su, L., Henkart, P.A., 1992. Cytotoxicity with target DNA Linkage of familial hemophagocytic lymphohistiocytosis (FHL) type-4 to breakdown by rat basophilic leukemia cells expressing both cytolysin chromosome 6q24 and identification of mutations in syntaxin 11. Hum. and granzyme A. Cell 71, 315. Mol. Genet. 14, 827. Smith, A.J., Pfeiffer, J.R., Zhang, J., Martinez, A.M., Griffiths, G.M., Wilson, B.S., zur Stadt, U., Rohr, J., Seifert, W., Koch, F., Grieve, S., Pagel, J., Strauss, J., Kasper, B., 2003. Microtubule-dependent transport of secretory vesicles in RBL-2H3 Nurnberg, G., Becker, C., Maul-Pavicic, A., Beutel, K., Janka, G., Griffiths, G., cells. Traffic 4, 302. Ehl, S., Hennies, H.C., 2009. Familial hemophagocytic lymphohistiocytosis Sprague, B.L., Pego, R.L., Stavreva, D.A., McNally, J.G., 2004. Analysis of binding type 5 (FHL-5) is caused by mutations in Munc18-2 and impaired binding reactions by fluorescence recovery after photobleaching. Biophys. J. 86, 3473. to syntaxin 11. Am. J. Hum. Genet. 85, 482.