Advances in dermatology and venereology ActaDV Acta Dermato-Venereologica ActaDV lesions displayanalteredsequenceandexpres cells isdisturbed. The keratinocytesinactivepsoriatic phology (1). in termsof expression, function and cellular mor­ features specific by characterized is layers these of Each stages to form the spinous, granular and cornified layers. from thebasallayerofepidermisthroughdistinct differentiation. Inthisprocess,thekeratinocytesprogress pression in psoriatic keratinocytes (3),where it wasfound identified. differentiation ofpsoriatickeratinocytes havenotbeen the mediatorsthatareresponsible forthedysregulated sion levelsofthedifferentiation markers(2).However, T 85 Linköping,Sweden. E-mail:[email protected] ment of and Clinical Experimental Medicine, Linköping University, SE-581 Corr: Charlotta Enerbäck, Ingrid Asp Research Center, Depart Acta DermVenereol 2017;97:441–448. Accepted Dec12,2016;Epubaheadofprint13,2016 psoriasis. Key words: psoriasin;S100A7; differentiation; keratinocyte; the psoriasisepidermis. tributes to the dysregulated differentiation process in con psoriasin that suggest findings These epidermis. ofan expressionpattern that reminiscent inpsoriatic to analtered regulation ofdifferentiation genesand of psoriasin,mimickingthepsoriaticmilieu,gaverise ferentiation. Thelentivirus-mediated overexpression moglein 1, transglutaminase 1 and CD24 in normal dif psoriasin mediates theexpressionof involucrin, des sin expression by small interfering RNA revealed that tein kinaseCpathway.Thedownregulation of psoria sin expression was found to be mediated by the pro psoria marker involucrin. Thedifferentiation-induced expressioncurrent of psoriasin and the differentiation Induction of keratinocyte differentiation causedcon expression in differentiated thelayers. suprabasal, expression in the psoriatic epidermis with highest stochemical staining revealed a gradient of psoriasin keratinocyte differentiation in psoriasis. Immunohi ofgate the endogenous effect psoriasinon disturbed tiation complex.Theaimof thisstudy was to investi coded by a gene located within the epidermal differen inpsoriasis,isen ishighlyexpressed Psoriasin, which Ingrid AspPsoriasisResearchCenter,Departmentof Clinical andExperimentalMedicine,LinköpingUniversity, Linköping, Sweden Anna-Karin EKMAN, Differentiation inPsoriasis Overexpression ofPsoriasin(S100A7)ContributestoDysregulated This isan open access article under the CC BY-NC license.www.medicaljournals.se/acta Journal Compilation ©2017ActaDermato-Venereologica. In psoriasis, thedifferentiationIn psoriasis, oftheepidermal process Psoriasin (S100A7) was first identified for its overex its for identified first was (S100A7) Psoriasin keratinocytes undergo a tightly regulated process of o establishtheskinbarrierandepidermalstructure, Jenny VEGFORS, Cecilia BIVIK EDING INVESTIGATIVE REPORT ------­ ­ - and Charlotta ENERBÄCK in thepathogenesisofpsoriasis(7). We haveshownpre psoriasin of role the emphasizes which (TNF)-α, factor and bythecombinationofIL-17tumournecrosis (6). Psoriasinisstronglyinducedbyinterleukin(IL)-22 ofneutrophilsand the abilitytoinducechemotaxis T cells psoriasin functionsasanantimicrobialpeptideandhas psoriatic epidermis,psoriasinisalsoexpressedincondi expression innormalskinandthehigh endothelial cellproliferation(8).Inadditiontothelow for advancedglycationendproducts(RAGE),promoting viously thatextracellularpsoriasinbindstothereceptor (KFSM, Gibco) as described previously (13). Extracellular treat­ line NTERT cin (PAA Laboratories,Pasching, Austria). The keratinocyte cell 0.06 μM CaCl (EDGS), supplement growth defined EpiLife 1% with lemented gies, Carlsbad,CA,USA),were cultured inEpiLifemediumsupp Neonatal humanepidermalkeratinocytes(HEKn;Life Technolo Cells andculture conditions METHODS psoriasin onkeratinocytedifferentiation. investigate the effect ofkeratinocyte cellular mediator. The aim ofthisstudywasthereforeto effects ofpsoriasinasanendogenouslyproducedintra is keratinocyte-derived,itimperativetoconsiderthe of extracellularpsoriasin,butasthepsoriasininpsoriasis keratinocyte differentiation havefocusedontheeffects ferentiation. Previousstudiesoftherolepsoriasinin suggests that psoriasin is involved in keratinocyte dif conjunction withthedisturbeddifferentiation process epidermis (10,11). of importanceintheterminaldifferentiation ofthehuman (EDC) (10–12), a gene cluster that contains several is positionedwithintheepidermaldifferentiation complex ferentiation. Inaddition,thegenethatencodespsoriasin of expressionsuggestsaninvolvementinepithelialdif expression inundifferentiated basalioma(9). This pattern in differentiated squamouscellcarcinomaandalackof have previously demonstrated strong psoriasin expression conditions of dysregulated keratinocyte differentiation, we tions displaying abnormal differentiation. In a spectrum of nuclear factor (NF) to interactwithvarioussignallingproteins,includingthe epithelial cells(5).Intracellularpsoriasinhasbeenfound studies have demonstratedsecretion ofpsoriasin from to belocatedthenucleusandcytoplasm(4).Later The high expression level in psoriatic epidermis in -2G was grown in keratinocyte serum -free medium 2 (Gibco,Paisley, UK)and1%penicillin/streptomy - kB regulator Jab1, while secreted Acta DermVenereol 2017;97: 441–448 doi: 10.2340/00015555-2596 derived, intracellular -derived, intracellular 441 ­ ­ ­ ­ ­ ­ ­ ­ Advances in dermatology and venereology ActaDV Acta Dermato-Venereologica ActaDV www.medicaljournals.se/acta Annexin V additional changeofmediumfor5or7days. EDGS-free EpiLifemediumandcellsweregrownwithoutany for substituted was medium culture the confluence, cell Upon medium. EpiLife complete in near-confluence at seeded were harvested after 24 or 48 h. and For differentiation in confluence,EpiLife cells complete in seeded were cells The poly-HEMA. for 48 h. For suspension culture, 24-well plates were coated with Louis, MO, USA) or 1 μM TPA (Acros Organics, Geel, Belgium) were consideredtobeviable, Annexin V psoriasin were generated as described previously (14). Briefly, total Human NTERT keratinocyteswithasustained overexpressionof Generation ofpsoriasin-overexpressing keratinocytes (BeckmanCoulter,software USA). Brea,CA, Annexin V was analysed using a Gallios flow cytometer and Kaluza analysis with Annexin V tion KitI(BDBiosciences,SanJose,CA,USA),stainingcells Apoptosis was analysed by the FITC Annexin V Apoptosis Detec Apoptosis detectionassay CaCl mM 2 with treated were cells the transfection, Following USA). siRNA (C-siRNA)(SantaCruzBiotechnology, SantaCruz,CA, with psoriasin-siRNA (Pso-siRNA)oravalidatednontargeting To down-regulatepsoriasinexpression,HEKnweretransfected Small interferingRNA (siRNA) by treatmentwithCaCl PKC-δ inhibitor rottlerin (4 μM, Cell Signaling) for 30 min followed lylmaleimide I (4 μM, Cell Signaling, Danvers, MA, USA), or the pathway, HEKnwerepre-treatedwiththePKC -inhibitor bisindo To investigatetheparticipationofproteinkinaseC(PKC) Signal pathwayinhibitors CaCl Keratinocyte differentiation wasinducedbytreatingHEKnwith Induction ofkeratinocytedifferentiation (Invitrogen, Paisley, UK). Germany). Cell nuclei were counterstained with haematoxylin were visualized byDAB-staining (PolySciences, Eppelheim, conjugated polymerwasapplied,andantigen-antibodycomplexes 4°C. Followingincubation,DAKOEnVision anti-mouseHRP Imgenex, SanDiego,CA,USA)wascarriedoutovernightat binding withprimarymouseanti-humanpsoriasinantibody(1:400; binding wasinhibitedwith5%bovineserumalbumin. Antibody were blocked with 3% hydrogen peroxide, and unspecific buffer (DAKO,Glostrup, Denmark). Endogenous peroxidases antigen retrieval was performed in citrate (pH Gothenburg, Sweden)andrehydratedinethanol.Heat-induced sections were deparaffinized in Histolab-clear (Histolab Products, lesional psoriasis skin and were fixed and paraffin-embedded. The Skin punchbiopsieswereobtainedfromhealthycontrolsand Immunohistochemistry 0.15 µg/mlor1for72h. ment withpsoriasin(Abnova, Taipei, Taiwan) wasconductedwith 442 or TPA, HEKn were treated with 2 mM CaCl confirmed by measuring involucrin. For differentiation with CaCl culturing HEKn in suspension or confluence. Differentiation was (DMSO) was included in non-inhibitor wells as vehicle control. (DMSO) wasincludedinnon-inhibitorwellsasvehiclecontrol. 2 2 for48h. or12-O A.-K. Ekmanetal. + PI + cellspost-apoptoticnecrotic. -tetradecanoylphorbol13acetate (TPA) orby -FITC and propidium iodide (PI). Cell staining 2 . An equalvolumeofdimethylsulfoxide + PI – 2 = cellsapoptoticand (Sigma-Aldrich,St 6) antigen retrieval 6) antigen retrieval – PI – cells cells ­ ­ 2

Nuclei werecounterstainedwithDAPI(4’,6-diamidino2pheny anti-mouse AlexaFluor555 (Molecular Probes, Eugene, OR, USA). Cambridge, UK),followedbyincubationwithsecondarygoat 4°C withmonoclonalmouseanti-humanpsoriasin(Abcam, bilized with0.1%saponin. The cellswereincubatedovernightat permea and paraformaldehyde 4% in fixed were Keratinocytes Immunofluorescence C lized toRPLP0orGAPDHasindicated,usingthecomparative (Applied Biosystems)(Table I).Expressiondatawerenorma were designedusingthePrimerExpressSoftwareversion3.0 CD24and (TGM)-1 transglutaminase (DSC)-1, desmocollin 1, cytokeratin (K)1, K10, involucrin, filaggrin, desmoglein (DSG)- bed (15–18).Primersforribosomalproteinlarge p0(RPLP0), 3-phosphate dehydrogenase(GAPDH)weredesignedasdescri (Applied Biosystems). Primers for psoriasin and glyceraldehyde Foster city, CA,USA)onareal-time7500HT or7900HT PCR qPCR was performed with the SYBR green (Applied Biosystems, Strand cDNA (Fermentas, Kit Synthesis Vilnius, Lithuania). First Maxima the using synthesized was cDNA RNA. extract The RNeasyminikit(Qiagen,Hilden,Germany)wasusedto RNA extraction,cDNA synthesisandquantitativereal-time PCR GAPDH: glyceraldehyde 3-phosphate dehydro ­ Table I.Primersequencesusedforquantitativereal-timePCR TERTs orfrom PP, PNandNNepidermiswasusedtogenerate RNA extractedfrom3psoriasin-overexpressingorcontrolN microarray immediately. incubation, theepidermiswasremovedandRNA wasisolated does notinduceanychangesingeneexpression(18).Following saline (PBS)for30min,aspreviouslydescribed,amethodthat in 3.8%sterile ammonium thiocyanate in phosphate were obtained. The epidermiswasdetachedby soaking thebiopsy involved (PP),3uninvolved(PN)andnormal(NN)skinbiopsies, and fromhealthycontrols. A totalof9biopsies,consisting3 were obtainedfromage-andsexmatchedpatientswithpsoriasis and S100A12in psoriasis, skin punchbiopsies, 4-mm in diameter, To determinetheco-occurrenceofpsoriasin,S100A8,S100A9 Removal ofepidermis ( an AxioVert.A1in Microscope evaluated was Staining lindole). with secondaryantibody. These controlsdisplayednostaining. by omittingtheprimaryantibodyandonlyincubatesections TO/V5-DEST andusedtoproduceinfectiouslentivirusparticles. subsequently clonedintothelentiviralexpressionvectorspLenti6.3/ and PCR by amplified was (NM_002963) Psoriasin synthesized. RNA wasextractedfrompsoriaticskinbiopsiesandcDNA was Ribosomal protein.large.P0 GAPDH CD24 Transglutaminase 1 Desmocollin 1 Desmoglein 1 Filaggrin Involucrin Keratin 10 Keratin 1 Psoriasin (S100A7) Gene Zeiss, t (2 –∆∆Ct Oberkochen, Germany). Negative controls were obtained ) method. actgtgccagcccagaaca ccaggcgcccaatacg ttttacattgttgagctattgctgttc ccccggttggcatacaca tgatggagaactcgttgggtc tcccatttttgatgatctgttgtg ggcactgaaaggcaaaaagg ccatcaggagcaaatgaaacag gggctaaacagcatcaccatgt ccaggagctgatgaacacca tggtagtctgtggctatftctccc Forward primer genase. agcctggaaaaaggaggtcttc ccacatcgctcagacaccat tccaaagcctcaggaggaaa gagcggaaggcagtagagaca cctggcccacttatggaataaaa gctcaaagccagctgcacta aaacccggattcaccataatca gctcgacaggcaccttctg gcgggaggaagagtagtgctt gagggtcctgtaggtggcaat gcatgatcgacatgtttcacaaata Reverse primer -buffered ­ ­ ­ ­ Advances in dermatology and venereology ActaDV Acta Dermato-Venereologica ActaDV to GeneChip kit accordingtothemanufacturer’s instructions.Hybridization cut-off. The foldchangewascomputedbytheGeneSpringsoft obtained by omittingtheprimaryantibody. Thefiguresarerepresentative of5experiments.× present a gradient of psoriasin expression. Primary antibody was applied at a dilution of 1:400, and (c) panel displays the negative control, which was upper, more differentiated layers of the psoriatic skin. The weak expression in the basal cells and the intense expression in cellsof the suprabasal layers the epidermal expression of psoriasin in psoriatic skin, but not in normal, healthy skin. Psoriasin displays a substantially higher staining intensity in the Fig. 1.Psoriasin is expressed as a gradient in the psoriatic skin. stages ofkeratinocytedifferentiation. expression suggeststheinvolvementofpsoriasininlater ferentiated layersoftheepidermis. This patternofpsoriasin the basalcelllayertointenseexpressioninmoredif for apsoriasingradient,rangingfromweakexpressionin observed apronouncedstaining(Fig.1b)withtendency gative control(Fig.1c).Inthelesionalpsoriaticskin,we ( and obtainedasparsepsoriasinexpressioninnormalskin and healthycontrols,weperformedimmunohisto­ ferential expression pattern between patients with psoriasis expressed in lesional psoriatic skin (3). To describe the dif highly protein a as identified originally was Psoriasin Psoriasin isexpressed asagradientinpsoriaticskin RESULTS The dataarepresentedasthemean Statistical analysis based onnormalizeddata. constructed in R (version 3.2.4) and clustering was performed To determinetheco-expressionofS100proteins,aheatmapwas change wasappliedasacut-off forup-and down-regulated genes. ware. On the probe sets that remained after the filtering, a 1.5-fold hybridization probesusingtheGeneChip The probe sets were filtered on expression with a 20 a with expression on filtered were sets probe The (RMA) normalization and background correction was performed. Santa Clara, CA, USA). A Standard Robust Multi-Array Average using GenespringGXsoftware(v13.0; Agilent Technologies, files generated by the Affymetrix AGCC program were analysed products werefrom Affymetrix (Santa Clara,CA,USA).CEL- GeneChip p 6 software(GraphPadsoftware,LaJolla,CA,USA). A valueof signed-rank test. Analyses were performed using GraphPad Prism and werecomparedusingpairedStudent’s t staining inaGeneChip in aGeneChip (v1.2.1) wasusedtoverifythequalitycontrols. All GeneChip Fig. 1a)thatwasnotnoticeablydifferent fromthene < 0.05 wasconsideredstatisticallysignificant. a ® Scanner 3000 7G system. Expression Console software Scanner30007Gsystem.ExpressionConsolesoftware ® humantranscriptomearrays2.0wasperformed ® hybridizationoven,followedbywashingand ® FluidicsStation450andscanningina ±

standard error of mean (SEM), ® WT PLUSReagent test or Wilcoxon-test b th chemistry chemistry percentile Immunohistochemical staining of (a) normal and (b) psoriatic skin demonstrates ® ­ ­ ­ ­ Psoriasin contributestodysregulateddifferentiationinpsoriasis

differentiation. is endogenouslyproducedinkeratinocytesresponseto involucrin (Fig.2b).Inconclusion,wefoundthatpsoriasin conditions inducedtheexpressionofbothpsoriasinand differentiationestablished methods(21–24). All these are which of all confluence, or suspension in cultured Keratinocytes weretreatedwithcalcium, TPA orwere in cellsexposedtodifferentiation-inducing conditions. of gradientsexists,psoriasinexpressionwasevaluated and differentiation ratherthanmerelyaco-occurrence To evaluate whether a relationship between psoriasin Keratinocyte differentiation inducespsoriasinexpression differentiation. extracellular psoriasinmaybeunableinitselftoinduce morphology uponpsoriasintreatment,suggestingthat fashion (Fig.2a). We didnotobserveanychangeincell sin may induce intracellular production in an autocrine psoriasin expression, suggesting thatextracellular psoria increased involucrin,butalsothatitcausedup-regulated were investigated.Itwasfoundthatexogenouspsoriasin psoriasin and the expression of involucrin and psoriasin effects inourculturesystem,HEKnweretreatedwith Hattori etal.(19)andbySon(20). To examinethe tinocyte differentiation has been previously suggested by An effect ofextracell expression Exogenous psoriasinincreases involucrinandpsoriasin nocytes withintactPKCsignallingdisplayedinduced PKC inhibitorsindifferentiated keratinocytes.Kerati keratinocyte differentiation weinvestigatedtheeffect of To furtherevaluatetheroleofendogenouspsoriasinin block the calcium-induced expression of involucrin (26). differentiation (25) and inhibitors of the PKC-δ pathway PKC hasbeenimplicated in the regulation of keratinocyte by protein kinaseC Differentiation-induced psoriasinexpression isregulated 20 magnification was used. c ular, exogenouspsoriasinonkera Acta DermVenereol 2017 443 ­ ­ ­ Advances in dermatology and venereology ActaDV Acta Dermato-Venereologica ActaDV b a www.medicaljournals.se/acta in keratinocytedifferentiation. expression psoriasin enhanced the in involved is PKC-δ psoriasin andinvolucrin. These results demonstratethat PKC-δ inhibitor, markedly reduced the expression both of lylmaleimide (Fig. 2c) or with rottlerin (Fig. 2d), a specific ment. Treatment withthegeneralPKCinhibitorbisindo expression ofpsoriasinandinvolucrinoncalciumtreat Relative psoriasin expression 444 0 5000 10 000 15 000 20 000 25 000 Relative psoriasin expression Relative psoriasin expression Relative psoriasin expression 0 10 20 30 40 0 5 10 15 20 0 5 10 15 20 Relative psoriasin expression 0 1 2 3 4

Control Control Control Control Control A.-K. Ekmanetal.

confluence

suspension * 24 h 5 days 0.15 µg/ml * * psoriasin * * * * *

suspension confluence TPA CaCl 48 h 7 days 1.0 µg/ml 2 psoriasis

Relative0.0 0.5 involucrin1.0 1.5 expression2.0 2.5 Relative involucrin expression

0 20 40 60 80 Relative involucrin expression Relative involucrin expression

Relative0 involucrin2 expression4 6 0 1 2 3 0 2 4 6

Control Control Control Control Control

suspension confluence * 0.15 µg/ml 24 h * 5 days psoriasin * * * * *

suspension confluence TPA CaCl 1.0 µg/ml 48 h 7 days psoriasin 2 ­ ­ d c using RPLP0as the internal control.Data are displayed as mean levels are shown asrelative fold induction compared with untreated control psoriasin and involucrin, was reduced by the inhibition of PKC. Expression *p for differentiation, HEKn were treated with 2 mM CaCl µg/ml for 72 h. (b) To examine the effect of endogenous psoriasin expression (HEKn) were treated with psoriasin at concentrations of 0.15 µg/ml and 1 the effects of exogenous psoriasin, neonatal human epidermal keratinocytes regulated bytheprotein kinase C (PKC) pathway. differentiation is upon psoriasin expression 2. Theendogenous Fig. by treatment with 2mM CaCl (d) the PKC-δ-specific inhibitor rottlerin, or vehicle DMSO for 30 min, followed pre-treated with 4 μM of (c) the general PKC-inhibitor bisindolylmaleimide I, RPLP0 as the internal control. To further study the role of PKC, HEKnwere are shown as relative fold induction compared with untreated control, using levels Expression confluence. in or suspension in cultured cells in induced of psoriasin and involucrin. Psoriasin and involucrin expression was also expression the induced both treatment TPA and Calcium confluence. in or tetradecanoylphorbol-13-acetate (TPA) for 48 h or cultured in suspension Relative psoriasin expression Relative psoriasin expression 0 1 2 3 4 5 0 1 2 3 4 5 .5 ** < 0.05, down ced, cellsweretransfected with siRNA. The successful differentiation pathway, ormerely simultaneouslyindu To determinewhetherpsoriasinispartofthekeratinocyte process inkeratinocytes Psoriasin isamediatorinthenormaldifferentiation Vehicle Vehicle -

regulation of psoriasin expression using siRNA was CaCl + CaCl + * *

p vehicle vehicle 2 2 < 0.01.

bisindolyl- rottlerin maleimide * *

CaCl + CaCl + bisindolyl- rottlerin maleimide2 2

for 48 h. CaCl 2

Relative involucrin expression Relative0 involucrin2 expression4 6 0 2 4 6 Vehicle Vehicle 2 inducedmRNA expression of

CaCl +

CaCl + vehicle * * vehicle 2 2

2 bisindolyl- o 4 h r μM 1 or h 48 for (a) To determine maleimide rottlerin * * ±

SEM, CaCl + bisindolyl- CaCl + maleimide2 rottlerin 2 n = 6; ­ Advances in dermatology and venereology ActaDV Acta Dermato-Venereologica ActaDV that psoriasindoesnot,onits own,inducedifferentiation, observed with the extracellular psoriasin, again indicating control cells(datanotshown). This supportstheresultswe or necrosis in siRNA-treated keratinocytes compared with Likewise, wedidnotseeany difference ineitherapoptosis (datanotshown). proliferation comparedwith control cells did notaltercellularmorphologyandaffect cell The down-regulationofpsoriasinexpressionbysiRNA does notaffectcellviabilityormorphology Down-regulation ofendogenous psoriasinexpression ator during the later stages of keratinocyte differentiation. suggests thatendogenouspsoriasinisanimportantmedi cess mayvaryindifferent stagesofdifferentiation. This that the importance of psoriasin onthe differentiation pro DSC-1 (Fig.3e),K1orK10(datanotshown),suggesting down-regulation wasseenonthedifferentiation markers not reach statistical significance (Fig. 3c). No effect of the did but decreased, was filaggrin of expression The 3g). (Fig. CD24 and 3f) (Fig. TGM-1 3d), (Fig DSG-1 3b), (Fig. involucrin of expression diminished significantly a not shown). The down-regulationofpsoriasinresultedin treatment inducedtheexpressionofK1andK10(data calcium Furthermore, 3b–g). (Fig. CD24 and TGM-1 DSC-1, DSG-1, filaggrin, markers differentiation the of was induced using calcium, which triggered the expression confirmed by qPCR (Fig.3a). The differentiation process d f a Relative TGM-1 expression 0 2 4 6 8 10 Relative psoriasin expression Relative DSG-1 expression 0 10 20 30 40 50 0 2 4 6 8

C-siRNA C-siRNA C-siRNA control control control * * * C-siRNA C-siRNA C-siRNA CaCl CaCl CaCl

2 2 2

Pso-siRNA Pso-siRNA Pso-siRNA control control control * * *

Pso-siRNA Pso-siRNA Pso-siRNA CaCl CaCl CaCl

2 2 2 b g e Relative involucrin expression Relative CD24 expression 0 5 10 15 0 1 2 3 4 Relative DSC-1 expression 0 2 4 6 8

C-siRNA C-siRNA C-siRNA control control control * * * C-siRNA C-siRNA C-siRNA CaCl CaCl CaCl

2 2 2

Pso-siRNA Pso-siRNA Pso-siRNA control control control n * * s ­ ­ Psoriasin contributestodysregulateddifferentiationinpsoriasis Pso-siRNA Pso-siRNA Pso-siRNA CaCl CaCl CaCl the genecodingforinvolucrin wasfoundtobethe11 in themicroarraypsoriasin -overexpressing cells, and the SPRR1A gene. Among the up-regulated genes FOXN1 K1, TGM-1, genes differentiation-regulating the top15mostdown-regulatedgenes,weobserved DSG-1, CASP14,K10andDSC1(Table II ). Among control cells, 4are associated with differentiation, namely psoriasin-overexpressing keratinocytescomparedwith 5 mostdown-regulatedgenesinthemicroarrayof related todifferentiation. Interestingly, among thetop effect of psoriasin overexpression on mRNA transcripts logy (Fig.4b).Usingmicroarray, wefoundaprofound ( keratinocytes, butnostaininginnon-transfectedcells demonstrated astrongstaininginthevector Immunofluorescence generated. were overexpression sin, as seeninpsoriasis, keratinocytes with asustained To evaluatetheeffect ofahighexpressionpsoria keratinocyte differentiation Overexpression ofpsoriasinleadstodysregulated we seearenotduetoincreasedcelltoxicity. nor does it affect apoptosis. It also confirms that the effects These resultssupportthatpsoriasin hasadysregulating of IL1BandK16 and a down-regulation of CXCL14. of psoriasinwasalsofound tocauseanup-regulation most upregulatedgene.Furthermore, theoverexpression 2 2 2 Fig. 4a). The transfectiondidnotaffect thecellmorpho­ c Relative filaggrin expression 0 1 2 3

C-siRNA control mean (GAPDH) as the internal control. Data are displayed as control usingglyceraldehyde 3-phosphate dehydrogenase shown as relative fold inductioncompared with untreated by down-regulation of psoriasin. Expression levels are (e)No reduction of DSC-1 mRNAexpression was demonstrated significance. statistical reach not did filaggrin of down-regulation of psoriasin. (c) The reduced expression TGM-1 and (g) CD24 mRNA expression was decreased by calcium treatment (a-g). (b) Involucrin, (d) DSG-1, (f) with quantitative real-time PCR (qPCR),was induced by (DSC)-1, desmocollintransglutaminase (TGM)-1 and CD24, analysed (DSG)-1, desmoglein filaggrin, involucrin, mM CaCl2 for 48 h. The mRNA expression of psoriasin, (C-siRNA)controlsiRNA by followed treatment with 2 transfectedwere or (Pso-siRNA) psoriasin-siRNA with Neonatal human epidermal keratinocytes (HEKn) siRNA suppresses normal keratinocyte differentiation. Fig. 3.The down-regulation of psoriasin expression by * C-siRNA ± CaCl

standard error of the mean (SEM),

2

Pso-siRNA n

control s (p =0 .0 6) Pso-siRNA CaCl

2 Acta DermVenereol 2017 n -transfected ; *p = 6; < 0.05. 445 th ­

Advances in dermatology and venereology ActaDV Acta Dermato-Venereologica ActaDV www.medicaljournals.se/acta healthy keratinocytes (NN), of S100- in lesionalpsoriatic(PP),non-lesional(PN)and non-lesional psoriasisandhealthy epidermis. We found expression ofS100-proteinsbetweenlesionalpsoriasis, in psoriasis,weconstructed aheatmap,comparingthe in thisfamilysharetheexpression patternofpsoriasin . To determinewhether otherproteins Psoriasin ispartofafamilyS100-proteinswithhigh are co-expressed inpsoriasis Psoriasin (S100A7),S100A8,S100A9andS100A12 the accompanyingdecreaseinproliferation. strengthening thatthesecellsundergo differentiation with lower proliferation than controlkeratinocytes(Fig.4c), that overexpressed psoriasin also exhibited a significantly function on keratinocyte differentiation. Keratinocytes and the control cells. Data are displayed as mean demonstrates the proliferation of the psoriasin-overexpressing NTERTs keratinocytes. The images are representative of 4 experiments. Panel (c) the psoriasin-overexpressing NTERT keratinocytes and the NTERT control representative of 4 experiments. Panel (b) displays the cell morphology of 2-phenylindole) (blue) was used for nuclear staining. The images are was used to visualize psoriasin expression and DAPI (4’,6-diamidino- with controlkeratinocytes. Alexa555-conjugated secondary antibody (red protein expression was verified using: (a) immunofluorescence compared control NTERT keratinocytes lacking the overexpression (NT1). Psoriasin overexpression of psoriasin (psoriasin-NTERTs) and were compared with NTERT keratinocytes were vector-transfected to generate a sustained are co-expressed. () S100A12 andS100A7A S100A9, S100A8, and psoriasin(S100A7), dysregulated differentiation, of psoriasin displaysigns 4. Keratinocytesoverexpressing Fig. 446 mean (SEM), n A.-K. Ekmanetal. ; *** = 4; p ≤ 0.001. (d) Heatmaps illustrating the clustering n = 3. ±

standard error of the ) *Differentiation-related genes. DISCUSSION NTERTs comparedwithcontrol differentially expressed genes in psoriasin-overexpressing down-regulated and top15mostup-regulated Table II.The treatment. Applying severalmethodsofinduction ofdif increase ininvolucrinthat weobserveuponpsoriasin the with line in are al. et Hattori by findings tiation. The exogenous psoriasinmaynegatively regulatedifferen after psoriasintreatment,Son etal.(20)suggestedthat demonstrated up-regulationofdifferentiation markers (19) al. et Hattori While results. conflicting with riasin, focused ontheeffects ofextracellular, exogenouspso role ofpsoriasin in keratinocyte differentiation have as K1andK10,beingdown-regulated(36). demonstrating anoverexpression(2,35),andothers,such are abnormal,withsomemarkers,includinginvolucrin, cornified layer. The expression levels of several markers markers, such as filaggrin, are either absent or found in the the lowerlayersofpsoriaticepidermis,whileother in prematurely appear TGM, and involucrin including markers, differentiation Some layer. cornified irregular with anabsenceofthegranularlayerandathickened of humanepidermis(34). also been detected intheupper, more differentiated layers in differentiated mammaryepithelium(32,33),buthas the expression of filaggrin (31). CD24 is most prominent differentiation (30). The stratumcorneumismarkedby contrast, K1andK10areconsideredmarkersofearly (28) in a similar localization pattern as TGM-1 (29). In spinous layer and continues through the granular layer The expression of involucrin commences in the upper ratinocytes, withinvolucrinbeingthemostestablished. ke epidermal in identified been differentiationhave of cate sequenceofgeneactivation(27).Severalmarkers Keratinocyte differentiation iscoordinatedbyanintri (Fig. 4d). and S100A12,suggestingaco-regulationoftheseproteins a strongco-clusteringofpsoriasinandS100A8,S100A9 ALDH1A3 HSD11B1 HEPHL1 LCP1 IVL* NCCRP1 IL1B ITGB6 TNFAIP3 DKK1 MMP10 MIR614|GPRC5A PDCD1LG2 PTHLH LOC730755|KRTAP2-4 Up-regulated genes Previous studiesthathaveattemptedtoelucidatethe Psoriasis ischaracterizedbyanepidermalthickening 1.89 1.90 1.91 1.92 1.93 1.95 1.97 1.98 2.00 2.07 2.08 2.10 2.12 2.52 4.55 Fold change IGFL1 SPRR1A* KRT1* SLC7A8 BCAM TGM1* ALOX15B FOXN1* EGR1 C10orf99 DSC1* KRT10* CXCL14 CASP14* DSG1* genes Down-regulated Fold change –2.30 –2.37 –2.38 –2.39 –2.39 –2.45 –2.52 –2.63 –2.80 –3.01 –3.25 –5.79 –7.14 –7.86 –10.10 ­ ­ ­ ­ ­

Advances in dermatology and venereology ActaDV Acta Dermato-Venereologica ActaDV S100A9 andS100A12,suggesting a co-regulation anda sion ofthehomologueS100 proteinspsoriasin,S100A8, epidermis andcontrolskin,reveals aprominentco-expres consistent withwhathasbeen describedinpsoriasis(44). expression ofK16,inthepsoriasinoverexpressingcells, which is decreased in psoriasis (46). We also identified over and down-regulationofthechemokineligandCXCL14, cytokine IL1B,whichislocallyincreasedinpsoriasis(45) of psoriasinwasalsofoundtocauseup-regulationthe down-regulated (43,44).Furthermore,theoverexpression involucrin is up-regulated and caspase where epidermis, psoriasis in seen pattern the reflect sion expres gene in changes These K1. and TGM-1 FOXN1, and down-regulation of DSG-1, caspase-14, K10, DSC-1, differentiation, manifesting in up-regulation of involucrin, overexpression ofpsoriasinregulatesseveralmarkers sion ofpsoriasin. We foundthatthesustainedintracellular we generatedkeratinocyteswithasustainedoverexpres from thoseinnormalskin. To mimicthisup-regulation, psoriasin ondifferentiation arethereforelikelytodiffer it ismarkedlyup-regulatedinpsoriasis. The effects of late differentiation. in specifically involvement the indicate necessarily not do findings our although skin, normal in differentiation the expressionofpsoriasiniscorrelatedwithmarkers down-regulation ofpsoriasin. These resultssuggestthat increase inDSG-1expressionthatwasabolishedbythe 42). Consistentwiththis,wefoundacalcium-induced tion ofdesmosomeshasbeendescribedpreviously(41, interaction byhighcalciumlevelsthroughtheforma chanism inkeratinocytes. The inductionoftightcell- epithelial cells (33), and now demonstrate a similar me CD24 expressionisregulatedbypsoriasininmammary to alsoregulatethem. We havepreviouslyreportedthat substrate fortransglutaminases(40),butisherefound a be to suggested been has psoriasin Similarly, finding. mediating roleofpsoriasininitsexpressionis a novel differentiation hasbeendescribedpreviously, butthe regulate thesemarkers. The inductionofinvolucrinupon to found is psoriasin time first the is This expression. CD24 and TGM-1 DSG-1, involucrin, for mediator a as that inthenormaldifferentiation process,psoriasinacts down ofpsoriasinexpression. This knock-downrevealed mal keratinocytedifferentiation, weperformedaknock- (26, 37). PKC activation leads to an up is consideredakeypathwayofepidermaldifferentiation psoriasin isinvolvedinthedifferentiation process.PKC expression ofinvolucrinandpsoriasin,supportingthat ferentiation, wefoundthatallthesemethodsinducedthe shared PKCregulation. an associationbetweenpsoriasinandinvolucrinbythe (39). calcium-dependent involucrinexpression We reveal S100A8 and S100A9 (38), while inhibition of PKC blocks Our heatmap,basedonthe transcriptome ofpsoriatic While psoriasinisonlyweaklypresentinnormalskin, To investigatetheroleofintracellularpsoriasininnor 14, K10 and K1 -14, K10andK1 - regulation of ­ ­ ­ ­ ­ ­ ­ Psoriasin contributestodysregulateddifferentiationinpsoriasis psoriatic epidermis. differentiation processthathasbeenestablishedinthe psoriasin isaprominentcontributortothedysregulated that process. suggest the findings skew These to appears a positiveornegativeregulatorofdifferentiation, psoriasin clear thatitactsasamodulator. Insteadofmerelyactingas psoriasin doesnotonitsowninducedifferentiation, itis that resemblesseeninlesionalpsoriaticskin. While yielding anexpressionpatternofdifferentiation markers different than those seen upon induction in normal skin, pressed atpathologicallyrelevantlevels,theeffects are and latedifferentiation markers.However, whenoverex psoriasin regulatestheexpressionofseveralintermediate dependent manner. In the normal differentiation process, affects keratinocytedifferentiation inaconcentration- overlap ofpathwaysbetweentheseS100proteins. tion is mediated by p38 (49). This suggests an interesting showed thatup-regulationofpsoriasinon TLR3 activa translocation ofS100A8/A9(48). A recentpublication kinases regulate NOX2 activity via p38 MAPK-dependent plicated intheregulationofS100A8/9(48).Sphingosine im been has pathway signalling MAPK The (47). tion S100A9 havebeenimplicatedinkeratinocytedifferentia fect topromotedifferentiation. Interestingly, S100A8and REFERENCES The authorsdeclare noconflictsofinterest. Medical ResearchCouncil. Welander Foundation,theSwedishpsoriasisassociationand rating thepsoriasin-overexpressingNTERTs. The authorswouldliketothankStefanStollforhelpwithgene ACKNOWLEDGEMENTS putative redundancy. They mayalsosynergize intheiref 8. 7. 6. 5. 2. 4. 3. 1. This research was funded by the Ingrid Asp Foundation, the In conclusion,thisstudydemonstratesthatpsoriasin Shubbar E, Vegfors J, Carlstrom M, Petersson S, Enerback Hegyi Z, Zwicker S, Bureik D, Peric M, Koglin S, Batycka- Jinquan T, Vorum H,LarsenCG,MadsenP, Rasmussen HH, Celis JE, Rasmussen HH, Vorum H, Madsen P, Honore B, Wolf Bernard BA,Robinson SM,Vandaele S, MansbridgeJN,Dar Al-Haddad S, Zhang Z, Leygue E, Snell L, Huang A, Niu Y, et Madsen P, Rasmussen HH, Leffers H, Honore B, Dejgaard K, Houben E, De Paepe K, Rogiers V. A keratinocyte’s course of J Invest Dermatol 2012; 132: 1416–1424. psoriasin (S100A7) and koebnerisin (S100A15) in psoriasis. “alarmins” S100 proinflammatory cytokine-induced Th17 Baran A, et al. Vitamin D analog calcipotriol suppresses the Invest Dermatol 1996;107:5–10. Gesser B, etal.Psoriasin:anovel chemotacticprotein.J and externalize 1996;155:2105–2112. JUrol totheurine. it H, et al. Bladder squamous carcinomas express cell psoriasin Am J Pathol 1999;155:2057–2066. andinvasive (S100A7) expression Psoriasin al. breastcancer. Olsen E,etal.Molecularcloning,occurrence,andexpres life. SkinPharmacolPhysiol 2007; 20: 122–132. 1991; 97: 701–712. is highly up-regulated in psoriatic skin. J Invest Dermatol sion of a novel partially secreted protein “psoriasin” that psoriatic skin.Br J Dermatol 1985; 112:647–653. mon M. Abnormal maturation pathway of keratinocytes in Acta DermVenereol 2017 447 ­ ­ ­ ­ ­ - - ­

Advances in dermatology and venereology ActaDV Acta Dermato-Venereologica ActaDV www.medicaljournals.se/acta 23. 22. 12. 28. 21. 19. 17. 15. 11. 25. 24. 27. 26. 20. 18. 16. 14. 13. 10. 448 9. Watt FM, Jordan PW, O’Neill CH. Cell shape controls terminal Younus J, Gilchrest BA. Modulation of mRNA levels during Mischke D, Korge BP, Marenholz I, Volz A, Ziegler A. Genes Candi E, Schmidt R, Melino G. The cornified envelope: a model Hennings H, Michael D, Cheng C, Steinert P, Holbrook K, Hattori F, Kiatsurayanon C,Okumura K,Ogawa H,Ikeda S, Sato T, Wu X, Shimogaito N, Takino J, Yamagishi S, Takeuchi M, N,Hu LiX,Bloushtain-Qimron Krop I,MarzA,CarlssonH, Schafer BW, Wicki R, Engelkamp D, Mattei MG, Heizmann Dlugosz AA,Yuspa SH.Coordinatechanges ingeneexpres Minner F, Herphelin F, Poumay Y. Study of epidermal dif Eckert RL, Crish JF,Crish RL, Eckert Efimova Bone A, Deucher SR, Dashti T, Deucher A, Efimova T, Eckert RL. Calcium-dependent Son ED, KimHJ, KimKH,BinBH, BaeIH,LimKM,etal. Doroudi R, AnderssonM,Svensson PA, EkmanM,JernS, Skliris GP, Lewis A, Emberley E, Peng B, Weebadda WK, Vegfors J, EkmanAK,StollSW, BivikEdingC,EnerbäckC. Dickson MA,HahnWC,InoY, Ronfard V, Wu JY, Weinberg RefinedTA. Kruse T,P,JE, Flint Madsen AD,Celis Borglum Martinsson H, Yhr M, Enerback C. Expression patterns of differentiation of human epidermal keratinocytes. 152: 232–239. human keratinocyte PhysiolJ Cell differentiation. 1992; S100 calcium-binding proteins form a gene complex (“epi and cornification epidermal of proteins structural encoding of cell death in the skin. theskin. deathin of cell of mouse epidermal cells in culture. Cell 1980; 19: 245–254. Yuspa SH.Calciumregulationofgrowthanddifferentiation Okamoto K, et al. The antimicrobial protein S100A7/psoria M. Effects of high-AGE beverage on RAGE and VEGF expres et al. A putative role for psoriasin in breast tumor progres Genomics 1995;25: 638–643. nomenclature of the S100 calcium-binding protein family. genes on human 1q21: rationale for a new CW. Isolation of a YAC clone covering a cluster of nine S100 Dermatol 2004;123:13–22. F, et al. Regulation of involucrin gene expression. J Invest involucrin expressionisinversely regulatedby proteinki Exp Dermatol 2016;25:636–641. signalling. IκB/NF-κB through secretion IL-6 enhanced by S100A7 (psoriasin) inhibits human epidermal differentiation studies. Endothelium2005;12:215–223. genes as endogenous controls in vascular gene expression Karlsson reference ofmultiple studies L.Methodological 2007; 104:75–85. (S100A7) in human breast cancer. Breast Cancer Res Treat Kemp A, et al. Estrogen receptor-beta regulates psoriasin Br JDermatol 2016May 7. [Epub ahead ofprint]. Psoriasin (S100A7) promotes stress-induced angiogenesis. span become immortal yet retain normal growth and diffe bypass ap16(INK4a)-enforcedmechanismthatlimitslife RA, et al. Human keratinocytes that express hTERT and also q21. HumGenet1995;96:592–596. mapping ofthepsoriasin geneS100A7 tochromosome1cen- S100A7 (psoriasin)and S100A9(calgranulin-B) inkerati 17032–17040. nase C(PKC)alphaandPKCdelta. JBiol Chem 2002;277: 1993; 120:217–225. Biol JCell by C. areregulated kinase protein epidermis sion whichmarkthespinoustogranular celltransition in conditions. ferentiation inhumankeratinocytes culturedinautocrine J Dermatol 2014; 171: 742–753. markers and strengthens the skin’s tight junction barrier. Br sin enhances the expression of keratinocyte differentiation sions in the liver andkidneys.Eur J Nutr 2009; 48:6–11. sion. Cancer Res 2005;65: 11326–11334. characteristics.rentiation Biol2000;20:1436–1447. MolCell 1q21. J Invest Dermatol 1996;106:989–992. dermal differentiation complex”) on human chromosome nocyte differentiation. ExpDermatol 2005; 14: 161–168. proliferation. Breast Cancer Res Treat 2012; 134: 71–80. VEGF and acts through RAGEto promote endothelial cell C. Psoriasin (S100A7) increases the expression of ROS and Acad SciUSA A.-K. Ekmanetal. Methods MolBiol 1988; 85: 5576–5580. Nat Rev Biol Cell Mol 2010; 585: 71–82. 2005; 6:328–340. Proc Natl ------32. 31. 49. 46. 42. 34. 30. 36. 48. 45. 41. 39. 33. 29. 37. 35. 47. 44. 43. 40. 38. Al-Hajj M, Wicha MS, Benito-Hernandez A, Morrison SJ, Sandilands A, Sutherland C, Irvine AD, McLean WH. Filaggrin Lei H,Wang Y, ZhangT, ChangL,Wu Y, LaiY. TLR3activa Maerki C,MeuterS, LiebiM,MuhlemannK,FrederickMJ, Jones JC, Goldman RD. Intermediate filaments and the initia Magnaldo T, Barrandon Y. CD24 (heat stable antigen, necta Poumay Y, Pittelkow MR. Cell density and culture factors Thewes M,StadlerR,Korge B, Mischke D. Normalpsoriatic Schenten V, Melchior C, Steinckwich N, Tschirhart EJ, Cooper KD, Hammerberg C, Baadsgaard O, Elder JT, Chan LS, Jones JC,GoldmanAE,SteinertPM,Yuspa S, GoldmanRD. Efimova T, LaCelle P, Welter JF, Eckert RL. Regulation of hu Vegfors J, Petersson S, Kovacs A, Polyak K, Enerbäck C. The Eckert RL, MT,Sturniolo Broome AM, Ruse M, Rorke EA. Chew YC, Adhikary G, Wilson GM, Reece EA, Eckert RL. Chen JQ, ManXY, Li W, ZhouJ, LandeckL,CaiSQ, et al. Voss A, Bode G, Sopalla C, Benedyk M, Varga G, Bohm M, et Jiang S, Hinchliffe TE, Wu T. Biomarkers of an autoimmune Denecker G,Ovaere P, Vandenabeele P, Declercq W. Cas Ruse M, Lambert A, Robinson N, Ryan D, Shon KJ, Eckert Pearson C, Cataisson AJ, Torgerson S, Nedospasov SA, cancer cells. cancer cells. breast tumorigenic of identification MF.Prospective Clarke Cell Sci 2009; 122: 1285–1294. in thefrontline:roleskinbarrierfunction anddisease.J activity ofCXCL14 suggestsanimmediate roleinskininfec Yawalkar N,etal.Potent andbroad-spectrumantimicrobial 1995; 104:271–276. expression of suprabasal K1/K10 keratins. J Invest Dermatol keratinocyteregulate and to commitment differentiation epidermis expression of hyperproliferation-associated kera Biol 2011;89: 587–596. p38 MAPK-dependent translocation of S100A8/A9.J Leukoc Brechard S. Sphingosine kinases regulate NOX2 activity via in psoriasis. J Invest Dermatol 1990;95: 24S–26S. Taylor RS, etal.Interleukin-1inhumanskin:dysregulation Cell Motil 1982; 2:197–213. intermediate filamentnetworksinculturedepidermalcells. Dynamic aspects of the supramolecular organization of PloS One2012; 7: e53119. related to the differentiation of mammary epithelial cells. expression of Psoriasin(S100A7)andCD24 islinked and 2005; 124:481–492. Transglutaminase function in epidermis. J Invest Dermatol Protein kinaseC(PKC)deltasuppresseskeratinocyte proli 2013; 66: 523–528. the rolesof ERK1/2andGSK-3beta. CellBiochemBiophys Regulation of involucrin in psoriatic epidermal keratinocytes: 2011; 585:440–446. the rate of cell proliferation and differentiation. FEBS Lett al. Expression of S100A8/A9 in HaCaT keratinocytes alters 2015; 13: 224–233. Proteomics Bioinformatics skin disease – Genomics psoriasis. substrates. Biochemistry2001; 40: 3167–3173. RL. S100A7,S100A10, andS100A11are transglutaminase 2005; 174:1686–1692. of TNF alpha signaling in mouse skin in vivo. J Immunol neutrophils requires NF-kappa B activity but is independent Yuspa SH.ProteinkinaseCalpha-mediatedchemotaxisof tins. Arch Dermatol Res 1991; 283: 465–471. the colony-forming cells.JCellSci1996;109:3035–3045. rentially expressed in areas of the hair follicle containing drin), a novel keratinocyte differentiation marker, is prefe ahead of print]. after skin injury. Sci China Life Sci 2016 Aug 17. [Epub tion induces S100A7 to regulate keratinocyte differentiation tions. J Immunol 2009; 182:507–514. pase-14 reveals itssecrets.JCellBiol 2008;180:451–458. tion of desmosome assembly. J Cell Biol 1985; 101: 506–517. Biol Chem1998;273:24387–24395. MEKK1, MEK3,p38/RK,AP1signaltransduction pathway. J man involucrin promoter activity by a protein kinase C, Ras, 28772–28782. tion factor-dependent mechanism.J Biol Chem2011;286: feration by increasing p21(Cip1) level by a KLF4 transcrip Proc Natl Acad Sci USA AcadSci Proc Natl 2003;100:3983–3988. ------