Understanding the Mechanisms of Interleukin-1Alpha Processing and Secretion

Understanding the mechanisms of Interleukin-1α processing and secretion

A thesis submitted to The University of Manchester for the degree of Doctor of Philosophy in the Faculty of Biology, Medicine and Health

2020

Victor Sebastian Tapia Olivares

School of Biological Sciences Division of Neuroscience and Experimental Psychology

Contents List of Figures ...... 4 Abbreviations ...... 5 Abstract ...... 7 Declaration ...... 8 Copyright Statement ...... 9 Thesis Format ...... 10 Acknowledgements ...... 11 Chapter 1. General Introduction ...... 12 1.1. Inflammation ...... 13 1.2. Regulation of the inflammatory response ...... 13 1.3. IL-1 signalling ...... 15 1.4. IL-1 expression ...... 17 1.5. IL-1 sequence ...... 18 1.6. IL-1 sub-cellular localization ...... 22 1.7. Mechanisms of IL-1 activation ...... 23 1.7.1. Calpain ...... 25 1.7.2. Inflammasome activation ...... 25 1.7.3. Non-canonical inflammasomes: Caspases-4/5/11 ...... 29 1.7.4. Caspase-8 ...... 30 1.7.5. Granzymes ...... 30 1.7.6. Extracellular activation of IL-1 ...... 31 1.8. Mechanisms of IL-1 secretion...... 32 1.8.1. Passive IL-1α release from death cells ...... 32 1.8.2. GSDMD-dependent IL-1 secretion ...... 32 1.8.3. Alternative mechanisms of IL-1 secretion ...... 35 1.9. Role of IL-1α in physiology and disease ...... 37 1.9.1. IL-1α in acute inflammation ...... 37 1.9.2. IL-1α in chronic inflammation ...... 38 1.9.3. IL-1 therapy ...... 40 1.10. Summary and aims ...... 42 Chapter 2. The three cytokines IL-1β, IL-18 and IL-1α share related but distinct routes...... 43 2.1. Paper title and authors ...... 44 2.2. Abstract ...... 46 2.3. Introduction ...... 47 2.4. Results ...... 48 2.5. Discussion ...... 61

2.6. Experimental procedures ...... 65 2.7. References ...... 70 Chapter 3. Regulation of IL-1α release by nuclear localization ...... 74 3.1. Paper title and authors ...... 75 3.2. Abstract ...... 76 3.3. Introduction ...... 77 3.4. Results ...... 78 3.5. Discussion ...... 84 3.6. Experimental procedures ...... 85 3.7. References ...... 89 3.8. Supplementary Figures ...... 91 Chapter 4. A TurboID-based proximity labelling approach to study the IL-1α interactome ...... 92 4.1. Paper title and authors ...... 93 4.2. Abstract ...... 94 4.3. Introduction ...... 95 4.4. Results ...... 96 4.5. Discussion ...... 102 4.6. Experimental procedures ...... 103 4.7. References ...... 107 4.8. Supplementary figures ...... 110 Chapter 5. General Discussion ...... 111 5.1. Summary...... 112 5.2. General discussion ...... 113 5.2.1. Degrees of IL-1α signalling ...... 113 5.2.2. Mechanisms of IL-1α processing and secretion ...... 115 5.3. Experimental considerations and future prospects ...... 116 5.3.1. Insights in IL-1 secretion ...... 116 5.3.2. Nuclear localization ...... 118 5.3.3. Pro-domain selectivity...... 118 5.3.4. IL-1α interactors ...... 119 5.4. Concluding remarks ...... 120 Chapter 6. General Bibliography ...... 121

Word count: 42701

List of Figures

Figure 1.1 - IL-1 signalling pathway and negative regulators...... 16 Figure 1.2 - Protein interactions, post-translational modifications and cleavage sites for IL-1...... 21 Figure 1.3 - Calpain and inflammasome-dependent IL-1 activation...... 24 Figure 1.4 - Canonical inflammasomes...... 28 Figure 1.5 - Unconventional secretory pathways of IL-1...... 33 Figure 2.1 - IL-1β release after inflammasome activation depends on plasma membrane permeability...... 49 Figure 2.2 - ASC speck release depends on cell lysis...... 53 Figure 2.3 - IL-18 release during inflammasome activation depends on plasma membrane permeability...... 55 Figure 2.4 - IL-1α processing and release depends on calpains 1 and 2...... 57 Figure 2.5 - IL-1α release can occur independently of cell lysis...... 60 Figure 2.6 - IL-1α is released from viable MEFs...... 62 Figure 3.1 - Expression constructs of pro-IL-1α...... 79 Figure 3.2 - Nuclear localization regulates processing and secretion of pro-IL-1α...... 81 Figure 3.3 - Effects of NLS mutation on IL-1α secretion...... 83 Figure 4.1 - Characterization of IL-1α-TID...... 97 Figure 4.2 - Protein biotinylation by TID constructs...... 99 Figure 4.3 - Purification of biotinylated proteins...... 101

Supplementary Figures

Figure S3.1 - Expression constructs of pro- and mature IL-1α...... 91 Figure S3.2 - Representative images from nuclear localization analysis in Fig 2.3A...... 91 Figure S4.1 - IL-1 and NLRP3 baits for TID proximity labelling...... 110

Abbreviations AGE Advanced glycation end-product AIM2 Absent in melanome 2 ALR AIM2-like receptor ANOVA Analysis of variance AP-1 Activator protein 1 Apoptosis-associated speck-like protein containing a ASC caspase recruitment domain ATG Autophagy-related gene ATP Adenosine triphosphate BSA Bovine serum albumin B30.2 B30.2/SPRY domain B-Box B-box zinc finger domain BMDM Bone marrow–derived macrophage CAPS Cryopyrin-associated periodic syndromes CARD Caspase recruitment domain CC Central-coiled domain CLR C-type lectin receptor CNS Central nervous system CPPD Calcium pyrophosphate dehydrate DAMP Damage-associated molecular pattern DMEM Dulbecco’s modified Eagle’s medium ER Endotiplasmic reticulum FBS Fetal bovine serum FIINDD Function to find domain FMF Familial Mediterranean fever GPI Glycosylphosphatidylinositol GRAS55 Golgi reassembly-stacking protein of 55 kDa GSDMD Gasdermin D HAT Histone acetyltransferase HAX1 HCLS1 associated protein X-1 HIF1α Hypoxia-inducible factor 1-α HMGB1 High mobility group box 1 HSP90 Heat shock protein 90 iBMDM Immortalized bone marrow–derived macrophage IL Interleukin IL-1R IL-1 receptor IL-1Ra IL-1R antagonist IL-1RAcP IL-1R accessory protein IRAK IL-1R-associated kinases JNK c-Jun N-terminal kinase LDH Lactate dehydrogenase LPS Lipopolysaccharide LRR Leucine-rich repeat domain

MAPK Mitogen-associated protein kinase mat-IL-1 / m-IL-1 Mature IL-1 MDM Monocyte-derive macrophage MEF Mouse embryonic fibroblast MS Mass spectrometry MSU Monosodium urate NEK7 NIMA-related kinase 7 NF-κB Nuclear factor κB NK Natural killer NLR NOD-like receptor NOD-, LRR- and caspase recruitment domain-containing NLRC4 protein 4 NLRP NOD-, LRR- and pyrin domain-containing protein NLS Nuclear localization signal NOD Nucleotide-binding oligomerization domain NT Not transfected PAMP Pathogen-associated molecular pattern PBMC Peripheral blood mononuclear cell PBS Phosphate-buffered saline PBST PBS 0.1% Tween 20 PenStrep Penicillin-streptomycin PIP2 Phosphatidylinositol 4,5-bisphosphate pro-IL-1/pIL-1 IL-1 proform PRR Pattern recognition receptor PTM Post-translational modifications Ptpn6 Protein tyrosine phosphatase non-receptor 6 PYD Pyrin domain RAGE Receptor of advanced glycation end-product RhoA Ras homolog family member A RLR RIG-I-like receptor RT-qPCR Reverse transcription - quantitative polymerase SASP Senescence-associated secretory phenotype SEM Standard error of the mean SNARE Soluble NSF attachment protein receptor SP Signal peptide T3SS Type 3 secretion system TAK TGF-β-activated kinase TID TurboID TIR Toll/interleukin-1 receptor TLR Toll like-receptor TMED Transmembrane emp24 domain-containing protein TNF Tumour necrosis factor TRAF6 TNF receptor-associated factor 6 TRIF TIR-domain-containing adapter-inducing interferon-β TRIM16 Tripartite motif-containing protein 16

Abstract

Inflammation is a biological response that protects the host against infection, promotes tissue repair and recovers tissue homeostasis. Understanding the mechanisms that regulate inflammation is essential, as inflammation can become a maladaptive response that leads to the development and exacerbation of many diseases. The cytokines of the Interleukin-1 (IL-1) family, namely IL-1α and IL-1β, initiate and propagate inflammatory responses. While IL-1α and IL-1β signal through the same IL-1 Receptor, they differ in their expression, protein interactions, subcellular distribution and secretory mechanisms. Research has widely focused in IL-1β secretion, while the mechanisms that regulate IL-1α function are poorly understood. The aim of this thesis was to investigate multiple aspects that distinctly regulate IL-1α secretion. Firstly, the work presented here shows that while IL-1α and other IL-1 family cytokines are secreted in absence of cell lysis, IL-1α has a distinct secretory pathway related to the proteases calpain- 1/2 and it may be dissociated from membrane permeability in contrast to IL-1β. Secondly, IL-1α nuclear localization was found to inhibit IL-1α release and activation, and IL-1α pro-domain was found to be necessary for IL-1α stability and activation. Finally, a new method to screen the IL-1α interactome by enzymatic proximity labelling was set up, which will be used to find novel functions of IL-1α protein interactors. Thus, the findings in this thesis give new insights in the mechanisms that regulate IL-1α secretion, and contribute to the understanding of an inflammatory signalling pathway of therapeutic interest.

Declaration

Work included in Chapter 3 of this thesis has previously been submitted as part of MSci dissertation of Rose Wellens, where I supervised throughout her project. I declare that no other portion of the work referred to in the thesis has been submitted in support of an application for another degree of qualification of this or any other university or other institute of learning.

Victor Tapia

31/08/2020

Copyright Statement i. The author of this thesis (including any appendices and/or schedules to this thesis) owns certain copyright or related rights in it (the “Copyright”) and s/he has given The University of Manchester certain rights to use such Copyright, including for administrative purposes. ii. Copies of this thesis, either in full or in extracts and whether in hard or electronic copy, may be made only in accordance with the Copyright, Designs and Patents Act 1988 (as amended) and regulations issued under it or, where appropriate, in accordance with licensing agreements which the University has from time to time. This page must form part of any such copies made. iii. The ownership of certain Copyright, patents, designs, trademarks and other intellectual property (the “Intellectual Property”) and any reproductions of copyright works in the thesis, for example graphs and tables (“Reproductions”), which may be described in this thesis, may not be owned by the author and may be owned by third parties. Such Intellectual Property and Reproductions cannot and must not be made available for use without the prior written permission of the owner(s) of the relevant Intellectual Property and/or Reproductions. iv. Further information on the conditions under which disclosure, publication and commercialisation of this thesis, the Copyright and any Intellectual Property University IP Policy (see: http://documents.manchester.ac.uk/display.aspx?DocID=24420, in any relevant Thesis restriction declarations deposited in the University Library, The University Library’s regulations (see http://www.library.manchester.ac.uk/about/regulations/) and in The University’s policy on Presentation of Theses.

Thesis Format

This thesis has been submitted in journal format to allow the inclusion of published papers. This consists of a general introduction, three results chapters, general discussion and references. This format has been approved by the University of Manchester Doctoral Academy (presentation of theses policy, section 9).

Acknowledgements

Firstly, I would like to thank Prof David Brough for these four years of supervision. Dave, I truly appreciate the opportunity I got in your lab. Thanks for all the guidance and intellectual challenges which made me grow as a scientist, and thanks for your support along the ups and down of my PhD. Thanks also to Jack Rivers-Auty and Elena Redondo for their co-supervision and guidance during the first half of my program. Outside the lab, thanks to Sally Jacobs and Prof Judy Williams for their support and encouraging along my PhD program.

I would also like to thank the Chilean National Agency for Research and Development (ANID) and its program Becas Chile, which funded my PhD and allowed me to do top research in the University of Manchester.

Thanks to all who have been part of the Brough lab, including Chris Hoyle, Tessa Swanton, Jack Green, Bali Lee, Eloise Lemarchand, Mike Daniels, Arthur Yushi, Jack Barrington, Rose Wellens, Matthew Dewhurst, James Cook , Lucy Morris, Dan Williams and Cath Diamond. Thanks to all the members of the Brain Inflammation Group. I am truly lucky to have arrived in a research group with such a good working environment. Special thanks to the PIs Catherine Lawrence, Stuart Allan and Emanuel Pinteaux, and to my labmates Sid, Claire, Connor, Siobhan and Hannah.

I also want to acknowledge relevant support to my research. Thanks to the bioimaging, transgenic and mass spectrometry core facilities in FMBH which facilitated many relevant techniques. Our molecular biology studies have only work thanks to the support of Antony Adamson and Hayley Bennet. Big thanks to the members of the Salford Royal NHS Foundation Trust, who gave me a space to finish my PhD in these unexpected times.

Finally, I would like to thanks my close ones. Mauro, Arvind and Scott, without your emotional support this would have been much more difficult. Aldo, Geraldyne, Miguel, Paulina and Ruben, thanks for keeping the long-distance friendships. And to my family, without all your efforts I would not be here. I dedicate this thesis to my Dad, who supported my scientific curiosity since I was a child.

Chapter 1. General Introduction

1.1. Inflammation

Inflammation is a response to infection, tissue injury or tissue malfunction, with the purpose of controlling infection, promoting tissue repair and restoring tissue homeostasis (Medzhitov, 2008). The inflammatory response is characterised by the cardinal signs of redness, swelling, heat, pain and loss of function. These clinical symptoms manifest due to the processes triggered by the acute inflammatory response: Delivery of soluble mediators, recruitment of leukocytes and activation of the immune system at the site of infection or injury. During the inflammatory response, the vascular system increases blood flow and the endothelium becomes permeable, facilitating the chemotaxis and extravasation of immune cells (Pober and Sessa, 2007). In response to infection, recruitment of neutrophils, monocytes and other immune cells limits the effects of pathogens and destroys them. If the infection is not initially controlled, antigen presenting cells recruit and tune the adaptive immune response, composed of several subsets of T and B-cells (Chaplin, 2010). While the inflammatory response orchestrates immunity to control infection, it can also be triggered in response to sterile injury (Chen and Nunez, 2010) and activate the immune system to control tissue repair (Eming et al., 2009).

In contrast to its homeostatic function, dysregulation of inflammation can lead to impaired infection control, tissue damage and loss of physiological balance (Medzhitov, 2008). Detrimental consequences during acute inflammatory responses are associated with tissue damage and organ failure during infection (Nedeva et al., 2019) and tissue scarring during wound healing (Eming et al., 2009). Settings of chronic inflammation have also been associated with the development of non-communicable diseases, such as metabolic syndromes, atherosclerosis, autoimmunity and central nervous system (CNS) diseases (Hotamisligil, 2006; Nikoopour et al., 2008; Skaper et al., 2018; Tedgui and Mallat, 2006). Therefore, there is therapeutic value in understanding the mechanisms that control the inflammatory response.

1.2. Regulation of the inflammatory response

While the inflammatory response is coordinated by a large variety of signalling networks, at a basic level the inflammatory pathways can be divided in four

13 nodes: Inducers, sensors, mediators and effectors (Medzhitov, 2008). During infection, inflammatory inducers can be pathogen-associated molecular patterns (PAMPs) and virulence factors. PAMPs are macromolecules with conserved molecular patterns found only in microorganisms, which can be recognised for host defence. On the other hand, virulence factors are molecules not directly recognised and instead, sensed by their detrimental effects on the host. Sterile inducers sometimes are referred as damage-associated molecular patterns (DAMPs). DAMPs can be intracellular molecules released during cell death (referred as alarmins); aggregated bodies such as endogenous crystals, and degradation products, such as breakdown components from the extracellular matrix during tissue damage, or advanced glycation end-products (AGEs) during chronic inflammation (Medzhitov, 2008).

Most inflammatory inducers are detected by sensors classified in five families of pattern recognition receptors (PRRs). The PRRs Toll-like receptors (TLRs) and C-type lectin receptors (CLRs) are membrane-bound and localise in the cell surface or in endosomal compartments, while the NOD-like receptors (NLRs), RIG-I-like receptors (RLRs) and AIM2-like receptors (ALRs) localise in the cytosol (Brubaker et al., 2015). In addition to PRRs, certain DAMPs are recognised by specific membrane-bound receptors such as receptors of AGEs (RAGEs), which recognise AGEs and intracellular released proteins (Chen and Nunez, 2010). The diverse sub-cellular localisation of inflammatory sensors ensures the detection of extracellular and cytosolic PAMPs, virulence factors and DAMPs. When triggered, these sensors initiate downstream signalling cascades that lead to the expression, activation and secretion of mediators, such as cytokines, chemokines, vasodilators, lipid mediators and proteolytic enzymes (Medzhitov, 2008).

The focus of this PhD thesis is the pro-inflammatory cytokine Interleukin-1α and the related Interleukin-1β (referred together as IL-1). IL-1 is a central mediator of the inflammatory and immune response, targeting effector cells from the vascular system, immune system and the parenchyma to promote a local inflammatory response, while also targeting effector cells in the brain and liver to induce a systemic inflammatory response (Garlanda et al., 2013; Mantovani et al., 2019). The following sections will discuss the mechanisms of IL-1 signalling, and how

14 inducers and sensors trigger the expression, activation and secretion of IL-1α and IL-1β.

1.3. IL-1 signalling

IL-1α and IL-1β are members of the IL-1 superfamily of receptors and ligands, one of the main cytokine families that regulate the inflammatory response (Mantovani et al., 2019). The superfamily is composed of 10 receptors and 11 ligands, which share a common binding mode for receptor-ligand complexes (Krumm et al., 2014; Rivers-Auty et al., 2018). The ligands IL-1α, IL-1β, IL-1RA, IL-36α, IL-36β, IL-36γ, IL-36RA, IL-37 and IL-38 have a common ancestor and reside in the same chromosome cluster. The remaining ligands, IL-18 and IL-33, have an independent evolutionary history but share structural features and mechanisms of activation with the other members of the family (Rivers-Auty et al., 2018).

IL-1α and IL-1β were the first discovered and are the most studied members of the IL-1 superfamily (Dinarello, 2013). IL-1α diverged from IL-1β in a gene duplication event during early mammalian evolution (Rivers-Auty et al., 2018), sharing only a 25% of sequence homology (March et al., 1985). Despite this evolutionary divergence, both IL-1α and IL-1β signal through the major IL-1 receptor IL-1R1 (Figure 1.1). IL-1α and IL-1β also share similarities in their mechanism of activation and secretion. They lack a leader sequence required for secretion through the endoplasmic reticulum (ER) /Golgi pathway. Instead, IL-1α and IL-1β are stored as intracellular precursors (pro-IL-1) and after proteolytic processing a mature form is released by unconventional secretory pathways (Mantovani et al., 2019). The processing to a mature form is relevant for IL-1 signalling, as it increases IL-1α activity (Afonina et al., 2011; Burzynski et al., 2019; Zheng et al., 2013) and is absolutely essential for IL-1β signalling (Black et al., 1988; Hazuda et al., 1990; Mizutani et al., 1991).

IL-1 signalling through IL-1R1 is mediated by the IL-1R accessory protein (IL- 1RAcP) (Cullinan et al., 1998), which is a common co-receptor for several members of the IL-1 superfamily (Højen et al., 2019). Both IL-1R1 and IL-1RAcP consist in three immunoglobulin domains at the extracellular side and an intracellular toll/interleukin-1 receptor (TIR) domain (Figure 1.1). Upon ligand binding, IL-1R1 and IL-1RAcP dimerise through their TIR domains, inducing the

Figure 1.1 - IL-1 signalling pathway and negative regulators. Pro-IL-1α, mature IL-1α and mature IL-1β bind to IL-1R1 and induce the recruitment of the accessory protein IL-1RAcP (1). The cytoplasmatic Toll/interleukin-1 receptor (TIR) domains on each receptor chain come close and recruit MyD88 via its TIR domain (2). MyD88 triggers the phosphorylation of the IL-1R-associated kinases IRAK4 and IRAK1 (3). Phosphorylated IRAKs recruit and activate TRAF-6, which is ubiquitinated (4). TRAF- 6 associates to TAK1 (TGF-β-activated kinase 1), TAK1-binding proteins (TAB) TAB1 and TAB2, inducing TAK1 phosphorylation (5). TAK1 activates the nuclear factor-κB (NF- κB), mitogen-activated protein kinase (MAPK) p38, JNK and ERK1/3 signalling pathways, leading to activation of transcription factors (6). On the surface, IL-1R1 can be inhibited by the antagonist IL-1Ra (7) and IL-1 cytokines can be sequestered by surface-bound and soluble receptors IL-1R2, IL-1RAcP and IL-1R1 (8).

16 recruitment of the TIR domain-containing adaptor protein Myd88. Myd88 then couples to downstream IL-1R-associated kinases (IRAKs) and tumour necrosis factor receptor-associated factor 6 (TRAF6). The signal transduction activates the transcription factors nuclear factor-κB (NF-κB) and activator protein-1 (AP-1), promoting the transcription of pro-inflammatory genes in effector cells (Dinarello, 2009).

While IL-1, IL-1R1 and IL-1RAcP form a signalling complex, alternative isoforms and other members of the IL-1 superfamily inhibit the IL-1 signalling pathway (Figure 1.1). The ligand IL-1Ra is a secreted antagonist that competes with IL-1, binding to IL-1R1 and inhibiting its signalling (Dinarello, 2009). IL-1R2 is a decoy receptor that lacks the intracellular TIR domain, blocking IL-1 signalling when binding to IL-1 (Colotta et al., 1993). IL-1R2 is expressed in the plasma membrane, but it can be secreted by alternative splicing or proteolytic processing, thus sequestering secreted IL-1 (Kuhn et al., 2007; Lorenzen et al., 2012). Membrane-bound or soluble Il-1RAcP can bind to the IL-1R2 - IL-1 complex, enhancing its inhibition of IL-1 signalling (Malinowsky et al., 1998; Smith et al., 2003). A soluble from of IL-1R1 also inhibits IL-1 signalling (Fanslow et al., 1990).

1.4. IL-1 expression

Despite being localized in the same gene cluster (Modi et al., 1988) and sharing a common IL-1 signalling pathway, IL-1α and IL-1β have different tissue expression patterns. Expression of both IL-1α and IL-1β is induced in response to inflammatory inducers, a process prominently studied in hematopoietic cells, but IL-1α is also constitutively expressed in barrier tissues such as the skin, gastrointestinal tract and lungs, and in liver, kidney and epithelial cells (Garlanda et al., 2013).

IL-1α and IL-1β inducible expression is upregulated in response to PAMPs and DAMPs, and the Toll-like Receptor (TLR) signalling pathway has a major role in IL-1 expression. After being triggered, TLRs signalling promotes gene transcription via the NF-kB, AP-1 and IRF transcription factors (Brubaker et al., 2015). In experimental models, the most common inducer for IL-1 expression is bacterial lipopolysaccharide (LPS), a TLR4 agonist (Darveau, 1998). This process is called priming, as it promotes readiness of cells to secrete IL-1. While

17 priming is usually performed by LPS treatment, DAMPs can also activate TLRs and induce priming (Patel et al., 2017). Sterile inducers that activate TLR signalling are released intracellular molecules, such as high mobility group box 1 protein (HMGB1) (Andersson and Tracey, 2011), S100 proteins (Vogl et al., 2007), nucleic acids (Karikó et al., 2004; Leadbetter et al., 2002) and oxidised phospholipids (Imai et al., 2008; Stewart et al., 2010); broken components of the extracellular matrix such as heparan sulphate (Johnson et al., 2002) and hyaluronan (Termeer et al., 2002); and aggregated molecules such as monosodium urate crystals (Liu-Bryan et al., 2005) or amyloid-β peptides (Reed- Geaghan et al., 2009). IL-1 expression can also be upregulated by other sterile stimuli, such as AGEs (Alexiou et al., 2010), oxidative stress (Bauernfeind et al., 2011; Mccarthy et al., 2013) and hypoxia (Rider et al., 2012; Tannahill et al., 2013), and also by pro-inflammatory mediators such as tumour necrosis factor α (TNFα) (Franchi et al., 2009) and IL-1 itself (Hiscott et al., 1993; Kimura et al., 1998).

Inducible IL-1α and IL-1β expression is partially regulated by the same group of transcription factors. NF-κB, AP-1 and hypoxia-inducible factor 1-α (HIF-1α) transcription factors promote IL-1α (Bailly et al., 1996; Mori and Prager, 1996; Rider et al., 2012) and IL-1β expression (Hiscott et al., 1993; Roman et al., 2000; Tannahill et al., 2013). IL-1β expression is also promoted by the transcription factors PU.1 and C/EBPβ (Kominato et al., 1995; Shirakawa et al., 1993; Tsukada et al., 1994). Inducible IL-1α expression in hematopoietic cells is also promoted by the long non-coding RNA AS-IL-1a, an antisense transcript which is partially complementary to the IL-1α mRNA (Chan et al., 2015; Daniels et al., 2017). The Il1a promoter region also contains a binding site for the Sp1 transcription factor (Mcdowell et al., 2005), which possibly regulates constitutive expression of IL-1α as it promotes the expression of housekeeping genes (Wierstra, 2008), and a transcriptional-repressor-site (Mcdowell et al., 2005).

1.5. IL-1 sequence

Despite a low sequence homology (March et al., 1985), the mature domains of IL-1α and IL-1β have a conserved protein structure (Graves et al., 1990; Oostrum et al., 1991). This structure is composed of 12 β-strands in a β-trefoil architecture, with the β4/5 and β11/12 loops important for interaction and activation of IL-1R1

(Fields et al., 2019). In both cytokines the mature domain is connected to the pro- domain by a region, approximately of 20 aminoacids long, with multiple cleavage sites (Figure 1.2). As previously mentioned, the pro-domains inhibit IL-1α (Afonina et al., 2011; Burzynski et al., 2019; Zheng et al., 2013) and IL-1β signalling (Black et al., 1988; Hazuda et al., 1990; Mizutani et al., 1991). The IL- 1β pro-domain may also inhibit IL-1β secretion. IL-1β processing increases IL-1β interactions with heat shock protein 90 (HSP90), transmembrane emp24 domain- containing protein 10 (TMED10) and phosphatidylinositol 4,5-bisphosphate (PIP2)-enriched plasma membrane, inducing unconventional secretory pathways that will be discussed later (Monteleone et al., 2018; Zhang et al., 2015; Zhang et al., 2020). These interactions are mediated by HSP90 and TMED10 binding sequences and a polybasic motif localised in the mature domain (Figure 1.2).

A striking difference between IL-1α and IL-1β is the presence of several protein- interaction motifs in the IL-1α pro-domain (Figure 1.2). Moreover, the IL-1α pro- domain has a higher degree of conservation than its IL-1β counterpart, suggesting that pro-domain functions have been relevant for IL-1α evolution since diverged from IL-1β (Rivers-Auty et al., 2018). The motif most recognised in the IL-1α pro-domain is the nuclear localization signal (NLS) (Luheshi et al., 2009b; Wessendorf et al., 1993), which is highly conserved but not present in all species (Rivers-Auty et al., 2018). Associated to the NLS, several nuclear proteins have been found to interact with the IL-1α pro-domain by two-yeast hybrid and immunoprecipitation techniques. Interactions with the proteins importin-α1 and importin-α5 (Pollock et al., 2003) are associated to their role in recognising NLS and mediating nuclear transport (Lange et al., 2007). Pro-IL-1α interacts with the histone acetyltransferases (HATs) p300, PCAF and GCN5 and promotes gene transcription, via two α-helix motifs in its pro-domain (Figure 1.2) (Buryskova et al., 2004; Zamostna et al., 2012). IL-1α pro-domain also has been shown to interact with proteins involved in RNA processing, such as ASF/SF2, prp8 and hnRNPAB, with the aminoacid valine-73 essential for these interactions (Figure 1.2) (Pollock et al., 2003). The first 36 aminoacids of pro-IL-1α promotes an interaction with necdin, a nuclear growth suppressor. Interestingly, IL-1β pro- domain is also reported to interact with necdin despite not having a nuclear localization signal (Figure 1.2) (Hu et al., 2003).

Outside the nucleus, two-yeast hybrid and immunoprecipitation studies report IL- 1α interaction with a cytosolic IL-1R2 isoform (Kawaguchi et al., 2006; Zheng et al., 2013) and HCLS1 associated protein X-1 (HAX-1) (Kawaguchi et al., 2006; Yin et al., 2001). IL-1R2 interacts with the mature domain (Kawaguchi et al., 2006) and HAX1 interaction is mediated by several sequences in the pro-domain (Figure 1.2) (Yin et al., 2001). While cytosolic IL-1R2 is known to prevent IL-1α processing (Zheng et al., 2013), the role of HAX-1 interaction in IL-1α function remains poorly understood. HAX1 is a pleiotropic protein involved in regulation of apoptosis (Simmen, 2011), calcium signalling (Larsen et al., 2020; Simmen, 2011) and cell migration (Fadeel and Grzybowska, 2009), but it has only been shown to promote IL-1α nuclear localization in multiple sclerosis-derived fibroblasts (Kawaguchi et al., 2006). Interestingly, it has been proposed that the first 40 aminoacids of pro-IL-1α, which contain HAX-1, HATs and necdin binding sequences, are a main driver of IL-1α evolution because its high level of conservation along all mammalian species (Rivers-Auty et al., 2018).

Post-translational modifications (PTMs) have been also described for IL-1. Aminoacids within or close the NLS can be phosphorylated (Beuscher et al., 1988), acetylated (Cohen et al., 2015) and myristoylated (Stevenson et al., 1993) (Figure 1.2). These PTMs could regulate IL-1α sub-cellular localization. Acetylation has been suggested to promote IL-1α nuclear localization (Cohen et al., 2015), while phosphorylation (Beuscher et al., 1988; Kobayashi et al., 1990a) and myristoylation (Stevenson et al., 1993) have been associated with membrane localisation. The ubiquitin system also regulates IL-1 protein levels and secretion (Lopez-Castejon, 2020). Following IL-1 upregulation by inflammatory stimuli in dendritic cells and macrophages, polyubiquination promotes IL-1α and IL-1β degradation by the proteosome (Ainscough et al., 2014; Eldridge et al., 2017). In LPS-primed macrophages IL-1α ubiquination could also promote processing and secretion by an unknown mechanism (Lin et al., 2020). IL-1β has a specific polyubiquination site in the mature domain that promotes processing, possibly by promoting oligomerization with proteins involved in IL-1β cleavage (Figure 1.2) (Duong et al., 2015).

Figure 1.2 - Protein interactions, post-translational modifications and cleavage sites for IL-1. Diagrams showing binding sites (black), multiple cleavage regions (red) and post- translational modifications (PTM, green) in the pro- and mature domains of IL-1α (a) and IL-1β (b) with their respective aminoacid positions. a, IL-1α is cleaved by the proteases elastase, caspase-5, caspase-11, granzyme B, chymase, calpain and cathepsin G. The IL-1α pro-domain contains a nuclear localization signal (NLS), which can be acetylated, myristoylated and phosphorylated. IL-1α contains two binding sites for histone acetyltransferases (HATs), three binding sequences for HAX-1, a single sequence for necdin and for RNA-splicing proteins in the pro-domain, and a putative binding sequence for TMED10 in the mature domain. b, IL-1β is cleaved by the proteases elastase, chymase, cathepsin G, caspase-1, caspase-8 and granzyme A. IL-1β pro-domain interacts with necdin, while the mature domain contains two binding sites for HSP90 and a single binding domain for TMED10. IL-1β mature domain also contains a polybasic motif and can be poly-ubiquitinated. Motifs for interactions with IL-1R1 and IL-1R2 are not depicted.

1.6. IL-1 sub-cellular localization

The previously discussed motifs and PTMs differentially regulate IL-1α and IL-1β subcellular distribution. IL-1β has a cytosolic distribution, on the contrary IL-1α has a marked nuclear localization as it contains an NLS (Luheshi et al., 2009b). IL-1α nuclear localization has been proposed to regulate inflammation by two different mechanisms. A pro-inflammatory and cytokine-independent role has been proposed by regulation of gene expression. IL-1α interacts with HAT proteins to stimulate gene transcription (Buryskova et al., 2004), and when pro- IL-1α or only IL-1α pro-domain are expressed in cells, they promote expression of pro-inflammatory genes in an IL-1 signalling independent manner (Werman et al., 2004; Zhang et al., 2017). This seems to be a specific trait of IL-1α, as the expression of IL-33, another nuclear member of the IL-1 family, has no effect on gene regulation (Travers et al., 2018).

Nuclear localization also has an anti-inflammatory role by dampening IL-1α secretion. IL-1α is retained in the nuclei of necrotic (Luheshi et al., 2009a) and apoptotic cells (Cohen et al., 2010). How nuclear localization is regulated to inhibit IL-1α release is not completely understood. Nuclear transport is an active process regulated by the importin proteins (Lange et al., 2007; Luheshi et al., 2009b), and as previously mentioned, it may also be promoted by HAX1 binding (Kawaguchi et al., 2006) and histone deacetylases (Cohen et al., 2015). Mobility inside the nucleus could also be a regulated process for IL-1α sequestration, as intra-nuclear mobility decreases in necrotic and apoptotic cells (Cohen et al., 2010; Luheshi et al., 2009a), while IL-1α has been shown to actively mobilise to damaged DNA areas in response to irradiation (Cohen et al., 2015).

While the role of nuclear localization has been a main focus on IL-1α research, it has been suggested that the nuclear localization is not essential for IL-1α function as the NLS is not conserved in all mammalian species (Rivers-Auty et al., 2018). IL-1α is found in the cytosol, where interacts with HAX-1 and IL-1R2 (Kawaguchi et al., 2006), and at low levels in the cell surface (Fettelschoss et al., 2011; Kurt-Jones et al., 1985). Cell surface pro-IL-1α can activate IL-1R1 via juxtacrine signalling (Kaplanski et al., 1994; Orjalo et al., 2009) or be secreted as a mature soluble form when cleaved by extracellular enzymes (Burzynski et al., 2019; Chan et al., 2020). Increase in surface IL-1α has been observed in

22 macrophages and dendritic cells after LPS-priming (Burzynski et al., 2019; Chan et al., 2020; Fettelschoss et al., 2011; Kurt-Jones et al., 1985), in platelets after collagen activation (Burzynski et al., 2019) and in fibroblasts during senescence (Orjalo et al., 2009; Wiggins et al., 2019). On the other hand, IFN-γ has been reported to decrease surface IL-1α in macrophages (Chan et al., 2020). It is unclear how IL-1α is translocated to the cell surface. Besides IL-1α myristoylation and phosphorylation (Beuscher et al., 1988; Kobayashi et al., 1990a; Stevenson et al., 1993), interactions with cell surface proteins may be involved, as cell surface glycoproteins (Brody and Durum, 1989; Kaplanski et al., 1994), proteins anchored to the surface by glycosylphosphatidylinositol (GPI-anchors), and membrane-bound IL-1R2 (Chan et al., 2020) have been shown to modulate IL-1α surface levels.

1.7. Mechanisms of IL-1 activation

Stored as inactive pro-forms, IL-1 must be cleaved by proteases to induce its full activation. Early discoveries showed that IL-1α and IL-1β activation was regulated by different mechanisms; IL-1α processing was mediated by the calcium-dependent protease calpain (Carruth et al., 1991; Kobayashi et al., 1990b) and IL-1β processing by the protease caspase-1 (Cerretti et al., 1992; Thornberry et al., 1992). Currently multiple proteases have been reported to activate IL-1α and IL-1β (Figure 1.2). The following section discusses how inflammatory stimuli trigger sensors that activate these proteases, by different but sometimes related mechanisms of activation (Figure 1.3).

Figure 1.3 - Calpain and inflammasome-dependent IL-1 activation. Cleavage of IL-1α and IL-1β by calpain and inflammasomes is a process connected by ion disbalance. Calpain-dependent IL-1α processing occurs in response to calcium influx, induced by cell death, virulence factors and plasma membrane pores (1). Canonical NLRP3 inflammasome activation, induced by potassium influx, leads to caspase-1- dependent processing of IL-1β, IL-18, GSDMD pore formation and degradation of IL-1R2. Calpain-dependent IL-1α processing is promoted by GSDMD-induced calcium influx and degradation of IL-1R2 (2). Caspase-11 activation occurs in response to cytosolic LPS, this leads to IL-1α processing and GSDMD pore formation. NLRP3 inflammasome activation is promoted by GSDMD-induce potassium efflux (3).

1.7.1. Calpain

Calpains are a superfamily of cysteine proteases activated by calcium and represented by 15 members in humans (Ono et al., 2016). There are few specific calpain inhibitors (Ono et al., 2016), and therefore pharmacological studies were not able to identify which calpain members cleave IL-1α until genetic analysis found that calpain-1 and -2 induce IL-1α processing (Tapia et al., 2019) (see Chapter 2). Calpain-1 and -2 are also named µ- and m-calpains as they are activated by micromolar and millimolar calcium levels (Goll et al., 2003). Although calpain-1 and -2 are the best characterized members of the calpain family, how they are activated in physiological contexts is not well understood as intracellular calcium levels are tightly regulated and reach micromolar levels at most (Ono et al., 2016). On the contrary, millimolar calcium levels are found in the extracellular fluid, and it is known that calcium influx leads to calpain-1 and calpain-2 activation (Mellgren et al., 2009; Mellgren et al., 2007).

Calpain-dependent IL-1α processing (Figure 1.3) occurs in response to necrosis (Zheng et al., 2013), programmed-cell deaths that involved formation of membrane pores such as pyroptosis (England et al., 2014; Groß et al., 2012; Tapia et al., 2019) and necroptosis (England et al., 2014), bacterial and fungal virulence factors (Caffrey-Carr et al., 2017; Fang et al., 2017), following activation of endogenous plasma membrane calcium channels (Groß et al., 2012) and treatment with the calcium ionophore ionomycin (Groß et al., 2012; Tapia et al., 2019). Calpain activation depends on calcium influx, as IL-1α processing is inhibited in calcium free media (England et al., 2014; Fang et al., 2017; Tapia et al., 2019). The calpain system is regulated by the expression of the endogenous inhibitor calpastatin (Hanna et al., 2008), and calpain-dependent IL-1α activation is inhibited by intracellular IL-1R2 (Zheng et al., 2013).

1.7.2. Inflammasome activation

Caspases are a family of cysteine proteases which essential roles in programmed cell death. Caspases are broadly divided in apoptotic caspases (caspase-1, 3 and 6-10) and inflammatory caspases (caspase-1, 4, 5, 11, 12). Caspases are expressed as inactive pro-forms and are activated by proteolysis, usually when recruited to protein platforms or when cleaved by other caspases

(Man and Kanneganti, 2015). Although IL-1β was found to be activated by caspase-1 in 1992 (Cerretti et al., 1992; Thornberry et al., 1992), the basis of caspase-1 activation was elucidated 10 years later with the discovery of the inflammasome complex (Martinon et al., 2002; Tschopp et al., 2003).

Inflammasomes are intracellular protein complexes assembled by pattern PRRs in response to PAMPs, virulence factors, or DAMPs (Figure 1.4). When activated, the PRRs oligomerise forming the inflammasome complex, which recruits the adaptor protein apoptosis-associated speck-like protein containing a caspase recruitment domain (ASC). ASC self-oligomerise via homotypic PYD-PYD (pyrin domains) and CARD-CARD (caspase recruitment domains) interactions into filament-like structures, leading to the formation of a macromolecular platform that can reach up to 1 µm in diameter. This platform, referred as ASC speck, recruits and activates caspase-1. While there are 22 human and 34 murine PRR inflammasome genes, the most characterized inflammasomes are NLRP3, NLRP4, NLRC1, AIM2 and pyrin, which are activated by different sterile and pathogen stimuli (Broz and Dixit, 2016).

Inflammasome research has widely focused on NLRP3 because is activated during both infectious and sterile inflammation, and because it is an effective therapeutic target for a wide variety of inflammatory diseases (Mangan et al., 2018). NLRP3 activation is classically considered a two-step process. NLRP3 is constitutively expressed in resting cells, but similar to IL-1 cytokines, an initial priming step via TLR signalling induces NF-κB-dependent upregulation of NLRP3 levels (Bauernfeind et al., 2009). In addition, priming also induces changes in PTMs (Lopez-Castejon, 2020; Mckee and Coll, 2020) and promotes interactions with adaptor proteins TRIF and IRAK1 (Fernandes-Alnemri et al., 2013; Lin et al., 2014) to promote NLRP3 inflammasome activation.

Following priming, a second signal is required for NLRP3 activation. A wide variety of inflammatory inducers activate NLRP3, being the most commonly used the potassium ionophore nigericin, ATP, and particulate material such as monosodium urate (MSU) crystals (Martinon et al., 2006; Perregaux and Gabel, 1994). The diverse nature of activators suggests that NLRP3 is not a direct sensor of these signals, and instead detects downstream cellular events. Several events have been found to promote NLRP3 activation, including altered ion

26 homeostasis, oxidative stress, and organelle disruption (He et al., 2016). It has been proposed that NLRP3 activating signals converge on potassium efflux (Muñoz-Planillo et al., 2013) and downstream NLRP3 activation by NIMA-related kinase 7 (NEK7) (Schmid-Burgk et al., 2016; Yuan et al., 2016). The potassium efflux-dependent mechanism has been referred as canonical NLRP3 activation, as alternative potassium efflux-independent mechanisms have also been reported (Chen and Chen, 2018; Groß et al., 2016; Wolf et al., 2016).

Besides NLRP3, mechanisms for NLRC4, NLRP1, AIM2 and pyrin inflammasome activation have been described (Figure 1.4) (Broz and Dixit, 2016). NLRC4 inflammasome is activated by sensor proteins NAIPs, which detect flagellin and subunits of the bacterial type 3 secretion system (T3SS) during intracellular infection (Miao et al., 2010; Zhao et al., 2011). Although inducers for human NLRP1 have not yet been found, this inflammasome could be activated by mechanisms involving proteolysis of the PRR, as mouse NLRP1b and rat NLRP1 are activated following cleavage by Bacillus anthacis lethal factor (Boyden and Dietrich, 2006; Levinsohn et al., 2012) . AIM2 is a cytosolic DNA sensor (Fernandes-Alnemri et al., 2009; Hornung et al., 2009; Roberts et al., 2009), and is activated in response to DNA viruses, intracellular bacteria or in autoinflammatory diseases by self-DNA (Dombrowski et al., 2011; Rathinam et al., 2010). Pyrin is activated in response to Ras homolog family member A (RhoA) inactivation by virulence factors (Xu et al., 2014), and it has been suggested that pyrin recognizes disturbances of the cytoskeleton, as RhoA modulates actin dynamics (Broz and Dixit, 2016).

Following inflammasome assembly, active caspase-1 cleaves and activate the pro-forms of IL-1β and another cytokine of the IL-1 superfamily, IL-18 (Figure 1.3) (Chan and Schroder, 2020). Caspase-1 also cleaves the pore-forming protein gasdermin D (GSDMD). Full length GSDMD stays inactive by its autoinhibitory C- terminal domain, and following caspase-1 cleavage the N-terminal domain translocates and forms pores in the plasma membrane (Aglietti et al., 2016; Ding et al., 2016; Liu et al., 2016; Sborgi et al., 2016). GSDMD pores allow the exchange of water, ions and small macromolecules, causing osmostic pressure and membrane rupture, leading to the pro-inflammatory cell death called pyroptosis (Broz et al., 2020).

Figure 1.4 - Canonical inflammasomes. Inflammasomes can assemble from a variety of pattern recognition receptors (PRRs). Canonical NLRP3 is activated in response to potassium efflux and interact with NEK7 for its activation. NLRP3 comprises a leucine rich repeat (LRR) domain, a nucleotide-binding and oligomerization domain (NOD, also named NACHT) and a pyrin (PYD) domain. NLRC4 assembles following detection of flagelling or T3SS proteins by the sensor NAIPs, and comprises an LRR, NACHT and CARD domains. NLRP1b (mouse gen) is activated by anthax letal factor and comprises a NACHT, LRR, function to find (FIINDD) and CARD domains. AIM2 detects double stranded DNA and comprises a DNA-sensing HIN200 domain and PYD. Pyrin assembles following RhoA inhibition by virulent factors and comprises a B30.2/SPRY (B30.2) domain, central-coiled (CC) domain, B-box-type zinc finger (B-Box) domain and PYD. Following assembly, inflammasomes recruit ASC by PYD (yellow) and CARD (green) homo-typic interactions, which then recruits and activate pro-caspase-1 (Casp1).

While IL-1α is not a direct target of caspase-1, inflammasome activation also induces calpain-dependent IL-1α activation (Figure 1.3) (England et al., 2014; Groß et al., 2012; Tapia et al., 2019). GSDMD pore formation induces a rapid calcium influx (De Vasconcelos et al., 2018; Rühl et al., 2018), explaining how calpain is activated. Caspase-1 also degrades the cytosolic IL-1R2 that protects IL-1α from proteolytic cleavage, further increasing the activation of IL-1α (Burzynski et al., 2015; Zheng et al., 2013).

In summary, the diversity of PRR activating mechanisms ensures that a wide diversity of PAMPs, virulence factors and DAMPs trigger the assembly of the inflammasome, leading to caspase-1 activation and IL-1α, IL-1β and IL-18 activation. In a following section it will be discussed how GSDMD pores are also involved in the secretion of the IL-1 cytokines.

1.7.3. Non-canonical inflammasomes: Caspases-4/5/11

Caspase-4, caspase-5 (human) and capase-11 (mice) are sensors of intracellular bacteria that induce IL-1 secretion and pyroptosis (Figure 1.3). These caspases directly bind to cytosolic LPS (Kayagaki et al., 2013; Shi et al., 2014) and following activation, they cleave GSDMD and induce pyroptosis (Aglietti et al., 2016; Kayagaki et al., 2015). Caspase-5 and caspase-11 directly cleave and activate IL-1α (Wiggins et al., 2019). While IL-1β is not directly cleaved by these caspases, formation of GSDMD pores induces potassium efflux, which activates the inflammasome in NLRP3-competent cells and leads to IL-1β cleavage (Kayagaki et al., 2015). As activation of caspases-4/5/11 was found to induce IL- 1 secretion and pyroptosis independently of inflammasome activation, this process has been called non-canonical inflammasome activation (Kayagaki et al., 2011).

Non canonical inflammasome activation is activated in response to Gram- negative bacterial infections (Kayagaki et al., 2011). Interestingly, the non- canonical inflammasome also has reported functions in sterile conditions or fungal infection. Caspase-11-dependent IL-1α secretion is observed in senescent cells (Wiggins et al., 2019). In response to fungal infection, caspase-11 is also necessary for IL-1α secretion (Ketelut-Carneiro et al., 2019) and non-canonical NLRP3 activation (Sun et al., 2018). The alternative mechanisms that involve

LPS-independent caspase-11 activation are unknown. The fact that caspase-11 can interact with oxidized phospholipids (oxPAPC), although with opposite proposed mechanisms of caspase-11 activation (Zanoni et al., 2016) and inhibition (Chu et al., 2018), suggests that non-canonical inflammasomes could be regulated by ligands other than LPS.

1.7.4. Caspase-8

Caspase-8 is an apoptotic caspase that initiates the extrinsic cell death pathway, via recruitment to the ripoptosome, a protein platform composed by RIPK1, FADD and caspase-8 that regulates apoptotic and necroptotic cell death (Blander, 2014). Opposite to its role in apoptosis, which is non-inflammatory cell death, caspase-8-dependent IL-1 secretion and pyroptosis has been reported in some specific cases (Gaidt et al., 2016; Gringhuis et al., 2012; Maelfait et al., 2008; Orning et al., 2018; Sarhan et al., 2018). Moreover, caspase-8 has been found to directly cleave IL-1β (Maelfait et al., 2008) and GSDMD (Orning et al., 2018).

The contexts of caspase-8-dependent IL-1 secretion are quite specific. Following Yersinia infection, TAK-1 inhibition mediated by virulence factors activates caspase-8, leading to GSDMD cleavage, non-canonical NLRP3 activation and IL- 1 secretion (Orning et al., 2018; Sarhan et al., 2018). TLR4 signalling in monocytes also induces a caspase-8-dependent NLRP3 activation and IL-1β secretion, referred as alternative activation, as it is independent of potassium efflux and ASC speck formation (Gaidt et al., 2016). Caspase-8 also induces IL- 1β secretion in inflammasome-independent manners, following sensing of fungal PAMPs by the PRR dectin, signalling via TLR and via receptors from the TNF family (Blander, 2014). Therefore, caspase-8 activation adds another mechanism for the robust activation of IL-1β and pyroptosis. Further investigations should address how cell fate is decided between silent apoptosis, and pyroptosis and IL- 1 secretion.

1.7.5. Granzymes

Granzymes are proteases delivered from natural killer (NK) and cytotoxic T cells into the cytosol of target cells. Granzymes and other proteins are delivered into

30 target cells to induce cytotoxic cell death (Chowdhury and Lieberman, 2008). It has been reported that granzyme B cleaves and activates IL-1α (Afonina et al., 2011) and granzyme A cleaves IL-1β, producing a partially active IL-1β (Irmler et al., 1995). Afonina and colleagues showed by in vitro experiments that NK cells can induce IL-1α processing inside target cells (Afonina et al., 2011), suggesting that IL-1 could be activated following cytotoxic lymphocyte activation. How relevant is granzyme-dependent IL-1 activation during physiological conditions or diseases has to be addressed yet.

1.7.6. Extracellular activation of IL-1

While the previous mechanisms explain how IL-1 is activated inside cells, surface IL-1α or pro-IL-1 released from death cells can also be activated by extracellular proteases. Several proteases released from neutrophils have been described to activate IL-1. IL-1α is cleaved and activated by elastase, cathepsin G and proteinase-3 (Afonina et al., 2011; Clancy et al., 2018; Hazuda et al., 1991). IL-1β is also processed by neutrophil proteases, but studies show contradictory results on how this affects its activity. Low to high increase in IL-1β activity after elastase and cathepsin G cleavage has been reported (Black et al., 1988; Hazuda et al., 1990). Opposite to these results, Clancy and colleagues found that elastase, proteinase-3 and supernatants from degranulated neutrophils degraded IL-1β, while they activated IL-1α and other IL-1 cytokines (Clancy et al., 2018). Neutrophils are not the only immune cells that secrete IL-1-activating proteases. Chymase, secreted by mast cells, cleaves and activates IL-1α (Afonina et al., 2011) and IL-1β (Mizutani et al., 1991). Granzyme B, previously mentioned to induce intracellular IL-1α activation, can also be secreted from NK cells and cleave extracellular IL-1α (Afonina et al., 2011). While there is clearly a wide range of immune proteases that can activate IL-1, most of these studies have been performed with purified enzyme, thus the biological role of these activating mechanisms has yet to be assessed in physiological contexts.

Recently it was also found that thrombin directly cleaves and activates IL-1α, linking the coagulation system to the IL-1 pathway (Burzynski et al., 2019). Thrombin is able to cleave IL-1α from necrotic cell lysates and release IL-1α from the surface of macrophages and platelets. Generating transgenic mice in which IL-1α cannot be cleaved by thrombin, it was found that thrombin-dependent IL-1α

31 activation is necessary for appropriate wound healing and for thrombopoiesis after platelet depletion (Burzynski et al., 2019).

1.8. Mechanisms of IL-1 secretion

IL-1 cytokines lack a signal peptide for secretion through the ER/Golgi pathway. Instead, following activation by proteases, mature IL-1 is secreted through poorly understood unconventional secretory pathways (Daniels and Brough, 2017). As observed by the mechanisms of calpain, caspases, and granzyme activation, the secretion of IL-1 is tightly coupled to cell death, although new insights in the IL-1 field have shown that these cytokines are also secreted from live cells.

1.8.1. Passive IL-1α release from death cells

IL-1α sometimes is classified as an alarmin, a danger signal released from dying cells that initiates an inflammatory response (Figure 1.5a) (Chen et al., 2007; Eigenbrod et al., 2008; Kono et al., 2010). Although protein release from dying cells is a passive process caused by cell rupture, certain aspects can regulate IL- 1α signalling in this context. As previously mentioned, IL-1α can be retained in necrotic nuclei (Luheshi et al., 2009a), and cytosolic IL-1R2 can inhibit calpain- dependent activation (Zheng et al., 2013). Cells can also co-express an intracellular IL-1Ra isoform that is released upon cell death alongside IL-1α, blocking IL-1 signalling (Martin et al., 2020). Therefore, although IL-1α release from dying cells is a passive mechanism, the activation of IL-1 signalling following necrosis is still a process regulated by the phenotype of the necrotic cell.

1.8.2. GSDMD-dependent IL-1 secretion

Inflammasome activation leads to both IL-1 secretion and pyroptosis (Brough and Rothwell, 2007; Edgeworth et al., 2002; Fink and Cookson, 2006). As IL-1 lacks a route for conventional secretion through the ER/Golgi system, it was first thought that its release was a passive mechanism following membrane rupture (Cullen et al., 2015; Hogguist et al., 1990). However, it was found that IL-1β secretion precedes pyroptosis (Brough and Rothwell, 2007) and it can be uncoupled from cell lysis using the osmoprotectants glycine and polyethylene glycol (Evavold et al., 2018; Liao and Mogridge, 2009; Martín-Sánchez et al., 2016). Instead, using the membrane stabilizing agent punicalagin, IL-1β secretion was found to be

Figure 1.5 - Unconventional secretory pathways of IL-1. a, Following lytic cell death, IL-1α can be passively released as a mature form or be retained inside the nucleus. b, Following inflammasome activation, GSDMD pores induce an increase in membrane permeability and mature IL-1β and IL-18 localise in the plasma membrane. Secretion of IL-1β and IL-18 occurs through GSDMD pores and is inhibited by the membrane-stabilising agent punicalagin, while mature IL-1α may be secreted by an independent mechanism. c, Vesicle-mediated secretion of IL-1β occurs when is translocated inside autophagosomes, lysosomes and multi-vesicular bodies. IL-1α has a putative motif for vesicle-mediated secretion. d, Following ATP-stimulus, a rapid secretion of mature IL-1β occurs by microvesicle shedding, which could be promoted by plasma membrane localization of IL-1β. e, Pro-IL-1α can be translocated to the cell surface where is secreted after proteolytic cleavage.

33 dependent in an increase on membrane permeability that precedes cell lysis (Martín-Sánchez et al., 2016). The increase in membrane permeability and IL-1β secretion depend on GSDMD pores. These pores measure 10-14 nm in diameter (Aglietti et al., 2016; Liu et al., 2016; Sborgi et al., 2016). As mature IL-1β has a diameter of 4.5 nm (Oostrum et al., 1991), it has been proposed that IL-1β is secreted through the GSDMD pores (Figure 1.5b) (Heilig et al., 2018). Therefore, although pyroptosis is usually an inevitable consequence of inflammasome activation, GSDMD-dependent IL-1β secretion is an independent and early process.

Although few studies have focused on IL-1α secretion during inflammasome activation, it seems that it may be secreted by a distinct secretory pathway (Figure 1.5b). While mature IL-1α secretion can also be uncoupled from cell lysis following NLRP3 activation, its secretion is independent of the effects of punicalagin, which inhibits membrane permeability and the secretion of IL-1β and IL-18 (Gritsenko et al., 2020; Tapia et al., 2019) (see Chapter 2). Moreover, IL-1α lacks a polybasic motif found in mature L-1β and IL-18, which redirects the cytokines to the plasma membrane and promotes GSDMD-dependent secretion (Monteleone et al., 2018). This suggests that while IL-1β and IL-18 are redirected to the GSDMD pores, IL-1α is secreted by an alternative mechanism.

While in many cases inflammasome activation and GSDMD pore formation lead to cell lysis, there are several cell contexts where IL-1 secretion occurs following non-lytic inflammasome activation. The term hyperactive has been used to describe a GSDMD-dependent IL-1β secretion in viable macrophage and dendritic cells following alternative NLRP3 activation (Evavold et al., 2018; Wolf et al., 2016; Zanoni et al., 2016). Non lytic, GSDMD-dependent IL-1β secretion is also observed in neutrophils following NLRP3, NLRC4 and AIM2 inflammasome activation (Chen et al., 2014; Karmakar et al., 2016; Karmakar et al., 2020). Monocytes also secrete IL-1β after non-canonical inflammasome activation and alternative NLRP3 activation (caspase-8-dependent) without showing signs of cell lysis (Diamond et al., 2017; Gaidt et al., 2016; Viganò et al., 2015). While all these studies have focused on IL-1β secretion, IL-1α secretion also has been detected in viable macrophages and monocytes after NLRP3 activation (Diamond et al., 2017; Evavold et al., 2018; Viganò et al., 2015; Wolf et al., 2016).

Some mechanisms have been proposed to explain how inflammasome activation induces sub-lytic GSDMD pores. Cells could remain viable by repairing the plasma membrane, as the recruitment of the ESCRT-III protein complex can promote membrane repair following GSDMD-pore formation (Rühl et al., 2018). Reduced inflammasome activation has been proposed to explain why neutrophils survive canonical inflammasome activation but die by non-canonical, as they express low levels of caspase-1 in comparison to caspase-11 (Chen et al., 2018). It has also been suggested that in neutrophils GSDMD pores can localize in internal vesicles instead of the plasma membrane, decreasing plasma membrane permeability and pyroptosis (Karmakar et al., 2020).

While IL-1 secretion can be uncoupled from cell lysis, it is worth mentioning that pyroptosis has IL-1 independent pro-inflammatory roles. Intracellular molecules act as danger signals when released following pyroptosis, a well-documented example is the nuclear protein HMGB1, which is released from macrophages after inflammasome activation and promotes septic shock (Davis et al., 2019; Lamkanfi et al., 2010). The inflammasome itself can also be released after pyroptosis, remaining active and inducing further IL-1 processing in the extracellular medium or inside macrophages when phagocytosed (Baroja-Mazo et al., 2014; Franklin et al., 2014). Upon inflammasome activation, ASC oligomerize in a speck that measures up to 1µm in diameter (Man et al., 2014; Stein et al., 2016), and is therefore too big to be secreted by the GSDMD pores. ASC oligomers are retained when cell lysis is inhibited (Tapia et al., 2019) (see Chapter 2) and real time imaging has shown that ASC specks remain intracellular until cells rupture (Davis et al., 2019), demonstrating that the inflammasome speck is released following membrane rupture.

1.8.3. Alternative mechanisms of IL-1 secretion

In addition to sub-lytic GSDMD-dependent IL-1β secretion, alternative mechanisms have been proposed for IL-1 secretion from live cells. Several studies have proposed mechanisms involving IL-1β translocation to secretory vesicles (Figure 1.5c). Mature IL-1β has been found inside vesicles with possible secretory functions, such as pre- and mature autophagosomes (Dupont et al., 2011; Kimura et al., 2017; Zhang et al., 2015; Zhang et al., 2020), lysosomes (Andrei et al., 1999; Andrei et al., 2004) and multi-vesicular bodies (Qu et al.,

2007; Qu et al., 2009). Secretory autophagy has been the unconventional pathway most characterized for IL-1β secretion. It has been proposed that IL-1β interactions with the proteins trim-16 (Kimura et al., 2017; Munding et al., 2006), sec22b (Kimura et al., 2017), HSP90 (Zhang et al., 2015) and TMED10 (Zhang et al., 2020) promotes IL-1β localisation inside pre-autophagosome vesicles. Other components that regulate autophagy-dependent IL-1β secretion are the autophagy-related gene (ATG) proteins ATG5 (Dupont et al., 2011) and ATG7 (Karmakar et al., 2020), the Golgi reassembly stacking proteins GRASP55 and Rab8a (Dupont et al., 2011), and several SNAREs proteins (Kimura et al., 2017). Currently it is unclear if these proteins and vesicles form part of a unified secretory mechanism or are context specific. Moreover, although vesicle- mediated secretion has been studied in contexts of canonical inflammasome activation (Qu et al., 2007; Qu et al., 2009; Zhang et al., 2020), lysosomal damage (Kimura et al., 2017) and starvation-induced secretory autophagy (Kimura et al., 2017; Zhang et al., 2015), it is unknown how IL-1β is directed to a vesicle-dependent pathway instead of GSDMD-dependent secretion.

Another unconventional mechanism less studied is the secretion of IL-1β by microvesicle shedding (Figure 1.5d). A rapid release of IL-1β-loaded microvesicles has been observed in microglia (Bianco et al., 2005), dendritic cells (Pizzirani et al., 2007) and the monocytic cell line THP-1 (Wang et al., 2011) in response to the NLRP3-activator ATP. These microvesicles are able to induce IL- 1 signalling in other cells (Wang et al., 2011). It is unclear how relevant this mechanism of secretion is, as following ATP exposure a GSDMD-dependent secretion of IL-1β should occur. Microvesicle shedding mechanisms have not been well studied, but the enzyme acid sphingomyelinase has been proposed to mediate the shedding of IL-1β-loaded microvesicles (Bianco et al., 2009) and the localization of mature IL-1β to plasma membrane ruffles could promote this secretory pathway (Monteleone et al., 2018) .

In comparison to IL-1β, non-lytic mechanisms of IL-1α secretion have been poorly studied. Besides secretion during non-lytic inflammasome activation (Diamond et al., 2017; Viganò et al., 2015; Wolf et al., 2016), it has been reported that IL-1α is secreted from live cells to promote the secretory-associate senescence phenotype (SASP), an array of pro-inflammatory secreted cytokines that promote paracrine senescence (Acosta et al., 2013; Gardner et al., 2015;

Laberge et al., 2015). The mechanisms of IL-1α secretion from senescent cells are unknown. IL-1α secretion seems to be independent of membrane- permeability and cell lysis (Chan et al., 2020; Tapia et al., 2019; Wiggins et al., 2019) (see Chapter 2). While non-lytic IL-1α secretion can be achieved by thrombin cleavage of cell surface IL-1α in macrophages and platelets (Figure 1.5e) (Burzynski et al., 2019), senescent cells can secrete IL-1α without expressing it in the cell surface (Chan et al., 2020). Interestingly, bioinformatic analysis suggests that IL-1α contains a TMED-interaction motif found in mature IL-1β. This motif promotes IL-1β vesicle-mediated secretion (Zhang et al., 2020). Therefore is possible that IL-1α could be secreted via this unconventional pathway (Figure 1.5d).

1.9. Role of IL-1α in physiology and disease

IL-1 signalling is a main regulator of the inflammatory and immune response (Mantovani et al., 2019) and IL-1 inhibitory therapies target a broad spectrum of diseases (Dinarello et al., 2012; Gabay et al., 2010). It is not completely clear whether IL-1α and IL-1β have redundant or specialised functions during physiological conditions and diseases. Considering the previously mentioned differences in expression and mechanisms of activation of IL-1α and IL-1β, this last section will discuss contexts where IL-1α has a non-redundant role in sterile inflammation

1.9.1. IL-1α in acute inflammation

IL-1α seems to have a more relevant role than IL-1β in the initiation of the inflammatory response. As previously mentioned, IL-1α is constitutively expressed in many tissues and has some activity as its pro-form. Contrary to IL- 1β, IL-1α cleavage is mediated by mechanisms that do not need priming by previous inflammatory stimuli, such as calpain and thrombin activation. The release of active IL-1α from necrotic cells induces the expression of secondary pro-inflammatory signals in adjacent cells, promoting neutrophil recruitment (Chen et al., 2007; Eigenbrod et al., 2008). The role of IL-1α in starting a sterile inflammatory response is observed in several models. IL-1α-deficient mice have a reduced inflammatory response and deficient tissue remodelling in response to cutaneous UV radiation (Cohen et al., 2015). Similarly, mice that express IL-1α

37 lacking the thrombin cleavage site have a decreased inflammatory response and delayed wound healing in a model of skin injury (Burzynski et al., 2019). IL-1α, but not IL-1β, is released from necrotic cardiomyocytes, and IL-1α-deficient mice have a reduced inflammatory response after myocardial infarct (Lugrin et al., 2015).

Comparative studies using IL-1α or IL-1β deficient mice and specific neutralizing antibodies show that in certain contexts these cytokines have non-redundant roles, each one being active at different times of the inflammatory response. In a model of sterile inflammation using hypoxic cell lysates, IL-1α induces an initial neutrophil recruitment, while IL-1β is relevant at later inflammatory stages involving macrophage recruitment (Rider et al., 2011). Similar results were found in a model of experimental colitis induced by ingestion of dextran sodium sulfate. In this model IL-1α is released from intestinal epithelial cells, inducing an early and detrimental inflammatory response. On the contrary, IL-1β is relevant for the reconstitution of the epithelial barrier, suggesting that IL-1β is involved in the resolution phase of colitis (Bersudsky et al., 2014). IL-1α could also have a specific early role during acute CNS injury. While inflammasome activation and IL-1 signalling are known to promote a detrimental inflammatory response in ischaemic stroke (Boutin et al., 2001; Denes et al., 2015; Mulcahy et al., 2003), it has been shown that IL-1α is expressed earlier than IL-1β, and IL-1α acute administration is neuroprotective following ischaemic stroke (Luheshi et al., 2011; Salmeron et al., 2019).

1.9.2. IL-1α in chronic inflammation

Dysregulation of IL-1 signalling has been widely associated to chronic inflammatory diseases. Mutations causing hyperactivation of the NLRP3, NLRC4 and pyrin inflammasomes are recognised to induce a plethora of autoinflammatory diseases (De Torre-Minguela et al., 2017; Romberg et al., 2017). Mice models of cryopyrin-associated periodic syndromes (CAPS), a group of autoinflammatory diseases associated to NLRP3 mutations, have shown that IL-1β, IL-18 and pyroptosis are involved in the development of the disease (Agostini et al., 2004; Brydges et al., 2013; Brydges et al., 2009). A mouse model of familial Mediterranean fever (FMF), disease caused by pyrin mutations, reported a role of IL-1β, but not IL-1α, in the development of the inflammatory

38 disease (Sharma et al., 2017). Therefore, auto-inflammatory diseases caused by inflammasome hyperactivation involve IL-1β rather than IL-1α.

On the other hand, IL-1α is relevant on certain pathologies where IL-1-driven chronic inflammation is independent of inflammasomes. IL-1α promotes chronic inflammation in a mouse model of the auto-inflammatory disease neutrophilic dermatosis, caused by the expression of a hypomorphic mutant of the gene Ptpn6 (Gurung et al., 2017; Lukens et al., 2013). The chronic inflammation was independent of caspase-1, caspase-11 and IL-1β, demonstrating that IL-1α release was independent of inflammasome activation (Lukens et al., 2013). By bone marrow chimera experiments it was shown that IL-1α is released from non- hematopoietic cells and induces exacerbated IL-1 signalling, mediated by the ptpn6 mutation, in hematopoietic cells (Gurung et al., 2017). IL-1α has also been shown to be relevant in a mice model for psoriasis, induced by the skin irritant Aldara. The release of IL-1α from keratinocytes following Aldara-induced cell death was also independent of caspase-1 and caspase-11 (Martin et al., 2020). IL-1α has also been suggested to be involved in systemic sclerosis (SSc), another skin auto-immune disease. IL-1α is upregulated in fibroblasts isolated from SSc patients and promotes a fibrogenic phenotype in these cells (Kawaguchi et al., 2004; Kawaguchi et al., 2006).

IL-1α is also involved in the low and chronic inflammation associated to senescence. Cellular senescence is a mechanism in which cells permanently stop proliferating. While senescence is involved in tumour suppression, tissue development and wound healing in physiological conditions, chronic senescence during ageing promote tissue dysfunctions and tumorigenesis (Childs et al., 2014; Van Deursen, 2014). Senescence is regulated by the senescence-associated secretory phenotype (SASP). The SASP involves the secretion of IL-6, IL-8, TGF- β and other pro-inflammatory mediators from senescent cells that can promote paracrine senescence (Acosta et al., 2013; Kuilman et al., 2008). Early findings demonstrated that senescent cells express high levels of IL-1α (Garfinkel et al., 1994; Kumar et al., 1992; Mariotti et al., 2006). Currently it has been reported that there is a critical role for IL-1α during senescence, as IL-1α is required for the development of SASP (Gardner et al., 2015; Laberge et al., 2015; Orjalo et al., 2009) and in some cases can drive cellular senescence (Acosta et al., 2013; Maier et al., 1990). The role of IL-1α-dependent SASP in vivo has not been

39 addressed. It has been reported that the expression of caspase-11, which is required for the development of IL-1α-dependent SASP, in senescent cells is necessary for their clearance in a mouse model of liver senescence (Wiggins et al., 2019). Further studies should explore the role of IL-1α-dependent SASP in physiological contexts and disease.

1.9.3. IL-1 therapy

Inhibition of the IL-1 signalling pathway is a therapeutic target for a broad spectrum of diseases (Dinarello et al., 2012; Gabay et al., 2010). So far, three therapies targeting IL-1 have been approved. Anakinra, the endogenous IL-1R1 antagonist previously mentioned as IL-1Ra, is currently approved to treat rheumatoid arthritis (Cavalli and Dinarello, 2015). Rilonacept, an engineered soluble IL-1 decoy receptor, and Canakinumab, an IL-1β neutralizing antibody, are approved to treat CAPS (Feist and Burmeste, 2010; Gillespie et al., 2010). Clinical research with these three therapeutic agents is also targeting many other diseases, including autoinflammatory, cardiovascular, CNS and metabolic pathologies (Dinarello et al., 2012; Gabay et al., 2010). As protein-based therapies have disadvantages associated to poor biological activity, bioavailability and formulation cost, the development of small molecules to inhibit inflammasome activation is a major focus to treat IL-1 associated pathologies (Baldwin et al., 2016; Lopez-Castejon and Pelegrin, 2012).

These therapies inhibit both IL-1α and IL-1β signalling, or directly neutralise IL- 1β, and less research has been focused in specific anti-IL-1α therapies. As previously discussed, IL-1α may have a non-redundant role during acute inflammation and in certain contexts of chronic inflammation. Only one anti-IL-1α therapy is being study in clinical research. The IL-1α neutralising antibody MABp1 was developed as a possible therapeutic agent for cancer, but a phase III clinical trial to improve survival in patients with colorectal cancer had poor result outcomes (Phase III, NCT01767857). Nevertheless, MABp1 is now in phase II clinical trial for pancreatic cancer patients with cachexia (NCT03207724), and phase II trials have been completed for the dermatological diseases hidradenitis suppurativa (NCT03496974), acne vulgaris (NCT01474798) and psoriasis (NCT01384630), and the vascular pathology restenosis (El Sayed et al., 2016).

Overall, current pre-clinical and clinical research demonstrates how inhibition of IL-1 signalling pathway is therapeutically effective in several diseases. Approved therapies and development of new therapeutic agents are mostly focused in blocking IL-1 signalling, neutralizing IL-1β and inhibiting inflammasome activation. Further research in the redundant and specific roles of IL-1α and IL-1β should elucidate whether anti-IL-1α therapies could be effective in specific diseases.

1.10. Summary and aims

In summary, IL-1α and IL-1β are critical regulators of the inflammatory response. Although both cytokines induce IL-1 signalling, IL-1α and IL-1β differ in levels of expression, cellular localization, protein interactions, post-translational modifications and mechanisms of activation and secretion. The IL-1 field has widely focused in understanding the mechanisms of inflammasome activation and IL-1β secretion, but we currently have an incomplete understanding of how IL-1α processing and secretion is regulated.

The overall aim of this PhD was to investigate the distinct mechanism of IL-1α regulation. Specifically, this thesis aimed to:

1. Discern similarities and differences of the IL-1α secretory pathway with other cytokines from the IL-1 superfamily. 2. Understand the role of nuclear localization on IL-1α processing and secretion. 3. Investigate the role of intracellular protein interactions on IL-1α function.

Chapter 2. The three cytokines IL-1β, IL-18 and IL-1α share related but distinct routes

2.1. Paper title and authors

The three cytokines IL-1β, IL-18 and IL-1α share related but distinct routes

Victor S. Tapia1,2, Michael J. D. Daniels2,3, Pablo Palazon-Riquelme4,5, Matthew Dewhurst2,6, Nadia M. Luheshi2,7, Jack Rivers-Auty1,2, Jack Green1,2, Elena Redondo-Castro2, Phillips Kaldis6, Gloria Lopez-Castejon1,4,&, and David Brough1,2,&

1Lydia Becker Institute of Immunology and Inflammation, University of Manchester, Manchester M13 9PT, UK

2Division of Neuroscience and Experimental Psychology, School of Biological Sciences, Faculty of Biology, Medicine and Health, Manchester Academic Health Science Centre, University of Manchester, AV Hill Building, Oxford Road, Manchester M13 9PT, UK

3UK Dementia Research Institute, University of Edinburgh, College of Medicine and Veterinary Medicine, 49 Little France Crescent, Edinburgh EH16 4SB, Scotland, UK

4Division of Infection, Immunity, and Respiratory Medicine, School of Biological Sciences, Faculty of Biology, Medicine and Health, Manchester Collaborative Centre of Inflammation Research, Manchester Academic Health Science Centre, Core Technology Facility, University of Manchester, Manchester M13 9PT, UK

5International Centre for Infectiology Research, INSERM U1111, CNRS UMR5308, École Normale Supérieure de Lyon, Claude Bernard Lyon 1 University, 69100 Lyon, France

6Institute of Molecular and Cell Biology (IMCB), A*STAR (Agency for Science, Technology and Research), Department of Biochemistry, National University of Singapore (NUS), Singapore 119007, Singapore

7MedImmune Ltd., Aaron Klug Building, Granta Park, Cambridge CB21 6GH, United Kingdom

&Corresponding authors: [email protected] [email protected]

Adapted from published manuscript: J. Biol. Chem DOI: 10.1074/jbc.RA119.008009

Contribution The original idea of this study was conceived by DB and GLC. I designed and performed the experiments in figures 2.1, 2.2, 2.5 and 2.6, while ERC assisted with figures 2.1e,f and JG with figures 2c,d. PPR designed and performed the experiments in figure 2.3. NL designed and performed the experiments in figure 2.4a. MJD designed and performed the experiments in figure 2.4b-i. MD and PK previously developed the cell line and methods for figure 2.6. JRA, ERC, PK, GLC and DB supervised the project. DB, GLC and I wrote the manuscript.

Funding VT was supported by CONICYT (Becas Chile 721704488). MJD was supported by MRC DTP Studentship MR/K501211/1. PPR was supported by the Manchester Collaborative Centre for Inflammation Research, as a joint initiative of the University of Manchester, AstraZeneca, and GlaxoSmithKline. JRA was supported by BBSRC Grant BB/P01061X/1. This work was also supported by Medical Research Council Grant MR/N029992/1 (to DB) and a Sir Henry Dale Fellowship jointly funded by the Wellcome Trust and the Royal Society (Grant 104192/Z/14/Z (to GLC))

2.2. Abstract

Interleukin (IL)-1 family cytokines potently regulate inflammation, with the majority of the IL-1 family proteins being secreted from immune cells via unconventional pathways. In many cases, secretion of IL-1 cytokines appears to be closely coupled to cell death, yet the secretory mechanisms involved remain poorly understood. Here, we studied the secretion of the three best-characterized members of the IL-1 superfamily, IL-1α, IL-1β, and IL-18, in a range of conditions and cell types, including murine bone marrow–derived and peritoneal macrophages, human monocyte–derived macrophages, HeLa cells, and mouse embryonic fibroblasts. We discovered that IL-1β and IL-18 share a common secretory pathway that depends upon membrane permeability and can operate in the absence of complete cell lysis and cell death. We also found that the pathway regulating the trafficking of IL-1α is distinct from the pathway regulating IL-1_ and IL-18. Although the release of IL-1α could also be dissociated from cell death, it was independent of the effects of the membrane-stabilizing agent punicalagin, which inhibited both IL-1β and IL-18 release. These results reveal that in addition to their role as danger signals released from dead cells, IL-1 family cytokines can be secreted in the absence of cell death. We propose that models used in the study of IL-1 release should be considered context-dependently.

Keywords: Inflammasome, inflammation, interleukin 1 (IL-1), NLRP3, caspase-1 (CASP1), calpain, cytokine.

2.3. Introduction

Understanding mechanisms of unconventional protein secretion is a fundamental question of cell biology. Its importance is underscored by the biomedical relevance of many unconventionally secreted proteins. This is typified by the unconventionally secreted members of the interleukin (IL)-1 cytokine family that have established roles in host-defense responses and in inflammatory responses that contribute to disease (Dinarello et al., 2012). The ancestral IL-1 family consists of IL-1β, IL-1α, IL-1Ra, IL-36Ra, IL-36α, IL-36β, IL-36γ, IL-37, and IL-38, with IL-18 and IL-33 having a distinct ancestry, but based on structural homology, receptor binding and immunomodulatory function remain part of the IL-1 superfamily (Rivers-Auty et al., 2018). The best-characterized members of the IL- 1 family are IL-1α, IL-1β, and IL-18, and all are released via unconventional pathways.

IL-1α, IL-1β, and IL-18 are initially produced as precursor pro-forms. In cells of hematopoietic lineage, such as macrophages, expression of precursor forms of IL-1α and IL-1β occurs after stimulation of membrane pattern recognition receptors such as TLR4, which can be activated by bacterial endotoxin for example, whereas pro-IL-18 is constitutively expressed. Both precursor forms of IL-1β and IL-18 are cleaved directly by the protease caspase-1, which then also, indirectly, influences Ca2+- and calpain-dependent processing of pro-IL-1α (Groß et al., 2012). Activation of caspase-1 occurs after the assembly of macromolecular protein complexes called inflammasomes, upon which caspase- 1 is activated. Inflammasomes are formed by a cytosolic pattern recognition receptor, the best-studied of which is NLRP3, which nucleates oligomerization of an adaptor protein, ASC, into an inflammasome complex (Latz et al., 2013). A consequence of inflammasome activation is an inflammatory form of cell death called pyroptosis (Kovacs and Miao, 2017). Thus, a consequence of studying IL-1 release after inflammasome activation has been the concomitant death of the secreting cell, so it has long been considered that IL-1β release occurred through membrane rupture and lysis (Cullen et al., 2015; Lopez-Castejon and Brough, 2011). However, there are numerous examples, namely in human monocytes and neutrophils, where inflammasome activation can drive the release of IL-1β in the absence of cell death (Chen et al., 2014; Gaidt et al., 2016). We and others have reported that the mechanism of secretion of IL-1β may depend on an

47 alteration in membrane permeability (Martín-Sánchez et al., 2016; Shirasaki et al., 2014). Furthermore, the recent discovery that caspase-1 also cleaves gasdermin D, which subsequently forms pores in the plasma membrane that could allow passage of IL-1β (Kayagaki et al., 2015; Shi et al., 2015), and that a polybasic motif in the mature IL-1β domain could target it to phosphatidylinositol 4,5-bisphosphate–rich domains in the plasma membrane (Monteleone et al., 2018) have established that the mechanism of secretion is more complicated than simply membrane rupture. The mechanism through which IL-18 and IL-1α are secreted and the question of whether they are common with IL-1β remain underexplored. Here, we show that IL-1β, IL-18, and IL-1α can be secreted when cell lysis is prevented and that IL-1β and IL-18 share a common mechanism that relies on gasdermin D–dependent plasma membrane permeabilization.

2.4. Results

Secretion of IL-1β depends on membrane permability

Here we set out to test the initial hypothesis that release of IL-1β following NLRP3 inflammasome activation depended on a change in membrane permeability and not cell lysis. To interrogate this, we used the membrane- stabilizing reagent punicalagin. Punicalagin is a complex polyphenolic compound isolated from pomegranate extract that we previously reported to inhibit ATP- induced IL-1β release and uptake of the dye Yo-PRO-1 (as a measure of membrane permeability) with comparable potency and kinetics. Punicalagin also inhibits Yo-PRO-1 uptake and lactate dehydrogenase (LDH) release in response to membrane detergents digitonin and Triton X-100. Punicalagin also inhibits release of IL-1β independent of the inflammasome (Martín-Sánchez et al., 2016), strongly suggesting that under these conditions, it is acting at the plasma membrane. However, punicalagin is also reported to have additional effects, including potent anti-oxidant activity in macrophages (Xu et al., 2015), so some care must be taken when interpreting its effects. We also used the cytoprotectant glycine, which does not inhibit IL-1β release but limits cell lysis (Verhoef et al., 2005). We initially tested the effects of punicalagin (50 μM) and glycine (5 mM) directly on membrane permeability. LPS-primed (1 μg/ml, 2 h) immortalized mouse bone marrow–derived macrophages (iBMDMs) were incubated with CellTox Green dye, which would label cells after permeabilization, and were then

Figure 2.1 - IL-1β release after inflammasome activation depends on plasma membrane permeability. A-D, LPS-primed (1 μg/ml, 2 h) iBMDMs were incubated with vehicle, punicalagin (Pun; 50 μM), or glycine (Gly; 5 mM) 15 min prior to activation with nigericin (Nig; 10 μM). A, membrane permeability was measured in real time by CellTox Green uptake (n = 4). Supernatants were assayed for cell death (B), measured as LDH release and normalized to a total cell lysis control, and for IL-1β release by ELISA (n = 4) (C). D, 1 h after nigericin stimulation, combined supernatant and cell lysate were analyzed for pro-IL-1β (31 kDa), m-IL-1β (17 kDa), gasdermin D (GSDMD) full-length (FL; 53 kDa), GSDMD N- terminal fragment (NT; 31 kDa), and β-actin (42 kDa) by Western blotting. E,F, LPS-

49 primed (1 μg/ml, 3 h) mixed glia cultures were incubated with vehicle, punicalagin (50 μM), glycine (5mM), or MCC950 (10 μM) 15 min prior to activation with nigericin (10 μM, 1 h). Supernatants were assayed for cell death, measured as LDH release (E), and IL-1β release by ELISA (n=4) (F). *, p = 0.05; **, p = 0.01; ***, p = 0.001; ****, p = 0.0001; n.s., nonsignificant, determined by two-way ANOVA with Sidak’s post hoc analysis and compared with the nigericin-treated group (a-c) or one-way ANOVA with Dunnet’s post hoc analysis compared with the nigericin-treated group (e-f). Error bars indicate ± SEM. Western blots are representative of three independent experiments. Experiments designed and performed by VT, ERC assisted with replicas in e and f. incubated with vehicle, the NLRP3-activating stimulus nigericin (10 μM), or nigericin and either punicalagin or glycine, with the effects on dye uptake monitored by microscopy (for 100 min). In untreated cells, there was no dye uptake, whereas nigericin treatment caused a robust increase in fluorescence (Figure 2.1a). Glycine had no effect on nigericin-induced dye uptake, whereas punicalagin significantly delayed it, suggesting that these two reagents were having significantly different effects on the plasma membrane (Figure 2.1a). Sixty minutes of nigericin treatment of LPS-primed iBMDMs caused significant cell lysis, as measured by release of the cytoplasmic protein LDH (Figure 2.1b). Nigericin-induced LDH release at 60 min was completely inhibited by both punicalagin and glycine. At 90 min of nigericin treatment, there was more LDH released, and this was still significantly decreased by punicalagin and glycine (Figure 2.1b), suggesting that both reagents had a protective effect.

We next assessed the effects of punicalagin and glycine on nigericin-induced IL- 1β release. Sixty minutes of nigericin treatment caused significant release of IL- 1β that was partially inhibited by both punicalagin and glycine (Figure 2.1c). At 90 min of nigericin treatment, punicalagin still decreased IL-1β release to some degree, but the inhibitory effect of glycine observed at 60 min was absent (Figure 2.1c). These data suggest that whereas punicalagin was an effective inhibitor of IL-1β release, glycine slowed its release, likely by preventing release due to cell lysis. We then tested the effects of punicalagin and glycine on inflammasome- dependent processing of pro-IL-1β and gasdermin D by western blotting of combined cell lysates and supernatants after nigericin treatment. Neither punicalagin nor glycine blocked the caspase-1–dependent processing of pro-IL- 1β or gasdermin D, suggesting that they did not inhibit the inflammasome (Figure 2.1d). Incubation with the NLRP3 inflammasome inhibitor NBC6 (Baldwin et al.,

2017) or MCC950 (Coll et al., 2015) inhibited pro-IL-1β and gasdermin D processing as would be expected (Figure 2.1d).

The iBMDM cells are useful for measuring inflammasome responses in general. However, it is important to determine whether the same mechanisms occur in cells that may experience tissue-specific disease conditions. Recent research has demonstrated that microglia form inflammasomes during Alzheimer’s disease (Venegas et al., 2017), and inflammasomes are implicated in the progression of a number of other neurological and neurodegenerative conditions (Swanton et al., 2018). Thus, we investigated the relationship between IL-1β release and membrane permeability and cell death in cultures of glial cells (astrocytes and microglia) isolated from the brains of mice. These mixed glial cultures from the brains of neonates have microglial inflammasome responses very similar to those from primary microglia isolated from adult mice (Redondo-Castro et al., 2018). LPS-primed (1 μg/ml, 3 h) glial cells were treated with the NLRP3 inflammasome activator nigericin (10 μM, 1 h), which caused robust cell death, and this was significantly reduced by punicalagin and by glycine (Figure 2.1e). Nigericin also induced release of IL-1β from glial cells, which was inhibited by punicalagin (50 μM) but not by glycine (5 mM) (Figure 2.1f). These data confirm the data obtained using the iBMDM cultures, which suggested that the release of IL-1β depends on a change in membrane permeability rather than cell lysis. These data also suggest that mechanisms of inflammasome activation and IL-1β release under these conditions are common between macrophages and microglia.

Activation of the NLRP3 inflammasome often forms an ASC speck, which itself can be released and is known to have proinflammatory effects in the extracellular space (Baroja-Mazo et al., 2014; Franklin et al., 2014). Using iBMDMs stably expressing ASC-mCherry (Daniels et al., 2016), we observed that the number of visible ASC specks increased with nigericin treatment (10 μM) and that the number of visible specks increased further when the cells were treated with nigericin plus punicalagin (50 μM) or glycine (5 mM) (Figure 2.2a). We then repeated this experiment, except we included the pan-caspase inhibitor Z-VAD, which allowed ASC speck formation, but inhibited potential ASC speck loss through caspase-1–dependent pyroptotic cell death. Incubation of the cells with Z-VAD increased the number of specks produced by nigericin treatment but had no further effect on the increase of ASC specks observed in nigericin-treated

51 cells in the presence of punicalagin or glycine (Figure 2.2b). These data suggest that ASC specks are released by pyroptotic cell lysis and that both punicalagin and glycine inhibited this release. This further supports a regulated mechanism for IL-1β release dependent upon a change in membrane permeability, as its release was unaffected by glycine (Figure 2.1). We investigated the release of ASC further by analyzing the oligomeric forms released into the cell supernatant using cross-linking and Western blotting. LPS-treated iBMDMs did not release any ASC into the supernatant (Figure 2.2c). Nigericin treatment caused the release of a monomeric and a range of oligomeric ASC forms, which was reduced by punicalagin treatment (Figure 2.2c). Glycine treatment inhibited the release of high-molecular weight oligomeric ASC, but lowermolecular weight forms were released (Figure 2.2c). This suggested that monomeric ASC may follow the same pathway out of the cell as IL-1β. The inflammasome inhibitor NBC6 inhibited the release of all forms of ASC, confirming that its release was inflammasome-dependent (Figure 2.2c). These data suggest that oligomeric ASC and ASC specks are released by pyroptotic cell lysis but that changes in membrane permeability allow the release of monomeric ASC. Western blotting of combined cell lysates and supernatants after nigericin treatment confirmed this, showing that punicalagin and glycine did not inhibit ASC oligomerization in response to nigericin, whereas the inflammasome inhibitor NBC6 did (Figure 2.2d).

Figure 2.2 - ASC speck release depends on cell lysis. A,B, LPS-primed (1μg/ml, 2 h) ASC-mCherry iBMDMs were incubated with vehicle, punicalagin (Pun; 50 μM), or glycine (Gly; 5 mM) 15 min prior to activation with nigericin (Nig; 10 μM), and ASC speck formation was measured in real time without (A) or with (B) incubation of Z-VAD (50 μM) (n = 4). C,D, WT iBMDMs were treated as in A and B and activated with nigericin for 1 h. Supernatants (C) or combined supernatant and lysate (D) were cross-linked and analyzed with antibodies targeting ASC or β-actin by Western blotting. ASC monomers (22 kDa), dimers (44 kDa), and oligomers are indicated. *, p = 0.05; ***, p = 0.001, determined by two-way ANOVA with Sidak’s post hoc analysis and compared with the nigericin-treated group. Error bars indicate ± SEM. Western blots are representative of three independent experiments. Experiments designed and performed by VT, JG assisted with replicas in c and d.

IL-18 and IL-1β follow a similar secretory route

IL-18 is also produced as a precursor pro-form and is directly regulated by the inflammasome and caspase-1. However, the mechanisms underpinning release of IL-18 are poorly understood. In these studies, we used primary human monocyte–derived macrophage cultures (MDMs), which also allowed us to interrogate the release pathway in human cells. MDMs were primed with LPS (1 μg/ml, 4 h) and then stimulated with nigericin (10 μM, 45 min) to induce release of IL-1β and IL-18. Under these conditions, nigericin induced release of both IL- 1β and IL-18, and in both cases release was inhibited by a 15-min pre-incubation with punicalagin (25 μM) (Figure 2.3a,b). Under these conditions, punicalagin did not significantly reduce nigericin-induced LDH release (Figure 2.3c). Under the same conditions, incubation with glycine (5 mM) did not inhibit nigericin-induced IL-1β or IL-18 release from MDMs (Figure 2.3d,e) but did inhibit nigericin-induced LDH release (Figure 2.3f), suggesting that the release of IL-18 was also dependent upon a change in membrane permeability. These data also suggest that IL-1β release after NLRP3 inflammasome activation is common in mouse and human macrophages, highlighting that under these conditions the mouse BMDMs are representative of a range of macrophage IL-1 release models.

Figure 2.3 - IL-18 release during inflammasome activation depends on plasma membrane permeability. A–C, LPS-primed (1 μg/ml, 2 h) MDMs were incubated with vehicle or punicalagin (25μM) 15 min prior to activation with nigericin (10 μM, 45 min). Supernatants were assayed for IL-1β (A) and IL-18 (B) by ELISA (n = 8–9). C, cell death was measured as LDH release normalized to a total cell lysis control. D–F, LPS-primed (1 μg/ml, 2 h) MDMs were incubated with vehicle or glycine (5mM) 15 min prior to activation with nigericin (10 μM, 45 min). Supernatants were assayed for IL-1β (D) and IL-18 (E) by ELISA (n = 8–9). F, cell death was measured as LDH release. *, p = 0.05; **, p = 0.01; ***, p = 0.001; ****, p = 0.001; n.s., nonsignificant, determined by oneway ANOVA with Dunnet’s post hoc analysis and compared with the nigericin-treated group. Error bars indicate ± SEM. Experiments desgined and performed by PRR.

IL-1α is secreted via an alternative pathway

Release of IL-1α can also be regulated by inflammasomes, albeit indirectly (Groß et al., 2012). Release of IL-1α is thought to be dependent upon Ca2+-activated calpain proteases (Groß et al., 2012), although a number of other proteases are known to also cleave pro-IL-1α (Clancy et al., 2018). In primary mouse peritoneal macrophages primed with LPS (1 μg/ml, 2 h) and treated with NLRP3 inflammasome activator ATP (30 min) or MSU or CPPD crystals (250 μg/ml, 1 h), there was a release of both mature IL-1α and mature IL-1α into the culture supernatants (Figure 2.4a). Incubation of the cells with calpain inhibitor III (50 μM) or in Ca2+-free buffer with subsequent NLRP3 inflammasome activation by ATP or by MSU or CPPD crystals inhibited the release of mature IL-1α but not IL- 1β (Figure 2.4a), highlighting the divergence of the secretory signalling pathways. Whereas the pharmacological data produced by us and others has strongly suggested that a calpain protease is required for pro-IL-1α processing, genetic proof for this is lacking. To address this, we generated a reconstituted cellular model of IL-1α secretion. Macrophage cells are difficult to transfect, and they respond to DNA with inflammasome activation. Thus, we investigated whether we could model IL-1α release in easy-to-transfect HeLa cells. HeLa cells were transfected to express pro-IL-1α-GFP and were then treated with the Ca2+ ionophore ionomycin (10 μM, 1 h) to induce calpain activation and IL-1α processing and release (Figure 2.4b). In this model, release of mature IL-1α was also inhibited by calpain inhibitor III (40 μM) and by the removal of extracellular Ca2+, suggesting that the pathways of IL-1α processing and release in our reconstituted HeLa cell model are representative of the pathways of IL-1α release in primary macrophages (Figure 2.4b). There are 14 members of the calpain family in mammals, with calpains 1 and 2 the best characterized (Goll et al., 2003). We therefore knocked down expression of calpain 1, calpain 2, or both calpains 1 and 2 in HeLa cells using siRNAs that were transfected to express pro-IL-1α-GFP and then treated them with ionomycin to induce calpain activation and mature IL-1α release (Figure 2.4c). We were able to selectively knock down expression of calpain 1 and calpain 2 (Figure 2.4c). Knockdown of either calpain

Figure 2.4 - IL-1α processing and release depends on calpains 1 and 2. A, LPS-primed (1 μg/ml, 2 h) peritoneal macrophages were incubated with calpain inhibitor III (50 μM) or in calcium-containing (+Ca) or calcium-free (0Ca) buffers 15 min prior to activation with ATP (5mM, 1 h), MSU (250 μg/ml, 1 h), or CPPD (250 μg/ml, 1 h). Supernatants were analyzed for IL-1α (pro-form, 31 kDa; mature form, 17 kDa) and IL-1β (pro-form, 31 kDa; mature form, 17 kDa) by western blotting. B, HeLa cells were transfected with pro-IL-1α-GFP (24 h) and then incubated with calpain inhibitor III (40 μM) or in calcium-containing (+Ca) or calcium-free (0Ca) buffers 15 min prior to activation with ionomycin (10M, 1 h). Supernatants were analyzed by western blot using an antibody targeting IL-1α to detect pro-IL-1α-GFP (58 kDa) and IL-1α-GFP (44 kDa). C–I, HeLa cells were transfected with calpain 1, calpain 2, or scrambled siRNA (48 h), transfected with pro-IL-1α-GFP (24 h), and treated as in B. C, cell lysates were analyzed by western blot using antibodies targeting calpain 1 (CPN1; 75 kDa), calpain 2 (CPN2; 75 kDa), and β-actin (42 kDa), and supernatants were analized for IL-1α-GFP, by Western blotting. Supernatants were assayed for IL-1α release measured by ELISA (D - F) and cell death, measured as LDH release (n = 4) (G–I). *, p = 0.05; **, p = 0.01; ***, p = 0.001; ****, p = 0.0001; n.s., nonsignificant, determined by one-way ANOVA with Dunnet’s post hoc analysis compared with the ionomycin-treated group. Error bars indicate ± SEM. Western blots are representative of at least three independent experiments. Experiments designed and performed by NL (a) and MJD (b-i). inhibited release of mature IL-1α as determined by western blotting (Figure 2.4c), confirming the importance of calpain to this pathway and suggesting that both calpains 1 and 2 can process pro-IL-1α. This was further confirmed by ELISA of the HeLa cell supernatants after ionomycin treatment, which contained significantly less IL-1α after calpain knockdown (Figure 2.4d-f). Calpain knockdown also significantly reduced ionomycin-induced cell death (Figure 2.4g- i).

IL-1α may be released and processed as a consequence of cell death (Afonina et al., 2011; Zheng et al., 2013). Whereas IL-1β–secreting cells often undergo a pyroptotic or pyronecrotic cell death (Brough and Rothwell, 2007; Cullen et al., 2015), there are examples where IL-1β is secreted in the absence of cell death (Chen et al., 2014; Stoffels et al., 2015). Our data above suggest that IL-1β release depends upon membrane permeability, but not cell lysis per se. We therefore sought to determine whether Ca2+/calpain-dependent release of IL-1α requires cell lysis. We previously published that punicalagin does not inhibit IL-1α release, suggesting a separate pathway of secretion from IL-1β (Martín-Sánchez

58 et al., 2016). To directly compare the effects of punicalagin and glycine on the release of IL-1α to IL-1β and IL-18, we treated primary mouse BMDMs with LPS (1 μg/ml, 4 h) and then incubated them with punicalagin (50 μM) or glycine (5 mM) and then stimulated with ionomycin (10 μM, 1 h) to activate calpain or with nigericin (10 μM, 1 h) to activate the NLRP3 inflammasome. Both punicalagin and glycine inhibited ionomycin and nigericin-induced cell death (Figure 2.5a). However, neither punicalagin nor glycine inhibited release of IL-1α in response to ionomycin or nigericin (Figure 2.5b,c). Ionomycin did not cause release of IL-1β (Figure 2.5d) or cleavage of gasdermin D (Figure 2.5e), and nigericin-induced cleavage of gasdermin D was not prevented by calpain inhibition but was prevented by NLRP3 inflammasome inhibition with NBC6 (Figure 2.5e). Together, these data suggest that, whereas in many cell types, close associations between the release of related cytokines IL-1α and IL-1β and cell death are observed, these processes can be dissociated from each other. Release of IL-1β appears to rely on a change in membrane permeability dependent upon gasdermin D cleavage (Evavold et al., 2018; Martín-Sánchez et al., 2016). Calpain-dependent IL-1α release appears to be independent of cell lysis but relies on alternative, but seemingly parallel, pathways to IL-1β.

The above data suggested that IL-1α could be secreted from cells independently of plasma membrane rupture. We next examined the release of IL-1α in an alternative cell model. Cellular senescence is a barrier to tumorigenesis in response to oncogenic stresses by forcing cells to permanently exit from the cell cycle (Childs et al., 2014). Although beneficial early in an organism’s life, at older ages, cellular senescence can promote tissue disruption and can paradoxically be pro-tumorigenic by virtue of the senescence-associated secretory phenotype (SASP) (Childs et al., 2014). The SASP is the secretion of pro-inflammatory cytokines from senescent cells that can promote paracrine senescence (Acosta et al., 2013). A defining feature of cellular senescence is the expression of IL-1α, which is critical for the development of the SASP and in some cases can drive senescence (Acosta et al., 2013), whereas in other cases, blockade of IL-1α reduces the SASP, but the cell still senesces (Gardner et al., 2015; Laberge et al., 2015). It is not currently understood whether IL-1α secretion, required for SASP development, results in death of the secreting cell. To address this, we used immortalized mouse embryonic fibroblast (MEF) cells (Diril et al., 2012), as

Figure 2.5 - IL-1α release can occur independently of cell lysis. A–D, LPS-primed (1 μg/ml, 4 h) primary mouse BMDMs were incubated with vehicle, punicalagin (Pun; 50 μM), or glycine (Gly; 5 mM) 15 min prior to activation with ionomycin (10 μM, 1 h) or nigericin (10 μM, 1 h). A, cell death was measured as LDH release (n = 5). IL-1α release was assayed by ELISA (n = 5) (B) or analyzed for pro-IL-1α (31 kDa) and m-IL-1α (17 kDa) by western blotting (C). D, IL-1β release was assayed by ELISA (n = 5). E, BMDMs were treated as previously but incubated with calpain inhibitor III (40 μM) or NBC6 (20 μM) prior to ionomycin or nigericin treatment. Combined supernatants and lysates were analyzed for GSDMD full-length (FL; 53 kDa), GSDMD N-terminal fragment (NT; 31 kDa), and β-actin (42 kDa) by Western blotting. *, p = 0.01; **, p = 0.001; ***, p =

0.0001; ****, p = 0.0001; n.s., nonsignificant, determined by one-way ANOVA with Dunnet’s post hoc analysis compared with the ionomycin- or nigericin-treated groups. Error bars indicate ± SEM. Western blots are representative of two independent experiments. Experiments designed and performed by VT, cellular senescence is often studied with fibroblasts. To recapitulate a SASP-like phenotype, MEF cells were transfected to express pro-IL-1α-GFP. IL-1α was released from transfected MEF cells when assayed 48 h after transfection (Figure 2.6a). IL-6 and CXCL1 levels were also significantly increased after 48 h in pro- IL-1α-GFP–transfected groups but not in GFP-transfected or nontransfected groups (Figure 2.6b,c). In addition, 48 h after treatment with the IL-1 receptor antagonist IL-1Ra (1 μg/ml added every 24 h for the duration of the experiment), CXCL1and IL-6 secretion were significantly reduced, whereas levels of IL-1α were not affected (Figure 2.6a-c). These data suggest that IL-1α is secreted over time to induce the release of IL-6 and CXCL1. Importantly, there was no significant cell death over the duration of this experiment, and glycine (5 mM) added for the last 24 h of incubation had no effect on IL-1α release (Figure 2.6d,e). These data confirm the finding above that IL-1α can be released in the absence of cell lysis and through a separate pathway to IL-1β and IL-18 in a variety of cell types. The release of IL-1α by these MEF cells was independent of gasdermin D cleavage, as it was not expressed (Figure 2.6f), again highlighting the difference between IL-1α secretion and the GSDMD-dependent secretory pathway.

2.5. Discussion

Members of the IL-1 family have been described as canonical DAMPs, and indeed there is evidence to support this (Martin, 2016). For an IL-1 family member to act like a canonical DAMP, it would be released as a result of cellular death or injury. However, there is also evidence to suggest that some IL-1 family members can be released in the absence of cell death and may therefore also act as actively secreted cytokines (Rubartelli et al., 1990; Semino et al., 2018). For example, there is evidence that caspase-1–dependent processing and secretion of IL-1β from macrophages and neutrophils can occur in the absence of cell lysis (Chen et al., 2014; Stoffels et al., 2015), although from these studies, the measurements are from cell populations rather than single cells, which may mask any correlations with cell death and IL-1β release at the single-cell

Figure 2.6 - IL-1α is released from viable MEFs. A–C, MEF cells were transfected with pro-IL-1α-GFP or with GFP alone (48 h) and treated with IL-1Ra (10 μg/ml, 48 h). Supernatants were assayed for IL-1α (A), IL-6 (B), and CXCL1 (C) release by ELISA (n = 6). D and E, MEF cells transfected as previously were treated with glycine (5mM, 24 h). Supernatants were assayed for cell death, measured as LDH release (D), and IL-1α release measured by ELISA (n = 4) (E). F, cell lysates from MEFs, transfected as previously, and LPS-primed iBMDMs, incubated with NBC6 (20 μM) and stimulated with nigericin (10 μM, 1 h), were analyzed for GSDMD full- length (FL; 53 kDa), GSDMD N-terminal fragment (NT; 31 kDa), and β-actin (42 kDa) by Western blotting. ***, p = 0.0001; ****, p = 0.0001; n.s., nonsignificant, determined by one-way ANOVA with Sidak’s post hoc analysis with multiple comparisons (A and B), or one-way ANOVA with Dunnet’s post hoc analysis compared with the pro-IL-1α-GFP– transfected group (D and E). n.d., not detected. Western blots are representative of two independent experiments. Error bars indicate ± SEM. Experiments designed and performed by VT, with the exception of a-c design by MD.

62 level (Martín-Sánchez et al., 2016). An often reported consequence of inflammasome activation in macrophages is cell death, and although release of IL-1β can be temporally separated from release of a lytic marker such as LDH, it seems that a complete loss of cell integrity is inevitable in many cases (Brough and Rothwell, 2007). However, cytoprotectants such as glycine can be used to prevent cell lysis after inflammasome activation in macrophages but still allow the release of mature IL-1β (Pelegrin et al., 2008; Verhoef et al., 2005).

The release of IL-1β from macrophages can also be blocked by the membrane- stabilizing agent punicalagin (Martín-Sánchez et al., 2016). Here, we showed that glycine, while blocking cell lysis and ASC speck/oligomer release, did not inhibit NLRP3-dependent release of IL-1β and that punicalagin was at least partially effective against both cell lysis and IL-1β release. Pyroptosis leads to release of active IL-1β and concomitant release of ASC specks capable of being taken up by other cells and propagating an inflammatory response (Baroja-Mazo et al., 2014; Franklin et al., 2014). This process of ASC speck release was recently implicated in models of Alzheimer’s disease where ASC specks were shown to seed β-amyloid plaques (Venegas et al., 2017). Here, we report conditions allowing release of IL-1β and monomeric ASC from cells with active inflammasomes, but where release of ASC oligomers and specks is blocked. By dissociating IL-1β secretion from ASC speck release, we have provided conditions that allow for novel insights to be made into the individual roles played by these inflammatory factors in future studies.

The IL-1β release inhibitor punicalagin influenced the permeability of the plasma membrane to the dye CellTox Green, suggesting that it is a specific change in membrane permeability rather than cell lysis per se that is allowing release of IL- 1β. This was also the case for NLRP3-dependent IL-1β release in human macrophages and for the related cytokine IL-18, suggesting that they may share a common exit route from the cell. Identifying that, under the stated conditions, the pathway of IL-1β release is common between mouse and human macrophages and different subtypes of macrophage allows us to further reliably interpret and compare studies in different cell types and from different species. Although the secretions of IL-1α and IL-1β from macrophages in response to NLRP3 inflammasome–activating stimuli were previously suggested to follow a common secretory route based on kinetics and inhibitor sensitivity (Perregaux

63 and Gabel, 1998), our data suggest that in fact the secretory mechanisms are distinct. IL-1α and IL-1β are closely related molecules, with IL-1α arising as a result of a gene duplication event of IL-1β (Rivers-Auty et al., 2018). Significant divergence between IL-1α and IL-1β has occurred since the duplication event at the amino acid level, particularly within the pro-domain, although there is very little evidence of divergence in mechanisms of secretion. Here, we provide evidence in macrophages that the secretion of IL-1α is differently regulated of the secretion of IL-1β and IL-18. We have also modelled the IL-1α release pathway in easy-to-transfect cell lines (HeLa and MEF), allowing us to further conclude that IL-1α may be actively secreted from cells, which may be important for development of the SASP and thus cellular senescence. This discovery opens further avenues of research where we can now address the other contexts in which IL-1α is actively secreted from living cells. Our studies in the MEF cells suggest that IL-1α secretion is independent of gasdermin D. It should be noted, however, that IL-1α release from BMDMs infected with a mutant strain of Staphylococcus aureus was less from gasdermin D KO cells compared with WT (Evavold et al., 2018). Also, whereas it is now becoming well-accepted that release of IL-1β is gasdermin D–dependent, a delayed gasdermin D– independent mechanism of IL-1β release has also been described (Monteleone et al., 2018).

Overall, these data have broad implications and suggest that IL-1 family members behave both as DAMPs and as actively secreted cytokines. Our use of a senescence-like model to study IL-1α secretion highlights the value of using context-specific models when studying IL-1 release pathways. Cellular senescence, a process in which there is no overt cell death, now provides a context for the nonlytic release of IL-1α. Likewise, DAMP-dependent release of IL-1 from macrophages may not present us with a unifying pathway to describe IL-1β secretion in all circumstances, and we are learning that activations of canonical and alternative inflammasomes have very different effects on ASC speck formation and cell death (Gaidt et al., 2016; Green et al., 2018).

2.6. Experimental procedures

Antibodies and reagents

Antibodies used targeted mouse IL-1β (AF-401-NA, R&D Systems), mouse gasdermin D (ab209845, Abcam), ASC (AL177, Adipogen), mouse IL-1α (AF- 400-NA, R&D Systems), human calpain 1 (ab39170, Abcam), human calpain 2 (ab39165,Abcam), and β-actin-HRP (A3854, Sigma). Pharmacological agents used were punicalagin (Sigma), glycine (Sigma), NBC6 (synthesized in house (Baldwin et al., 2017)), MCC950 (CP-456773, Sigma), Z-VAD-fluoromethyl ketone (Merck), calpain inhibitor III (Merck), nigericin (Sigma), adenosine triphosphate (Sigma),ionomycin (Sigma), monosodium urate crystals (InVivoGen), calcium pyrophosphate dihydrate crystals (InVivoGen), and IL-Ra (Kineret®, Amgen). All other materials were from Sigma-Aldrich unless specified.

Cell culture

Mouse iBMDMs, obtained from Clare Bryant (Department of Veterinary Medicine, University of Cambridge), and ASCmCherry iBMDMs (23) were cultured in Dulbecco’s modified Eagle’s medium (DMEM), 10% fetal bovine serum (FBS; Life Technologies), 100 units/ml penicillin, and 100 μg/ml penicillin-streptomycin (PenStrep). The iBMDMs were seeded overnight at a density of 0.75 x 106 cells/ml. Murine mixed glia cultures were prepared from brains isolated from 3–4- day-old C57BL/6 mouse pups (Envigo). All animal procedures were performed with appropriate personal and project licenses in place, in accordance with the Home Office (Animals) Scientific Procedures Act (1986) and approved by the Home Office and the local Animal Ethical Review Group, University of Manchester. As described previously (Redondo-Castro et al., 2018), brain tissue was mechanically digested, and cells were maintained in DMEM, 10% FBS, PenStrep until 80% confluence was reached (10 –13 days in vitro). Cultures were then reseeded at a density of 1.7 x 105 cells/ml. After a further 2–3 days, cells were ready for experimentation.

Murine peritoneal macrophages were isolated from C57BL/6 mice. Mice were anesthetized with isoflurane (induced at 3–4% in 33% O2, 67% NO2, maintained at 1–2%), and peritoneal cavities were lavaged with 6 ml of RPMI. Peritoneal

65 macrophages were cultured in DMEM, 10% FBS, PenStrep and seeded overnight at a density of 1 x 106 cells/ml before the experiment the following day.

Murine primary BMDMs were prepared by flushing femurs of C57BL/6 mice. Red blood cells were lysed with ACK lysis buffer (Lonza), and BMDMs were generated by culturing the resulting marrow cells in 70% DMEM (containing 10% FBS, PenStrep) and 30% L929 mouse fibroblast–conditioned medium for 7–10 days. Primary BMDMs were seeded overnight at a density of 1 x 106 cells/ml before the experiment.

The MEF cell line was derived from primary MEFs and immortalized with retroviral introduction of shRNA against p53 (pSuperRetro-sh53) (Diril et al., 2012). Cells were cultured in DMEM, 10% FBS, PenStrep. Before experiments, MEFs were seeded overnight at a density of 5 x 104 cells/ml.

Human MDMs were generated as described previously (Baldwin et al., 2017). Briefly, peripheral blood mononuclear cells (PBMCs) were obtained from leukocyte cones from healthy donors (Service Blood and Transplant, Manchester, UK) with full ethical approval from the Research Governance, Ethics, and Integrity Committee at the University of Manchester (reference no.2018-2696- 5711). After a density centrifugation step using a Ficoll gradient, the PBMC layer was carefully removed, and monocytes were obtained from the PBMCs by positive selection with CD14 magnetic MicroBeads and an LS column (Miltenyi) for 15 min. Monocytes were differentiated into macrophages for 6 days (5x105 cells/ml) in RPMI (containing 10% FBS, PenStrep) and in the presence of 0.5 ng/ml M-CSF (Peprotech). At day 3, half of the medium was removed and replaced with fresh medium to foster proliferation.

Human HeLa cells were cultured in DMEM, 10% FBS, Pen-Strep. HeLa cells were cultured overnight after seeding at a density of 5 x 104 cells/ml.

NLRP3 and calpain activation protocols

Cells were seeded in 96- or 48-well plates and primed with LPS (1 μg/ml) for 2 h (iBMDMs, peritoneal macrophages), 3 h (mixed glia), or 4 h (primary BMDMs, MDMs). After priming, the medium was changed to FBS-free DMEM, calcium- free buffer, or calcium-containing buffer (England et al., 2014). Calcium-free

66 buffer was composed of 121 mM NaCl, 5.4 mM KCl, 0.8 mM MgCl2, 6 mM NaHCO3, 25 mM HEPES, 5 mM glucose, and 5 mM EGTA. Calcium-containing buffer was composed of 121 mM NaCl, 5.4 mM KCl, 0.8 mM MgCl2, 1.8 mM CaCl2, 6 mM NaHCO3, 25 mM HEPES, and 5 mM glucose. Cells were then treated with punicalagin (25 or 50 μM), glycine (5 mM), NBC6 (20 μM), MCC950 (10 μM), or calpain inhibitor III (40 and 50 μM) for 15 min. Cells were then stimulated by adding the NLRP3-activating stimuli ATP (5 mM), nigericin (10 μM), MSU (250 μg/ml), CPPD (250 μg/ml), or the Ca2+ ionophore ionomycin (10 μM).

Live-cell imaging

Real-time membrane permeabilization assays were performed using iBMDMs seeded in 96-well plates. Cells were primed with LPS (1 μg/ml, 2 h). After priming, cells were incubated with CellTox Green (Promega); treated with punicalagin (50 μM), glycine (5 mM), and Z-VAD (50 μM); and stimulated with nigericin (10 μM, 100 min). Real-time ASC speck assays were performed in the same conditions, using ASC-mCherry iBMDMs. Images were captured every 10 or 15 min using an IncuCyte ZOOM System (Essen Bioscience) with a x20/0.61 S Plan Fluor objective. Excitation and emission wavelengths were 440–480 and 504–544 nm for permeability assays and 565–605 and 625–705 nm for speck assays.

Cell death analysis

Cell death was measured by assessing LDH release into cell culture supernatants, using the CytoTox 96 Non-Radioactive Cytotoxicity Assay (Promega) according to the manufacturer’s instructions. Samples were quantified by reading absorbance at 490 nm in a Synergy HT microplate reader (Biotek Instruments). LDH release was expressed as a percentage normalized to a total cell lysis control, subtracting the background signal from cell culture medium.

Cytokine release analysis

IL-1α, IL-1β, CXCL1, and IL-6 measurements were made in cell supernatants by using Duoset ELISA kits (R&D Systems) following the manufacturer’s instructions. Human IL-18 was measured using the eBioscience kit (IL-18,

BMS267/2MST). Samples were quantified using corrected values of 450 and 570 nm, reading absorbance in a Synergy HT microplate reader (Biotek Instruments).

Western blot analysis

Western blot analysis was performed on supernatants and lysates for IL-1β, gasdermin D, ASC, IL-18, IL-1α, calpain 1, calpain 2, and β-actin. Samples were run on 10% (calpain 1 and calpain 2), 12% (ASC and pro-IL-1α-GFP), or 15% (IL- 1α, IL-1β, IL-18, and gasdermin D) SDS-polyacrylamide gels. Gels were transferred using a Trans-Blot® Turbo™ Transfer System (Bio-Rad) at 25 V for 7 min before blocking with 2.5% bovine serum albumin (BSA) in PBS, 0.1% Tween 20 (PBST) for 1 h at room temperature. Membranes were washed and incubated (4 °C) overnight in primary antibody in PBST, 0.1% BSA. Following this, membranes were washed and incubated with horseradish peroxidase-conjugated secondary antibodies (Dako) in PBST, 0.1% BSA for 1 h at room temperature. Finally, membranes were washed and incubated in Amersham Biosciences ECL Western Blotting Detection Reagent (GE Life Sciences) before exposure using a G:BOX gel doc system (Syngene).

ASC oligomerization assays iBMDMs were seeded into 24-well plates. Cells were primed with LPS (1μg/ml, 2 h) and then incubated with punicalagin (50 μM), glycine (5 mM), or NBC6 (20 μM) for 15 min and stimulated with nigericin (10 μM, 60 min). For total oligomerization, cells were directly lysed in the well by the addition of 1% Triton X-100. Cell lysates were separated into a Triton X-100–soluble fraction and insoluble fraction by centrifugation at 6800 x g for 20 min at 4 °C. The insoluble pellets were cross-linked with disuccinimidyl suberate (2mM; Thermo Fisher Scientific) for 30 min. Cross-linked pellets were further spun down at 6800 x g for 20 min and eluted in Laemmli buffer for SDS-PAGE. For detection of released ASC oligomers, supernatants were collected and detached cells were removed, and the supernatants were then concentrated by centrifugal filtering (Amicon 10K centrifugal filters) according to the manufacturer’s instructions. The concentrated supernatants were chemically crosslinked with disuccinimidyl suberate for 30 min at room temperature before Laemmli buffer was added in preparation for Western blotting.

IL-1α release from Hela cells

HeLa cells were seeded into 24-well plates. Cells were transfected with plasmids expressing pro-IL-1α-GFP or GFP-only control (0.5 μg/well, 24 h) using Lipofectamine 3000 according to the manufacturer’s instructions. For RNAi studies, HeLa cells were transfected with siRNA for calpain 1, calpain 2, or scrambled control (Santa Cruz Biotechnology, Inc.; 40 nM, 72h) using Lipofectamine 3000. On the day of the ionomycin stimulus, medium was changed to DMEM, calcium-free buffer, or calcium-containing buffer, and cells were incubated with or without calpain inhibitor III (40 μM, 15 min) before stimulation with ionomycin (10 μM, 1 h).

SASP-lile IL-1α release model

MEF cells were seeded into 24-well plates. Cells were transfected with plasmids for pro-IL-1_-GFP or GFP expression (0.5 μg of DNA/well, 48 h) using Lipofectamine 3000. Transfected groups were treated with and without IL-1Ra (1μg/ml, added at 0 and 24 h) and with or without glycine (5 mM, 24 h).

Statistics

Data are presented as scatter plots with the mean ± standard error of the mean (SEM). Statistical analysis was performed using GraphPad Prism version 7 software. Accepted levels of significance were as follows: *, p < 0.05; **, p < 0.01; ***, p < 0.001; ****, p < 0.0001. Data with comparisons against a vehicle control were analyzed using one-way ANOVA followed by Dunnet’s post hoc analysis, or with multiple comparisons with Sidak’s post hoc analysis. Time courses were compared against a vehicle control by two-way ANOVA with Sidak’s post hoc analysis. In one-way ANOVA, equal variance was evaluated with the Brown– Forsythe test, and transformations were performed where necessary. Experimental replicates (n) were defined as experiments performed on different passages of immortal cell lines (iBMDMs, HeLa, or MEF cells) or individual animal/human donors (primary BDMDs or MDMs, respectively).

2.7. References

Acosta, J. C., Banito, A., Wuestefeld, T., Georgilis, A., Janich, P., Morton, J. P., Athineos, D., Kang, T. W., Lasitschka, F., Andrulis, M., Pascual, G., Morris, K. J., Khan, S., Jin, H., Dharmalingam, G., Snijders, A. P., Carroll, T., Capper, D., Pritchard, C., Inman, G. J., Longerich, T., Sansom, O. J., Benitah, S. A., Zender, L. & Gil, J. (2013). 'A complex secretory program orchestrated by the inflammasome controls paracrine senescence', Nature Cell Biology, 15(8), pp. 978-990. Afonina, I. S., Tynan, G. A., Logue, S. E., Cullen, S. P., Bots, M., Lüthi, A. U., Reeves, E. P., McElvaney, N. G., Medema, J. P., Lavelle, E. C. & Martin, S. J. (2011). 'Granzyme B-dependent proteolysis acts as a switch to enhance the proinflammatory activity of IL-1α', Molecular Cell, 44(2), pp. 265-278. Baldwin, A. G., Rivers-Auty, J., Daniels, M. J. D., White, C. S., Schwalbe, C. H., Schilling, T., Hammadi, H., Jaiyong, P., Spencer, N. G., England, H., Luheshi, N. M., Kadirvel, M., Lawrence, C. B., Rothwell, N. J., Harte, M. K., Bryce, R. A., Allan, S. M., Eder, C., Freeman, S. & Brough, D. (2017). 'Boron-Based Inhibitors of the NLRP3 Inflammasome', Cell Chemical Biology, 24(11), pp. 1321-1335.e5. Baroja-Mazo, A., Martín-Sánchez, F., Gomez, A. I., Martínez, C. M., Amores- Iniesta, J., Compan, V., Barberà-Cremades, M., Yagüe, J., Ruiz-Ortiz, E., Antón, J., Buján, S., Couillin, I., Brough, D., Arostegui, J. I. & Pelegrín, P. (2014). 'The NLRP3 inflammasome is released as a particulate danger signal that amplifies the inflammatory response', Nature Immunology, 15 VN - r(8), pp. 738-748. Brough, D. & Rothwell, N. J. (2007). 'Caspase-1-dependent processing of prointerleukin-1beta is cytosolic and precedes cell death', J Cell Sci, 120(Pt 5), pp. 772-81. Chen, K. W., Groß, C. J., Sotomayor, F., Stacey, K. J., Tschopp, J., Sweet, M. J. & Schroder, K. (2014). 'The neutrophil NLRC4 inflammasome selectively promotes IL-1β maturation without pyroptosis during acute Salmonella challenge', Cell Reports, 8(2), pp. 570-582. Childs, B. G., Baker, D. J., Kirkland, J. L., Campisi, J. & van Deursen, J. M. (2014). 'Senescence and apoptosis: dueling or complementary cell fates?', EMBO reports, 15(11), pp. 1139-1153. Clancy, D. M., Sullivan, G. P., Moran, H. B. T., Henry, C. M., Reeves, E. P., McElvaney, N. G., Lavelle, E. C. & Martin, S. J. (2018). 'Extracellular neutrophil proteases are efficient regulators of IL-1, IL-33, and IL-36 cytokine activity but poor effectors of microbial killing', Cell Rep, 22(11), pp. 2937-2950. Coll, R. C., Robertson, A. A. B., Chae, J. J., Higgins, S. C., Munoz-Planillo, R., Inserra, M. C., Vetter, I., Dungan, L. S., Monks, B. G., Stutz, A., Croker, D. E., Butler, M. S., Haneklaus, M., Sutton, C. E., Nunez, G., Latz, E., Kastner, D. L., Mills, K. H. G., Masters, S. L., Schroder, K., Cooper, M. A. & O'Neill, L. A. J. (2015). 'A small-molecule inhibitor of the NLRP3 inflammasome for the treatment of inflammatory diseases', Nat Med, 21(3), pp. 248-255. Cullen, S. P., Kearney, C. J., Clancy, D. M. & Martin, S. J. (2015). 'Diverse activators of the NLRP3 inflammasome promote IL-1β secretion by triggering necrosis', Cell Reports, 11(10), pp. 1535-1548. Daniels, M. J. D., Rivers-Auty, J., Schilling, T., Spencer, N. G., Watremez, W., Fasolino, V., Booth, S. J., White, C. S., Baldwin, A. G., Freeman, S., Wong, R.,

Latta, C., Yu, S., Jackson, J., Fischer, N., Koziel, V., Pillot, T., Bagnall, J., Allan, S. M., Paszek, P., Galea, J., Harte, M. K., Eder, C., Lawrence, C. B. & Brough, D. (2016). 'Fenamate NSAIDs inhibit the NLRP3 inflammasome and protect against Alzheimer's disease in rodent models', Nature Communications, 7, pp. 1-10. Dinarello, C. A., Simon, A. & van der Meer, J. W. (2012). 'Treating inflammation by blocking interleukin-1 in a broad spectrum of diseases', Nat Rev Drug Discov, 11(8), pp. 633-52. Diril, M. K., Ratnacaram, C. K., Padmakumar, V. C., Du, T., Wasser, M., Coppola, V., Tessarollo, L. & Kaldis, P. (2012). 'Cyclin-dependent kinase 1 (Cdk1) is essential for cell division and suppression of DNA re-replication but not for liver regeneration', PNAS, 109. England, H., Summersgill, H. R., Edye, M. E., Rothwell, N. J. & Brough, D. (2014). 'Release of interleukin-1α or interleukin-1β depends on mechanism of cell death', Journal of Biological Chemistry, 289(23), pp. 15942-15950. Evavold, C. L., Ruan, J., Tan, Y., Xia, S., Wu, H. & Kagan, J. C. (2018). 'The pore-forming protein gasdermin D regulates interleukin-1 secretion from living macrophages', Immunity, 48(1), pp. 35-44 e6. Franklin, B. S., Bossaller, L., De Nardo, D., Ratter, J. M., Stutz, A., Engels, G., Brenker, C., Nordhoff, M., Mirandola, S. R., Al-Amoudi, A., Mangan, M. S., Zimmer, S., Monks, B. G., Fricke, M., Schmidt, R. E., Espevik, T., Jones, B., Jarnicki, A. G., Hansbro, P. M., Busto, P., Marshak-Rothstein, A., Hornemann, S., Aguzzi, A., Kastenmuller, W. & Latz, E. (2014). 'The adaptor ASC has extracellular and 'prionoid' activities that propagate inflammation', Nat Immunol, 15(8), pp. 727-37. Gaidt, M. M., Ebert, T. S., Chauhan, D., Schmidt, T., Schmid-Burgk, J. L., Rapino, F., Robertson, A. A. B., Cooper, M. A., Graf, T. & Hornung, V. (2016). 'Human Monocytes Engage an Alternative Inflammasome Pathway', Immunity, 44(4), pp. 833-846. Gardner, S. E., Humphry, M., Bennett, M. R. & Clarke, M. C. H. (2015). 'Senescent vascular smooth muscle cells drive inflammation through an interleukin-1α-dependent senescence-associated secretory phenotype', Arteriosclerosis, Thrombosis, and Vascular Biology, 35(9), pp. 1963-1974. Goll, D. E., Thompson, V. F., Li, H., Wei, W. & Cong, J. (2003). 'The calpain system', Physiological Reviews, 83(3), pp. 731-801. Green, J. P., Yu, S., Martin-Sanchez, F., Pelegrin, P., Lopez-Castejon, G., Lawrence, C. B. & Brough, D. (2018). 'Chloride regulates dynamic NLRP3- dependent ASC oligomerization and inflammasome priming', Proc Natl Acad Sci U S A, 115(40), pp. E9371-E9380. Groß, O., Yazdi, A. S., Thomas, C. J., Masin, M., Heinz, L. X., Guarda, G., Quadroni, M., Drexler, S. K. & Tschopp, J. (2012). 'Inflammasome activators induce Interleukin-1α secretion via distinct pathways with differential requirement for the protease function of Caspase-1', Immunity, 36(3), pp. 388-400. Kayagaki, N., Stowe, I. B., Lee, B. L., O'Rourke, K., Anderson, K., Warming, S., Cuellar, T., Haley, B., Roose-Girma, M., Phung, Q. T., Liu, P. S., Lill, J. R., Li, H., Wu, J., Kummerfeld, S., Zhang, J., Lee, W. P., Snipas, S. J., Salvesen, G. S., Morris, L. X., Fitzgerald, L., Zhang, Y., Bertram, E. M., Goodnow, C. C. & Dixit, V.

M. (2015). 'Caspase-11 cleaves gasdermin D for non-canonical inflammasome signalling', Nature, 526(7575), pp. 666-671. Kovacs, S. B. & Miao, E. A. (2017). 'Gasdermins : Effectors of Pyroptosis', Trends in Cell Biology, In Press, pp. 1-12. Laberge, R. M., Sun, Y., Orjalo, A. V., Patil, C. K., Freund, A., Zhou, L., Curran, S. C., Davalos, A. R., Wilson-Edell, K. A., Liu, S., Limbad, C., Demaria, M., Li, P., Hubbard, G. B., Ikeno, Y., Javors, M., Desprez, P. Y., Benz, C. C., Kapahi, P., Nelson, P. S. & Campisi, J. (2015). 'MTOR regulates the pro-tumorigenic senescence-associated secretory phenotype by promoting IL1A translation', Nature Cell Biology, 17(8), pp. 1049-1061. Latz, E., Xiao, T. S. & Stutz, A. (2013). 'Activation and regulation of the inflammasomes', Nature Reviews Immunology, 13(6). Lopez-Castejon, G. & Brough, D. (2011). 'Understanding the mechanism of IL-1b secretion', Cytokine and Growth Factor Reviews, 22(4), pp. 189-195. Martín-Sánchez, F., Diamond, C., Zeitler, M., Gómez, A. I., Bagnall, J., Spiller, D., White, M., Daniels, M. J. D., Morterallo, A., Peñalver, M., Paszek, P., Steringer, J. P., Nickel, W., Brough, D. & Pelegrín, P. (2016). 'Inflammasome- dependent IL-1 β release depends upon membrane permeabilisation', pp. 1219- 1231. Martin, S. J. (2016). ' Cell death and inflammation: the case for IL-1 family cytokines as the canonical DAMPs of the immune system', FEBS J, 283, pp. 2599-2615. Monteleone, M., Stanley, A. C., Chen, K. W., Brown, D. L., Bezbradica, J. S., von Pein, J. B., Holley, C. L., Boucher, D., Shakespear, M. R., Kapetanovic, R., Rolfes, V., Sweet, M. J., Stow, J. L. & Schroder, K. (2018). 'Interleukin-1β Maturation Triggers Its Relocation to the Plasma Membrane for Gasdermin-D- Dependent and -Independent Secretion', Cell Reports, 24(6), pp. 1425-1433. Pelegrin, P., Barroso-Gutierrez, C. & Surprenant, A. (2008). 'P2X7 receptor differentially couples to distinct release pathways for IL-1beta in mouse macrophage', J Immunol, 180(11), pp. 7147-7157. Perregaux, D. G. & Gabel, C. A. (1998). 'Post-translational processing of murine IL-1: evidence that ATP-induced release of IL-1α and IL-1β occurs via a similar mechanism', J Immunol, 160, pp. 2469-2477. Redondo-Castro, E., Faust, D., Fox, S., Baldwin, A. G., Osborne, S., Haley, M. J., Karran, E., Nuthall, H., Atkinson, P. J., Dawson, L. A., Routledge, C., Allan, S. M., Freeman, S., Brownlees, J. & Brough, D. (2018). 'Development of a characterised tool kit for the interrogation of NLRP3 inflammasome-dependent responses', Scientific Reports, 8(1), pp. 1-11. Rivers-Auty, J., Daniels, M. J. D., Colliver, I., Robertson, D. L. & Brough, D. (2018). 'Redefining the ancestral origins of the interleukin-1 superfamily', Nature Communications, 9(1), pp. 1-12. Rubartelli, A., Cozzolinol, F., Talio, M. & Sitia, R. (1990). 'A novel secretory pathway for interleukin-lβ, a protein lacking a signal sequence', The EMBO Journal1, 9(5), pp. 1503-1510. Semino, C., Carta, S., Gattorno, M., Sitia, R. & Rubartelli, A. (2018). 'Progressive waves of IL-1β release by primary human monocytes via sequential activation of

72 vesicular and gasdermin D-mediated secretory pathways', Cell Death and Disease, 9(11). Shi, J., Zhao, Y., Wang, K., Shi, X., Wang, Y., Huang, H., Zhuang, Y. & Cai, T. (2015). 'Cleavage of GSDMD by inflammatory caspases determines pyroptotic cell death', Nature, 526, pp. 660-665. Shirasaki, Y., Yamagishi, M., Suzuki, N., Izawa, K., Nakahara, A., Mizuno, J., Shoji, S., Heike, T., Harada, Y., Nishikomori, R. & Ohara, O. (2014). 'Real-time single-cell imaging of protein secretion', Scientific Reports, 4. Stoffels, M., Zaal, R., Kok, N., van der Meer, J. W. M., Dinarello, C. A. & Simon, A. (2015). 'ATP-induced IL-1β specific secretion: True under stringent conditions', Frontiers in Immunology, 6(FEB), pp. 1-6. Swanton, T., Cook, J., Beswick, J. A., Freeman, S., Lawrence, C. B. & Brough, D. (2018). ' Is targeting the inflammasome a way forward for neuroscience drug discovery?', SLAS Discov, 23, pp. 991-1017. Venegas, C., Kumar, S., Franklin, B. S., Dierkes, T., Brinkschulte, R., Tejera, D., Vieira-Saecker, A., Schwartz, S., Santarelli, F., Kummer, M. P., Griep, A., Gelpi, E., Beilharz, M., Riedel, D., Golenbock, D. T., Geyer, M., Walter, J., Latz, E. & Heneka, M. T. (2017). 'Microglia-derived ASC specks cross-seed amyloid-β in Alzheimer’s disease', Nature, 552(7685), pp. 355-361. Verhoef, P. A., Kertesy, S. B., Lundberg, K., Kahlenberg, J. M. & Dubyak, G. R. (2005). 'Inhibitory effects of chloride on the activation of caspase-1, IL-1beta secretion, and cytolysis by the P2X7 receptor', J Immunol, 175(11), pp. 7623-34. Xu, X., Li, H., Hou, X., Li, D., He, S., Wan, C., Yin, P., Liu, M., Liu, F. & Xu, J. (2015). 'Punicalagin induces Nrf2/HO-1 expression via upregulation of PI3K/AKT pathway and inhibits LPS-induced oxidative stress in RAW264.7 macrophages', Mediators Inflamm, p. 380218. Zheng, Y., Humphry, M., Maguire, J. J., Bennett, M. R. & Clarke, M. C. H. (2013). 'Intracellular Interleukin-1 Receptor 2 Binding Prevents Cleavage and Activity of Interleukin-1α, Controlling Necrosis-Induced Sterile Inflammation', Immunity, 38(2), pp. 285-295.

Chapter 3. Regulation of IL-1α release by nuclear localization

3.1. Paper title and authors

Regulation of IL-1α release by nuclear localization

Victor S. Tapia1,2, Rose Wellens1,2, Antony Adamson3, Jack Rivers-Auty1,2,4 and David Brough1,2,&

1Lydia Becker Institute of Immunology and Inflammation, University of Manchester, Manchester M13 9PT, UK

3Genome Editing Unit Core Facility, Faculty of Biology, Medicine and Health, University of Manchester, Manchester, UK.

4School of Medicine, College of Health and Medicine, University of Tasmania, Hobart, Tasmania, Australia.

&Corresponding author: [email protected]

Manuscript submitted to Scientific Reports.

Contribution The original idea of this study was conceived by DB. DB, AA, JRA and I designed experiments. I performed the experiments for figures 3.1c-e, 3.2, 3.3 and supplementary figures. RW performed the experiments for figure 3.1b and replicates of figure 3.1e. AA designed the constructs. DB, AA, JRA and I wrote the manuscript.

Funding

This work was supported by ANID / Scholarship program / Doctorado becas Chile/2016 – 721704488 (to VT) and by the Medical Research Council (MRC) (grant ref no: MR/N029992/1 to DB)

3.2. Abstract

Inflammatory cytokines implicated in disease-associated inflammation include members of the interleukin-1 (IL-1) family, namely IL-1α and IL-1β. The biology of IL-1α has received relatively little attention. Here we analysed evolutionary conserved features of the pro- domain of pro-IL-1α that may influence the secretion of the mature, active, IL-1α molecule, namely the presence of a nuclear localisation sequence. We report that the pro-domain is essential for pro-IL-1α processing by calpain, and that the pro-domain is also required for the nuclear compartmentalisation of human pro-IL-1α. Nuclear localisation of pro-IL-1α limits its availability to calpain and thus processing and release from the cell. These data suggest nuclear trafficking represents a mechanism to regulate inflammation by limiting the availability of pro-IL-1α for calpain-dependent processing.

Keywords: Inflammation, interleukin-1α, nucleus, nuclear localisation, calpain, cell death.

3.3. Introduction

Inflammation is a non-specific response of the innate immune system that controls infection and promotes tissue repair. However, inflammation can also be damaging, and is implicated as a causal factor in many diseases (Rock et al., 2010). In this context, inflammation is a maladaptive response, and therefore represents a therapeutic target (Brough et al., 2015). Inflammatory cytokines associated with damaging inflammation include pro-inflammatory members of the interleukin-1 (IL-1) family, namely IL-1α and IL-1β (Rock et al., 2010). The biology and therapeutic potential of targeting IL-1α is relatively poorly explored, although in a murine model of sepsis in neonates, lethality was found to be dependent specifically on IL-1α (Benjamin et al., 2018). There is also growing evidence for a role for IL-1α in cellular senescence and cancer (Laberge et al., 2015).

IL-1α lacks a signal peptide and is secreted by unconventional pathways independent of the ER and Golgi apparatus. IL-1α is initially produced as a precursor pro-form that is cleaved by proteases to a mature, more biologically active form (Brough and Denes, 2015). Processing and release of IL-1α can be regulated by calcium-dependent proteases known as calpains (Kobayashi et al., 1990b), and during senescence by inflammatory caspases (Wiggins et al., 2019). The relationship between IL-1α processing and release is not known. We recently studied the evolutionary origin of IL-1 and discovered that IL-1α arose as a gene duplication of IL-1β and is present only in mammals (Rivers-Auty et al., 2018). Despite its relatively recent appearance in evolution, IL-1α shares just 26% homology with IL-1β at the amino acid level (March et al., 1985).

A striking difference between IL-1α and IL-1β is the conservation of their pro- domains. The pro-domain of IL-1α is highly conserved between species, while the pro-domain of IL-1β is not (Rivers-Auty et al., 2018). Furthermore, within the pro-domain of IL-1α is the presence of a relatively well conserved nuclear localisation sequence (NLS) (Luheshi et al., 2009b). The importance of nuclear localisation in the regulation of IL-1α is not understood although may be responsible for the cellular retention of IL-1α by apoptotic (Berda-Haddad et al., 2011; Cohen et al., 2010) and necrotic cells (Luheshi et al., 2009a). A related cytokine, IL-33, requires nuclear sequestration to prevent aberrant damaging inflammation (Bessa et al., 2014). However, the NLS is not present in the pro-IL-

1α sequences of toothed whales, suggesting that approximately 35 million years ago the NLS was lost (Rivers-Auty et al., 2018). We recently reported that there are features of the pro- domain of IL-1α that are conserved across all species suggesting that the NLS is therefore unlikely to be the factor facilitating a divergence of IL-1α from IL-1β (Rivers-Auty et al., 2018). This leaves the question why did the NLS evolve? The aim of this study was to investigate the importance of the pro-domain for the activation and release of IL-1α.

3.4. Results

Computational analysis (Rivers-Auty et al., 2018) found that there was no NLS in the sequence of toothed whale pro-IL-1α. To validate this and the intracellular localisation of different IL-1 molecules HeLa cells were transfected to express pro-IL-1α, a chimeric IL-1 with the pro-domain of human IL-1β and the mature domain of human IL-1α (β-pro-IL-1α), a chimeric toothed whale propiece (Orca, Orcina orcus) and a human mature domain (Orca-pro-(h)IL-1α), and pro-IL-1β. Except for pro-IL-1β the calpain cleavage site was conserved in the IL-1 encoding sequences in all plasmids (Figure 3.1a). 24 hours after transfection the cells were fixed, stained with anti-IL-1 antibodies, and with DAPI to identify the nucleus, and then representative images were taken using a confocal microscope (Figure 3.1b) and sub-cellular distribution was analysed by co-localization of IL-1 and DAPI staining using wide-field microscopy. Pro-IL-1α was enriched in the nuclear compartment (Figure 3.1b, c). Orca-pro-(h)IL-1α, β-pro-IL-1α, and pro-IL- 1β were distributed ubiquitously throughout the cell (Figure 3.1b, c). All expression vectors shared the same backbone and were driven by the same promoter (CMV), and the proteins expressed well except for β-pro-IL-1α (Figure 3.1d) whose expression was increased by co-treatment of the cells with proteasome inhibitors (Figure 3.1e), suggesting that the pro-domain of IL-1α was important for its stability within the cell. This observation was strengthened when we tried to express mature IL-1α alone, which proved to be highly unstable within the cell and could only be detected when fused to a signal peptide (SP) sequence to direct it out of the cell (Figure S3.1). These data are the experimental validation of our previous research which identified a lack of NLS within the pro-domain of pro-IL-1α within toothed whales (Rivers-Auty et al., 2018), and highlights that the pro-domain stabilises the mature cytokine.

Figure 3.1 - Expression constructs of pro-IL-1α. a: For each construct (pro-IL-1α, β-pro-IL-1α, Orca-pro-(h)IL-1α, and pro-IL-1β), amino acid positions of nuclear localization signal (NLS) and calpain cleavage site are indicated. Pro- and mature domains of human IL-1α, human IL-1β, and orca IL-1α are indicated by light and dark blue, red and green colours. b and c: HeLa cells were transfected with the

79 indicated constructs and 24 h later cell localization analysed by immunocytochemistry. Representative confocal images are shown (b). Nuclear localization was analysed in wide-field microscopy images (n=6) (c). d: HeLa cells were transfected as before and lysates analysed with antibodies targeting IL-1α (pro-IL-1α, 31 kDa), IL-1β (pro-IL-1 β, 31 kDa) and β-Actin (42 kDa) by western blotting. e: HeLa cells were transfected with pro-IL- 1α or β-pro-IL-1α for 18 h and then treated for 6 h with: (lane 1) vehicle; the proteasome inhibitors (2) carfilzomib (1 µM), (3) bortezomib (1 µM), and (4) MG-132 (1 µM); or autophagy inhibitors (5) bafilomycin A1 (100 nM), (6) chloroquine (50 µM), and (7) wortmannin (1 µM). Cell lysates were analysed for pro-IL-1α and β-Actin by western blotting. ***p ≤ 0.001 determined by one-way ANOVA with Dunnet’s post hoc analysis. Error bars indicate ± SEM. Western blots representative of three independent experiments. Scale bar = 12 µm. Experiments performed by VT (c-e) and RW (b, e),

Release of mature IL-1α from the cell can be triggered by Ca2+-dependent calpain processing of pro-IL-1α which can be achieved by treatment of a pro-IL- 1α expressing cell with the Ca2+ ionophore ionomycin (Tapia et al., 2019). With the constructs we had generated we were now in a position to test the hypothesis that nuclear localisation of pro-IL-1α and its pro- domain regulated the release of IL-1α. HeLa cells were transfected to express pro-IL-1α, β-pro-IL-1α, and Orca- pro-(h)IL-1α. After transfection, β-pro-IL-1α protein levels were recovered by pre- treatment with the proteosome inhibitor carfilzomib. Cells were then treated with ionomycin (10 µM, 1 h) to induce calpain activation. Cell lysates and supernatants were harvested for analysis of pro-IL-1α processing by western blot (Figure 3.2a). Treatment of pro-IL-1α expressing cells with ionomycin resulted in processing of pro-IL-1α to a mature form, which was detectable in the cell supernatants (Figure 3.2a). β-pro-IL-1α was insensitive to ionomycin treatment, even though the calpain cleavage sequence was preserved, suggesting that the pro- domain of IL-1α was important for calpain-dependent processing (Figure 3.2a). Treatment of Orca-pro-(h)IL-1α expressing cells with ionomycin resulted in greater processing of pro-IL-1α to a mature form within the cells and this was reflected by more mature IL-1α in the supernatant (Figure 3.2a). To further establish an effect on processing the above experiment was repeated except with just pro-IL-1α and Orca-pro-(h)IL-1α with western blot of combined lysates and supernatants conducted to compare processing (Figure 3.2b). These blots suggest that there is greater processing of Orca-pro-(h)IL-1α compared to pro-IL- 1α (Figure 3.2b), which was confirmed by densitometric analysis of the blots (Figure 3.2c). There is very high homology between pro- domains of IL-1α across

Figure 3.2 - Nuclear localization regulates processing and secretion of pro-IL-1α. a: HeLa cells were transfected to express pro-IL-1α, β-pro-IL-1α, or Orca-pro-(h)IL-1α and 18 h later were treated with carfilzomib (1 µM, 6 h) followed by treatment with ionomycin (10 µM, 1 h). Supernatants and cell lysates were analysed by western blot using antibodies targeting IL-1α, for pro-IL-1α (31 kDa) and mature IL-1α (17 kDa), and β- Actin (42 kDa). b-f: HeLa cells were transfected to express pro-IL-1α or Orca-pro(h)IL-1α as above and then treated with ionomycin (10 µM) for 1 and 4 h. Combined supernatants and lysates were analysed for pro-IL-1α processing by western blotting. Representative western blot of pro- (31 kDa) to mature IL-1α (17 kDa) processing is shown in b, and densitometric analysis of the ratio of mature to total IL-1 is shown in c (n = 6). d and e are supernatants and lysates analysed for IL-1α by ELISA (n = 6). IL-1α release is shown in d and total levels (supernatant + lysate) are shown in e. f: Cell death from the experiment presented in D was quantified by measuring LDH release from supernatants (n = 6). Statistics were determined by paired t test (C) or by two-way ANOVA with Sidak’s post hoc analysis (D-F). n.s. = non-significant, ***p ≤ 0.001, ****p ≤ 0.0001. Error bars indicate ± SEM. Western blots are representative of two (A) or six (B) independent experiments. Experiments designed and performed by VT,

81 mammalian species with an absence of the NLS the only apparent difference (Rivers-Auty et al., 2018). Thus, these data suggest that the increased calpain- dependent processing of Orca-pro-(h)IL-1α is a result directly related to more of it being present in the cytosol of the cell, compared to less processing of pro-IL-1α which has a greater enrichment in the nuclear compartment.

We next assessed whether release of IL-1α was also affected by nuclear localisation. HeLa cells were transfected to express pro-IL-1α or Orca-pro-(h)IL- 1α as above and 24 hours later treated with ionomycin (10 µM) for 1 or 4 hours with IL-1α release measured by ELISA. Released IL-1α was detectable at 1 and 4 hours after ionomycin treatment, and after 4 hours was significantly greater from cells expressing Orca-pro-(h)IL-1α (Figure 3.2d). This difference was not explained by a difference in total levels of IL-1α expressed as these were equivalent between constructs (Figure 3.2e), and was independent of an effect of cell death, as this was also the same between the cells expressing the different constructs (Figure 3.2f). Thus, these data suggest that nuclear sequestration exerts a profound influence on the levels of IL-1α released. To confirm this observation we repeated the experiment using expression constructs previously used to evaluate the function of the IL-1α NLS (Luheshi et al., 2009b), expressing mouse pro-IL-1α-GFP and K85E-pro-IL-1α-GFP, in which the NLS had been mutated by site directed mutagenesis of lysine (K) 85 to glutamate (E) . HeLa cells were transfected with the respective constructs, along with a GFP only control, and wide-field microscopy was used to assess nuclear localisation as described above. Pro-IL-1α-GFP showed enriched nuclear localisation compared to K85E-pro-IL-1α-GFP, whose cellular distribution was identical to GFP alone (Figure 3.3a, Figure s3.2). Western blot analysis of processing after ionomycin treatment (10 µM, 1 h) of pro-IL-1α-GFP and K85E-pro-IL-1α-GFP was consistent with the data above showing that nuclear localisation impaired processing (Figure 3.3b, c). Furthermore, there was greater IL-1α release from the K85E-pro-IL-1α-GFP expressing cells after ionomycin treatment at both 1 and 4 hours compared to wild type pro-IL-1α-GFP (Figure 3.3d) which was not explained by a difference in expression (Figure 3.3e). Together these data strongly suggest that calpain-dependent processing and release of IL-1α was limited by nuclear localisation of the pro-form.

Figure 3.3 - Effects of NLS mutation on IL-1α secretion. a: HeLa cells were transfected to express pro-IL-1α-GFP, K85E-pro-IL-1α-GFP, or GFP alone and nuclear localization was analysed by wide-field fluorescence microscopy (n = 6). b-e: HeLa cells transfected as in a were treated with ionomycin (10 µM) for 1 and 4 h. Combined supernatants and lysates were analysed for pro-IL-1α-GFP (58 kDa) processing to mature IL-1α-GFP (44 kDa), using antibodies targeting IL-1α and β-actin by western blotting. Representative western blot is shown in b and densitometric analysis of the ration of the mature versus total IL-1 is shown in c (n = 6). d and e, supernatant and lysates were analysed for IL-1α by ELISA (n = 6). IL-1α release is shown in d, and total levels (supernatant + lysate) are shown in e. Data were analysed by one-way ANOVA with Dunnet’s post hoc analysis (A), by paired t test (C) or by two-way ANOVA with Sidak’s post hoc analysis (D-E). n.s. = non-significant, *p ≤ 0.05, ***p ≤ 0.001. Error bars indicate ± SEM. Western blot is representative of six independent experiments. Experiments designed and performed by VT,

3.5. Discussion

Understanding the regulation of IL-1α is important for the understanding of sterile inflammatory responses and how inflammation contributes to disease (Rock et al., 2010). With this manuscript we report a number of insights into how the pro- domain of pro-IL-1α regulates the activity of the mature active IL-1α protein. Firstly we observed that the pro- domain of IL-1α was important for the stability of the mature domain. The chimera of the pro- domain of IL-1β and the mature IL- 1α domain was not stable and was rapidly degraded by the proteasome (Figure 3.1e). Coupled with the labile nature of mature IL-1α in the cell these data highlight an important role for the pro- domain in stabilising the protein. We also see that the pro- domain is essential for calpain-dependent processing. When fused to the β pro- domain Ca2+-dependent processing is was blocked, suggesting that the α pro-domain confers specificity to the calpain dependent processing event (Figure 3.2a), thus opening a new avenue for further exploration. An effect of nuclear localization on IL-1α release has been reported previously by us and others (Berda-Haddad et al., 2011; Cohen et al., 2010; Luheshi et al., 2009a), and we add further to this insight that processing is also influenced by nuclear localization (Figure 3.2b).Thus further understanding the importance of the pro- domain of pro-IL-1α will reveal more about the regulation of this important cytokine.

As stated above IL-1α arose as a gene duplication of IL-1β, and is present only in mammals, and shares limited homology (26%) with IL-1β at the amino acid level (March et al., 1985). Given that the pro- domains of IL-1α from different mammalian species are very tightly conserved it is possible that a function of the pro- domain drove the evolution of IL-1α (Rivers-Auty et al., 2018). When expressed in cells pro-IL-1α shows a strong nuclear localisation by virtue of its NLS (Luheshi et al., 2009a; Luheshi et al., 2009b). However, unusually, the NLS is not present in the pro-IL-1α sequences of toothed whales, suggesting that approximately 35 million years ago the importance of the NLS was lost to toothed whales (Rivers-Auty et al., 2018). Thus if nuclear localisation was an evolutionary adaption for IL-1α or inflammation, then the pressure was lost, unless toothed whales developed a different sequestration method. Without an alternative method for IL-1α sequestration toothed whale cells may release more IL-1α under relevant cellular stresses than other mammals, where we find that nuclear

84 localisation limits IL-1α release, and thus in humans, is a mechanism regulating the extent of an inflammatory response.

In summary we report that in addition to nuclear localization, the pro-domain of pro-IL-1α has important regulatory control over the activity and function of the mature protein and this area of its biology warrants further investigation.

3.6. Experimental procedures

Antibodies and reagents

Antibodies used targeted human IL-1α (AF-200-NA, R&D Systems), human IL-1β (AF-201-NA, R&D Systems), mouse IL-1α (AF-400-NA, R&D Systems) and β- Actin (A3854, Sigma). Pharmacological agents used were carfilzomib (17554- 1mg-CAY, Cambridge Bioscience), bortezomib (10008822-1mg-CAY, Cambridge Bioscience), MG-132 (474787-10mg, VWR International), bafilomycin A1 (B1793- 2UG, Sigma), chloroquine (C6628-25G, Sigma), wortmannin (W1628-1MG, Sigma) and ionomycin (I0634-1MG, Sigma). All other materials were from Sigma- Aldrich unless specified.

IL-1 constructs

Coding sequences were obtained from human IL1A (NCBI Gene ID: 3552), human IL1B (NCBI Gene ID: 3553), Orcinus orca IL1A (NCBI reference sequence: XM_004276766.2) and human INS (NCBI ID: 3630). Pro-IL-1α, β-pro- IL-1α, orca-pro-(h)IL-1α, pro-IL-1β, mat-IL-1α and SP-mat-IL-1α genes were synthesized and cloned to pcDNA3.1(+) vectors (Life Technologies). β-pro-IL-1α chimeric expressed the Met1 to Asp116 of human IL-1β, followed by Ile109 to Ala271 of human IL-1α. Orca-pro-(h)IL-1α chimeric expressed the Met1 to Ile108 of Orca IL-1α, followed by Ile109 to Ala271 of human IL-1α. Mat-IL-1α and SP-mat-IL-1α expressed the Ser113 to Ala271 of human IL-1α, in SP-mat-IL-1α this sequence was preceded by the insulin 24-residue signal peptide (SP). Murine pro-IL-1α- GFP and K85E-pro-IL-1α-GFP were generated previously (Luheshi et al., 2009b).

Cell culture

HeLa cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM), 10% fetal bovine serum (FBS, Life Technologies), 100 units/ml penicillin and 100

µg/ml streptomycin (PenStrep). Cells were seeded overnight into 96-well plated at a density of 1 x 105 cells/ml. Cells were transfected with plasmids (5 µg/ml DNA) using Lipofectamine 3000 (Invitrogen) according to the manufacturer’s instructions for 18-24 h. For protein degradation experiments, cells were treated with carfilzomib (1 µM), bortezomib (1 µM), MG-132 (1 µM), bafilomycin A1 (100 nM), chloroquine (50 µM), wortmannin (1 µM) for 6 h in DMEM, 1% FBS, PenStrep. For calpain activation experiments, cells were treated with ionomycin (10 µM) for 1 or 4 h in DMEM, 1% FBS, PenStrep.

Immunohistochemistry analysis

HeLa cells were seeded onto glass coverslips in 24 well-plates and transfected as above. Cells were fixed in 4% paraformaldehyde, then incubated with primary antibodies against human IL-1α (2 µg/ml) or human IL-1β (1 µg/ml) in PBS with 1% bovine serum albumin (BSA) and 0.1% Triton-X100 overnight at 4 ˚C. Following this, cells were labelled using anti-goat Alexa Fluor 488 (1 µg/ml, Invitrogen) in the same buffer for 1 h at room temperature. 40,6-diamino-2- phenylindole (DAPI, 1 µg/ml, Thermo Fisher) was used to label nuclei. Pro-IL-1α- GFP expressing cells were directly incubated with DAPI after fixation.

Representative confocal images were collected on a Leica TCS SP8 AOBS upright confocal microscope using a 63x oil objective. Wide-field images for nuclear localization analysis were collected on a Zeiss Axioimager.D2 upright microscope using a 20x objective. Nuclear localization was quantified using the ImageJ “Intensity Ratio Nuclei Cytoplasm” tool and plotted as percentage of the total IL-1 fluorescence intensity which co-localised with DAPI signal.

Western blot analysis

Western blot was used to detect human IL-1α, human IL-1β, mouse IL-1α, and β- Actin on cell supernatants and lysates. Samples of lysate and supernatant were run on 10% (mouse IL-1α) or 15% (human IL-1α/β) SDS-polyacrilamide gels, and were transferred using a Trans-Blot® TurboTM Transfer System (Bio-Rad) at 25 V for 7 min. Membranes were blocked in PBS with 0.1% Tween (PBST) with 2.5% BSA for 1 h at room temperature. After washing the membranes were incubated (4 ˚C) overnight in primary antibodies in PBST, 0.1% BSA. Membranes were then washed and incubated with peroxidase-conjugated secondary anti-

86 goat antibodies (Dako) in PBST, 0.1% BSA for 1 h at room temperature. For the detection step the membranes were incubated in Amersham Bioscience ECL prime western blotting detection reagent (GE Life Sciences) before being exposured using a G:Box gel doc system (Syngene).

RT-qPCR

Total RNAs were extracted from samples with PureLinkTM RNA mini kit (Thermo Fisher) according to the manufacturer. RNA (1 µg) was converted to cDNA using M-MLV (Moloney Murine Leukemia Virus) Reverse Transcriptase (Thermo Fisher). Quantitative polymerase chain reaction (qPCR) was performed using Power SYBR Green PCR Master Mix (Thermo Fisher) in 384-well format using a 7900HT Fast Real-Time PCR System (Applied Biosystems). Three microliters of 1:50 diluted cDNA was loaded with 200 mmol/L of primers in triplicate. To detect IL1A expression from plasmids, a forward primer was designed for IL1A and a reverse primer for the pCDNA3.1 BGH polyA terminator region. Data were normalized to the expression of the housekeeping gene ACTB. These specific primers were designed using Primer3Plus software (http://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi). Primers used were:

- Il1a Forward: GGCCACCCTCTATCACTGAC - BGH-polyA Reverse: CAACAGATGGCTGGCAACTA - Actb Forward: CACCATTGGCAATGAGCGGTTC - Actb Reverse: AGGTCTTTGCGGATGTCCACGT.

Expression levels of IL1A were computed as follows: relative mRNA expression = E−(Ct of IL1A)/ E−(Ct of ACTB), where Ct is the threshold cycle value and E is efficiency. Negative controls without M-MLV were used to check that plasmid DNA was not being detected.

IL-1α ELISA

Quantification of human and mouse IL-1α in cell supernatant and lysates was performed by using DuoSet ELISA Kits (R&D Systems) and following the manufacturer’s instructions. Absorbance was detected using a Synergy HT microplate reader (Biotek Instruments).

Cell death analysis

Release of LDH into the supernatant was used to quantify cell death using the CytoTox 96 Non-Radioctive Cytotoxicity Assay (Promega). Samples were quantified by reading absorbance at 490 nm in a Synergy HT microplate reader (Biotek Instruments). The release of LDH was normalized to a total cell lysis control and expressed as a % of total cell death.

Statistics

Data are represented as the mean ± standard error of the mean (SEM). Statistical analysis was performed using GraphPad Prism version 7 software. Accepted levels of significance were as follows: *, p<0.05; **, p<0.01; ***, p<0.001; ****, p<0.0001. Nuclear localization data were analyzed using one-way ANOVA with matched measures followed by Dunnet’s post hoc analysis. Densitometric analysis data were compared using paired t-test. ELISA and LDH time course comparisons were analyzed using two-way ANOVA with matched measures followed by Sidak’s post hoc analysis. Equal variance and normality were assessed graphically and transformations were applied where necessary. Experimental replicates (n) were defined as transfections performed on different cell passages.

3.7. References

Benjamin, J. T., Moore, D. J., Bennett, C., van der Meer, R., Royce, A., Loveland, R. & Wynn, J. L. (2018). 'Cutting Edge: IL-1alpha and Not IL-1beta Drives IL- 1R1-Dependent Neonatal Murine Sepsis Lethality', J Immunol, 201(10), pp. 2873-2878. Berda-Haddad, Y., Robert, S., Salers, P., Zekraoui, L., Farnarier, C., Dinarello, C. A., Dignat-George, F. & Kaplanski, G. (2011). 'Sterile inflammation of endothelial cell-derived apoptotic bodies is mediated by interleukin-1', Proceedings of the National Academy of Sciences, 108(51), pp. 20684-20689. Bessa, J., Meyer, C. A., de Vera Mudry, M. C., Schlicht, S., Smith, S. H., Iglesias, A. & Cote-Sierra, J. (2014). 'Altered subcellular localization of IL-33 leads to non- resolving lethal inflammation', J Autoimmun, 55, pp. 33-41. Brough, D. & Denes, A. (2015). 'Interleukin-1alpha and brain inflammation', IUBMB Life, 67(5), pp. 323-30. Brough, D., Rothwell, N. J. & Allan, S. M. (2015). 'Interleukin-1 as a pharmacological target in acute brain injury', Exp Physiol. Cohen, I., Rider, P., Carmi, Y., Braiman, A., Dotan, S., White, M. R., Voronov, E., Martin, M. U., Dinarello, C. A. & Apte, R. N. (2010). 'Differential release of chromatin-bound IL-1 discriminates between necrotic and apoptotic cell death by the ability to induce sterile inflammation', Proceedings of the National Academy of Sciences, 107(6), pp. 2574-2579. Kobayashi, Y., Yamamoto, K., Saido, T., Kawasaki, H., Oppenheim, J. J. & Matsushima, K. (1990). 'Identification of calcium-activated neutral protease as a processing enzyme of human interleukin 1 alpha', Proc Natl Acad Sci U S A, 87(14), pp. 5548-5552. Laberge, R. M., Sun, Y., Orjalo, A. V., Patil, C. K., Freund, A., Zhou, L., Curran, S. C., Davalos, A. R., Wilson-Edell, K. A., Liu, S., Limbad, C., Demaria, M., Li, P., Hubbard, G. B., Ikeno, Y., Javors, M., Desprez, P. Y., Benz, C. C., Kapahi, P., Nelson, P. S. & Campisi, J. (2015). 'MTOR regulates the pro-tumorigenic senescence-associated secretory phenotype by promoting IL1A translation', Nature Cell Biology, 17(8), pp. 1049-1061. Luheshi, N. M., McColl, B. W. & Brough, D. (2009a). 'Nuclear retention of IL-1α by necrotic cells: A mechanism to dampen sterile inflammation', European Journal of Immunology, 39(11), pp. 2973-2980. Luheshi, N. M., Rothwell, N. J. & Brough, D. (2009b). 'The dynamics and mechanisms of interleukin-1α and β nuclear import', Traffic, 10(1), pp. 16-25. March, C. J., Mosley, B., Larsen, A., Ceretti, D. P., Braedt, G., Price, V., Gillis, S., Henney, C. S., Kronheim, S. R., Grabstein, K., Conlon, P., J. Hopp, T. P. & Cosman, D. (1985). 'Cloning, sequence and expression of two distinct human interleukin-1 complementary cDNAs', Nature, 315(20), pp. 641-647. Rivers-Auty, J., Daniels, M. J. D., Colliver, I., Robertson, D. L. & Brough, D. (2018). 'Redefining the ancestral origins of the interleukin-1 superfamily', Nature Communications, 9(1), pp. 1-12. Rock, K. L., Latz, E., Ontiveros, F. & Kono, H. (2010). 'The sterile inflammatory response', Annual review of immunology, 28(3), pp. 321-42.

Tapia, V. S., Daniels, M. J. D., Palazón-Riquelme, P., Dewhurst, M., Luheshi, N. M., Rivers-Auty, J., Green, J., Redondo-Castro, E., Kaldis, P., Lopez-Castejon, G. & Brough, D. (2019). 'The three cytokines IL-1β, IL-18, and IL-1α share related but distinct secretory routes', Journal of Biological Chemistry, 294, pp. jbc.RA119.008009-jbc.RA119.008009. Wiggins, K. A., Parry, A. J., Cassidy, L. D., Humphry, M., Webster, S. J., Goodall, J. C., Narita, M. & Clarke, M. C. H. (2019). 'IL-1α cleavage by inflammatory caspases of the noncanonical inflammasome controls the senescence- associated secretory phenotype', Aging Cell, 18(3), pp. 1-13.

3.8. Supplementary Figures

Figure S3.1 - Expression constructs of pro- and mature IL-1α. Hela cells were transfected for 24 h with the following plasmids: Pro-IL-1α, mature IL-1α (mat-IL-1α), β-pro-IL-1α and signal peptide fused to mature IL-1α (SP-mat-IL-1α). a: Lysates were analysed using antibodies targeting IL-1α and β-Actin by western blotting. b: Supernatants were analysed for IL-1α by ELISA (n = 6). c: Lysates were analysed for Il1a expression using Actb as control by RT-qPCR (n = 4). Statistics were determined by one-way ANOVA with Dunnett’s post hoc analysis. n.s. = non-significant, *p ≤ 0.05, ****p ≤ 0.0001. Error bars indicate ± SEM. Western blot is representative of four independent experiments. Experiments performed by VT.

Figure S3.2 - Representative images from nuclear localization analysis in Fig 2.3A. Hela cells were transfected with GFP, pro-IL-1α-GFP and K85A-pro-IL-1α-GFP and 24 h later cell localization was analysed by GFP and DAPI fluorescence. Scale bar = 40 µm. Wide-field microscopy images are representative of 6 experiments. Experiments performed by VT.

Chapter 4. A TurboID-based proximity labelling approach to study the IL-1α interactome

4.1. Paper title and authors

A TurboID-based proximity labelling approach to study the IL-1α interactome

Victor S. Tapia1,2, Antony Adamson3, and David Brough1,2,&

1Lydia Becker Institute of Immunology and Inflammation, University of Manchester, Manchester M13 9PT, UK

3Genome Editing Unit Core Facility, Faculty of Biology, Medicine and Health, University of Manchester, Manchester, UK.

&Corresponding author: [email protected]

Manuscript in preparation.

Contribution The original idea of this study was conceived by DB. DB, AA and I designed the experiments. I performed all the experiments. AA designed the constructs. I wrote the manuscript, which was reviewed by DB.

Funding This work was supported by ANID / Scholarship program / Doctorado becas Chile/2016 – 721704488.

4.2. Abstract

The cytokines of the Interleukin-1 (IL-1) family, namely IL-1α and IL-1β, are important regulators of inflammatory responses. Understanding the mechanisms of IL-1 secretion is also therapeutically relevant as they are implicated in disease- associated inflammation. The mechanisms of IL-1α secretion are poorly understood. Contrary to IL-1β, IL-1α has several putative intracellular protein interactions with poorly explored functions. Here we utilised a method to screen protein interactors of IL-1α, using enzymatic-proximity labelling with the enzyme TurboID (TID). We generated a fusion of IL-1α-TID, which retains all relevant IL- 1α functions. A protocol for proximity labelling and purification of labelled proteins was set up. This methodology will be used in the future to screen IL-1α protein interactors that regulate its secretion.

Keywords: Inflammation, interleukin-1α, turboID, proximity labelling

4.3. Introduction

Inflammation is a response of the immune system that acts to control infection, promote tissue repair and recover tissue homeostasis. However, dysregulation of an inflammatory response can induce tissue damage and underlies the development of many pathologies (Rock et al., 2010). Therefore, there is a therapeutic interest on understanding the molecular mechanisms that control inflammation. The Interleukin-1 (IL-1) family cytokines, IL-1α and IL-1β, are important mediators of inflammatory responses (Mantovani et al., 2019). Classically IL-1α has been considered an alarmin, as its released during necrosis (Chen et al., 2007; Eigenbrod et al., 2008), necroptosis (England et al., 2014) and, alongside IL-1β, pyroptosis (Groß et al., 2012; Tapia et al., 2019). However, IL-1α secretion independent of cell death has been reported during inflammasome activation (Diamond et al., 2017; Wolf et al., 2016) and during the development of the senescence-associated secretory phenotype (SASP) (Tapia et al., 2019; Wiggins et al., 2019). Therefore, the classic concept of IL-1α as an alarmin has been challenged and further research is needed to understand the mechanisms that regulate its secretion.

IL-1α arose as a gene duplication of IL-1β during mammalian evolution (Rivers- Auty et al., 2018) and both cytokines share certain common traits. IL-1α and IL- 1β are stored as intracellular pro-forms which lack a peptide signal for conventional secretion via the ER and Golgi apparatus. Instead, IL-1α and IL-1β are cleaved by proteases to a mature form, increasing its biological activity, and are secreted by unconventional pathways (Daniels and Brough, 2017).

A distinctive difference between IL-1α and IL-1β is their pro-domain. The IL-1α pro-domain is highly conserved between species and contains motifs with several functions, while the IL-1β pro-domain does not (Rivers-Auty et al., 2018). The IL- 1α pro-domain contains a nuclear localization signal (NLS) (Wessendorf et al., 1993) and binding sequences to several nuclear and cytosolic proteins (Buryskova et al., 2004; Hu et al., 2003; Kawaguchi et al., 2006; Pollock et al., 2003). Nuclear localization has been proposed to dampen inflammation by IL-1α nuclear retention during necrosis and apoptosis (Cohen et al., 2010; Luheshi et al., 2009a). On the contrary, with the exception of IL-1R2 interaction which

95 inhibits IL-1α processing (Zheng et al., 2013), it has been poorly explored how intracellular protein interactors regulate IL-1α processing and secretion.

Enzyme-catalysed proximity labelling is a new alternative to screen protein interactions in physiological conditions (Kim and Roux, 2016; Trinkle-Mulcahy, 2019). In this study we developed a method to study the IL-1α interactome using the ligase TurboID (TID), which allows a rapid and non-toxic labelling of proximal proteins by nonspecific biotinylation (Branon et al., 2018). We expressed a functional IL-1α-TID fusion protein and we set up a protocol to purify proximity labelled proteins. In the future this method will be used to identify protein interactions that regulate IL-1α processing and secretion.

4.4. Results

To study the IL-1α interactome by proximity labelling, we generated a fusion protein of pro-IL-1α and TID (Figure 4.1a). Protein fusion can lead to issues on protein stability or loss of function, therefore we first characterised the properties of IL-1α-TID. HeLa cells were transfected to express pro-IL-1α (IL-1α), pro-IL-1α- TID (IL-1α-TID) and TID. 18 to 24 h later proteins were detected using antibodies anti-IL-1α and anti-BirA, which recognises TID (Branon et al., 2018). Western blot analysis of cell lysates showed that all proteins expressed well (Figure 4.1b). Next we checked the sub-cellular localization of IL-1α. Transfected HeLa cells were fixed, proteins detected by immunofluorescence and co-stained with DAPI to identify the nucleus. Representative images were taken using a confocal microscope (Figure 4.1c) and sub-cellular localization was quantified by co- localization of TID (Figure 4.1d) or IL-1α (Figure 4.1e) with DAPI staining using wide-field microscopy. TID was evenly distributed in the cytosol and nucleus, while IL-1α-TID and IL-1α had a nuclear localization (Figure 4.1c,d). Interestingly, nuclear localization of IL-1α-TID was slightly higher than IL-1α (Figure 4.1e).

Processing and release of mature IL-1α can be triggered by the Ca2+-activated protease calpain (Kobayashi et al., 1990b; Tapia et al., 2019). To test if TID fusion affected the release of mature IL-1α, calpain activation was induced by treatment with the Ca2+ ionophore ionomycin. IL-1α and IL-1α-TID expressing HeLa cells were incubated with ionomycin 10 μM for 1 h to induce calpain activation. Cell lysates and supernatants were analysed for IL-1α pro- and mature forms by western blot (Figure 4.1f). Ionomycin induced the processing of IL-1α

96 and IL-1α-TID within the cells, and the release of their mature forms to the media. Altogether, these results demonstrate that the mechanisms associated to sub- cellular localization, processing and secretion of IL-1α are not affected by the fusion of TID.

Figure 4.1 - Characterization of IL-1α-TID. a: Domains of pro-IL-1α (IL-1α), pro-IL-1α-TID (IL-1α-TID) and TID constructs are shown. Calpain cleavage site is indicated (scissor). b: HeLa cells were transfected to express these constructs or not transfected (NT) and 18 h later cells lysates were analysed by western blot for pro-IL-1α (31 kDa), pro-IL-1α-TID (67 kDa), TID (35 kDa) and β-actin (42 kDa). c-e: Cells were transfected as above and cell localization of TID (anti-BirA, green) and IL-1α (red) was analysed by immunohistochemistry. Representative confocal images are shown of transfected cells and non-transfected adjacent cells, scale bar = 12 μm. (c). Nuclear localization of TID (anti-BirA, d) and IL-1α (e) was quantified in wide-field microscopy images (n = 6). f: Cells were transfected to express IL-1α and IL-1α-TID as above and treated with ionomycin (10 μM, 1h). Cell lysates and supernatants were analysed by western blot for pro-IL-1α (31 kDa), mat-IL-1α (17 kDa), pro-IL-1α-TID (67 kDa) and mat-IL-1α-TID (52 kDa). Data were analysed by paired t test. *p ≤ 0.05, ***p ≤ 0.0001. Western blots are representative of three independent experiments.

We next assessed the labelling activity of IL-1α-TID. HeLa cells were transfected to express IL-1α, IL-1α-TID, TID or NT, and labelling was initiated by incubation with exogenous biotin (500 µM, 1h). Lysates were harvested and protein biotinylation was analysed by streptavidin blotting (Figure 4.2a). Following biotin incubation, an increase in biotinylated proteins was detected in IL-1α-TID and TID expressing cells, but not in IL-1α expressing or NT cells. TID proteins also biotinylate themselves during protein labelling, and as expected auto-biotinylation of IL-1α-TID and TID was observed (Figure 4.2a). We next assessed if proteins were labelled in the proximity of TID. HeLa cells were transfected to express IL- 1α-TID and TID, biotinylation was performed as before and co-localization of TID and biotinylated proteins was evaluated by confocal microscopy (Figure 4.2b). TID and its biotinylated proteins had a similar cell distribution along the nucleus and cytosol, while IL-1α-TID and its biotinylated proteins were predominantly localized in the nucleus, confirming that proteins were labelled in the vicinity of TID.

While the previous analyses were carried out with 1h of biotin incubation, interactome studies by TID-proximity labelling have been performed within 10 min to 3 h of biotin incubation (Cho et al., 2020; Larochelle et al., 2019; May et al., 2020). Therefore we checked if protein labelling was successful during different times of biotin incubation. For this, IL-1α-TID and TID-expressing HeLa cells were incubated in a biotin time course and biotinylated proteins were detected by western blot (Figure 4.2c). Protein biotinylation was observed even at 10 min of biotin incubation for IL-1α-TID and TID expressing cells, in comparison to vehicle treated or NT cells. The level of biotinylation increased in intensity until 3 hours of incubation. This shows that the labelling of proteins could be adapted to different long lasting experiments.

Figure 4.2 - Protein biotinylation by TID constructs. a: HeLa cells were transfected to express IL-1α, IL-1α-TID, TID or not transfected (NT) and 18 h later cells were incubated with biotin (500 μM, 1 h). Cell lysates were analysed by western blot for biotinylated proteins (streptavidin) and β-actin. Bands associated to pro-IL-1α-TID (67 kDa) and TID (35 kDa) are indicated. b: Cells were transfected to express IL-1α-TID and TID, treated with biotin (500 μM, 1 h) and cell localization of TID (red) and biotinylated proteins (green) was analysed by immunohistochemistry. Representative confocal images are shown of transfected cells and non-transfected adjacent cells. Scale bar = 12 μm. c: Cells were transfected to express IL-1α-TID, TID or NT, and treated with biotin 500 μM for the indicated times. Cell lysates were analysed by western blot for biotinylated proteins (streptavidin) and β-actin. Western blots are representative of three independent experiments

Having confirmed that IL-1α-TID and TID induce proximity labelling of proteins, we set up a protocol for streptavidin-based purification of biotinylated proteins (Chastney et al., 2020). First, TID-expressing HeLa cells were treated with biotin, and cell lysates were incubated with different amounts of streptavidin-coated magnetic beads. Cell lysates were then analysed by western blot to determine the amount of beads needed to capture most of biotinylated proteins (Figure 4.3a). Then cell lysates were incubated with the chosen amount of beads, and the purification protocol was evaluated by western blot (Figure 4.3b). As previously observed most of the biotinylated proteins were captured by the beads. No leaking of biotinylated proteins was detected from the beads during the washing steps, and most of the biotinylated proteins were recovered in a first purified elution, as shown by streptavidin signal but lack of β-actin (Figure 4.3b).

We then tested the purification protocol in IL-1α-TID, TID expressing and NT cells. Proximity labelling was performed and biotinylated proteins were purified by the previously established protocol. The initial cell lysates and the final purified elutions were analysed by western blot (Figure 4.3c). Biotinylated proteins were purified from IL-1α-TID and TID expressing cells, as observed by the streptavidin and anti-BirA signals but the lack of β-actin. This was corroborated by total protein staining of the same samples (Figure 4.3d). While cell lysates of NT, IL- 1α-TID and TID-expressing cells had a similar protein pattern, specific proteins bands were detected in the purified elution of IL-1α-TID and TID expressing cells, but not in NT cells. Together these results show that we have a protocol to purify proximity labelled proteins. Purified samples will be analysed by mass- spectrometry (MS), and comparison between IL-1α-TID and TID labelled proteins will allow to identify specific protein interactors of IL-1α.

Finally, interactions of other proteins from the IL-1 pathway will be analysed by proximity labelling (Figure s4.1a). The expression in HeLa cells of pro-IL-1β, mature IL-1β and the NLRP3 inflammasome fused to TID were detected by western blot (Figure s4.1b). All IL-1-TID proteins and TID had a similar expression, while NLRP3-TID protein levels were lower. All the fusion proteins had a biotinylating activity detected by streptavidin blot (Figure s4.1c), making them suitable for future proximity labelling studies.

100

Figure 4.3 - Purification of biotinylated proteins. a: HeLa cells were transfected to express TID or not transfected, 18 h later cells were incubated with biotin (500 μM, 1 h) and cell lysates were harvested. Lysates were incubated with streptavidin beads in ratios of 0.8 (A), 4.0 (B) or 20 (C) μl beads / 105 seeded cells. Lysates before and after beads incubation were analysed by western blot for biotinylated proteins (streptavidin) and β-actin. b: HeLa cells were transfected to express TID, treated as above and biotinylated proteins were purified with streptavidin beads. Steps of the purification protocol were analysed by western blot for biotinylated proteins (streptavidin) and β-actin: Cell lysate (1), cell lysate post-beads incubation (2), beads washing steps (3-5), and first and second protein elution from beads (6-7). c, d: Cells were transfected with IL-1α-TID, TID or not transfected (NT), biotin treatment and biotinylated protein enrichment was followed as above. Cell lysates and biotinylated enriched elutions were analysed by western blot for biotinylated proteins (streptavidin), TID (BirA) and β-actin (c) or by InstantBlue staining for total protein content (d). Western blots are representative of three independent experiments.

101

4.5. Discussion

Understanding the mechanisms that regulate IL-1α secretion will give us a better comprehension of its contribution to inflammation and disease (Mantovani et al., 2019; Rock et al., 2010). IL-1α has a highly conserved pro-domain containing binding sequences to several proteins (Rivers-Auty et al., 2018), but how protein interactors regulate IL-1α secretion has not been fully explored. In this study we report a proximity labelling method to screen the IL-1α interactome. We characterised a functional IL-1α-TID fusion protein and a method to purify proximity labelled proteins. In the future these labelled proteins will be analysed by mass-spectrometry to identify IL-1α protein partners.

Screening of IL-1α protein interactions has been previously analysed by immunoprecipitation and yeast-two-hybrid methods (Buryskova et al., 2004; Hu et al., 2003; Kawaguchi et al., 2006; Pollock et al., 2003; Yin et al., 2001). These classic methods are limited to the detection of high-affinity protein interactions under non-physiological conditions. On the contrary, enzyme-catalysed proximity labelling is an alternative that allows the screening of interactions during diverse cellular processes, and the detection of low affinity or transient protein interactions (Kim and Roux, 2016; Trinkle-Mulcahy, 2019). Therefore, while we should expect to detect already known protein interactors, it is possible we could detect transient interactions that have been missed by the classic methods.

After identifying protein interactors by proximity labelling, we plan to evaluate their role in IL-1α secretion by previously established cellular models. We previously evaluated the role of calpain-1 and calpain-2 in the release of mature IL-1α by siRNA knockdown in HeLa cells (Tapia et al., 2019). HeLa cells are also a suitable model to evaluate the secretion of IL-1α induced by caspase-5 activation (Wiggins et al., 2019), an inflammatory caspase that senses intracellular endotoxin (Shi et al., 2014). While calpain and caspase-5-dependent IL-1α release is associated to cell death, we also previously reported that IL-1α is secreted from viable mouse embryonic fibroblast (MEFs) (Tapia et al., 2019). Therefore, we can assess the role of new proteins in IL-1α secretion through different cellular contexts.

Another interesting property of TID to be explored in the future is the labelling and screening of proteins by short biotin incubation (Branon et al., 2018; May et al.,

102

2020). Mature IL-1α is secreted after just one hour of calpain activation or inflammasome activation (Groß et al., 2012; Tapia et al., 2019), therefore is possible that transient protein interactions may be involved in its secretion. Furthermore, the development of TID tools to screen the interactome of NLRP3 and IL-1β may allow the study of protein interactions not explored before. Certain aspects of inflammasome assembly are transient processes, such as the recruitment, activation and inactivation of caspase-1 (Boucher et al., 2018). Similarly to IL-1α, IL-1β secretion is a transient process that occurs shortly after the formation of GSDMD pores and increase in membrane permeability (Martín- Sánchez et al., 2016).

In summary, we report a new method to detect IL-1α protein interactions. This method will be used to screen protein interactions by MS, and the role of these interactions in IL-1α secretion will be tested in a diverse array of cellular contexts.

4.6. Experimental procedures

Antibodies and reagents

Antibodies used targeted IL-1α (AF-200-NA, R&D Systems), BirA (11582-RP01, Sino Biological) and β-Actin (A3854, Sigma). Biotinylated proteins were detected using streptavidin-HRP (S911, ThermoFisher) and streptavidin-conjugated alexa 594 (S11227, ThermoFisher), and purified using MagReSyn® streptavidin magnetic beads (MR-STV002, ReSyn Biosciences). All other materials were from Sigma-Aldrich unless specified.

Constructs

Coding sequences were obtained from human IL1A (NCBI Gene ID: 3552), human IL1B (NCBI Gene ID: 3553), human NLRP3 (NCBI Gene ID: 114548) and TID reported sequence (Branon et al., 2018). Genes were synthesized and cloned in pcDNA3.1(+) vectors (Life Techonologies). IL-1α, IL-1β and NLRP3 were fused to TID with a modified Waldo protein linker GGSGGSGSAGSAAGSGEF (Waldo et al., 1999). Overall structure of TID constructs is shown in Figure S4.1a.

103

Cell culture

HeLa cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM), 10% fetal bovine serum (Life Technologies), 100 units/ml penicillin and 100 µg/ml streptomycin. Cells were seeded overnight into 96, 24, 12 or 6-well plates, seeding respectively 0.1, 0.5, 1.0 or 2.5 ml of cells at a density of 105 cells/ml. Cells were transfected with plasmids (0.01 ng DNA / seeded cells) using Lipofectamine 3000 (Invitrogen) according to the manufacturer’s instructions for 18-24 h. To induce calpain activation, cells were treated with ionomycin (10 µM) for 1 h in DMEM serum free. For proximity labelling assays, cells were incubated with biotin (500 µM, variable times) in DMEM serum free and labelling was stopped by three washes in PBS 1x.

Western blot analysis

HeLa cells were seeded in 96-well plates, treated as indicated above and western blot was used to detect human IL-1α, TID, biotinylated proteins and β- Actin on cell lysates or supernatants. Samples were reduced using Laemmli buffer at 95 °C for 5 min. Samples were ran on 10% SDS-polyacrilamide gels, with the exception of blots detecting mature IL-1α which was ran on 12%. Proteins were transferred to methanol-activated PVDF membranes using a Trans-Blot® TurboTM Transfer System (Bio-Rad) at 25 V for 10 min. Membranes were blocked in 0.1% Tween PBS (PBST) with 2.5% bovine serum albumin (BSA) for 1 h at room temperature. For IL-1α or TID, membranes were incubated (4 ˚C) overnight in anti-IL-1α or anti-BirA (1:2000) in PBST, 0.1% BSA, and then incubated with peroxidase-conjugated secondary anti-goat or anti-rabbit antibodies (Dako, 1:2000) in PBST, 0.1% BSA for 1 h at room temperature. For biotinylated proteins or β-actin, membranes were incubated for 1 h at room temperature with streptavidin-HRP (1:3000 in PBST 2.5% BSA) or anti-β-actin- HRP (1:40000 in PBST 0.1% BSA). For the detection step the membranes were incubated in Amersham ECL prime detection reagent (GE Life Sciences) before being imaged in a G:Box gel doc system (Syngene), or incubated in Amersham ECL Select detection reagent (GE Life Sciences) before being imaged in a C- Digit blot scanner (LI-COR).

104

Immunohistochemistry analysis

HeLa cells were seeded onto glass coverslips in 24-well plates, and transfection and proximity labelling was performed as indicated above. Cells were fixed in 4% paraformaldehyde, and then incubated with antibodies anti-IL-1α or anti-BirA (1:500) in PBS with 1% BSA, 0.1% Triton-X100 and 0.05% Tween 20 overnight at 4 ˚C or for 2 h at room temperature. Following this, cells were labelled using anti-goat Alexa Fluor 594, anti-rabbit Alexa Fluor 488 or streptavidin-conjugated (1:500) Alexa 594 (1:1000) in the same buffer for 1 h at room temperature. 40,6- diamino-2-phenylindole (DAPI, 1 µg/ml, Thermo Fisher) was used to label nuclei.

Representative confocal images were collected on a Leica TCS SP8 AOBS upright confocal microscope using a 63x oil objective. Wide-field images for nuclear localization analysis were collected on a Zeiss Axioimager.D2 upright microscope using a 20x objective. Nuclear localization was quantified using the ImageJ “Intensity Ratio Nuclei Cytoplasm” tool and plotted as percentage of the total anti-IL-1 or anti-BirA fluorescence intensity which co-localised with DAPI signal.

Streptvidin-based purification

HeLa cells were seeded in 12- or 6-well plates, and transfection and proximity labelling were performed as indicated above. After biotinylation, cells were washed three times in PBS and lysed with 400 µl of lysis buffer (50 mM Tris HCl, Ph 7.4, 250 mM NaCl, 0.1% SDS, 0.5 mM DTT, proteinase inhibitor cocktail) at room temperature. Cells were lysed by passing through a 19 G needle four times before adding 40 µl of 20% triton X-100 was added. Lysates were passed through 21 G and 27 G needle four times each, before adding 360 µl of chilled 50 mM Tris HCl Ph 7.4. Cell lysates were centrifugated at full speed for 10 min at 4 °C. Unless other amount was indicated, lysates and MagReSyn beads were incubated using a ratio of 4.0 μl beads / 105 seeded cells. Supernatants were incubated in rotation with beads at 4 °C overnight. Beads were washed twice with 500 μl of wash buffer 1 (10% SDS) at room temperature, once with 500 μl of wash buffer 2 (0.1% sodium deoxycholate, 1% Triton X-100, 1 mM EDTA, 500 mM NaCl, 50 mM HEPES) at 4 °C, and once with 500 μl of wash buffer 3 (0.5% sodium deoxycholate, 0.5% NP-40, 1 mM EDTA, 10 mM Tris HCl, pH 7.4) at 4

105

°C. Proteins were eluted in 60 μl of 2X reducing sample buffer (250 mM Tris HCl, Ph 6.8, 2% SDS, 10% glycerol, 0.2% bromophenol blue, 20 mM DTT and 500 μM biotin), incubating beads at room temperature for 15 min and then at 70 °C for 10 min. Samples were analysed by western blot as indicated above.

Protein Staining

HeLa cells were seeded in a full 6 well-plate, transfection, proximity labelling and streptavidin purification were performed as indicated above. Cell lysates or beads elution were ran on 10% SDS-polyacrilamide gels. Gel was washed with ultrapure water for 10 min, and then incubated with InstantBlue (Sigma) at room temperature for 1h for cell lysates and overnight for bead elution

Statistics

Data are represented as the mean ± standard error of the mean (SEM). Statistical analysis was performed using GraphPad Prism version 8 software. Accepted levels of significance were as follows: *, p<0.05; **, p<0.01; ***, p<0.001; ****, p<0.0001. Nuclear localization data were analyzed using paired t- test. Experimental replicates (n) were defined as transfections performed on different cell passages.

106

4.7. References

Boucher, D., Monteleone, M., Coll, R. C., Chen, K. W., Ross, C. M., Teo, J. L., Gomez, G. A., Holley, C. L., Bierschenk, D., Stacey, K. J., Yap, A. S., Bezbradica, J. S. & Schroder, K. (2018). 'Caspase-1 self-cleavage is an intrinsic mechanism to terminate inflammasome activity', The Journal of Experimental Medicine, pp. jem.20172222-jem.20172222. Branon, T. C., Bosch, J. A., Sanchez, A. D., Udeshi, N. D., Svinkina, T., Carr, S. A., Feldman, J. L., Perrimon, N. & Ting, A. Y. (2018). 'Efficient proximity labeling in living cells and organisms with TurboID', Nat Biotechnol, 36(9), pp. 880-887. Buryskova, M., Pospisek, M., Grothey, A., Simmet, T. & Burysek, L. (2004). 'Intracellular interleukin-1α functionally interacts with histone acetyltransferase complexes', Journal of Biological Chemistry, 279(6), pp. 4017-4026. Chastney, M. R., Lawless, C., Humphries, J. D., Warwood, S., Jones, M. C., Knight, D., Jorgensen, C. & Humphries, M. J. (2020). 'Definition of the fibroblast adhesome using multiplexed proximity biotinylation', BioRxiv. Chen, C. J., Kono, H., Golenbock, D., Reed, G., Akira, S. & Rock, K. L. (2007). 'Identification of a key pathway required for the sterile inflammatory response triggered by dying cells', Nat Med, 13(7), pp. 851-6. Cho, K. F., Branon, T. C., Rajeev, S., Svinkina, T., Udeshi, N. D., Thoudam, T., Kwak, C., Rhee, H. W., Lee, I. K., Carr, S. A. & Ting, A. Y. (2020). 'Split-TurboID enables contact-dependent proximity labeling in cells', Proc Natl Acad Sci U S A, 117(22), pp. 12143-12154. Cohen, I., Rider, P., Carmi, Y., Braiman, A., Dotan, S., White, M. R., Voronov, E., Martin, M. U., Dinarello, C. A. & Apte, R. N. (2010). 'Differential release of chromatin-bound IL-1 discriminates between necrotic and apoptotic cell death by the ability to induce sterile inflammation', Proceedings of the National Academy of Sciences, 107(6), pp. 2574-2579. Daniels, M. J. D. & Brough, D. (2017). 'Unconventional pathways of secretion contribute to inflammation', International Journal of Molecular Sciences, 18(1). Diamond, C. E., Leong, K. W. K., Vacca, M., Rivers-Auty, J., Brough, D. & Mortellaro, A. (2017). 'Salmonella typhimurium-induced IL-1 release from primary human monocytes requires NLRP3 and can occur in the absence of pyroptosis', Scientific Reports, 7(1), pp. 1-9. Eigenbrod, T., Park, J.-H., Harder, J., Iwakura, Y. & Núñez, G. (2008). 'Critical role for mesothelial cells in necrosis-induced inflammation through the recognition of IL-1α released from dying cells', The Journal of Immunology, 181(12), pp. 8194–8198. England, H., Summersgill, H. R., Edye, M. E., Rothwell, N. J. & Brough, D. (2014). 'Release of interleukin-1α or interleukin-1β depends on mechanism of cell death', Journal of Biological Chemistry, 289(23), pp. 15942-15950. Groß, O., Yazdi, A. S., Thomas, C. J., Masin, M., Heinz, L. X., Guarda, G., Quadroni, M., Drexler, S. K. & Tschopp, J. (2012). 'Inflammasome activators induce Interleukin-1α secretion via distinct pathways with differential requirement for the protease function of Caspase-1', Immunity, 36(3), pp. 388-400. Hu, B., Wang, S., Zhang, Y., Feghali, C. A., Dingman, J. R. & Wright, T. M. (2003). 'A nuclear target for interleukin-1α: Interaction with the growth suppressor

107 necdin modulates proliferation and collagen expression', Proceedings of the National Academy of Sciences of the United States of America, 100(17), pp. 10008-10013. Kawaguchi, Y., Nishimagi, E., Tochimoto, A., Kawamoto, M., Katsumata, Y., Soejima, M., Kanno, T., Kamatani, N. & Hara, M. (2006). 'Intracellular IL-1alpha- binding proteins contribute to biological functions of endogenous IL-1alpha in systemic sclerosis fibroblasts', Proceedings of the National Academy of Sciences of the United States of America, 103(39), pp. 14501-14506. Kim, D. I. & Roux, K. J. (2016). 'Filling the void: Proximity-based labeling of proteins in living cells', Trends Cell Biol, 26(11), pp. 804-817. Kobayashi, Y., Yamamoto, K., Saido, T., Kawasaki, H., Oppenheim, J. J. & Matsushima, K. (1990). 'Identification of calcium-activated neutral protease as a processing enzyme of human interleukin 1 alpha', Proc Natl Acad Sci U S A, 87(14), pp. 5548-5552. Larochelle, M., Bergeron, D., Arcand, B. & Bachand, F. (2019). 'Proximity- dependent biotinylation mediated by TurboID to identify protein-protein interaction networks in yeast', J Cell Sci, 132(11). Luheshi, N. M., McColl, B. W. & Brough, D. (2009). 'Nuclear retention of IL-1α by necrotic cells: A mechanism to dampen sterile inflammation', European Journal of Immunology, 39(11), pp. 2973-2980. Mantovani, A., Dinarello, C. A., Molgora, M. & Garlanda, C. (2019). 'Interleukin-1 and related cytokines in the regulation of inflammation and immunity', Immunity, 50(4), pp. 778-795. Martín-Sánchez, F., Diamond, C., Zeitler, M., Gómez, A. I., Bagnall, J., Spiller, D., White, M., Daniels, M. J. D., Morterallo, A., Peñalver, M., Paszek, P., Steringer, J. P., Nickel, W., Brough, D. & Pelegrín, P. (2016). 'Inflammasome- dependent IL-1 β release depends upon membrane permeabilisation', pp. 1219- 1231. May, D. G., Scott, K. L., Campos, A. R. & Roux, K. J. (2020). 'Comparative Application of BioID and TurboID for Protein-Proximity Biotinylation', Cells, 9(5). Pollock, A. S., Turck, J. & Lovett, D. H. (2003). 'The prodomain of interleukin 1α interacts with elements of the RNA processing apparatus and induces apoptosis in malignant cells', FASEB Journal, 17(2), pp. 203-213. Rivers-Auty, J., Daniels, M. J. D., Colliver, I., Robertson, D. L. & Brough, D. (2018). 'Redefining the ancestral origins of the interleukin-1 superfamily', Nature Communications, 9(1), pp. 1-12. Rock, K. L., Latz, E., Ontiveros, F. & Kono, H. (2010). 'The sterile inflammatory response', Annual review of immunology, 28(3), pp. 321-42. Shi, J., Zhao, Y., Wang, Y., Gao, W., Ding, J., Li, P., Hu, L. & Shao, F. (2014). 'Inflammatory caspases are innate immune receptors for intracellular LPS', Nature, 514(7521), pp. 187-192. Tapia, V. S., Daniels, M. J. D., Palazón-Riquelme, P., Dewhurst, M., Luheshi, N. M., Rivers-Auty, J., Green, J., Redondo-Castro, E., Kaldis, P., Lopez-Castejon, G. & Brough, D. (2019). 'The three cytokines IL-1β, IL-18, and IL-1α share related but distinct secretory routes', Journal of Biological Chemistry, 294, pp. jbc.RA119.008009-jbc.RA119.008009.

108

Trinkle-Mulcahy, L. (2019). 'Recent advances in proximity-based labeling methods for interactome mapping', F1000Research, 8, pp. F1000 Faculty Rev- 135. Waldo, G. S., Standish, B. M., Berendzen, J. & Terwilliger, T. C. (1999). 'Rapid protein-folding assay using green fluorescent protein.', Nat Biotechnol, 17(7), pp. 691-695. Wessendorf, J. H., Garfinkel, S., Zhan, X., Brown, S. & Maciag, T. (1993). 'Identification of a nuclear localization sequence within the structure of the human interleukin-1 alpha precursor', Journal of biological chemistry, 268(29), pp. 22100-4. Wiggins, K. A., Parry, A. J., Cassidy, L. D., Humphry, M., Webster, S. J., Goodall, J. C., Narita, M. & Clarke, M. C. H. (2019). 'IL-1α cleavage by inflammatory caspases of the noncanonical inflammasome controls the senescence- associated secretory phenotype', Aging Cell, 18(3), pp. 1-13. Wolf, A. J., Reyes, C. N., Liang, W., Becker, C., Shimada, K., Wheeler, M. L., Cho, H. C., Popescu, N. I., Coggeshall, K. M., Arditi, M. & Underhill, D. M. (2016). 'Hexokinase is an innate immune receptor for the detection of bacterial peptidoglycan', Cell, 166(3), pp. 624-636. Yin, H., Morioka, H., Towle, C. A., Vidal, M., Watanabe, T. & Weissbach, L. (2001). 'Evidence that HAX-1 is an interleukin-1α N-terminal binding protein', Cytokine, 15(3), pp. 122-137. Zheng, Y., Humphry, M., Maguire, J. J., Bennett, M. R. & Clarke, M. C. H. (2013). 'Intracellular Interleukin-1 Receptor 2 Binding Prevents Cleavage and Activity of Interleukin-1α, Controlling Necrosis-Induced Sterile Inflammation', Immunity, 38(2), pp. 285-295.

109

4.8. Supplementary figures

Figure S4.1 - IL-1 and NLRP3 baits for TID proximity labelling. a, Pro-IL-1α-TID (IL-1α-TID), pro-IL-1β-TID (pIL-1β-TID), mature IL-1β-TID (mIL-1β-TID), NLRP3-TID and TID domains are shown. Calpain and caspase-1 cleavage sites (scissor) and peptide linker are indicated. b, c, HeLa cells were transfected to express the TID constructs or not transfected (NT). 18 h later cells were incubated with vehicle or biotin (500 μM, 1h) and cell lysates were harvested. Lysates were analysed by western blot for TID (anti-BirA) in vehicle treated samples (a), and for biotinylated proteins (streptavidin) in vehicle and biotin treated samples (b). Expected molecular weights of proteins are shown by red arrowheads.

110

Chapter 5. General Discussion

111

5.1. Summary

The cytokines IL-1α and IL-1β are potent mediators of the inflammatory response. Both cytokines activate the IL-1 signalling pathway and usually are referred together as IL-1. However, IL-1α and IL-1β have different expression patterns, sub-cellular localization and mechanisms of activation and secretion. A consequence of these differences is that IL-1α and IL-1β have non-redundant roles in many biological contexts. Most IL-1 research has focused on the mechanisms of inflammasome activation and IL-1β secretion, while the mechanisms that regulate IL-1α signalling remain poorly understood.

The main goal of this thesis was to investigate mechanisms that distinctly regulate IL-1α secretion. Within this main goal, in Chapters 2 - 4 I addressed three specific objectives:

1. Discern similarities and differences of the IL-1α secretory pathway with other cytokines from the IL-1 superfamily. 2. Understand the role of the nuclear localization on IL-1α processing and secretion. 3. Investigate the role of intracellular protein interactions on IL-1α function.

In Chapter 2, I took a comparative approach to evaluate the mechanisms of IL- 1α, IL-1β and IL-18 secretion. I evaluated a range of conditions, including inflammasome activation in mouse and human macrophages, calpain activation in HeLa cells, and development of a SASP-like phenotype in fibroblasts. First, I used membrane stabilising agents to uncouple the role of membrane permeability and cell lysis during inflammasome activation. The release of IL-1β and IL-18 was independent of cell lysis, but associated with membrane permeability. IL-1α release was also independent of cell lysis, but it was not affected by the inhibition of membrane permeability induced by punicalagin. I next assessed the mechanism for IL-1α maturation. As shown previously by other studies, calpain activity was necessary for IL-1α release but not for IL-1β. Moreover, using a reconstituted model in HeLa cells, I provided the first genetic proof that calpain-1 and calpain-2 were necessary for release of mature IL-1α. Finally, I examined the secretion of IL-1α in an alternative model. I found that fibroblasts can secrete IL- 1α without prior stimulus and induce a SASP-like phenotype, and this secretion was not associated with cell lysis. Altogether, these results reveal that cytokines

112 from the IL-1 superfamily can be secreted in the absence of cell death, and IL-1α has an alternative secretory pathway to IL-1β and IL-18.

In Chapter 3, I explored the role of nuclear localization in IL-1α secretion. Previously our research group reported that while the IL-1α pro-domain is highly conserved across species, the NLS is not present in all IL-1α forms (Rivers-Auty et al., 2018). This raised questions on how relevant was the NLS for IL-1α function. I continued working with the model of calpain-dependent IL-1α secretion in HeLa cells, used in Chapter 2. I expressed IL-1α chimeras that had a cytosolic distribution, by fusing mature IL-1α to the pro-domain of IL-1β (β-pro-IL-1α) or to the pro-domain of IL-1α orca (Orca-pro-(h)IL-1α), which naturally lacks an NLS. I discovered that nuclear localization not only inhibits IL-1α release, but also the calpain-dependent processing, adding another degree of inhibition to IL-1α signalling. Interestingly, the substitution of the IL-1α pro-domain induced proteosome degradation and insensitivity to calpain processing, while the lack of NLS had no similar effect. These results suggest that while nuclear localization has an inhibitory role, it is not essential for IL-1α function, and other motifs in the pro-domain could be involved in stability and secretion of IL-1α.

In Chapter 4, I set up a new method to study the IL-1α interactome. Using a proximity labelling approach I was able to purify biotin-labelled proteins that could interact with IL-1α. Now, I expect to identify these interactors by MS analysis. My results in Chapter 3 suggest that rather than the NLS, other motifs in the IL-1α pro-domain could have essential roles on IL-1α stability and processing. Therefore, following the screening of IL-1α interactors, their function in sub- cellular distribution, stability, processing and release of IL-1α will be assessed.

5.2. General discussion

5.2.1. Degrees of IL-1α signalling

Early results in this thesis showed that IL-1 cytokines are released in the absence of cell death. It has been widely accepted that IL-1β is secreted by living cells (hyperactive state) and several mechanisms of secretion have been proposed for non-lytic secretion. On the contrary, the secretion of IL-1α from living cells has been poorly studied. IL-1α has been classified as an alarmin as it is released following necrosis, necroptosis and pyroptosis (Chen et al., 2007; Cohen et al.,

113

2010; Eigenbrod et al., 2008; England et al., 2014; Groß et al., 2012). Despite this, our findings and other studies demonstrate that in addition to its role as an alarmin, IL-1α can be secreted from viable cells. Furthermore, IL-1α secretion from living cells may occurs in several biological contexts, as it has been reported in NLRP3 hyperactive cells (Diamond et al., 2017; Viganò et al., 2015; Wolf et al., 2016), senescent cells (Chan et al., 2020; Wiggins et al., 2019) and coagulation (Burzynski et al., 2019).

The role of IL-1α as an alarmin in the induction of sterile and acute inflammatory responses has been well documented. Studies have shown an IL-1α-dependent infiltration of leukocytes in response to in vivo administration of necrotic cell lysates (Chen et al., 2007; Cohen et al., 2010; Eigenbrod et al., 2008; Rider et al., 2011) or different types of tissue injury (Bersudsky et al., 2014; Burzynski et al., 2019; Cohen et al., 2015; Lugrin et al., 2015). IL-1α has a non-redundant role in these responses, as the inflammation is not regulated, or is regulated at a later stage, by IL-1β. On the contrary to its role as an alarmin, the physiological roles of IL-1α signalling in the absence of cell death are unknown.

It has been suggested that the fate of inflammasome activation in cells, leading to pyroptosis or a hyperactive state, depends on the intensity of the inflammatory stimulus (Lopez-Castejon and Brough, 2011). In fact, hyperactive cells secrete lower and/or slower levels of IL-1β in comparison to cells undergoing pyroptosis (Evavold et al., 2018; Gaidt et al., 2016; Monteleone et al., 2018). Although it has not been evaluated, a similar difference may be observed between necrotic and non-lytic IL-1α secretion. Low levels of inflammatory signals that modulate a local tissue response have been denominated para-inflammation, in opposition to the classic acute inflammatory response that involves leukocyte infiltration (Medzhitov, 2008). As IL-1α is constitutively expressed in many tissues, is possible that non-lytic IL-1α secretion or cell-surface IL-1α could promote a low IL-1 signalling associated with para-inflammation. For example, constitutive expression of IL-1α primes epithelial cells and fibroblasts to have an efficient IFN- γ antiviral response (Hurgin et al., 2007). Similarly, it has been proposed that local IL-1α signalling could regulate an appropriated anti-tumor response (Malik and Kanneganti, 2018).

114

While low levels of IL-1α could have a role on local tissue defence and homeostasis, dysregulation of para-inflammation may be associated with chronic low-grade inflammation and the development of diseases (Medzhitov, 2008). We, and others, have shown that non-lytic IL-1α secretion induces the development of the SASP (Tapia et al., 2019; Wiggins et al., 2019). Cellular senescence involves maladaptive tissue responses, such as aberrant tissue architecture and impaired wound healing (Van Deursen, 2014). Therefore it is possible that in contexts of ageing, IL-1α secretion from senescent cells could induce maladaptive responses.

5.2.2. Mechanisms of IL-1α processing and secretion

The IL-1 field has widely focused in the mechanisms of IL-1β secretion. We currently know how canonical and non-canonical inflammasome activation induces IL-1β processing, and GSDMD-dependent and independent secretory mechanisms have been proposed for IL-1β secretion (Chan and Schroder, 2020). On the contrary, the mechanisms that regulate IL-1α secretion still need to be clarified. In the beginning of this thesis, IL-1α processing was associated to calpain activation by studies using pharmacological inhibitors (Carruth et al., 1991; Groß et al., 2012; Kobayashi et al., 1990b) or to proteases activated in specific biological contexts, such as granzyme B (Afonina et al., 2011). Now, relevant insights have been discovered about the processing of IL-1α. In this thesis I demonstrate that calpain-1 and calpain-2 are necessary for release of mature IL-1α (Tapia et al., 2019), while Clarke and colleagues have also found that caspase-5, caspase-11 and thrombin cleave IL-1α (Burzynski et al., 2019; Wiggins et al., 2019). The identification of IL-1α-activating proteases has given us the current understanding: In response to harmful stimuli, inflammasome- competent cells can cleave IL-1α and IL-1β by interconnected mechanisms involving calcium and potassium imbalance (Figure 1.3 - Introduction). On the contrary, other harmful stimuli will specifically activate IL-1α, such as necrosis inducing calpain activation or tissue injury inducing thrombin activation.

The mechanisms that regulate IL-1α processing in other sterile contexts still awaits for clarification. How IL-1α is activated in senescent cells is unknown. While in our SASP-like model we did not check processing of IL-1α, it has been shown that senescent cells secrete cleaved IL-1α in a caspase-5-dependent

115 manner (Wiggins et al., 2019). It has also been suggested that oxidative stress and calpain activity modulates IL-1 signalling during cellular senescence (Mccarthy et al., 2013). How caspases-5, caspase-11 and calpain may be activated during senescence has yet to be addressed.

Another cellular context that could induce IL-1α activation in living cells is membrane repair. Following formation of membrane pores or damage to the plasma membrane, calcium influx activates programs for membrane repair. During pyroptosis and necroptosis, membrane pores induce calcium influx leading to the activation of the ESCRT-III complex, which shed off damaged plasma membrane (Gong et al., 2017; Rühl et al., 2018). Calcium influx also induces a mechanism of membrane repair mediated by calpain-1 and calpain-2 (Mellgren et al., 2009; Mellgren et al., 2007). It is possible that in these contexts, calcium influx could also induce calpain-dependent IL-1α secretion. In fact, following necroptotic stimuli, cells that remain viable by the ESCRT-III-complex secrete IL-1α and other pro-inflammatory mediators (Gong et al., 2017).

IL-1α secretion from living cells is also a poorly researched process, as the IL-1 field has solely focused on unconventional secretory pathways of IL-1β. Our results with punicalagin inhibition (Tapia et al., 2019) and the discovery of the polybasic motif (Monteleone et al., 2018) suggest that IL-1β and IL-18 share a secretory pathway following inflammasome activation, but IL-1α may be secreted by an alternative mechanism. In a context not associated with inflammasome activation, we and others have shown that IL-1α secretion occurs from fibroblasts that lack GSDMD, and is not associated with an increase in cell lysis (Tapia et al., 2019), membrane permeability or surface IL-1α (Chan et al., 2020). Unconventional secretory pathways for IL-1α still need to be characterized. Two feasible pathways are the secretion from cell-surface IL-1α mediated by extracellular enzymes (Burzynski et al., 2019) and the vesicle-mediated secretory pathway that IL-1α may share with IL-1β (Zhang et al., 2020).

5.3. Experimental considerations and future prospects

5.3.1. Insights in IL-1 secretion

Punicalagin was previously found to inhibit membrane permeability and IL-1β secretion, since then it has been widely used to inhibit IL-1β release in pyroptotic

116 and hyperactive cells (Martín-Sánchez et al., 2016; Monteleone et al., 2018; Saeki et al., 2020; Semino et al., 2018). In this thesis we found that punicalagin inhibits IL-18 release but has no effect on mature IL-1α (Tapia et al., 2019). A recent study also reported inhibition of IL-37 release by punicalagin (Gritsenko et al., 2020). Altogether these studies suggest that IL-1β, IL-18 and IL-37 share a similar secretory pathway.

While studies using punicalagin correlate the secretion of cytokines and membrane permeability, a critical analysis should consider that the mechanism of action of punicalagin is unknown. The effects of punicalagin are similar to the phenotype observed by knocking out GSDMD, in that IL-1β secretion and membrane permeability are inhibited but canonical inflammasome activation is not affected (He et al., 2015; Shi et al., 2015). Similarly, IL-18 and IL-37 secretion have a similar phenotype in punicalagin-treated and GSDMD-KO cells (Gritsenko et al., 2020). Punicalagin stabilises lipids in the plasma membrane during inflammasome activation (Martín-Sánchez et al., 2016), therefore it is possible that punicalagin inhibits the formation or function of GSDMD pores in the plasma membrane. However, punicalagin also inhibits the GSDMD-independent slow secretion of IL-1β (Monteleone et al., 2018; Saeki et al., 2020). It is not clear if this type of secretion involves membrane permeability, but it is promoted by the IL-1β polybasic motif which is required for IL-1β relocation to PIP2-enriched plasma membrane ruffles. As punicalagin stabilises lipids, disruption of the PIP2 interactions could be an alternative mechanism for inhibition of IL-1β secretion. Accordingly, IL-18 contains a polybasic motif while IL-1α does not, which correlates with the effects of punicalagin. Therefore, future research should critically consider how the lipid stabilisation induced by punicalagin may regulate different secretory pathways of IL-1 cytokines.

While our results show that mature IL-1α release is not affected by punicalagin, it is still not clear if IL-1α is secreted through GSDMD pores during inflammasome activation. Mature IL-1α has a similar structure to mature IL-1β, and therefore it could be secreted through the pores. It has been reported that inflammasome- dependent IL-1α secretion is inhibited by knocking out GSDMD (Batista et al., 2020; Evavold et al., 2018), but IL-1α cleavage was not assessed in these studies. This is relevant as GSDMD pores induce calcium influx, and it is possible that inhibition of IL-1α secretion occurred by a lack of calpain processing rather

117 than a direct effect on secretion. As it has been done for IL-1β, Il-18 and IL-37, future studies on IL-1α should compare the effect of punicalagin with GSDMD-KO cells. As GSDMD pores and calpain activation are interconnected by calcium influx, a better approach to study this problem could be IL-1α secretion induced by non-canonical inflammasome activation. In this way, the role of punicalagin and GSDMD pores in the secretion of IL-1α could be tested without affecting the caspase-5-dependent cleavage of IL-1α.

5.3.2. Nuclear localization

Our results suggest that nuclear localization may dampen inflammation by inhibition of IL-1α release and calpain-dependent maturation. How IL-1α is retained in the nucleus is not understood. IL-1α associates with chromatin (Cohen et al., 2010) and its mobility within the nucleus decreases during necrosis and apoptosis (Cohen et al., 2010; Luheshi et al., 2009a). It is possible that changes in chromatin organization observed during cell death could be a key process for IL-1α nuclear sequestration. However, programmed cell deaths have different levels of chromatin condensation. While apoptotic cells undergo a full nuclear condensation, cells undergoing necroptosis and pyroptosis have moderate levels of chromatin condensation, and in a contrary situation, neutrophils release their chromatin fibres during NETosis (Tang et al., 2019). In accordance with this, it has been shown that IL-1α signalling is reduced in apoptotic cells compared to necrotic cells (Cohen et al., 2010). Moreover, senescent cells can lose the integrity of the nuclear envelope, and chromatin fragments can be released into the cytosol (Dou et al., 2017; Ivanov et al., 2013). Therefore, the relevance of IL-1α nuclear sequestration may depend on the cellular context. We induced a calpain-dependent secretion of IL-1α to evaluate the role of nuclear localization. The cell death occurring alongside IL-1α release was not characterized, and further analysis should check if nuclear sequestration occurs at a similar extent in other relevant contexts, such as inflammasome activation, necroptosis and senescence.

5.3.3. Pro-domain selectivity

The insensitivity of the chimera β-pro-IL-1α to ionomycin-induced processing and release suggests the IL-1α pro-domain is necessary for calpain-dependent

118 cleavage. This phenotype is similar to a recent report of caspase-4/11 insensitivity when GSDMD lacks its C-terminal domain (pro-domain) (Wang et al., 2020). Previously it was thought that GSDMD processing was exclusively dependent on its cleavage site. Caspases generally recognize a tetrapeptide motif (XXXD) in the substrate and cleave after the aspartate (Poreba et al., 2013), and the catalytic domains of inflammatory caspases-1/4/11 bind and cleave the tetrapeptide FLTD in GSDMD (Yang et al., 2018). This was challenged by two studies showing that active caspases-1/4/11 recognise the GSDMD C- terminal domain, and this interaction is necessary and sufficient for GSDMD cleavage (Liu et al., 2020; Wang et al., 2020).

Our results suggest a similar recognition mechanism for calpain-mediated IL-1α processing. Moreover, there is clearly some degree of specificity on IL-1 processing by inflammatory caspases. While GSDMD is cleaved by caspases- 1/4/5/8/11 (Kayagaki et al., 2015; Orning et al., 2018; Shi et al., 2015), IL-1β is only cleaved by caspases-1/8 (Cerretti et al., 1992; Maelfait et al., 2008) and IL- 1α is only cleaved by caspases-5/11 (Wiggins et al., 2019). Therefore, the pro- domains of IL-1α and IL-1β could have a role in the recognition by proteases. On other hand, it is possible that the calpain insensitivity we observed in β-pro-IL-1α was caused by protein instability, as the protein was degraded by the proteosome. Future studies using chimeras of IL-1α and IL-1β, or constructs with partially deleted pro-domains, should evaluate if calpain, caspase-1, and capase- 5/11 processing are mediated by recognition of IL-1 pro-domains.

5.3.4. IL-1α interactors

I discovered that the lack of NLS in the orca IL-1α pro-domain promotes cytosolic localization. Interestingly, the orca pro-domain is highly conserved despite the loss of NLS (Rivers-Auty et al., 2018). This suggests that the IL-1α pro-domain must have relevant protein interactions in the cytosol. Most of IL-1α protein interactions have been associated to nuclear functions, such as regulation of transcription (Buryskova et al., 2004; Zamostna et al., 2012), RNA splicing, apoptosis regulation (Pollock et al., 2003) and growth inhibition (Hu et al., 2003). The only non-nuclear protein that has been reported to interact with IL1-α pro- domain is HAX1. While HAX1 has been suggested to promote nuclear localization of IL-1α (Kawaguchi et al., 2006), this could not be a conserved

119 function in orca IL-1α. Our results suggest that the IL-1α pro-domain may be necessary for calpain-processing induced by calcium influx. HAX-1 directly binds to calcium (Balcerak et al., 2017), has calcium-dependent protein interactions (Hirasaka et al., 2016) and regulates calcium signalling from the ER and mitochondria (Simmen, 2011), therefore future analysis should check if HAX1 is involved in calcium-induced processing and secretion of IL-1α.

While HAX1 is an interesting target to study, in this thesis I decided to go for an unbiased approach and screen the IL-1α interactome with a novel technique. I set up a protocol for purification of proximity labelled proteins, which will be screened by MS analysis. The TID-based proximity labelling method give us several advantages in comparison to classic methods to study protein interactions: The screening will be performed in more physiological conditions, we may detect low affinity protein interactions missed by previous methods, and labelling for a short length of time will allow us to detect transient interactions occurring during the processing and secretion of IL-1α. Following the screening, we will select several candidates to study their function in sub-cellular distribution, stability, processing and secretion of IL-1α. The candidates will be tested by transient expression or knock downs in our already established models of HeLa cells and development of SASP. As our results suggest that the pro-domain could have novel non-nuclear functions, we expect to find new regulatory mechanisms that control IL-1α secretion.

5.4. Concluding remarks

The work in this thesis offers new insights into several aspects that regulate IL-1α function. These results will aid future research focused in the secretion of IL-1α from viable cells and in discovering new regulatory mechanisms of IL-1α processing and secretion. Specifically, I have:

- Demonstrated that IL-1α, IL-1β and IL-18 can be secreted in absence of cell lysis, and that IL-1β and IL-18 share a secretory pathway not associated to IL-1α. - Discovered that nuclear localization not only sequesters IL-1α, but also inhibits the IL-1α cleavage. - Found evidence suggesting new roles for the IL-1α pro-domain, and set up a method to screen new functions of IL-1α interactors.

120

Chapter 6. General Bibliography

Acosta, J. C., Banito, A., Wuestefeld, T., Georgilis, A., Janich, P., Morton, J. P., Athineos, D., Kang, T. W., Lasitschka, F., Andrulis, M., Pascual, G., Morris, K. J., Khan, S., Jin, H., Dharmalingam, G., Snijders, A. P., Carroll, T., Capper, D., Pritchard, C., Inman, G. J., Longerich, T., Sansom, O. J., Benitah, S. A., Zender, L. & Gil, J. (2013). 'A complex secretory program orchestrated by the inflammasome controls paracrine senescence', Nature Cell Biology, 15(8), pp. 978-990. Afonina, I. S., Tynan, G. A., Logue, S. E., Cullen, S. P., Bots, M., Lüthi, A. U., Reeves, E. P., McElvaney, N. G., Medema, J. P., Lavelle, E. C. & Martin, S. J. (2011). 'Granzyme B-dependent proteolysis acts as a switch to enhance the proinflammatory activity of IL-1α', Molecular Cell, 44(2), pp. 265-278. Aglietti, R. A., Estevez, A., Gupta, A., Gonzalez, M., Liu, P. S. & Kayagaki, N. (2016). 'GsdmD p30 elicited by caspase-11 during pyroptosis forms pores in membranes', Proceedings of the National Academy of Sciences, 113(28), pp. 7858-7863. Agostini, L., Martinon, F., Burns, K., McDermott, M. F., Hawkins, P. N. & Tschopp, J. (2004). 'NALP3 forms an IL-1β-processing inflammasome with increased activity in Muckle-Wells autoinflammatory disorder', Immunity, 20. Ainscough, J. S., Frank Gerberick, G., Zahedi-Nejad, M., Lopez-Castejon, G., Brough, D., Kimber, I. & Dearman, R. J. (2014). 'Dendritic cell IL-1alpha and IL- 1beta are polyubiquitinated and degraded by the proteasome', J Biol Chem, 289(51), pp. 35582-92. Alexiou, P., Chatzopoulou, M., Pegklidou, K. & Demopoulos, V. J. (2010). 'RAGE: a multi-ligand receptor unveiling novel insights in health and disease', Curr Med Chem, 17(21), pp. 2231-2252. Andersson, U. & Tracey, K. J. (2011). 'HMGB1 is a therapeutic target for sterile inflammation and infection', Annual Review of Immunology, 29, pp. 139-162. Andrei, C., Dazzi, C., Lotti, L., Torrisi, M. R., Chimini, G. & Rubartelli, A. (1999). 'The secretory route of the leaderless protein interleukin 1β involves exocytosis of endolysosome-related vesicles', Molecular biology of the cell, 10(May), pp. 1463- 1475. Andrei, C., Margiocco, P., Poggi, A., Lotti, L. V., Torrisi, M. R. & Rubartelli, A. (2004). 'Phospholipases C and A2 control lysosome-mediated IL-1 secretion: Implications for inflammatory processes', Proceedings of the National Academy of Sciences, 101(26), pp. 9745-9750. Bailly, S., Fay, M., Israël, N. & Gougerot-Pocidalo, M. A. (1996). 'The transcription factor AP-1 binds to the human interleukin 1 alpha promoter', european cytokine network, 7(2), pp. 125-128. Balcerak, A., Rowinski, S., Szafron, L. M. & Grzybowska, E. A. (2017). 'The calcium binding properties and structure prediction of the Hax-1 protein', Acta Biochimica Polonica, 64(3), pp. 537-542. Baldwin, A. G., Brough, D. & Freeman, S. (2016). 'Inhibiting the Inflammasome: A Chemical Perspective', Journal of Medicinal Chemistry, 59(5), pp. 1691-1710.

121

Baroja-Mazo, A., Martín-Sánchez, F., Gomez, A. I., Martínez, C. M., Amores- Iniesta, J., Compan, V., Barberà-Cremades, M., Yagüe, J., Ruiz-Ortiz, E., Antón, J., Buján, S., Couillin, I., Brough, D., Arostegui, J. I. & Pelegrín, P. (2014). 'The NLRP3 inflammasome is released as a particulate danger signal that amplifies the inflammatory response', Nature Immunology, 15 VN - r(8), pp. 738-748. Batista, S. J., Still, K. M., Johanson, D., Thompson, J. A., OʼBrien, C. A., Lukens, J. R. & Harris, T. H. (2020). 'Gasdermin-D-dependent IL-1α release from microglia promotes protective immunity during chronic Toxoplasma gondii infection', Nature Communications, 11, p. 3687. Bauernfeind, F., Bartok, E., Rieger, A., Franchi, L., Núñez, G. & Hornung, V. (2011). 'Cutting edge: reactive oxygen species inhibitors block priming, but not activation, of the NLRP3 inflammasome', Journal of immunology, 187(2), pp. 613- 617. Bauernfeind, F., Horvath, G., Stutz, A., Alnemri, E. S., Speert, D., Fernandes- alnemri, T., Wu, J., Brian, G., Fitzgerald, K. A., Hornung, V. & Latz, E. (2009). 'NF-kB activating pattern recognition and cytokine receptors license NLRP3 inflammasome activation by regulating NLRP3 expression', Journal of immunology, 183(2), pp. 787-791. Bersudsky, M., Luski, L., Fishman, D., White, R. M., Ziv-Sokolovskaya, N., Dotan, S., Rider, P., Kaplanov, I., Aychek, T., Dinarello, C. A., Apte, R. N. & Voronov, E. (2014). 'Non-redundant properties of IL-1alpha and IL-1beta during acute colon inflammation in mice', Gut, 63(4), pp. 598-609. Beuscher, H. U., Nickells, M. W. & Colten, H. R. (1988). 'The precursor of interleukin-1α is phosphorylated at residue serine 90', The Journal of Biological Chemistry, 263(8), pp. 4023-4028. Bianco, F., Perrotta, C., Novellino, L., Francolini, M., Riganti, L., Menna, E., Saglietti, L., Schuchman, E. H., Furlan, R., Clementi, E., Matteoli, M. & Verderio, C. (2009). 'Acid sphingomyelinase activity triggers microparticle release from glial cells', The EMBO Journal, 28(8), pp. 1043-1054. Bianco, F., Pravettoni, E., Colombo, A., Schenk, U., Moller, T., Matteoli, M. & Verderio, C. (2005). 'Astrocyte-derived ATP induces vesicle shedding and IL-1 release from microglia', The Journal of Immunology, 174(11), pp. 7268-7277. Black, R. A., Kronheim, S. R., Cantrell, M., Deeley, M. C., March, C. J., Prickett, K. S., Wignall, K., Conlon, P. J., Cosman, D., Hopp, T. P. & Mochizuki, D. Y. (1988). 'Generation of biologically active interleukin-1 beta by proteolytic cleavage of the inactive precursor', The Journal of Biological Chemistry, 263(19), pp. 9437-9442. Blander, J. M. (2014). 'A long-awaited merger of the pathways mediating host defence and programmed cell death', Nat Rev Immunol, 14(9), pp. 601-18. Boutin, H., LeFeuvre, R. a., Horai, R., Asano, M., Iwakura, Y. & Rothwell, N. J. (2001). 'Role of IL-1alpha and IL-1beta in ischemic brain damage', The Journal of neuroscience : the official journal of the Society for Neuroscience, 21(15), pp. 5528-5534. Boyden, E. D. & Dietrich, W. F. (2006). 'Nalp1b controls mouse macrophage susceptibility to anthrax lethal toxin', Nature genetics, 38, pp. 240–244.

122

Brody, D. T. & Durum, S. K. (1989). 'Membrane IL-1: IL-1alpha precursor binds to the plasma membrane via a lectin-like interaction', The Journal of Immunology, 143(4), pp. 1183-1187. Brough, D. & Rothwell, N. J. (2007). 'Caspase-1-dependent processing of prointerleukin-1beta is cytosolic and precedes cell death', J Cell Sci, 120(Pt 5), pp. 772-81. Broz, P. & Dixit, V. M. (2016). 'Inflammasomes: mechanism of assembly, regulation and signalling', Nature Reviews Immunology, 16(7), pp. 407-420. Broz, P., Pelegrin, P. & Shao, F. (2020). 'The gasdermins, a protein family executing cell death and inflammation', Nat Rev Immunol, 20(3), pp. 143-157. Brubaker, S. W., Bonham, K. S., Zanoni, I. & Kagan, J. C. (2015). 'Innate immune pattern recognition: a cell biological perspective', Annu Rev Immunol, 33, pp. 257-290. Brydges, S. D., Broderick, L., McGeough, M. D., Pena, C. A., Mueller, J. L. & Hoffman, H. M. (2013). 'Divergence of IL-1, IL-18, and cell death in NLRP3 inflammasomopathies', J Clin Invest, 123(11), pp. 4695-705. Brydges, S. D., Mueller, J. L., McGeough, M. D., Pena, C. A., Misaghi, A., Gandhi, C., Putnam, C. D., Boyle, D. L., Firestein, G. S., Horner, A. A., Soroosh, P., Watford, W. T., O'Shea, J. J., Kastner, D. L. & Hoffman, H. M. (2009). 'Inflammasome-mediated disease animal models reveal roles for innate but not adaptive immunity', Immunity, 30(6), pp. 875-87. Buryskova, M., Pospisek, M., Grothey, A., Simmet, T. & Burysek, L. (2004). 'Intracellular interleukin-1α functionally interacts with histone acetyltransferase complexes', Journal of Biological Chemistry, 279(6), pp. 4017-4026. Burzynski, L. C., Humphry, M., Bennett, M. R. & Clarke, M. C. H. (2015). 'Interleukin-1α activity in necrotic endothelial cells is controlled by caspase-1 cleavage of interleukin-1 receptor-2: Implications for allograft rejection', Journal of Biological Chemistry, 290(41), pp. 25188-25196. Burzynski, L. C., Humphry, M., Pyrillou, K., Wiggins, K. A., Chan, J. N. E., Figg, N., Kitt, L. L., Summers, C., Tatham, K. C., Martin, P. B., Bennett, M. R. & Clarke, M. C. H. (2019). 'The coagulation and immune systems are directly linked through the activation of interleukin-1α by thrombin', Immunity, 50(4), pp. 1033- 1042.e6. Caffrey-Carr, A. K., Kowalski, C. H., Beattie, S. R., Blaseg, N. A., Upshaw, C. R., Thammahong, A., Lust, H. E., Tang, Y. W., Hohl, T. M., Cramer, R. A. & Obar, J. J. (2017). 'Interleukin 1 alpha is critical for resistance against highly virulent Aspergillus fumigatus isolates', Infect Immun, 85(12). Carruth, L. M., Demczuk, S. & Mizel, S. B. (1991). 'Involvement of a calpain-like protease in the processing of the murine interleukin la precursor', Journal of Biological Chemistry, 266(19), pp. 12162-12167. Cavalli, G. & Dinarello, C. A. (2015). 'Treating rheumatological diseases and co- morbidities with interleukin-1 blocking therapies', Rheumatology (Oxford), 54(12), pp. 2134-44. Cerretti, D. P., Kozlosky, C. J., Mosley, B., Nelson, N., Van Ness, K., Greenstreet, T. A., March, C. J., Kronheim, S. R., Druck, T., Cannizzaro, L. A.,

123

Huebner, K. & Black, R. A. (1992). 'Molecular cloning of the interleukin-1 beta converting enzyme', Science, 256(5053), pp. 97-100. Chan, A. H. & Schroder, K. (2020). 'Inflammasome signaling and regulation of interleukin-1 family cytokines', The Journal of experimental medicine, 217(1), pp. 1-10. Chan, J., Atianand, M., Jiang, Z., Carpenter, S., Aiello, D., Elling, R., Fitzgerald, K. A. & Caffrey, D. R. (2015). 'A natural antisense transcript, AS-IL1α, controls inducible transcription of the proinflammatory cytokine IL-1α', Journal of immunology, 195(4), pp. 1359-63. Chan, J. N. E., Humphry, M., Kitt, L., Krzyzanska, D., Filbey, K. J., Bennett, M. R. & Clarke, M. C. H. (2020). 'Cell surface IL-1alpha trafficking is specifically inhibited by interferon-gamma, and associates with the membrane via IL-1R2 and GPI anchors', Eur J Immunol. Chaplin, D. D. (2010). 'Overview of the immune response', J Allergy Clin Immunol, 125, pp. S3-23. Chen, C. J., Kono, H., Golenbock, D., Reed, G., Akira, S. & Rock, K. L. (2007). 'Identification of a key pathway required for the sterile inflammatory response triggered by dying cells', Nat Med, 13(7), pp. 851-6. Chen, G. Y. & Nunez, G. (2010). 'Sterile inflammation: sensing and reacting to damage', Nat Rev Immunol, 10(12), pp. 826-37. Chen, J. & Chen, Z. J. (2018). 'PtdIns4P on dispersed trans-Golgi network mediates NLRP3 inflammasome activation', Nature, 564(7734), pp. 71-76. Chen, K. W., Groß, C. J., Sotomayor, F., Stacey, K. J., Tschopp, J., Sweet, M. J. & Schroder, K. (2014). 'The neutrophil NLRC4 inflammasome selectively promotes IL-1β maturation without pyroptosis during acute Salmonella challenge', Cell Reports, 8(2), pp. 570-582. Chen, K. W., Monteleone, M., Boucher, D., Sollberger, G., Ramnath, D., Condon, N. D., Von Pein, J. B., Sweet, M. J. & Schroder, K. (2018). 'Noncanonical inflammasome signaling elicits gasdermin D–dependent neutrophil extracellular traps', Science immunology, 3(6), p. eaar6676. Childs, B. G., Baker, D. J., Kirkland, J. L., Campisi, J. & van Deursen, J. M. (2014). 'Senescence and apoptosis: dueling or complementary cell fates?', EMBO reports, 15(11), pp. 1139-1153. Chowdhury, D. & Lieberman, J. (2008). 'Death by a thousand cuts: granzyme pathways of programmed cell death', Annu Rev Immunol, 26, pp. 389-420. Chu, L. H., Indramohan, M., Ratsimandresy, R. A., Gangopadhyay, A., Morris, E. P., Monack, D. M., Dorfleutner, A. & Stehlik, C. (2018). 'The oxidized phospholipid oxPAPC protects from septic shock by targeting the non-canonical inflammasome in macrophages', Nat Commun, 9(1), p. 996. Clancy, D. M., Sullivan, G. P., Moran, H. B. T., Henry, C. M., Reeves, E. P., McElvaney, N. G., Lavelle, E. C. & Martin, S. J. (2018). 'Extracellular neutrophil proteases are efficient regulators of IL-1, IL-33, and IL-36 cytokine activity but poor effectors of microbial killing', Cell Rep, 22(11), pp. 2937-2950. Cohen, I., Rider, P., Carmi, Y., Braiman, A., Dotan, S., White, M. R., Voronov, E., Martin, M. U., Dinarello, C. A. & Apte, R. N. (2010). 'Differential release of chromatin-bound IL-1 discriminates between necrotic and apoptotic cell death by

124 the ability to induce sterile inflammation', Proceedings of the National Academy of Sciences, 107(6), pp. 2574-2579. Cohen, I., Rider, P., Vornov, E., Tomas, M., Tudor, C., Wegner, M., Brondani, L., Freudenberg, M., Mittler, G., Ferrando-May, E., Dinarello, C. A., Apte, R. N. & Schneider, R. (2015). 'IL-1α is a DNA damage sensor linking genotoxic stress signaling to sterile inflammation and innate immunity', Scientific Reports, 5(October), pp. 1-12. Colotta, F., Re, F., Muzio, M., Bertini, R., Polentarutti, N., Sironi, M., Giri, J. G., Dower, S. K., Sims, J. E. & Mantovani, A. (1993). 'Interleukin-1 type II receptor: a decoy target for IL-1 that is regulated by IL-4', Science, 261(5120), pp. 472-475. Cullen, S. P., Kearney, C. J., Clancy, D. M. & Martin, S. J. (2015). 'Diverse activators of the NLRP3 inflammasome promote IL-1β secretion by triggering necrosis', Cell Reports, 11(10), pp. 1535-1548. Cullinan, E. B., Kwee, L., Nunes , P., Shuster, D. J., Jun , G., McIntyre, K. W., Chizzonite, R. A. & Labow, M. A. (1998). 'IL-1 receptor accessory protein is an essential component of the IL-1 Receptor', Journal of Immunology, 161(10), pp. 5614-5620. Daniels, M. J. D., Adamson, A. D. & Humphreys, N. B., David (2017). 'CRISPR/Cas9 mediated mutation of mouse IL-1α nuclear localisation sequence abolishes expression', Sci Rep, 7(1), p. 17077. Daniels, M. J. D. & Brough, D. (2017). 'Unconventional pathways of secretion contribute to inflammation', International Journal of Molecular Sciences, 18(1). Darveau, R. P. (1998). 'Lipid A diversity and the innate host response to bacterial infection', Current opinion in microbiology, 1(1), pp. 36-42. Davis, M. A., Fairgrieve, M. R., Den Hartigh, A., Yakovenko, O., Duvvuri, B., Lood, C., Thomas, W. E., Fink, S. L. & Gale, M. (2019). 'Calpain drives pyroptotic vimentin cleavage, intermediate filament loss, and cell rupture that mediates immunostimulation', Proceedings of the National Academy of Sciences of the United States of America, 116(11), pp. 5061-5070. de Torre-Minguela, C., Mesa del Castillo, P. & Pelegrín, P. (2017). 'The NLRP3 and pyrin inflammasomes: Implications in the pathophysiology of autoinflammatory diseases', Front Immunol, 8. de Vasconcelos, N. M., Van Opdenbosch, N., Van Gorp, H., Parthoens, E. & Lamkanfi, M. (2018). 'Single-cell analysis of pyroptosis dynamics reveals conserved GSDMD-mediated subcellular events that precede plasma membrane rupture', Cell Death & Differentiation, pp. 1-1. Denes, A., Coutts, G., Lénárt, N., Cruickshank, S. M., Pelegrin, P., Skinner, J., Rothwell, N., Allan, S. M. & Brough, D. (2015). 'AIM2 and NLRC4 inflammasomes contribute with ASC to acute brain injury independently of NLRP3', Proceedings of the National Academy of Sciences of the United States of America, 112(13), pp. 4050-5. Diamond, C. E., Leong, K. W. K., Vacca, M., Rivers-Auty, J., Brough, D. & Mortellaro, A. (2017). 'Salmonella typhimurium-induced IL-1 release from primary human monocytes requires NLRP3 and can occur in the absence of pyroptosis', Scientific Reports, 7(1), pp. 1-9.

125

Dinarello, C. A. (2009). 'Immunological and inflammatory functions of the Interleukin-1 family', Annual review of immunology, 27, pp. 519-550. Dinarello, C. A. (2013). 'Overview of the interleukin-1 family of ligands and receptors ', Seminars in immunology, 25(6), pp. 389-393. Dinarello, C. A., Simon, A. & van der Meer, J. W. (2012). 'Treating inflammation by blocking interleukin-1 in a broad spectrum of diseases', Nat Rev Drug Discov, 11(8), pp. 633-52. Ding, J., Wang, K., Liu, W., She, Y., Sun, Q., Shi, J., Sun, H., Wang, D.-c. & Shao, F. (2016). 'Pore-forming activity and structural autoinhibition of the gasdermin family', Nature, 535, pp. 111-116. Dombrowski, Y., Peric, M., Koglin, S., Kammerbauer, C., Göss, C., Anz, D., Simanski, M., Gläser, R., Harder, J., Hornung, V., Gallo, R. L., Ruzicka, T., Besch, R. & Schauber, J. (2011). 'Cytosolic DNA triggers inflammasome activation in keratinocytes in psoriatic lesions', Sci Transl Med, 3(82), p. 82ra38. Dou, Z., Ghosh, K., Vizioli, M. G., Zhu, J., Sen, P., Wangensteen, K. J., Simithy, J., Lan, Y., Lin, Y., Zhou, Z., Capell, B. C., Xu, C., Xu, M., Kieckhaefer, J. E., Jiang, T., Shoshkes-Carmel, M., Tanim, K., Barber, G. N., Seykora, J. T., Millar, S. E., Kaestner, K. H., Garcia, B. A., Adams, P. D. & Berger, S. L. (2017). 'Cytoplasmic chromatin triggers inflammation in senescence and cancer', Nature, 550(7676), pp. 402-406. Duong, B. H., Onizawa, M., Oses-Prieto, J. A., Advincula, R., Burlingame, A., Malynn, B. A. & Ma, A. (2015). 'A20 restricts ubiquitination of pro-interleukin- 1beta protein complexes and suppresses NLRP3 inflammasome activity', Immunity, 42(1), pp. 55-67. Dupont, N., Jiang, S., Pilli, M., Ornatowski, W., Bhattacharya, D. & Deretic, V. (2011). 'Autophagy-based unconventional secretory pathway for extracellular delivery of IL-1β', The EMBO Journal, 30(23), pp. 4701-4711. Edgeworth, J. D., Spencer, J., Phalipon, A., Griffin, G. E. & Sansonetti, P. J. (2002). 'Cytotoxicity and interleukin-1β processing following Shigella flexneri infection of human monocyte-derived dendritic cells', European Journal of Immunology, 32, pp. 1464-1471. Eigenbrod, T., Park, J.-H., Harder, J., Iwakura, Y. & Núñez, G. (2008). 'Critical role for mesothelial cells in necrosis-induced inflammation through the recognition of IL-1α released from dying cells', The Journal of Immunology, 181(12), pp. 8194–8198. El Sayed, H., Kerensky, R., Stecher, M., Mohanty, P. & Davies, M. (2016). 'A randomized phase II study of Xilonix, a targeted therapy against interleukin 1α, for the prevention of superficial femoral artery restenosis after percutaneous revascularization', J Vasc Surg, 63(1), pp. 133-41.e1. Eldridge, M. J. G., Sanchez-Garrido, J., Hoben, G. F., Goddard, P. J. & Shenoy, A. R. (2017). 'The Atypical Ubiquitin E2 Conjugase UBE2L3 Is an Indirect Caspase-1 Target and Controls IL-1β Secretion by Inflammasomes', Cell Reports, 18(5), pp. 1285-1297. Eming, S. a., Hammerschmidt, M., Krieg, T. & Roers, A. (2009). 'Interrelation of immunity and tissue repair or regeneration', Seminars in cell & developmental biology, 20(5), pp. 517-27.

126

England, H., Summersgill, H. R., Edye, M. E., Rothwell, N. J. & Brough, D. (2014). 'Release of interleukin-1α or interleukin-1β depends on mechanism of cell death', Journal of Biological Chemistry, 289(23), pp. 15942-15950. Evavold, C. L., Ruan, J., Tan, Y., Xia, S., Wu, H. & Kagan, J. C. (2018). 'The pore-forming protein gasdermin D regulates interleukin-1 secretion from living macrophages', Immunity, 48(1), pp. 35-44 e6. Fadeel, B. & Grzybowska, E. (2009). 'HAX-1: A multifunctional protein with emerging roles in human disease', Biochimica et Biophysica Acta - General Subjects, 1790(10), pp. 1139-1148. Fang, R., Wu, R., Du, H., Jin, M., Liu, Y., Lei, G., Jiang, B., Lei, Z., Peng, Y., Nie, K. & Tsuchiya, K. (2017). 'Pneumolysin-dependent calpain activation and interleukin-1a secretion in macrophages infected with Streptococcus pneumoniae', Infection and Immunity, 85(9), pp. 1-11. Fanslow, W. C., Sims, J. E., Sassenfield, H., Morrissey, P. J., Gillis, S., Dower, S. K. & Widmer, M. B. (1990). 'Regulation of alloreactivity in vivo by a soluble form of the interleukin-1 receptor', Science, 248(4956), pp. 739-742. Feist, E. & Burmeste, G. R. (2010). 'Canakinumab for treatment of cryopyrin- associated periodic syndrome', Expert Opin Biol Ther, 10(11), pp. 1631-1636. Fernandes-Alnemri, T., Kang, S., Anderson, C., Sagara, J., Fitzgerald, K. A. & Alnemri, E. S. (2013). 'TLR signaling licenses IRAK1 for rapid activation of the NLRP3 inflammasome', Journal of immunology, 191(8), pp. 3995–3999. Fernandes-Alnemri, T., Yu, J.-W., Datta, P., Wu, J. & Alnemri, E. S. (2009). 'AIM2 activates the inflammasome and cell death in response to cytoplasmic DNA', Nature, 458(7237), pp. 509-513. Fettelschoss, A., Kistowska, M., LeibundGut-Landmann, S., Beer, H. D., Johansen, P., Senti, G., Contassot, E., Bachmann, M. F., French, L. E., Oxenius, A. & Kundig, T. M. (2011). 'Inflammasome activation and IL-1 target IL-1 for secretion as opposed to surface expression', Proceedings of the National Academy of Sciences, 108(44), pp. 18055-18060. Fields, J. K., Günther, S. & Sundberg, E. J. (2019). 'Structural basis of IL-1 family cytokine signaling', Frontiers in Immunology, 10(JUN), pp. 1-20. Fink, S. L. & Cookson, B. T. (2006). 'Caspase-1-dependent pore formation during pyroptosis leads to osmotic lysis of infected host macrophages', Cellular Microbiology, 8(11), pp. 1812-1825. Franchi, L., Eigenbrod, T. & NúÑez, G. (2009). 'TNF-α mediate sensitization to ATP and silica via the NLRP3 inflammasome in the absence of microbial stimulation', Journal of immunology, 183(2), pp. 792-796. Franklin, B. S., Bossaller, L., De Nardo, D., Ratter, J. M., Stutz, A., Engels, G., Brenker, C., Nordhoff, M., Mirandola, S. R., Al-Amoudi, A., Mangan, M. S., Zimmer, S., Monks, B. G., Fricke, M., Schmidt, R. E., Espevik, T., Jones, B., Jarnicki, A. G., Hansbro, P. M., Busto, P., Marshak-Rothstein, A., Hornemann, S., Aguzzi, A., Kastenmuller, W. & Latz, E. (2014). 'The adaptor ASC has extracellular and 'prionoid' activities that propagate inflammation', Nat Immunol, 15(8), pp. 727-37. Gabay, C., Lamacchia, C. & Palmer, G. (2010). 'IL-1 pathways in inflammation and human diseases', Nat Rev Rheumatol, 6(4), pp. 232-41.

127

Gaidt, M. M., Ebert, T. S., Chauhan, D., Schmidt, T., Schmid-Burgk, J. L., Rapino, F., Robertson, A. A. B., Cooper, M. A., Graf, T. & Hornung, V. (2016). 'Human Monocytes Engage an Alternative Inflammasome Pathway', Immunity, 44(4), pp. 833-846. Gardner, S. E., Humphry, M., Bennett, M. R. & Clarke, M. C. H. (2015). 'Senescent vascular smooth muscle cells drive inflammation through an interleukin-1α-dependent senescence-associated secretory phenotype', Arteriosclerosis, Thrombosis, and Vascular Biology, 35(9), pp. 1963-1974. Garfinkel, S., Brown, S., Wessendorf, J. H. M. & Maciag, T. (1994). 'Post- transcriptional regulation of interleukin 1α in various strains of young and senescent human umbilical vein endothelial cells', Proc Natl Acad Sci U S A, 91, pp. 1559-1563. Garlanda, C., Dinarello, C. A. & Mantovani, A. (2013). 'The interleukin-1 family: back to the future', Immunity, 39(6), pp. 1003-18. Gillespie, J., Mathews, R. & McDermott, M. F. (2010). 'Rilonacept in the management of cryopyrin-associated periodic syndromes (CAPS)', J Inflamm Res, 3, pp. 1-8. Goll, D. E., Thompson, V. F., Li, H., Wei, W. & Cong, J. (2003). 'The calpain system', Physiological Reviews, 83(3), pp. 731-801. Gong, Y. N., Guy, C., Olauson, H., Becker, J. U., Yang, M., Fitzgerald, P., Linkermann, A. & Green, D. R. (2017). 'ESCRT-III acts downstream of MLKL to regulate necroptotic cell death and its consequences', Cell, 169(2), pp. 286- 300.e16. Graves, B. J., Hatada, M. H., Hendrickson, W. A., Miller, J. K., Madison, V. S. & Satow, Y. (1990). 'Structure of Interleukin-1α at 2.7-Å resolution', Biochemistry, 29(11), pp. 2679-2684. Gringhuis, S. I., Kaptein, T. M., Wevers, B. A., Theelen, B., van der Vlist, M., Boekhout, T. & Geijtenbeek, T. B. (2012). 'Dectin-1 is an extracellular pathogen sensor for the induction and processing of IL-1beta via a noncanonical caspase-8 inflammasome', Nat Immunol, 13(3), pp. 246-54. Gritsenko, A., Yu, S., Martin-Sanchez, F., Diaz del Olmo, I., Nichols, E.-M., Davis, D. M., Brough, D. & Lopez-Castejon, G. (2020). 'Priming is dispensable for NLRP3 inflammasome activation in human monocytes', bioRxiv. Groß, C. J., Mishra, R., Schneider, K. S., Medard, G., Wettmarshausen, J., Dittlein, D. C., Shi, H., Gorka, O., Koenig, P. A., Fromm, S., Magnani, G., Cikovic, T., Hartjes, L., Smollich, J., Robertson, A. A. B., Cooper, M. A., Schmidt- Supprian, M., Schuster, M., Schroder, K., Broz, P., Traidl-Hoffmann, C., Beutler, B., Kuster, B., Ruland, J., Schneider, S., Perocchi, F. & Groß, O. (2016). 'K+ Efflux-Independent NLRP3 Inflammasome Activation by Small Molecules Targeting Mitochondria', Immunity, 45(4), pp. 761-773. Groß, O., Yazdi, A. S., Thomas, C. J., Masin, M., Heinz, L. X., Guarda, G., Quadroni, M., Drexler, S. K. & Tschopp, J. (2012). 'Inflammasome activators induce Interleukin-1α secretion via distinct pathways with differential requirement for the protease function of Caspase-1', Immunity, 36(3), pp. 388-400. Gurung, P., Fan, G., Lukens, J. R., Vogel, P., Tonks, N. K. & Kanneganti, T. D. (2017). 'Tyrosine Kinase SYK Licenses MyD88 Adaptor Protein to Instigate IL- 1alpha-Mediated Inflammatory Disease', Immunity, 46(4), pp. 635-648.

128

Hanna, R. A., Campbell, R. L. & Davies, P. L. (2008). 'Calcium-bound structure of calpain and its mechanism of inhibition by calpastatin', Nature, 456(7220), pp. 409-412. Hazuda, D. J., Strickler, J., Kueppers, F., Simon, P. L. & Young, P. R. (1990). 'Processing of precursos interleukin 1β and inflammatory disease', The Journal of Biological Chemistry, 265(11), pp. 6318-6322. Hazuda, D. J., Strickler, J., Simon, P. & Young, P. R. (1991). 'Structure-function mapping of interleukin 1 precursors', The Journal of Biological Chemistry, 266(11), pp. 7081-7086. He, W.-t., Wan, H., Hu, L., Chen, P., Wang, X., Huang, Z., Yang, Z.-h., Zhong, C.-q. & Han, J. (2015). 'Gasdermin D is an executor of pyroptosis and required for interleukin-1β secretion', Cell research, 25, pp. 1285-1298. He, Y., Hara, H. & Núñez, G. (2016). 'Mechanism and Regulation of NLRP3 Inflammasome Activation', Trends in Biochemical Sciences, 41(12), pp. 1012- 1021. Heilig, R., Dick, M. S., Sborgi, L., Meunier, E., Hiller, S. & Broz, P. (2018). 'The Gasdermin-D pore acts as a conduit for IL-1β secretion in mice', European Journal of Immunology, 48(4), pp. 584-592. Hirasaka, K., Mills, E. M., Haruna, M., Bando, A., Ikeda, C., Abe, T., Kohno, S., Nowinski, S. M., Lago, C. U., Akagi, K. I., Tochio, H., Ohno, A., Teshima-Kondo, S., Okumura, Y. & Nikawa, T. (2016). 'UCP3 is associated with Hax-1 in mitochondria in the presence of calcium ion', Biochemical and Biophysical Research Communications, 472(1), pp. 108-113. Hiscott, J., Marois, J., Garoufalis, J., D'Addario, M., Roulston, A., Kwan, I., Pepin, N., Lacoste, J., Nguyen, H., Bensi, G. & Fenton, M. (1993). 'Characterization of a functional NF-kappa B site in the human interleukin 1 beta promoter: Evidence for a positive autoregulatory loop', Molecular and cellular biology, 13(10), pp. 6321- 6240. Hogguist, K. A., Unanue, E. R. & Chapplin, D. D. (1990). 'Release of IL-1 from mononuclear phagocytes', Journal of Immunology, 147(7), pp. 2181-2186. Højen, J. F., Kristensen, M. L. V., McKee, A. S., Wade, M. T., Azam, T., Lunding, L. P., de Graaf, D. M., Swartzwelter, B. J., Wegmann, M., Tolstrup, M., Beckman, K., Fujita, M., Fischer, S. & Dinarello, C. A. (2019). 'IL-1R3 blockade broadly attenuates the functions of six members of the IL-1 family, revealing their contribution to models of disease', Nature Immunology, 20(9), pp. 1138-1149. Hornung, V., Ablasser, A., Charrel-Dennis, M., Bauernfeind, F., Horvath, G., Caffrey, D. R., Latz, E. & Fitzgerald, K. A. (2009). 'AIM2 recognizes cytosolic dsDNA and forms a caspase-1-activating inflammasome with ASC', Nature, 458(7237), pp. 514-518. Hotamisligil, G. S. (2006). 'Inflammation and metabolic disorders', Nature, 444(7121), pp. 860-867. Hu, B., Wang, S., Zhang, Y., Feghali, C. A., Dingman, J. R. & Wright, T. M. (2003). 'A nuclear target for interleukin-1α: Interaction with the growth suppressor necdin modulates proliferation and collagen expression', Proceedings of the National Academy of Sciences of the United States of America, 100(17), pp. 10008-10013.

129

Hurgin, V., Novick, D., Werman, A., Dinarello, C. A. & Rubinstein, M. (2007). 'Antiviral and immunoregulatory activities of IFN-γ depend on constitutively expressed IL-1α', PNAS, 104(12), pp. 5044–5049. Imai, Y., Kuba, K., Neely, G. G., Yaghubian-Malhami, R., Perkmann, T., van Loo, G., Ermolaeva, M., Veldhuizen, R., Leung, Y. H. C., Wang, H., Liu, H., Sun, Y., Pasparakis, M., Kopf, M., Mech, C., Bavari, S., Peiris, J. S. M., Slutsky, A. S., Akira, S., Hultqvist, M., Holmdahl, R., Nicholls, J., Jiang, C., Binder, C. J. & Penninger, J. M. (2008). 'Identification of oxidative stress and Toll-like Receptor 4 signaling as a key pathway of acute lung injury', Cell, 133(2), pp. 235-249. Irmler, M., Hertig, S., MacDonald, H. R., Sadoul, R., Becherer, D., Proudfoot, A., Solari, R. & Tschopp, J. (1995). 'Granzyme A is an interleukin 1β-converting enzyme', Journal of Experimental Medicine, 181, pp. 1917-1922. Ivanov, A., Pawlikowski, J., Manoharan, I., van Tuyn, J., Nelson, D. M., Rai, T. S., Shah, P. P., Hewitt, G., Korolchuk, V. I., Passos, J. F., Wu, H., Berger, S. L. & Adams, P. D. (2013). 'Lysosome-mediated processing of chromatin in senescence', J Cell Biol, 202(1), pp. 129-43. Johnson, G. B., Brunn, G. J., Kodaira, Y. & Platt, J. L. (2002). 'Receptor- mediated monitoring of tissue well-being via detection of soluble heparan sulfate by Toll-like receptor', Journal of immunology, 168(10), pp. 5233-5239. Kaplanski, G., Farnarier, C., Kaplanski, S., Porat, R., Shapiro, L., Bongrand, P. & Dinarello, C. A. (1994). 'Interleukin-1 induces interleukin-8 secretion from endothelial cells by a juxtacrine mechanism', Blood, 84(12), pp. 4242-4248. Karikó, K., Ni, H., Capodici, J., Lamphier, M. & Weissman, D. (2004). 'mRNA is an endogenous ligand for Toll-like receptor 3', Journal of Biological Chemistry, 279(13), pp. 12542-12550. Karmakar, M., Katsnelson, M. A., Dubyak, G. R. & Pearlman, E. (2016). 'Neutrophil P2X7 receptors mediate NLRP3 inflammasome-dependent IL-1β secretion in response to ATP', Nature Communications, 7, pp. 10555-10555. Karmakar, M., Minns, M., Greenberg, E. N., Diaz-Aponte, J., Pestonjamasp, K., Johnson, J. L., Rathkey, J. K., Abbott, D. W., Wang, K., Shao, F., Catz, S. D., Dubyak, G. R. & Pearlman, E. (2020). 'N-GSDMD trafficking to neutrophil organelles facilitates IL-1beta release independently of plasma membrane pores and pyroptosis', Nat Commun, 11(1), p. 2212. Kawaguchi, Y., McCarthy, S. A., Watkins, S. C. & Wright, T. M. (2004). 'Autocrine activation by interleukin 1-alpha induces the fibrogenic phenotype of systemic sclerosis fibroblasts', J Rheumatol, 31, pp. 1946-1954. Kawaguchi, Y., Nishimagi, E., Tochimoto, A., Kawamoto, M., Katsumata, Y., Soejima, M., Kanno, T., Kamatani, N. & Hara, M. (2006). 'Intracellular IL-1alpha- binding proteins contribute to biological functions of endogenous IL-1alpha in systemic sclerosis fibroblasts', Proceedings of the National Academy of Sciences of the United States of America, 103(39), pp. 14501-14506. Kayagaki, N., Stowe, I. B., Lee, B. L., O'Rourke, K., Anderson, K., Warming, S., Cuellar, T., Haley, B., Roose-Girma, M., Phung, Q. T., Liu, P. S., Lill, J. R., Li, H., Wu, J., Kummerfeld, S., Zhang, J., Lee, W. P., Snipas, S. J., Salvesen, G. S., Morris, L. X., Fitzgerald, L., Zhang, Y., Bertram, E. M., Goodnow, C. C. & Dixit, V. M. (2015). 'Caspase-11 cleaves gasdermin D for non-canonical inflammasome signalling', Nature, 526(7575), pp. 666-671.

130

Kayagaki, N., Warming, S., Lamkanfi, M., Walle, L. V., Louie, S., Dong, J., Newton, K., Qu, Y., Liu, J., Heldens, S., Zhang, J., Lee, W. P., Roose-Girma, M. & Dixit, V. M. (2011). 'Non-canonical inflammasome activation targets caspase- 11', Nature, 479(7371), pp. 117-121. Kayagaki, N., Wong, M. T., Stowe, I. B., Ramani, S. R., Gonzalez, L. C., Akashi- Takamura, S., Miyake, K., Zhang, J., Lee, W. P., Muszynski, A., Forsberg, L. S., Carlson, R. W. & Dixit, V. M. (2013). 'Noncanonical inflammasome activation by intracellular LPS independent of TLR4', Science, 241(6151). Ketelut-Carneiro, N., Souza, C. O. S., Benevides, L., Gardinassi, L. G., Silva, M. C., Tavares, L. A., Zamboni, D. S. & Silva, J. S. (2019). 'Caspase-11-dependent IL-1alpha release boosts Th17 immunity against Paracoccidioides brasiliensis', PLoS Pathog, 15(8), p. e1007990. Kimura, H., Inukai, Y., Takii, T., Furutani, Y., Shibata, Y., Hayashi, H., Sakurada, S., Okamoto, T., Inoue, J. I., Oomoto, Y. & Onozaki, K. (1998). 'Molecular analysis of constitutive IL-1α gene expression in human melanoma cells: authocrine stimulation through NF-κB activation by endogenous IL-1', Cytokine, 10(11). Kimura, T., Jia, J., Kumar, S., Kimura, T., Won Choi, S., Gu, Y., Mudd, M., Dupont, N., Jiang, S., Peters, R., Farzam, F., Jain, A., Lidke, K. A., Adams, C. M., Johansen, T. & Deretic, V. (2017). 'Dedicated SNAREs and specialized TRIM cargo receptors mediate secretory autophagy', The EMBO journal, 36(1), pp. 42- 60. Kobayashi, Y., Oppenheim, J. J. & Matsushima, K. (1990a). 'Calcium-dependent binding of phosphorylated human pre interleukin 1α to phospholipids', Journal of Biochemistry, 107(5), pp. 666-670. Kobayashi, Y., Yamamoto, K., Saido, T., Kawasaki, H., Oppenheim, J. J. & Matsushima, K. (1990b). 'Identification of calcium-activated neutral protease as a processing enzyme of human interleukin 1 alpha', Proc Natl Acad Sci U S A, 87(14), pp. 5548-5552. Kominato, Y., Galson, D., Waterman, W. R., Webb, A. C. & Auron, P. E. (1995). 'Monocyte expression of the human prointerleukin 1 beta gene (IL1B) is dependent on promoter sequences which bind the hematopoietic transcription factor Spi-1/PU.1', Molecular and Cellular Biology, 15(1), pp. 58-68. Kono, H., Karmarkar, D., Iwakura, Y. & Rock, K. L. (2010). 'Identification of the cellular sensor that stimulates the inflammatory response to sterile cell death', J Immunol, 184(8), pp. 4470-8. Krumm, B., Xiang, Y. & Deng, J. (2014). 'Structural biology of the IL-1 superfamily: Key cytokines in the regulation of immune and inflammatory responses', Protein Science, 23(5), pp. 526-538. Kuhn, P. H., Marjaux, E., Imhof, A., De Strooper, B., Haass, C. & Lichtenthaler, S. F. (2007). 'Regulated intramembrane proteolysis of the interleukin-1 receptor II by alpha-, beta-, and gamma-secretase', Journal of Biological Chemistry, 282, pp. 11982–11995. Kuilman, T., Michaloglou, C., Vredeveld, L. C., Douma, S., van Doorn, R., Desmet, C. J., Aarden, L. A., Mooi, W. J. & Peeper, D. S. (2008). 'Oncogene- induced senescence relayed by an interleukin-dependent inflammatory network', Cell, 133(6), pp. 1019-31.

131

Kumar, S., Millis, A. J. T. & Baglioni, C. (1992). 'Expression of interleukin 1- inducible genes and production of interleukin 1 by aging human fibroblasts', PNAS, 1992, pp. 4683-4787. Kurt-Jones, E. A., Beller, D. I., Mizel, S. B. & Unanue, E. R. (1985). 'Identification of a membrane-associated interleukin 1 in macrophages', Proc Natl Acad Sci U S A, 82, pp. 1204-1208. Laberge, R. M., Sun, Y., Orjalo, A. V., Patil, C. K., Freund, A., Zhou, L., Curran, S. C., Davalos, A. R., Wilson-Edell, K. A., Liu, S., Limbad, C., Demaria, M., Li, P., Hubbard, G. B., Ikeno, Y., Javors, M., Desprez, P. Y., Benz, C. C., Kapahi, P., Nelson, P. S. & Campisi, J. (2015). 'MTOR regulates the pro-tumorigenic senescence-associated secretory phenotype by promoting IL1A translation', Nature Cell Biology, 17(8), pp. 1049-1061. Lamkanfi, M., Sarkar, A., Vande Walle, L., Vitari, A. C., Amer, A. O., Wewers, M. D., Tracey, K. J., Kanneganti, T.-D. & Dixit, V. M. (2010). 'Inflammasome- dependent release of the alarmin HMGB1 in endotoxemia', J Immunol, 185(7), pp. 4385-92. Lange, A., Mills, R. E., Lange, C. J., Stewart, M., Devine, S. E. & Corbett, A. H. (2007). 'Classical nuclear localization signals: definition, function, and interaction with importin alpha', J Biol Chem, 282(8), pp. 5101-5. Larsen, E. K., Weber, D. K., Wang, S., Gopinath, T., Blackwell, D. J., Dalton, M. P., Robia, S. L., Gao, J. & Veglia, G. (2020). 'Intrinsically disordered HAX-1 regulates Ca2+ cycling by interacting with lipid membranes and the phospholamban cytoplasmic region', Biochimica et Biophysica Acta - Biomembranes, 1862(1), pp. 183034-183034. Leadbetter, E. A., Rifkin, I. R., Hohlbaum, A. M., Beaudette, B. C., Shlomchik, M. J. & Marshak-Rothstein, A. (2002). 'Chromatin–IgG complexes activate B cells by dual engagement of IgM and Toll-like receptors', Nature, 461(6881), pp. 603-607. Levinsohn, J. L., Newman, Z. L., Hellmich, K. A., Fattah, R., Getz, M. A., Liu, S., Sastalla, I., Leppla, S. H. & Moayeri, M. (2012). 'Anthrax lethal factor cleavage of Nlrp1 is required for activation of the inflammasome', PLoS Pathog, 8, p. e1002638. Liao, K. C. & Mogridge, J. (2009). 'Expression of Nlrp1b inflammasome components in human fibroblasts confers susceptibility to anthrax lethal toxin', Infect Immun, 77(10), pp. 4455-62. Lin, K.-M., Hu, W., Troutman, T. D., Jennings, M., Brewer, T., Li, X., Nanda, S., Cohen, P., Thomas, J. A. & Pasare, C. (2014). 'IRAK-1 bypasses priming and directly links TLRs to rapid NLRP3 inflammasome activation', PNAS, 111(2), pp. 775–780. Lin, X., Zhang, H., Boyce, B. F. & Xing, L. (2020). 'Ubiquitination of interleukin- 1alpha is associated with increased pro-inflammatory polarization of murine macrophages deficient in the E3 ligase ITCH', J Biol Chem. Liu-Bryan, R., Scott, P., Sydlaske, A., Rose, D. M. & Terkeltaub, R. (2005). 'Innate immunity conferred by Toll-like receptors 2 and 4 and myeloid differentiation factor-88 expression is pivotal to monosodium urate monohydrate crystal-induced inflammation', Arthritis and Rheumatism, 52(9), pp. 2936–1946.

132

Liu, X., Zhang, Z., Ruan, J., Pan, Y., Magupalli, V. G., Wu, H. & Lieberman, J. (2016). 'Inflammasome-activated gasdermin D causes pyroptosis by forming membrane pores', Nature, 535(7610), pp. 153-158. Liu, Z., Wang, C., Yang, J., Chen, Y., Zhou, B., Abbott, D. W. & Xiao, T. S. (2020). 'Caspase-1 engages full-length Gasdermin D through two distinct interfaces that mediate caspase recruitment and substrate cleavage', Immunity, 53(1), pp. 106-114 e5. Lopez-Castejon, G. (2020). 'Control of the inflammasome by the ubiquitin system', FEBS J, 287(1), pp. 11-26. Lopez-Castejon, G. & Brough, D. (2011). 'Understanding the mechanism of IL-1b secretion', Cytokine and Growth Factor Reviews, 22(4), pp. 189-195. Lopez-Castejon, G. & Pelegrin, P. (2012). 'Current status of inflammasome blockers as anti-inflammatory drugs', Expert opinion on investigational drugs, 21(7), pp. 995-1007. Lorenzen, I., Lokau, J., Dusterhoft, S., Trad, A., Garbers, C., Scheller, J., Rose- John, S. & Grotzinger, J. (2012). 'The membrane-proximal domain of A Disintegrin and Metalloprotease 17 (ADAM17) is responsible for recognition of the interleukin-6 receptor and interleukin-1 receptor II', FEBS lett, 586, pp. 1093– 1100. Lugrin, J., Parapanov, R., Rosenblatt-Velin, N., Rignault-Clerc, S., Feihl, F., Waeber, B., Muller, O., Vergely, C., Zeller, M., Tardivel, A., Schneider, P., Pacher, P. & Liaudet, L. (2015). 'Cutting edge: IL-1alpha is a crucial danger signal triggering acute myocardial inflammation during myocardial infarction', J Immunol, 194(2), pp. 499-503. Luheshi, N. M., Kovács, K. J., Lopez-Castejon, G., Brough, D. & Denes, A. (2011). 'Interleukin-1α expression precedes IL-1β after ischemic brain injury and is localised to areas of focal neuronal loss and penumbral tissues', J Neuroinflammation, 8, p. 186. Luheshi, N. M., McColl, B. W. & Brough, D. (2009a). 'Nuclear retention of IL-1α by necrotic cells: A mechanism to dampen sterile inflammation', European Journal of Immunology, 39(11), pp. 2973-2980. Luheshi, N. M., Rothwell, N. J. & Brough, D. (2009b). 'The dynamics and mechanisms of interleukin-1α and β nuclear import', Traffic, 10(1), pp. 16-25. Lukens, J. R., Vogel, P., Johnson, G. R., Kelliher, M. A., Iwakura, Y., Lamkanfi, M. & Kanneganti, T. D. (2013). 'RIP1-driven autoinflammation targets IL-1α independently of inflammasomes and RIP3', Nature, 498(7453), pp. 224-227. Maelfait, J., Vercammen, E., Janssens, S., Schotte, P., Haegman, M., Magez, S. & Beyaert, R. (2008). 'Stimulation of Toll-like receptor 3 and 4 induces interleukin-1beta maturation by caspase-8', J Exp Med, 205(9), pp. 1967-73. Maier, J. A., Volalas, P., Roeder, D. & Maciag, T. (1990). 'Extension of the life- span of human endothelial cells by an interleukin-1 alpha antisense oligomer', Science, 249(4976), pp. 1570-1574. Malik, A. & Kanneganti, T. D. (2018). 'Function and regulation of IL-1alpha in inflammatory diseases and cancer', Immunol Rev, 281(1), pp. 124-137.

133

Malinowsky, D., Lundkvist, J., Layé, S. & Bartfai, T. (1998). 'Interleukin-1 receptor accessory protein interacts with the type II interleukin-1 receptor', FEBS Lett, 429(3), pp. 299-302. Man, S. M., Hopkins, L. J., Nugent, E., Cox, S., Gluck, I. M., Tourlomousis, P., Wright, J. A., Cicuta, P., Monie, T. P. & Bryant, C. E. (2014). 'Inflammasome activation causes dual recruitment of NLRC4 and NLRP3 to the same macromolecular complex', Proc Natl Acad Sci U S A, 111(20), pp. 7403-8. Man, S. M. & Kanneganti, T. D. (2015). 'Converging roles of caspases in inflammasome activation, cell death and innate immunity', Nature reviews. Immunology, 16, pp. 7-21. Mangan, M. S. J., Olhava, E. J., Roush, W. R., Seidel, H. M., Glick, G. D. & Latz, E. (2018). 'Targeting the NLRP3 inflammasome in inflammatory diseases', Nature Reviews Drug Discovery, 17(8), pp. 588-606. Mantovani, A., Dinarello, C. A., Molgora, M. & Garlanda, C. (2019). 'Interleukin-1 and related cytokines in the regulation of inflammation and immunity', Immunity, 50(4), pp. 778-795. March, C. J., Mosley, B., Larsen, A., Ceretti, D. P., Braedt, G., Price, V., Gillis, S., Henney, C. S., Kronheim, S. R., Grabstein, K., Conlon, P., J. Hopp, T. P. & Cosman, D. (1985). 'Cloning, sequence and expression of two distinct human interleukin-1 complementary cDNAs', Nature, 315(20), pp. 641-647. Mariotti, M., Castiglioni, S., Bernardini, D. & Maier, J. A. (2006). 'Interleukin 1 alpha is a marker of endothelial cellular senescent', Immun Ageing, 3, p. 4. Martín-Sánchez, F., Diamond, C., Zeitler, M., Gómez, A. I., Bagnall, J., Spiller, D., White, M., Daniels, M. J. D., Morterallo, A., Peñalver, M., Paszek, P., Steringer, J. P., Nickel, W., Brough, D. & Pelegrín, P. (2016). 'Inflammasome- dependent IL-1 β release depends upon membrane permeabilisation', pp. 1219- 1231. Martin, P., Palmer, G., Rodriguez, E., Palomo, J., Lemeille, S., Goldstein, J. & Gabay, C. (2020). 'Intracellular IL-1 Receptor Antagonist Isoform 1 Released from Keratinocytes upon Cell Death Acts as an Inhibitor for the Alarmin IL-1α', The Journal of Immunology, 204(4), pp. 967-979. Martinon, F., Burns, K. & Tschopp, J. (2002). 'The Inflammasome: A molecular platform triggering activation of inflammatory caspases and processing of proIL- β', Molecular Cell, 10(2), pp. 417-426. Martinon, F., Petrilli, V., Mayor, A., Tardivel, A., Tschopp, J. & Pétrilli, V. (2006). 'Gout-associated uric acid crystals activate the NALP3 inflammasome', Nature, 440(7081), pp. 237-241. McCarthy, D. A., Clark, R. R., Bartling, T. R., Trebak, M. & Melendez, J. A. (2013). 'Redox control of the senescence regulator interleukin-1a and the secretory phenotype', Journal of Biological Chemistry, 288(45), pp. 32149-32159. McDowell, T. L., Symons, J. A. & Duff, G. W. (2005). 'Human interleukin-1 alpha gene expression is regulated by Sp1 and a transcriptional repressor', Cytokine, 30(4), pp. 141-53. McKee, C. M. & Coll, R. C. (2020). 'NLRP3 inflammasome priming: A riddle wrapped in a mystery inside an enigma', J Leukoc Biol.

134

Medzhitov, R. (2008). 'Origin and physiological roles of inflammation', Nature, 454(7203), pp. 428-35. Mellgren, R. L., Miyake, K., Kramerova, I., Spencer, M. J., Bourg, N., Bartoli, M., Richard, I., Greer, P. A. & McNeil, P. L. (2009). 'Calcium-dependent plasma membrane repair requires m- or µ-calpain, but not calpain-3, the proteosome, or caspases', Biochimica et Biophysica Acta, 1793(12), pp. 1886-1893. Mellgren, R. L., Zhang, W., Miyake, K. & McNeil, P. L. (2007). 'Calpain is required for the rapid, calcium-dependent repair of wounded plasma membrane', Journal of Biological Chemistry, 282(4), pp. 2567-2575. Miao, E. A., Mao, D. P., Yudkovsky, N., Bonneau, R., Lorang, C. G., Warren, S. E., Leaf, I. A. & Aderem, A. (2010). 'Innate immune detection of the type III secretion apparatus through the NLRC4 inflammasome', PNAS, 107(7), pp. 3076-3080. Mizutani, H., Schechter, N., Lazarus, G., Black, R. A. & Kupper, T. S. (1991). 'Rapid and specific conversion of precursor interleukin 1β (IL-1β) to an active IL-1 species by human mast cell chymase', Journal of Experimental Medicine, 174, pp. 821-825. Modi, W. S., Masuda, A., Yamada, M., Oppenheim, J. J., Matsushima, K. & O'Brien, S. J. (1988). 'Chromosomal localization of the human interleukin 1α (IL- 1α) gene', Genomics, 2(4), pp. 310-314. Monteleone, M., Stanley, A. C., Chen, K. W., Brown, D. L., Bezbradica, J. S., von Pein, J. B., Holley, C. L., Boucher, D., Shakespear, M. R., Kapetanovic, R., Rolfes, V., Sweet, M. J., Stow, J. L. & Schroder, K. (2018). 'Interleukin-1β Maturation Triggers Its Relocation to the Plasma Membrane for Gasdermin-D- Dependent and -Independent Secretion', Cell Reports, 24(6), pp. 1425-1433. Mori, N. & Prager, D. (1996). 'Transactivation of the interleukin-1a promoter by human T-cell leukemia virus type I and type II tax proteins', Blood, 78(8), pp. 3410-3417. Mulcahy, N. J., Ross, J., Rothwell, N. J. & Loddick, S. A. (2003). 'Delayed administration of interleukin-1 receptor antagonist protects against transient cerebral ischaemia in the rat', Br J Pharmacol, 140(3), pp. 471-476. Munding, C., Keller, M., Niklaus, G., Papin, S., Tschopp, J., Werner, S. & Beer, H. D. (2006). 'The estrogen-responsive B box protein: a novel enhancer of interleukin-1beta secretion', Cell death and differentiation, 13(11), pp. 1938-49. Muñoz-Planillo, R., Kuffa, P., Martínez-Colón, G., Smith, B., Rajendiran, T. & Núñez, G. (2013). 'K+ Efflux Is the Common Trigger of NLRP3 Inflammasome Activation by Bacterial Toxins and Particulate Matter', Immunity, 38(6), pp. 1142- 1153. Nedeva, C., Menassa, J. & Puthalakath, H. (2019). 'Sepsis: Inflammation is a necessary evil', Frontiers in Cell and Developmental Biology, 7(108). Nikoopour, E., Schwartz, J. A. & Singh, B. (2008). 'Therapeutic benefits of regulating inflammation in autoimmunity', Inflamm Allergy Drug Targets, 7(3), pp. 203-210. Ono, Y., Saido, T. C. & Sorimachi, H. (2016). 'Calpain research for drug discovery: challenges and potential', Nat Rev Drug Discov, 15(12), pp. 854-876.

135

Oostrum, J. V., Priestle, J. P., Grütter, M. G. & Schmitz, A. (1991). 'The structure of murine Interleukin-1β at 2.8 Å resolution ', Journal of structural biology, 107(2). Orjalo, A. V., Bhaumik, D., Gengler, B. K., Scott, G. K. & Campisi, J. (2009). 'Cell surface-bound IL-1α is an upstream regulator of the senescence-associated IL- 6/IL-8 cytokine network', Proceedings of the National Academy of Sciences of the United States of America, 106(40), pp. 17031-17036. Orning, P., Weng, D., Starheim, K., Ratner, D., Best, Z., Lee, B., Brooks, A., Xia, S., Wu, H., Kelliher, M. A., Berger, S. B., Gough, P. J., Bertin, J., Proulx, M. M., Goguen, J. D., Kayagaki, N., Fitzgerald, K. A. & Lien, E. (2018). 'Pathogen blockade of TAK1 triggers caspase-8–dependent cleavage of gasdermin D and cell death', Science, 362(6418), pp. 1064-1069. Patel, M. N., Carroll, R. G., Galvan-Pena, S., Mills, E. L., Olden, R., Triantafilou, M., Wolf, A. I., Bryant, C. E., Triantafilou, K. & Masters, S. L. (2017). 'Inflammasome priming in sterile inflammatory disease', Trends Mol Med, 23(2), pp. 165-180. Perregaux, D. & Gabel, C. A. (1994). 'Interleukin-1β maturation and release in response to ATP and nigericin. Evidence that potassium depletion mediated by these agents is a necessary and common feature of their activity', Journal of Biological Chemistry, 269, pp. 5195–15203. Pizzirani, C., Ferrari, D., Chiozzi, P., Adinolfi, E., Sandonà, D., Savaglio, E. & Virgilio, F. D. (2007). 'Stimulation of P2 receptors causes release of IL-1β-loaded microvesicles from human dendritic cells', Blood, 109(9), pp. 3856-3864. Pober, J. S. & Sessa, W. C. (2007). 'Evolving functions of endothelial cells in inflammation', Nature Reviews Immunology, 7(10), pp. 803-815. Pollock, A. S., Turck, J. & Lovett, D. H. (2003). 'The prodomain of interleukin 1α interacts with elements of the RNA processing apparatus and induces apoptosis in malignant cells', FASEB Journal, 17(2), pp. 203-213. Poreba, M., Strozyk, A., Salvesen, G. S. & Drag, M. (2013). 'Caspase substrates and inhibitors', Cold Spring Harb Perspect Biol, 5(8), p. a008680. Qu, Y., Franchi, L., Nunez, G. & Dubyak, G. R. (2007). 'Nonclassical IL-1 secretion stimulated by P2X7 receptors is dependent on inflammasome activation and correlated with exosome release in murine macrophages', The Journal of Immunology, 179(3), pp. 1913-1925. Qu, Y., Ramachandra, L., Mohr, S., Franchi, L., Harding, C. V., Nunez, G. & Dubyak, G. R. (2009). 'P2X7 Receptor-stimulated secretion of MHC Class II- containing exosomes requires the ASC/NLRP3 inflammasome but is independent of caspase-1', The Journal of Immunology, 182(8), pp. 5052-5062. Rathinam, V. A. K., Jiang, Z., Waggoner, S. N., Sharma, S., Leah, E., Waggoner, L., Vanaja, S. K., Monks, B. G., Ganesan, S., Latz, E., Hornung, V., Vogel, S. N., Szomolanyi-tsuda, E. & Fitzgerald, A. (2010). 'The AIM2 inflammasome is essential for host-defense against cytosolic bacteria and DNA viruses', Nature immunology, 11(5), pp. 395-402. Reed-Geaghan, E. G., Savage, J. C., Hise, A. G. & Landreth, G. E. (2009). 'CD14 and Toll-Like Receptors 2 and 4 Are Required for Fibrillar Aβ-Stimulated Microglial Activation', Journal of Neuroscience, 29(38), pp. 11982–11992.

136

Rider, P., Carmi, Y., Guttman, O., Braiman, A., Cohen, I., Voronov, E., White, M. R., Dinarello, C. A. & Apte, R. N. (2011). 'IL-1alpha and IL-1beta recruit different myeloid cells and promote different stages of sterile inflammation', J Immunol, 187(9), pp. 4835-43. Rider, P., Kaplanov, I., Romzova, M., Bernardis, L., Braiman, A., Voronov, E. & Apte, R. N. (2012). 'The transcription of the alarmin cytokine interleukin-1 alpha is controlled by hypoxia inducible factors 1 and 2 alpha in hypoxic cells', Front Immunol, 3, p. 290. Rivers-Auty, J., Daniels, M. J. D., Colliver, I., Robertson, D. L. & Brough, D. (2018). 'Redefining the ancestral origins of the interleukin-1 superfamily', Nature Communications, 9(1), pp. 1-12. Roberts, T. L., Idris, A., Dunn, J. A., Kelly, G. M., Burnton, C. M., Hodgson, S., Hardy, L. L., Garceau, V., Sweet, M. J., Ross, I. L., Hume, D. A. & Stacey, K. J. (2009). 'HIN-200 Proteins Regulate Caspase Activation in Response to Foreign Cytoplasmic DNA', Science, 323(5917), p. 1057. Roman, J., Ritzenthaler, J. D., Fenton, M. J., Roser, S. & Schuyler, W. (2000). 'Transcriptional regulation of the human interleukin 1beta gene by fibronectin: role of protein kinase C and activator protein 1 (AP-1)', Cytokine, 12(11), pp. 1581-96. Romberg, N., Vogel, T. P. & Canna, S. W. (2017). 'NLRC4 inflammasomopathies', Curr Opin Allergy Clin Immunol, 17(6), pp. 398-404. Rühl, S., Shkarina, K., Demarco, B., Heilig, R., Santos, J. C. & Broz, P. (2018). 'ESCRT-dependent membrane repair negatively regulates pyroptosis downstream of GSDMD activation', Science, 362(956-960). Saeki, A., Tsuchiya, K., Suda, T., Into, T., Hasebe, A., Suzuki, T. & Shibata, K. I. (2020). 'Gasdermin D-independent release of interleukin-1beta by living macrophages in response to mycoplasmal lipoproteins and lipopeptides', Immunology. Salmeron, K. E., Maniskas, M. E., Edwards, D. N., Wong, R., Rajkovic, I., Trout, A., Rahman, A. A., Hamilton, S., Fraser, J. F., Pinteaux, E. & Bix, G. J. (2019). 'Interleukin 1 alpha administration is neuroprotective and neuro-restorative following experimental ischemic stroke', J Neuroinflammation, 16(1), p. 222. Sarhan, J., Liu, B. C., Muendlein, H. I., Li, P., Nilson, R., Tang, A. Y., Rongvaux, A., Bunnell, S. C., Shao, F., Green, D. R. & Poltorak, A. (2018). 'Caspase-8 induces cleavage of gasdermin D to elicit pyroptosis during Yersinia infection', Proc Natl Acad Sci U S A, 115(46), pp. E10888-E10897. Sborgi, L., Rühl, S., Mulvihill, E., Pipercevic, J., Heilig, R., Farady, C. J., Müller, D. J., Broz, P. & Hiller, S. (2016). 'GSDMD membrane pore formation constitutes the mechanism of pyroptotic cell death', The EMBO Journal, 35(16), pp. 1766- 1778. Schmid-Burgk, J. L., Chauhan, D., Schmidt, T., Ebert, T. S., Reinhardt, J., Endl, E. & Hornung, V. (2016). 'A genome-wide CRISPR (clustered regularly interspaced short palindromic repeats) screen identifies NEK7 as an essential component of NLRP3 inflammasome activation', Journal of Biological Chemistry, 291(1), pp. 103-109. Semino, C., Carta, S., Gattorno, M., Sitia, R. & Rubartelli, A. (2018). 'Progressive waves of IL-1β release by primary human monocytes via sequential activation of

137 vesicular and gasdermin D-mediated secretory pathways', Cell Death and Disease, 9(11). Sharma, D., Sharma, B. R., Vogel, P. & Kanneganti, T. D. (2017). 'IL-1β and caspase-1 drive autoinflammatory disease independently of IL-1α or caspase-8 in a mouse model of familial Mediterranean fever', Am J Pathol, 187, pp. 236-244. Shi, J., Zhao, Y., Wang, K., Shi, X., Wang, Y., Huang, H., Zhuang, Y. & Cai, T. (2015). 'Cleavage of GSDMD by inflammatory caspases determines pyroptotic cell death', Nature, 526, pp. 660-665. Shi, J., Zhao, Y., Wang, Y., Gao, W., Ding, J., Li, P., Hu, L. & Shao, F. (2014). 'Inflammatory caspases are innate immune receptors for intracellular LPS', Nature, 514(7521), pp. 187-192. Shirakawa, F., Saito, K., Bonagura, C. A., Galson, D. L., Fenton, M. J., Webb, A. C. & Auron, P. E. (1993). 'The human prointerleukin 1 beta gene requires DNA sequences both proximal and distal to the transcription start site for tissue- specific induction', Molecular and Cellular Biology, 13(4), pp. 1332-1344. Simmen, T. (2011). 'Hax-1: A regulator of calcium signaling and apoptosis progression with multiple roles in human disease', Expert Opinion on Therapeutic Targets, 15(6), pp. 741-751. Skaper, S. D., Facci, L., Zusso, M. & Giusti, P. (2018). 'An Inflammation-Centric View of Neurological Disease: Beyond the Neuron', Frontiers in Cellular Neuroscience, 12(72). Smith, D. E., Hanna, R., Della, F., Moore, H., Chen, H., Farese, A. M., MacVittie, T. J., Virca, G. D. & Sims, J. E. (2003). 'The soluble form of IL-1 Receptor Accessory Protein enhances the ability of soluble Type II IL-1 Receptor to inhibit IL-1 action', Immunity, 18(1), pp. 87-96. Stein, R., Kapplusch, F., Heymann, M. C., Russ, S., Staroske, W., Hedrich, C. M., Rosen-Wolff, A. & Hofmann, S. R. (2016). 'Enzymatically inactive procaspase 1 stabilizes the ASC pyroptosome and supports pyroptosome spreading during cell Division', J Biol Chem, 291(35), pp. 18419-29. Stevenson, F. T., Bursten, S. L., Fanton, C., Locksley, R. M. & Lovett, D. H. (1993). 'The 31-kDa precursor of interleukin 1 alpha is myristoylated on specific lysines within the 16-kDa N-terminal propiece', Proceedings of the National Academy of Sciences of the United States of America, 90(15), pp. 7245-7249. Stewart, C. R., Stuart, L. M., Wilkinson, K., van Gils, J. M., Deng, J., Halle, A., Rayner, K., J., B., L., Zhong, R., Frazier, W. A., Lacy-Hulbert, A., Khoury, J. E., Golenbock, D. T. & and Moore, K. J. (2010). 'CD36 ligands promote sterile inflammation through assembly of a Toll-like receptor 4 and 6 heterodimer', Nature Immunology, 11(2), pp. 155-161. Sun, Y., Abbondante, S., Karmakar, M., de Jesus Carrion, S., Che, C., Hise, A. G. & Pearlman, E. (2018). 'Neutrophil caspase-11 is required for cleavage of caspase-1 and secretion of IL-1beta in Aspergillus fumigatus infection', J Immunol, 201(9), pp. 2767-2775. Tang, D., Kang, R., Berghe, T. V., Vandenabeele, P. & Kroemer, G. (2019). 'The molecular machinery of regulated cell death', Cell Res, 29(5), pp. 347-364. Tannahill, G. M., Curtis, A. M., Adamik, J., Palsson-McDermott, E. M., McGettrick, A. F., Goel, G., Frezza, C., Bernard, N. J., Kelly, B., Foley, N. H.,

138

Zheng, L., Gardet, A., Tong, Z., Jany, S. S., Corr, S. C., Haneklaus, M., Caffrey, B. E., Pierce, K., Walmsley, S., Beasley, F. C., Cummins, E., Nizet, V., Whyte, M., Taylor, C. T., Lin, H., Masters, S. L., Gottlieb, E., Kelly, V. P., Clish, C., Auron, P. E., Xavier, R. J. & O'Neill, L. A. (2013). 'Succinate is an inflammatory signal that induces IL-1beta through HIF-1alpha', Nature, 496(7444), pp. 238-42. Tapia, V. S., Daniels, M. J. D., Palazón-Riquelme, P., Dewhurst, M., Luheshi, N. M., Rivers-Auty, J., Green, J., Redondo-Castro, E., Kaldis, P., Lopez-Castejon, G. & Brough, D. (2019). 'The three cytokines IL-1β, IL-18, and IL-1α share related but distinct secretory routes', Journal of Biological Chemistry, 294, pp. jbc.RA119.008009-jbc.RA119.008009. Tedgui, A. & Mallat, Z. (2006). 'Cytokines in atherosclerosis: pathogenic and regulatory pathways', Physiological Reviews, 86, pp. 515-581. Termeer, C., Benedix, F., Sleeman, J., Fieber, C., Voith, U., Ahrens, T., Miyake, K., Freudenberg, M., Galanos, C. & Simon, J. C. (2002). 'Oligosaccharides of Hyaluronan activate dendritic cells via toll-like receptor 4', Journal of Experimental Medicine, 195(1), pp. 99-111. Thornberry, N. A., Bull, H. G., Calaycay, J. R., Chapman, K. T., Howard, A. D., Kostura, M. J., Miller, D. K., Molineaux, S. M., Weidner, J. R., Aunins, J., Elliston, K. O., Ayala, J. M., Casano, F. J., Chin, J., Ding, G. J.-F., Egger, L. A., Gaffney, E. P., Limjuco, G., Palyha, O. C., Raju, S. M., Rolando, A. M., Salley, J. P., Yamin, T.-T., Lee, T. D., Shively, J. E., MacCross, M., Mumford, R. A., Schmidt, J. A. & Tocci, M. J. (1992). 'A novel heterodimeric cysteine protease is required for interleukin-1β processing in monocytes', Nature, 356, pp. 768–774. Travers, J., Rochman, M., Miracle, C. E., Habel, J. E., Brusilovsky, M., Caldwell, J. M., Rymer, J. K. & Rothenberg, M. E. (2018). 'Chromatin regulates IL-33 release and extracellular cytokine activity', Nature Communications, 9(1), pp. 1- 15. Tschopp, J., Martinon, F. & Burns, K. (2003). 'NALPs: a novel protein family involved in inflammation', Nat Rev Mol Cell Biol, 4(2), pp. 95-104. Tsukada, J., Saito, K., Waterman, W. R., Webb, A. C. & Auron, P. E. (1994). 'Transcription factors NF-IL6 and CREB recognize a common essential site in the human prointerleukin 1 beta gene', Molecular and Cellular Biology, 14(11), pp. 7285–7297. van Deursen, J. M. (2014). 'The role of senescent cells in ageing', Nature, 509(7501), pp. 439-46. Viganò, E., Diamond, C. E., Spreafico, R., Balachander, A., Sobota, R. M. & Mortellaro, A. (2015). 'Human caspase-4 and caspase-5 regulate the one-step non-canonical inflammasome activation in monocytes', Nature Communications, 6, pp. 1-13. Vogl, T., Tenbrock, K., Ludwig, S., Leukert, N., Ehrhardt, C., van Zoelen, M. A. D., Nacken, W., Foell, D., van der Poll, T., Sorg, C. & Roth, J. (2007). 'Mrp8 and Mrp14 are endogenous activators of Toll-like receptor 4, promoting lethal, endotoxin-induced shock', Nature Medicine, 13, pp. 1042-1049. Wang, J.-G., Williams, J. C., Davis, B. K., Jacobson, K., Doerschuk, C. M., Ting, J. P. Y. & Mackman, N. (2011). 'Monocytic microparticles activate endothelial cells in an IL-1b-dependent manner', Blood, 118(8), pp. 2366-2374.

139

Wang, K., Sun, Q., Zhong, X., Zeng, M., Zeng, H., Shi, X., Li, Z., Wang, Y., Zhao, Q., Shao, F. & Ding, J. (2020). 'Structural mechanism for GSDMD targeting by autoprocessed caspases in pyroptosis', Cell, 180(5), pp. 941-955 e20. Werman, A., Werman-Venkert, R., White, R., Lee, J. K., Werman, B., Krelin, Y., Voronov, E., Dinarello, C. A. & Apte, R. N. (2004). 'The precursor form of IL-1α is an intracrine proinflammatory activator of transcription', Proceedings of the National Academy of Sciences of the United States of America, 101(8), pp. 2434- 2439. Wessendorf, J. H., Garfinkel, S., Zhan, X., Brown, S. & Maciag, T. (1993). 'Identification of a nuclear localization sequence within the structure of the human interleukin-1 alpha precursor', Journal of biological chemistry, 268(29), pp. 22100-4. Wierstra, I. (2008). 'Sp1: emerging roles--beyond constitutive activation of TATA- less housekeeping genes', Biochem Biophys Res Commun, 372(1), pp. 1-13. Wiggins, K. A., Parry, A. J., Cassidy, L. D., Humphry, M., Webster, S. J., Goodall, J. C., Narita, M. & Clarke, M. C. H. (2019). 'IL-1α cleavage by inflammatory caspases of the noncanonical inflammasome controls the senescence- associated secretory phenotype', Aging Cell, 18(3), pp. 1-13. Wolf, A. J., Reyes, C. N., Liang, W., Becker, C., Shimada, K., Wheeler, M. L., Cho, H. C., Popescu, N. I., Coggeshall, K. M., Arditi, M. & Underhill, D. M. (2016). 'Hexokinase is an innate immune receptor for the detection of bacterial peptidoglycan', Cell, 166(3), pp. 624-636. Xu, H., Yang, J., Gao, W., Li, L., Li, P., Zhang, L., Gong, Y.-N., Peng, X., Xi, J. J., Chen, S., Wang, F. & Shao, F. (2014). 'Innate immune sensing of bacterial modifications of Rho GTPases by the Pyrin inflammasome', Nature, 513(7517), pp. 237-241. Yang, J., Liu, Z., Wang, C., Yang, R., Rathkey, J. K., Pinkard, O. W., Shi, W., Chen, Y., Dubyak, G. R., Abbott, D. W. & Xiao, T. S. (2018). 'Mechanism of gasdermin D recognition by inflammatory caspases and their inhibition by a gasdermin D-derived peptide inhibitor', Proc Natl Acad Sci U S A, 115(26), pp. 6792-6797. Yin, H., Morioka, H., Towle, C. A., Vidal, M., Watanabe, T. & Weissbach, L. (2001). 'Evidence that HAX-1 is an interleukin-1α N-terminal binding protein', Cytokine, 15(3), pp. 122-137. Yuan, H., Zeng, M. Y., Yang, D., Motro, B. & Núñez, G. (2016). 'Nek7 is an essential mediator of NLRP3 activation downstream of potassium efflux', Nature, 530(7590), pp. 354-357. Zamostna, B., Novak, J., Vopalensky, V., Masek, T., Burysek, L. & Pospisek, M. (2012). 'N-terminal domain of nuclear IL-1alpha shows structural similarity to the C-terminal domain of Snf1 and binds to the HAT/core module of the SAGA complex', PLoS One, 7(8), p. e41801. Zanoni, I., Tan, Y., Di Gioia, M., Broggi, A., Ruan, J., Shi, J., Donado, C. A., Shao, F., Wu, H., Springstead, J. R. & Kagan, J. C. (2016). 'An endogenous caspase-11 ligand elicits interleukin-1 release from living dendritic cells', Science, 352(6290), pp. 1232-1236.

140

Zhang, M., Kenny, S. J., Ge, L., Xu, K. & Schekman, R. (2015). 'Translocation of interleukin-1β into a vesicle intermediate in autophagy- mediated secretion', eLife, 4, pp. 1-23. Zhang, M., Liu, L., Lin, X., Wang, Y., Li, Y., Guo, Q., Li, S., Sun, Y., Tao, X., Zhang, D., Lv, X., Zheng, L. & Ge, L. (2020). 'A translocation pathway for vesicle- mediated unconventional protein secretion', Cell, 181(3), pp. 637-652 e15. Zhang, Y., Yu, X., Lin, D., Lei, L., Hu, B., Cao, F., Mei, Y., Wu, D. & Liu, H. (2017). 'Propiece IL-1α facilitates the growth of acute T-lymphocytic leukemia cells through the activation of NF-κB and SP1', Oncotarget, 8(9), pp. 15677- 15688. Zhao, Y., Yang, J., Shi, J., Gong, Y.-N., Lu, Q., Xu, H., Liu, L. & Shao, F. (2011). 'The NLRC4 inflammasome receptors for bacterial flagellin and type III secretion apparatus', Nature, 477(7366), pp. 596-600. Zheng, Y., Humphry, M., Maguire, J. J., Bennett, M. R. & Clarke, M. C. H. (2013). 'Intracellular Interleukin-1 Receptor 2 Binding Prevents Cleavage and Activity of Interleukin-1α, Controlling Necrosis-Induced Sterile Inflammation', Immunity, 38(2), pp. 285-295.

141