The Nosology of Hereditary Cerebellar Ataxias: Development of a Classification for Recessive Ataxias and Phenotypical Description of Spinocerebellar Ataxia 34

The nosology of hereditary cerebellar ataxias: Development of a classification for recessive ataxias and phenotypical description of Spinocerebellar ataxia 34

Mémoire

Marie Beaudin

Maîtrise en épidémiologie - épidémiologie clinique - avec mémoire Maître ès sciences (M. Sc.)

Québec, Canada

The nosology of hereditary cerebellar ataxias Development of a classification for recessive ataxias and phenotypical description of Spinocerebellar ataxia 34

Mémoire

Marie Beaudin

Sous la direction de :

Nicolas Dupré, directeur de recherche Danielle Laurin, codirectrice de recherche

Résumé

Les ataxies cérébelleuses héréditaires causent une atteinte progressive de l’équilibre et de la marche. Malgré l’amélioration de la performance et de l’accessibilité des tests génétiques, environ la moitié des patients demeurent sans diagnostic précis, ce qui a un impact sur la prise en charge. Dans ce mémoire de maîtrise, nous abordons l’enjeu du sous-diagnostic chez les patients atteints d’ataxie cérébelleuse via l’élaboration d’une nouvelle classification pour les ataxies récessives et la caractérisation détaillée de l’ataxie spinocérébelleuse 34.

Le premier chapitre est une revue systématique de la littérature concernant les ataxies récessives. Au total, 2354 références et 130 articles complets ont été révisés afin d’identifier un groupe de 45 pathologies récessives où l’atteinte cérébelleuse est au cœur du phénotype et 29 pathologies multisystémiques additionnelles où l’ataxie est un élément secondaire, mais qui devraient être incluses dans le diagnostic différentiel du patient ataxique.

Le deuxième chapitre présente les résultats d’un groupe de travail dédié à la classification des ataxies récessives. En se basant sur les résultats de la revue systématique, 12 experts internationaux se sont entendus sur des critères d’inclusion ainsi que sur deux classifications basées sur la symptomatologie clinique et les mécanismes cellulaires impliqués. Une approche clinique au patient ataxique est proposée.

Le troisième chapitre présente une caractérisation en profondeur de l’ataxie spinocérébelleuse 34, causée par des mutations du gène ELOVL4. Nous avons étudié une famille multi-générationnelle présentant un syndrome cérébelleux tardif associé à des déficits exécutifs et une possible atteinte visuospatiale, attentionnelle et psychiatrique. L’analyse immunohistochimique de fibroblastes dermiques a démontré la délocalisation et l’agrégation de la protéine.

Un système de classification basé sur des descriptions phénotypiques étoffées est essentiel pour les cliniciens et les chercheurs afin d’organiser adéquatement les groupes de maladies complexes. Le travail présenté constitue une avancée concrète pour améliorer l’approche diagnostique aux patients avec ataxie héréditaire.

Abstract

Hereditary cerebellar ataxias are neurodegenerative disorders associated with progressive motor incoordination and gait imbalance. Despite significant progress in the availability and performance of genetic tests, around half of patients remain without a molecular diagnosis, which has major counselling and management consequences. In this master thesis, we address the issue of underdiagnosis in patients with hereditary ataxias through the development of a novel classification system for recessive cerebellar ataxias and the in-depth characterization Spinocerebellar ataxia 34.

The first chapter is a systematic review of the literature regarding recessive cerebellar ataxias. We revised 2354 references and 130 full-text articles to identify a group of 45 recessive disorders in which cerebellar ataxia is at the core of the clinical phenotype and 29 additional complex or multisystem disorders where ataxia is a secondary feature and which should be included in the differential diagnosis of ataxia.

The second chapter presents the work of a dedicated task force on the classification of recessive cerebellar ataxias. Based on the results of the systematic review, 12 international ataxia experts agreed on revised inclusion criteria and on classifications based on clinical symptoms and pathogenic cellular mechanisms. We also propose a general clinical approach to the ataxic patient.

The third chapter shows the clinical and biochemical characterization of a rare dominant ataxia, Spinocerebellar ataxia 34 caused by ELOVL4 mutations. We studied a multi-generational family with a late-onset cerebellar syndrome associated with executive deficits, and apparent visuospatial, attention, and psychiatric dysfunction. Immunohistochemistry of dermal fibroblasts showed the first evidence of ELOVL4 protein pathology in this disorder with mislocalization and aggregation of the protein.

Classification systems based on detailed phenotypic descriptions are essential for both clinicians and researchers to understand complex groups of disorders. The work presented here advances our understanding of hereditary ataxias and constitutes a pragmatic diagnostic tool for clinicians.

iii

Table des matières

Résumé ...... ii Abstract ...... iii Table des matières ...... iv Liste des abréviations ...... vi Remerciements ...... x Avant-propos ...... xi Introduction ...... 1 Chapter 1 Reviewing the evidence: a systematic scoping review of the literature on recessive cerebellar ataxias ...... 7 1.1 Résumé ...... 7 1.2 Abstract ...... 8 1.3 Background ...... 9 1.4 Methods ...... 10 1.5 Results ...... 11 1.6 Discussion ...... 12 1.7 Conclusion ...... 14 1.8 Tables ...... 14 Table 1.1 Proposed new list of autosomal recessive ataxias ...... 14 Table 1.2 Other complex movement or multisystem recessive disorders that have prominent ataxia ...... 16 Table 1.3 Recessive disorders that may occasionally present with ataxia, but where ataxia is a secondary feature ...... 18 1.9 Figures ...... 19 Figure 1.1 Flow diagram ...... 19 Figure 1.2 Clinical algorithm of autosomal recessive ataxias ...... 20 1.10 Supplementary material ...... 20 Search strategy for MEDLINE/Pubmed ...... 20 1.11 References ...... 21 Chapter 2 Building a conceptual framework: a new classification for recessive cerebellar ataxias . 30 2.1 Résumé ...... 30 2.2 Abstract ...... 31 2.3 Introduction ...... 31 2.4 Methods ...... 33 2.5 Results ...... 34 2.6 Discussion ...... 39 2.7 Conclusion ...... 41 2.8 Tables ...... 41 Table 2.1 Primary recessive cerebellar ataxias ...... 41

Table 2.3 Other metabolic or complex recessive disorders that have ataxia as an associated feature ...... 45 2.9 Figures ...... 48 Figure 2.1 Clinical classification of autosomal recessive ataxias ...... 48 Figure 2.2 Graphical summary of the clinical approach to a patient presenting with ataxia ..... 49 Figure 2.3 Classification of autosomal recessive ataxias according to molecular pathogenesis50 2.10 References ...... 51 Chapter 3 Contributing to the evidence: the phenotypical description of a cerebellar ataxia in the French-Canadian population ...... 64 3.1 Résumé ...... 64 3.2 Abstract ...... 65 3.3 Introduction ...... 66 3.4 Methods ...... 68 3.5 Results ...... 70 3.6 Discussion ...... 73 3.7 Conclusion ...... 75 3.8 Tables ...... 76 Table 3.1 Detailed neurological findings in affected individuals with ELOVL4 mutations ...... 76 Table 3.2 Results of the clinical evaluation in SCA34 patients and controls ...... 76 Table 3.3 Clinical and paraclinical characteristics of patients with mutations in ELOVL4 in present and previous studies ...... 77 3.9 Figures ...... 78 Figure 3.1 Pedigree of a French-Canadian Family with the c.504 G>C mutation in ELOVL4 . 78 Figure 3.2 Dermatologic lesion in a SCA34 patient ...... 78 Figure 3.3 Neuroimaging findings in patients with the c.504 G>C mutation in ELOVL4 ...... 79 Figure 3.4 Impaired copy of the RCFT in three patients with the c.504 G>C mutation in ELOVL4 ...... 80 Figure 3.5 Immunofluorescence staining of dermal fibroblasts from a SCA34 patient compared with fibroblasts from a healthy control ...... 81 3.10 Supplementary Material ...... 82 3.11 References ...... 83 Conclusion ...... 86 Bibliographie ...... 92

Liste des abréviations

ACPHD ataxia, combined cerebellar and peripheral with hearing loss and diabetes mellitus ALS Amyotrophic lateral sclerosis AOA ataxia with oculomotor apraxia; ARCA autosomal recessive cerebellar ataxia ARSACS autosomal recessive spastic ataxia of Charlevoix-Saguenay AT ataxia-telangiectasia ATLD ataxia-telangiectasia-like disorder AVED ataxia with vitamin E deficiency BVVLS2 Brown-Vialetto-Van Laere syndrome type 2 CA Cayman ataxia CAMOS cerebellar ataxia mental retardation optic atrophy and skin abnormalities CAMRQ cerebellar ataxia mental retardation with or without quadrupedal locomotion CCAS cerebellar cognitive-affective syndrome CDG congenital disorder of glycosylation CI confidence interval CLN neuronal ceroid lipofuscinosis CMT Charcot-Marie-Tooth COACH cerebellar vermis hypoplasia, oligophrenia, congenital ataxia, ocular coloboma, and hepatic fibrosis DCMA dilated cardiomyopathy with ataxia DES disequilibrium syndrome DTR deep tendon reflexes EAOH early-onset ataxia with oculomotor apraxia and hypoalbuminemia EKV erythrokeratodermia variabilis EPM progressive myoclonic epilepsy FAHN fatty acid hydroxylase-associated neurodegeneration FDG-PET [18F]-fluorodeoxyglucose positron emission tomography FRDA Friedreich ataxia GMS Galloway-Mowat syndrome IMNEPD infantile-onset multisystem neurologic, endocrine, and pancreatic disease IOSCA infantile onset spinocerebellar ataxia LIKNS Lichtenstein-Knorr syndrome MC3DN2 mitochondrial complex III deficiency, nuclear type 2 MGCA5 3-methyglutaconic aciduria type 5 MIRAS mitochondrial recessive ataxia syndrome MCSZ microchephaly seizures developmental delay MMSE Mini-Mental State Examinsation MMYAT mitochondrial myopathy and ataxia MoCA Montreal Cognitive Assessment MSS Marinesco-Sjogren syndrome MTDPS7 mitochondrial DNA depletion syndrome 7 NBIA neurodegeneration with brain iron accumulation PBD peroxisome biogenesis disorder PC Purkinje cell PCH pontocerebellar hypoplasia PEOA3 progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 3 PHARC polyneuropathy hearing loss ataxia retinitis pigmentosa and cataract RCFT Rey complex figure test

SANDO sensory ataxic neuropathy with dysarthria and ophthalmoparesis SCA spinocerebellar ataxia SCAE spinocerebellar ataxia with epilepsy SCAN1 spinocerebellar ataxia with axonal neuropathy 1 SCAR spinocerebellar ataxia, autosomal recessive SPAX spastic ataxia SeSAME seizures sensorineural deafness ataxia mental retardation and electrolyte imbalance SNVs single nucleotide variants SPAX spastic ataxia SPG spastic paraplegia UMN upper motor neuron WES Whole exome sequencing WGS Whole genome sequencing

vii

À Hugo, qui me pousse à me dépasser tous les jours

À Isabelle, qui m’apprend à grandir de chaque revers

viii

Every patient you see

is a lesson in much more

than the malady from which he suffers.

- Sir William Osler

Remerciements

Je tiens à remercier de tout cœur mon directeur de recherche, Dr Nicolas Dupré, qui m’a accompagnée dans tout le cheminement de ma maîtrise, depuis le début de mon implication en recherche jusqu’à la révision de mes articles et de ce mémoire. Merci de m’avoir guidée sur plusieurs aspects de la conciliation médecine et recherche et d’avoir été un véritable mentor pour m’initier à la recherche et à la neurologie. Un immense merci également à ma co-directrice de recherche, Dre Danielle Laurin, pour son appui soutenu et généreux dans la progression de ma maîtrise ainsi que pour ses conseils judicieux et opportuns. Merci de m’avoir accompagnée dans les imprévus de ce long processus et merci de votre grande compréhension face à mon parcours atypique. Finalement, merci à tous les collaborateurs avec lesquels j’ai travaillé pour la réalisation des projets qui composent ce mémoire de maîtrise, ce fut un grand plaisir de travailler et d’apprendre avec vous.

Avant-propos

Les travaux de ce mémoire de maîtrise ont été rendus possible grâce à une Bourse d’études supérieures du Canada au niveau de la maîtrise Frederick-Banting et Charles-Best octroyée par les Instituts de Recherche en Santé du Canada.

Le premier article inséré dans ce mémoire « Systematic review of autosomal recessive ataxias and proposal for a classification » a été soumis au journal Cerebellum & Ataxias le 22 novembre 2016, a été accepté le 17 février 2017 et a été publié dans ce journal le 23 février 2017. La version intégrée de l’article est identique à la version publiée. J’étais première auteure sur cet article et mon rôle a été de définir la méthode en élaborant la stratégie de recherche et les critères d’inclusion, de réaliser la revue systématique et d’écrire l’article. Les co-auteurs étaient Dr Christopher J. Klein, Dr Guy A. Rouleau et Dr Nicolas Dupré, qui ont tous contribué par un apport intellectuel à l’orientation de l’article et à la révision du manuscrit final. L’article est présenté tel que publié. Une bourse pour publication comme première auteure a été octroyée par la Faculté des études supérieures et postdoctorales suite à la publication de cet article.

Le deuxième article inséré dans ce mémoire « The Classification of Autosomal Recessive Cerebellar Ataxias: A consensus statement from the Society for Research on the Cerebellum and Ataxias Task Force » a été soumis au journal The Cerebellum le 30 décembre 2018 et est toujours en processus de révision. J’étais première auteure sur cet article et mon rôle a été de compléter la revue systématique jusqu’à la période d’octobre 2018 en utilisant la méthodologie préalablement développée, d’extraire les données cliniques, épidémiologiques et moléculaires, de développer les classifications et d’écrire l’article en intégrant les apports intellectuels des autres co-auteurs. Les autres co-auteurs étaient Dr Antoni Matilla-Dueñas, Dr Bing-Weng Soong, Dr Jose Luiz-Pedroso, Dr Orlando G. Barsottini, Dr Hiroshi Mitoma, Dr Shoji Tsuji, Dr Jeremy D Schmahmann, Dr Mario Manto, Dr Guy A. Rouleau, Dr Christopher Klein et Dr Nicolas Dupré qui ont tous fourni un apport intellectuel au contenu et commenté l’article final. L’article est présenté tel que soumis.

Le troisième article inséré dans ce mémoire « Characterization of the phenotype with neurocognitive impairment and protein mislocalization in ELOVL4-associated Spinocerebellar ataxia 34 » a été soumis au journal JAMA Neurology le 4 avril 2019 et est toujours en processus de révision. J’étais première auteure sur cet article et mon rôle a été de réviser la littérature pertinente, de participer à l’évaluation des patients et à la collecte de données, de réaliser les analyses statistiques portant sur les analyses cognitives, et d’écrire l’article. Les co-auteurs étaient Dre Leila

Sellami et Dr Robert Laforce qui ont réalisé les évaluations cognitives des patients, Christian Martel, Lydia Touzel-Deschênes et Dr François Gros-Louis qui ont réalisé les analyses immunohistochimiques sur les fibroblastes, Gabrielle Houle et Dr Guy A. Rouleau qui ont procédé aux analyses génétiques, ainsi que Dre Laurence Martineau, Dr Kevin Lacroix, Dre Andréane Lavallée, Dr Nicolas Chrestian qui ont contribué à l’évaluation des participants. Dr Nicolas Dupré a recruté les participants et supervisé la réalisation du projet. Tous les auteurs ont donné leurs commentaires sur le texte final. Le texte, les tableaux et les figures contenus dans le matériel supplémentaire de la publication ont été intégrés à l’article pour la présentation dans ce mémoire de maîtrise et des corrections mineures au contenu du texte ont été effectuées suite à la révision.

xii

Introduction

Ataxia comes from the greek a-, meaning not or absence of, and taxis, meaning order or arrangement. It refers to the loss of balance and coordination affecting gait and limb movements that results from lesions to the cerebellum or, occasionally, to the sensory or vestibular pathways. Cerebellar ataxia may result from a variety of acute and chronic insults to the cerebellum, including stroke, tumor, infection, toxin, trauma, vitamin deficiencies, hypothyroidism, auto-immune processes, and hereditary genetic mutations. Hereditary cerebellar ataxias present with progressive onset of gait imbalance leading to falls, incoordination of hands and feet, eye movement abnormalities, slurred speech, and difficulty swallowing. In addition to these frequent motor symptoms, patients may present with a wide variety of neurologic and multisystem involvement, depending on the mutated gene. Hereditary ataxias are divided according to the mode of inheritance based on family history, with autosomal dominant and recessive ataxias as the most frequent forms, while X-linked and mitochondrial mutations are much rarer (1, 2).

Hereditary cerebellar ataxias are individually rare diseases, but their pooled prevalence represents a significant number of affected patients. A recent systematic review with meta-analysis of international prevalence studies evaluated the global prevalence of hereditary ataxias at 9,8 per 100 000 population (95% confidence interval (CI) 6,7 - 12,8/105) (3). Specifically, the estimated prevalence for autosomal dominant ataxias was 2,7 per 100 000 population (95% CI 1,5 - 4,0/105), and for recessive ataxias, 3,3 per 100 000 (95% CI 1,7 - 4,9/105). These global estimates were limited by high heterogeneity between studies with an I2 value over 98,5% for all estimations. This heterogeneity was manifest in the very large range of prevalence estimates across studies, which varied between 0,0 to 5,6 per 100 000 population for dominant ataxias with highest prevalence in Portugal, Norway, and Japan, while for recessive ataxias, the prevalence varied between 0,0 to 7,2 per 100 000 population, with highest estimates in Cantabria and Alsace. This heterogeneity was attributed to different genetic backgrounds across geographical areas as well as different case ascertainment methods and inclusion criteria across studies. Hence, the prevalence of hereditary ataxias appears highly variable with clusters of higher prevalence in specific geographical areas or founder populations, but the global prevalence does represent a significant health concern.

Hereditary ataxias lead to considerable morbidity and mortality for affected patients. Studies of patients affected with dominant ataxias have shown that health-related quality of life is significantly impaired and deteriorates with time based on measurements with the EuroQol Five Dimensions Questionnaire and SF-36 General Health Questionnaire. Of interest, the severity of lost quality of

life was associated with the severity of the clinical involvement and depended on the presence of a carer (4, 5). Other studies in patients with Friedreich ataxia, the most prevalent recessive ataxia, have also shown lower health-related quality of life in children and adults affected with ataxia (6, 7). As regards to mortality, according to the World Health Organization data for the European Union, the age-adjusted mortality rate attributable to hereditary ataxias was 0,50 per 1 000 000 population (95% CI 0,42 - 0,57) in the time period between 2000 and 2012. This rate was slightly superior for men than for women, and appeared to increase over the time period studied (8).

Hereditary ataxias also represent a significant economic burden for society, the health and social care sector, caregivers and patients. A recent economic analysis from the United Kingdom and Germany of patients living with Friedreich ataxia estimated that the total annual cost was 18 774 € (≈28 500 $) (9). This included direct medical expenses for prescription medications, outpatient consultations, and hospitalisations, along with direct non-medical costs, notably for professional caregiver support, and finally long term adaptation of accommodation and mobility. The most important cost associated with the disorder was that associated with long-term unemployment or work loss since Freidreich ataxia typically begins in teenage or young adulthood.

Despite major genetic advances in the last decades that led to the discovery of over 40 mutated genes involved in dominant ataxias (10), and as many in recessive ataxias, a large number of patients remain without a specific genetic diagnosis. In the systematic review of prevalence studies by Ruano et al. (3), 20 to 92% of patients with a suspected dominant hereditary ataxia and 37 to 60% with a suspected recessive ataxia remained without a molecular diagnosis after extensive evaluation and genetic testing. This proportion varied according to geographical areas, possibly secondary to clusters of specific disorders and variability in the depth of the investigation method. For example, in a population-based study from Norway with multisource ascertainment and that included only patients with a positive family history, a precise genetic diagnosis was achieved in only 25% of patients with a standard clinical and genetic evaluation (11). In a Canadian study of 69 hereditary ataxia patients from 60 different families identified through a movement disorders clinic, a genetic diagnosis was obtained in only 26,7% of families, with higher yield in patients with a positive family history (12). Finally, in a more recent genetic study of 319 undiagnosed European cerebellar ataxia patients that had undergone previous extensive work-up, whole-exome sequencing led to a molecular diagnosis in only 28,5% of patients, leaving 71,5% patients with an undefined diagnosis (13). The diagnostic yield was better for patients with certain specific clinical features and those with earlier onset.

The absence of a specific molecular diagnosis has major impacts for patients, which will receive a tentative diagnosis of familial or sporadic ataxia with early or late onset, depending on the presence of a family history and age at symptom onset (14). Although no study has specifically evaluated this phenomenon in the ataxia population, the results of a recent nationwide survey of 462 Australian children living with a rare disease provide evidence as to the impact of absent or delayed diagnosis on patients and families (15). In this study, 37% of respondents believed that diagnosis was delayed, 27% initially received a wrong diagnosis, and 7% remained undiagnosed. The most common reported consequences included anxiety, frustration, and stress. Respondents also reported worsening of symptoms, disease progression, delays in treatment and intervention, inappropriate treatments received, additional medical costs, impact on family relationships and siblings, and extra unnecessary diagnostic tests. In adult patients, data regarding the impact of a long diagnostic odyssey come from the analysis of delayed diagnosis in patients with amyotrophic lateral sclerosis (ALS), another neurodegenerative disorder associated with severe functional impairment and for which no cure is available. Patients with delayed diagnosis in ALS have reported protracted periods of uncertainty, impression of lack of knowledge by physicians, and additional costs (16). In contrast, diagnosed patients reported satisfaction at having a label for their condition as opposed to diagnostic uncertainty, easier coping mechanisms once they knew their diagnosis, clarified expectations, and facilitated help demands with a precise diagnosis (17). We can conclude that undiagnosed patients with hereditary cerebellar ataxias are faced with major uncertainty regarding the expected evolution and risk of premature death, which may cause anxiety and frustration. They may experience anguish regarding the existence of disease-modifying treatment options from which they are denied. They may be subjected to additional invasive testing or inadequate treatments. They may engage additional costs for medical opinion, tests and treatments. Finally, they cannot have adequate genetic counselling and prenatal testing when applicable.

In order for physicians to be able to diagnose effectively patients with hereditary cerebellar ataxias, they must have access to an adequate knowledge base of the individual disorders and a systematic organization that enable non-expert clinicians to navigate this complex group of diseases. In the previously discussed study by Kurynski et al. of Australian children with rare diseases, the most frequent perceived reason for delayed diagnosis was the lack of knowledge among health professionals regarding the patient’s rare condition (15). Hence, it is essential to better define the typical and atypical phenotypic presentations of rare disorders, but also to develop useful classification systems for both physicians and researchers to gain a better understanding of these disorders.

There are different ways to define and categorize disorders. Before the development of molecular genetics, most disorders were defined according to clinical syndromes or pathogenic enzymatic defects. With the discovery of the underlying genetic mutation in a growing number of patients with hereditary disorders, the diseases are now defined according to the mutated gene and compiled in large online databases. This gene-based definition of disorders offers important advantages: it can be tested in a standardized manner for the presence of a mutation and is directly related to the pathogenic defect. Nevertheless, it is important to highlight that there are important variations in the clinical presentation and penetrance among patients with different mutations in the same gene, and even among patients with the same mutation. What is more, genetic variations of unknown significance are often identified in genes associated with hereditary disorders and their clinical relevance is difficult to clarify for the clinician. With the multiplication of genes involved in complex categories of disorders such as hereditary ataxias, it has become strenuous for the non- expert and even the expert clinician to maintain sufficient mastery of each disorder to adequately order and interpret test results in order to obtain a precise molecular diagnosis. To facilitate this, clinical or phenotypical classifications categorize gene-defined disorders in a meaningful way according to the presence of specific clinical and paraclinical features to give structure to the diagnostic approach of a group of disorders. Finally, as many of these disorders are individually rare, it is difficult to obtain funding and recruit adequate numbers of patients for the development of disease-modifying therapies. Hence, a pathophysiological classification that regroups disorders with common treatment targets is useful to develop adequately powered clinical trials or drug repurposing strategies. Hence, each of these classification systems presents important advantages, serves a specific purpose, and is in fact complementary to the others.

Previous classification systems have been proposed for hereditary cerebellar ataxias. In dominant ataxias, disorders have been regrouped according to the mutation type, distinguishing polyglutamine repeat expansion and conventional mutations (18), or according to clinical presentation, separating pure cerebellar phenotypes from those with associated features (19). On the opposite, the classification of recessive ataxias has proven to be a significant challenge owing to several reasons. Indeed, contrarily to their dominant counterparts who were named in a systematic numerical pattern – with SCA 1 to 47 listed to this day (20)– that defined the included disorders, recessive ataxias remained an ill-defined group of disorders that were named according to physicians’ surnames, areas of high prevalence, or dominant clinical signs. Moreover, recessive ataxias present with complex phenotypes and frequent multisystem involvement, showing partial overlap with other disease categories that may present with ataxia, such as hereditary spastic

paraplegias or inborn errors of metabolism. Finally, many recessive congenital disorders that present with cerebellar malformations may or may not be included depending on the goal and criteria of the classification. Hence, previous tentative classifications of recessive ataxias presented only the most prevalent disorders with incomplete assessment of the literature and underrecognition of rare or geographically circumscribed disorders (21-23). Isolated tentative classifications presented a variable list of included disorders and were not uniformly adopted owing to the absence of a consensus among experts in this field. This highlighted the need for a consensus on a recessive ataxia classification that would be useful for clinicians, researchers, and learners alike.

The other central issue for adequate diagnosis of hereditary ataxias is that several disorders remain with an incomplete or partial phenotypic characterization. Indeed, some are described only in rare families with superficial characterization, such that the range of clinical involvement remains unknown and that different phenotypes with atypical features are underrecognized. There exist many examples in the literature of disorders that were described with an initial typical phenotype, but where subsequent data showed that other clinical pictures were as prevalent if not more. For example, autosomal recessive cerebellar ataxia 1 associated with SYNE1 mutations, was initially described as a pure cerebellar ataxia (24), but subsequent data showed that motor neuron involvement was found in a majority of patients and associated with very severe neuromuscular involvement in some (25). Hence, proper phenotypic characterization is essential to facilitate diagnosis and to adequately manage patients by answering questions regarding expected evolution and symptomatic involvement, searching for subtle involvement that may be amenable to treatment, and addressing symptoms that patients may not associate with their neurological disease. It also provides additional elements to understand the underlying disease mechanism with the ultimate objective to develop disease-modifying therapies.

My perspective in completing the work that composes this master’s thesis was to address the complex issue of underdiagnosis in patients with hereditary ataxias. Hence, the general objective of this master’s thesis is to expand our understanding and knowledge of the presentation of hereditary ataxias through the development of a classification for recessive cerebellar ataxias and the phenotypical characterization of a specific ataxia in the French Canadian population. More specifically, I will present three articles that have been published or that are currently under review. The first one is a systematic scoping review of the literature on recessive cerebellar ataxia that aimed to identify all cerebellar disorders that should be included in a recessive ataxia classification. The second one presents a new classification of recessive cerebellar ataxias that was endorsed by a dedicated international Task Force. Finally, the third one aims at defining the phenotypical

description of a specific cerebellar ataxia in the French-Canadian population with new atypical features and in-depth cognitive assessment.

Chapter 1 Reviewing the evidence: a systematic scoping review of the literature on recessive cerebellar ataxias

Original title Systematic review of autosomal recessive ataxias and proposal for a classification

1.1 Résumé Introduction La classification des ataxies cérébelleuses autosomiques récessives représente un défi particulier vu l’hétérogénéité génétique importante et les phénotypes complexes des pathologies rencontrées. Nous avons réalisé une revue systématique de la littérature pour identifier l’ensemble des ataxies récessives préalablement décrites afin de proposer une classification clinique de ce groupe de pathologies et de mieux définir ce champ de recherche à l’ère des technologies de séquençage de nouvelle génération.

Méthodes Nous avons interrogé Pubmed et Embase afin d’identifier les articles originaux portant sur la description d’ataxies à transmission autosomique récessive chez l’humain pour lesquelles un gène avait été identifié. Nous avons également révisé les listes de références des articles sélectionnés ainsi que les bases de données publiques, notamment OMIM et GeneReviews. Pour chaque pathologie considérée, nous avons révisé la description clinique pour déterminer si l’ataxie cérébelleuse était un élément central du phénotype et avons évalué la qualité de l’évidence supportant l’association avec le gène impliqué. Les pathologies incluses étaient regroupées en trois catégories : les ataxies récessives primaires, les maladies complexes ou multisystémiques fréquemment associées à l’ataxie, et les maladies pouvant occasionnellement présenter un tableau ataxique.

Résultats Après le retrait des doublons, 2354 références ont été révisées sur la base du titre et du résumé pour évaluer leur éligibilité. Au final, 130 articles ont été révisés en entier et inclus dans cette analyse qualitative. La nouvelle liste des ataxies récessives primaires inclut 45 pathologies génétiques pour lesquelles l’ataxie cérébelleuse est au cœur du phénotype clinique. Vingt maladies complexes ou multisystémiques fréquemment associées à l’ataxie ont également été identifiées, ainsi que neuf maladies pouvant occasionnellement présenter un tableau ataxique. Un algorithme clinique basé sur les symptômes associés est également proposé.

Conclusion Cette revue systématique de la littérature des ataxies cérébelleuses récessives a permis de définir et de classifier ce groupe de maladies tout en mettant en évidence la complexité des phénotypes et la diversité des atteintes associées. Cette revue systématique devrait être instrumentale dans le développement d’un consensus sur la classification des ataxies récessives.

1.2 Abstract Introduction The classification of autosomal recessive ataxias represents a significant challenge because of high genetic heterogeneity and complex phenotypes. We conducted a comprehensive systematic review of the literature to examine all recessive ataxias in order to propose a new classification and properly circumscribe this field as new technologies are emerging for comprehensive targeted gene testing.

Methods We searched Pubmed and Embase to identify original articles on recessive forms of ataxia in humans for which a causative gene had been identified. Reference lists and public databases, including OMIM and GeneReviews, were also reviewed. We evaluated the clinical descriptions to determine if ataxia was a core feature of the phenotype and assessed the available evidence on the genotype-phenotype association. Included disorders were classified as primary recessive ataxias, as other complex movement or multisystem disorders with prominent ataxia, or as disorders that may occasionally present with ataxia.

Results After removal of duplicates, 2354 references were reviewed and assessed for inclusion. A total of 130 articles were completely reviewed and included in this qualitative analysis. The proposed new list of autosomal recessive ataxias includes 45 gene-defined disorders for which ataxia is a core presenting feature. Twenty complex or multisystem recessive disorders that have prominent ataxia were also identified along with nine recessive disorders that may occasionally present with ataxia, but where ataxia is a secondary feature. We propose a clinical algorithm based on the associated symptoms.

Conclusion We present a new classification for autosomal recessive ataxias that brings awareness to their complex phenotypes while providing a unified categorization of this group of disorders. This review should assist in the development of a consensus around a classification useful in both clinical and research applications.

1.3 Background The classification of the hereditary ataxias has represented a challenge for decades due to the large heterogeneity of clinical presentations and the important overlap between different pathologies (1). The first to propose a global classification for this group of disorders was Greenfield in 1954, whose classification was based on pathoanatomical findings (2). This was followed by Harding’s classification in 1983, which regrouped the ataxias according to age of onset, as a proxy for mode of inheritance, and clinical findings (3). Although this clinical classification had merit, it quickly became overshadowed by a nomenclature based on gene discoveries within each specific type of ataxia starting with ATXN1 in Spinocerebellar ataxia 1 in 1993 (4) and FXN in Friedreich ataxia (5). Since then, over 40 genes have been discovered in the dominant ataxias and as many in recessive ataxias (6).

One of the main challenges in the study of recessive ataxias is the difficulty to properly circumscribe which disorders belong to the field of hereditary ataxias and which belong to other disease categories. Indeed, ataxia is a cardinal symptom in cerebellar disorders, but may also be a presenting symptom of hereditary spastic paraplegias, hereditary polyneuropathies, neurodevelopmental disorders, and mitochondrial diseases, for example. Concurrently, recessive ataxias often manifest with complex phenotypes, even more so than their dominant counterparts, and may present diverse associated features including neuropathy, pyramidal and extrapyramidal involvement, oculomotor abnormalities, cognitive involvement, seizures, retinopathy, hypogonadism, and many others. This explains the high variability in the list of included disorders in recent literature reviews on recessive ataxias(7, 8).

Nevertheless, the advent of next generation sequencing techniques requires to properly determine which disorders belong to each disease category in order to design thoughtful targeted panels and facilitate the interpretation of whole exome and whole genome sequencing data. Indeed, targeted panel sequencing is a highly effective method for the diagnosis of neurological disorders, but it requires insightful categorization of disease phenotypes to respond to the specific needs of clinicians (9, 10). Similarly, the interpretation of unknown variants in the analysis of whole exome

or whole genome sequencing data poses a significant challenge for clinicians who must determine if the gene is associated with the suspected disease category and if the phenotype correlates with what has previously been described. As next generation sequencing techniques become increasingly available and the ability to detect DNA repeat expansion diseases improves (11), the proper classification of diseases will represent a useful tool in the interpretation of test results. Hence, this calls for a systematic effort to review recessive diseases in which ataxia is a prominent feature in order for experts in the field to collectively determine which disorders should be included in a recessive ataxia classification.

Therefore, the purpose of this article is to review the literature on recessive diseases presenting with ataxia in order to present a new classification. The goal is to bring together experts for the development of a much-needed consensus that fulfills research and clinical needs.

1.4 Methods We conducted a systematic scoping review to identify articles relevant to the classification of autosomal recessive ataxias. We searched Pubmed and Embase from inception to September 2016 in order to identify original articles on disorders presenting with ataxia. The search strategy was large and targeted both recessive and sporadic ataxias, since recessive inheritance may appear sporadic in certain circumstances (full search strategy is provided in Additional file 1). We also reviewed reference lists of relevant articles and public databases including OMIM and GeneReviews to identify other relevant articles.

We reviewed the titles and abstracts of all identified references to select original articles on recessive forms of ataxia in humans for which a causative gene was identified. We evaluated the articles from a clinical perspective to determine if cerebellar ataxia was a prominent feature in the reported patients or rather a secondary finding in other movement or multisystem diseases. Diseases reporting only on cerebellar atrophy or cerebellar malformations without any clinical correlate were not included. For each listed disorder, we reviewed the evidence for a genotype-phenotype association using the US National Human Genome Research Institute guidelines (12). Major considerations included the exclusion of previously described genes, the number of unrelated individuals described with similar genotype-phenotype correlations, the evidence of segregation with the disease, the absence of the variant in large control cohorts, and the presence of biochemical or animal-model functional validation. For the primary ataxias, we identified two relevant references from different research groups when possible. All relevant articles were fully reviewed to be included in this classification of recessive ataxias.

Identified disorders were classified in three categories: the first included the primary autosomal recessive ataxias, the second included other movement or multisystem recessive diseases that have prominent ataxia, and the final group was composed of recessive disorders that may occasionally present with ataxia, but where ataxia is a secondary feature.

We also developed a clinical algorithm for the primary recessive ataxias based on the most frequent phenotype and cardinal symptoms associated with each disorder. The objective of this algorithm is to rapidly summarize the main discriminatory features between different ataxias to serve in a clinical setting, but also as a pedagogical and research tool.

1.5 Results 3750 references were identified through the literature search in Pubmed and Embase, and 49 additional references were identified through reference lists or public databases. After removal of duplicates, 2354 references were reviewed on the basis of title and abstract. Finally, 130 articles were selected on the basis of the aforementioned criteria and completely reviewed to be included in this qualitative analysis (Figure 1.1).

Figure 1.1 Flow diagram

The proposed new list of autosomal recessive ataxias is presented in Table 1.1 in chronological order of gene discovery. The disorders included in this list were evaluated as having a relatively predominant cerebellar involvement compared to the involvement of other neurologic and non- neurologic systems. Table 1.2 presents the other complex motor or multisystem disorders that have prominent ataxia. Finally, Table 1.3 presents disorders that may occasionally present with ataxia, but where ataxia is a secondary feature. Certain decisions were made in the elaboration of this classification. Notably, abetalipoproteinemia (ABL) and Refsum disease were not included in the list of primary recessive ataxias, but rather in the list of complex disorders that have prominent ataxia. Indeed, despite their important Friedreich-like neurological picture, these disorders are primary lipid metabolism disorders with multisystem involvement. Moreover, ataxic disorders that are allelic to other movement disorders, especially spinocerebellar ataxias and hereditary spastic paraplegias, were assigned to the second category to avoid any confusion with the primary recessive ataxias. The MARS2-linked autosomal recessive ataxia with leukoencephalopathy (ARSAL/SPAX3) was not included because the genetic evidence was deemed insufficient (13). Finally, some disorders described only in single families were included, despite this being a factor for weaker genetic evidence, if other major considerations were met; this was indicated in the list.

Table 1.1 Proposed new list of autosomal recessive ataxias

Table 1.2 Other complex movement or multisystem recessive disorders that have prominent ataxia

Table 1.3 Recessive disorders that may occasionally present with ataxia, but where ataxia is a secondary feature

The primary recessive ataxias were also organized in a clinical algorithm (Figure 1.2) according to the presence of key clinical clues, which include the presence of sensorimotor involvement, cognitive impairment, spasticity, and oculomotor abnormalities.

Figure 1.2. Clinical algorithm of autosomal recessive ataxias

Other disorders have been reported with ataxia, but the authors evaluated that these disorders did not need to be included in the differential diagnosis of recessive ataxias. However, clinicians may bear in mind that the following may have ataxia as an associated feature: Lafora disease (EPM2A, EPM2B), megalencephalic leukoencephalopathy with subcortical cysts (MLC1), COL18A1-linked ataxia epilepsy cognitive problems and visual problems, Perrault syndrome (HSD17B4), Zellweger- spectrum disorders (PEX2), Wolfram syndrome (WFS1), Canavan disease (ASPA), metachromatic leukodystrophy (ARSA), Galloway-Mowat syndrome (WDR73), and GLUT-1 deficiency (SCL2A1).

1.6 Discussion We present a new classification for the autosomal recessive ataxias. This classification should allow for better categorization of recessive disorders presenting with ataxia with a clear separation between the primary recessive ataxias and disorders that may present with ataxia as an associated feature but belong to other disease categories. We also provided a clinical algorithm as a tool for diagnostic, learning, and research purposes. This comprehensive classification will allow for improved genetic diagnosis by targeted next generation sequencing applications as the ability to detect DNA repeat expansion diseases is quickly becoming a reality with prospects of treatment in the future (11, 14, 15).

As compared to previously published reports on this subject (7, 8), we systematically reviewed the literature to evaluate the available evidence on the disease-associated genes in order to include all disorders presenting with a predominant cerebellar ataxia phenotype. The systematic review methodology with a structured data search and comprehensive evaluation of all references allowed

for a complete evaluation of the literature regarding disorders presenting with ataxia to ensure that all potentially relevant disorders were included in this classification. Nevertheless, some methodological elements were not applicable to the task at hand. For example, two references were selected for each primary recessive ataxia, and articles that provided evidence for a separated genetic basis with a clinical corollary of ataxia were preferred. Therefore, some articles that provided only detailed clinical description were not included. Moreover, inclusion criteria were clearly defined but there remained a large place for interpretation to determine if cerebellar ataxia was a core feature of the phenotype and if the genotype-phenotype association was convincing. Thus, the classification of individual disorders between the three groups, i.e. as a recessive ataxia, a complex disorder with predominant ataxia or a disorder where ataxia is a secondary feature, remains a subjective appreciation and is open for discussion by a dedicated task force in order to reach a consensus. Finally, the search strategy was designed to be as sensible as possible, but ataxia is a frequent symptom in neurology, and it is possible that other ataxia-associated disorders could be considered for inclusion.

Important challenges remain to be addressed. First, the nosology of recessive ataxias is still highly confusing. Contrary to the dominantly inherited spinocerebellar ataxias, no universal acronym was adopted in the field of recessive ataxias, such that disorders were named based on the author who first described them, on regions of high prevalence, or according to clinical presentation. In the last few years, the term spinocerebellar ataxia, autosomal recessive (SCAR) was used to designate novel recessive ataxias, but this nomenclature did not include the previously described and most frequent ataxias. Moreover, as SCAR assignation was based on locus discovery, some of the included SCARs do not correspond to an identified gene. The term SPAX has also been used to designate ataxias with a strong spasticity component, irrespectively of their mode of inheritance. Recently, the International Parkinson and Movement Disorder Society Task Force for Nomenclature of Genetic Movement Disorders recommended a nomenclature with a gene suffix in order to overcome the shortcomings of the numbered locus system, which include erroneously assigned loci, the mingling of causative and risk factor genes, unconfirmed causative associations, and inconsistent phenotypic correlations (16). These concerns are justified, although numbered naming systems present definite advantages for ease of use and proper delineation of the field. The nomenclature of recessive ataxias should be discussed by a dedicated task force of international experts in order to develop a naming system that reflects the complexity of the recessive ataxia phenotypes while allowing convenient clinical use.

Finally, large phenotypic variability exists between patients from different families and even from a single family with the same mutated gene, depending on the type of mutation and on its location in the gene. Other factors that affect age at onset and clinical course probably include the presence of modifier genes and environmental exposures. Hence, one could argue that the paradigm of one gene-one disease presented here does not reflect all the phenotypic variability observed, and could as well be replaced by the concept of one patient-one disease as we identify new genetic and environmental prognostic features that characterise more precisely the age at onset, evolution, and response to treatment. Such developments are likely to modify our understanding of genetic disorders and of their classification.

1.7 Conclusion We present herein a classification of the autosomal recessive ataxias based on a systematic scoping review of the literature. This work should serve as a framework for scientific discussion in order to bring together experts for the establishment of a much-needed consensus in this field.

1.8 Tables

Table 1.1 Proposed new list of autosomal recessive ataxias

Relevant Disorder Gene OMIM Additional clinical features and neuroimaging findings references CTX CYP27A1 213700 Dementia, paresis, tendon xanthomas, atherosclerosis, cataracts, (17,18) elevated cholestanol level, childhood onset, variable cerebellar atrophy, cerebellar or cerebral leukodystrophy AVED TTPA 277460 Retinitis pigmentosa, head titubation, low serum vitamin E, teenage (19, 20) onset, spinal cord atrophy, absence of cerebellar atrophy AT ATM 208900 Telangiectasias, oculomotor apraxia, photosensitivity, (21, 22) immunodeficiency, predisposition for cancer, elevation of α- foetoprotein, infantile onset, cerebellar atrophy FRDA FXN 229300 Bilateral Babinski sign, square-wave jerks, scoliosis, hypertrophic (5, 23) cardiomyopathy, sensory involvement, teenage onset, spinal cord atrophy, absence of cerebellar atrophy ATLD MRE11 604391 Oculomotor apraxia, childhood onset, cerebellar atrophy (24, 25) ARSACS SACS 270550 Spastic paraparesis, retinal striation, pes cavus, infantile or childhood (26, 27) onset, anterior superior cerebellar atrophy, occasional T2-weighted linear hypointensities in pons AOA1/EAOH APTX 208920 Oculomotor apraxia, cognitive impairment, hypoalbuminemia, (28, 29) hypercholesterolemia, childhood onset, cerebellar atrophy SCAN1 TDP1 607250 Peripheral axonal sensorimotor neuropathy, distal muscular atrophy, (30, 31) hypercholesterolemia, teenage onset, cerebellar atrophy Cayman ataxia ATCAY 601238 Psychomotor retardation, hypotonia, strabismus, neonatal onset, (32, 33) cerebellar hypoplasia SANDO POLG1 607459 Sensory ataxia, ophthalmoparesis, myoclonus, ptosis, adult onset, (34, 35) variable cerebellar atrophy, cerebellar white matter lesions, stroke- or MIRAS/SCAE like lesions In MIRAS, cerebellar and sensitive ataxia, epilepsy, migraine, myoclonus, childhood or teenage onset, signal abnormalities in cerebellum and thalamus AOA2 SETX 606002 Polyneuropathy, pyramidal signs, oculomotor apraxia, head tremor, (36, 37)

chorea, dystonia, elevation of α-foetoprotein, teenage onset, cerebellar atrophy CAMRQ1, DES VLDLR 224050 Non-progressive cerebellar ataxia, mental retardation, hypotonia, (38, 39) strabismus, occasional quadripedal gait, congenital onset, inferior cerebellar hypoplasia, cortical gyral simplification IOSCA/MTDPS7 C10orf2 271245 Athetosis, hypotonia, optic atrophy, ophthalmoplegia, hearing loss, (40, 41) (Allelic to epilepsy, hypogonadism, liver involvement, infantile onset, moderate PEOA3) atrophy of brainstem and cerebellum with advancing disease MSS SIL1 248800 Cataracts, mental retardation, myopathy, short stature, childhood (42, 43) onset, cerebellar atrophy DCMA/MGCA5 DNAJC19 610198 Dilated cardiomyopathy, non-progressive cerebellar ataxia, mental (44, 45) retardation, testicular dysgenesis, anemia, increased urinary 3- methylglutaconic acid, infantile onset ARCA1 SYNE1 610743 Pure cerebellar ataxia, cognitive impairment, occasional pyramidal (46, 47) signs, late onset, cerebellar atrophy ARCA2 ADCK3 612016 Exercise intolerance, epilepsy, myoclonus, cognitive impairment, (48, 49) (CABC1) childhood onset, cerebellar atrophy, occasional stroke-like cerebral lesions SeSAME KCNJ10 612780 Epilepsy, sensorineural deafness, mental retardation, tubulopathy and (50, 51) syndrome electrolyte imbalance, infantile onset, absence of cerebellar atrophy CAMRQ3 CA8 613227 Mild mental retardation, occasional quadrupedal gait, congenital (52, 53) onset, cerebellar atrophy, white matter abnormalities Salih ataxia/ KIAA0226 615705 Epilepsy, mental retardation, childhood onset, absence of cerebellar (54, 55) SCAR15 atrophy (1 family) PHARC ABHD12 612674 Sensorimotor neuropathy, cataract, hearing loss, retinitis pigmentosa, (56, 57) teenage onset, variable cerebellar atrophy SPAX4 MTPAP 613672 Spastic paraparesis, optic atrophy, cognitive involvement, infantile (58, 59) (1 family) onset ARCA3 ANO10 613728 Cognitive impairment, downbeat nystagmus, teenage or adult onset, (60, 61) cerebellar atrophy SCAR11 (1 SYT14 614229 Psychomotor retardation, late onset, cerebellar atrophy (62) family) CAMRQ2 WDR81 610185 Occasional quadrupedal gait, cognitive impairment, congenital onset, (63, 64) hypoplasia of cerebellum and corpus callosum AOA3 (1 family) PIK3R5 615217 Oculomotor apraxia, sensorimotor involvement, teenage onset, (65) cerebellar atrophy SCAR13 GRM1 614831 Cognitive impairment, mild pyramidal signs, short stature, seizures, (66, 67) congenital onset, cerebellar atrophy CAMRQ4 ATP8A2 615268 Cognitive impairment, occasional quadrupedal gait, congenital onset, (68) (1 family) cerebellar and cerebral atrophy SCAR7 TPP1 609270 Pyramidal signs, posterior column involvement, tremor, childhood (69, 70) (Allelic to CLN2) onset, atrophy of the cerebellum and pons Ataxia and RNF216 212840 Hypogonadotropic hypogonadism, dementia, occasional chorea, (71, 72) hypogonado- childhood to young adult onset, cerebellar and cerebral atrophy tropism SCAR18 GRID2 616204 Tonic upgaze, psychomotor retardation, retinal dystrophy, infantile (73, 74) onset, cerebellar atrophy SCAR16 STUB1 615768 Pyramidal signs, neuropathy, occasional hypogonadism, variable age (75, 76) at onset, cerebellar atrophy SCAR12 WWOX 614322 Tonic-clonic epilepsy, mental retardation, spasticity, neonatal to (77, 78) childhood onset, variable cerebellar or cerebral atrophy ATLD2 PCNA 615919 Telangiectasias, sensorineural hearing loss, photosensitivity, (79) (1 family) cognitive impairment, short stature, childhood onset, cerebellar atrophy SCAR20 SNX14 616354 Mental retardation, sensorineural hearing loss, macrocephaly, (80, 81) dysmorphism, infantile onset, cerebellar atrophy SCAR17 CWF19L1 616127 Mental retardation, congenital onset, cerebellar hypoplasia (82, 83) ACPHD DNAJC3 616192 Diabetes mellitus, UMN signs, demyelinating neuropathy, (84)

(1 family) sensorineural hearing loss, childhood to adult onset, generalized supra- and infratentorial atrophy LIKNS/SCAR19 SLC9A1 616291 Sensorineural hearing loss, childhood onset, variable vermian (85) (1 family) atrophy AOA4 PNKP 616267 Dystonia, oculomotor apraxia, polyneuropathy, cognitive (86, 87) (Allelic to impairment, childhood onset, cerebellar atrophy MCSZ) SCAR2 PMPCA 213200 Non-progressive cerebellar ataxia, cognitive impairment, pyramidal (88, 89) signs, short stature, congenital or infantile onset, cerebellar atrophy SCAR21 SCYL1 616719 Liver failure, peripheral neuropathy, mild cognitive impairment, (90) childhood onset, cerebellar vermis atrophy, thinning of optic nerve SCAR22 VWA3B 616948 Cognitive impairment, pyramidal signs, adult onset, cerebellar (91) (1 family) atrophy and thin corpus callosum SCAR23 TDP2 616949 Tonic seizures, cognitive impairment, dysmorphism, childhood onset (92) (1 family) SCAR24 UBA5 617133 Cataracts, peripheral neuropathy, childhood onset, cerebellar atrophy (93) (1 family) Cerebellar ataxia THG1L - Psychomotor retardation, pyramidal signs, childhood onset, vermis (94) hypoplasia with developmental delay (1 family) ACPHD Ataxia, combined cerebellar and peripheral with hearing loss and diabetes mellitus; AOA ataxia with oculomotor apraxia; ARCA autosomal recessive cerebellar ataxia; ARSACS autosomal recessive spastic ataxia of Charlevoix- Saguenay; AT ataxia-telangiectasia; ATLD ataxia-telangiectasia-like disorder; AVED ataxia with vitamin E deficiency; CA Cayman ataxia; CAMOS cerebellar ataxia mental retardation optic atrophy and skin abnormalities; CAMRQ cerebellar ataxia mental retardation with or without quadrupedal locomotion; DCMA Dilated cardiomyopathy with ataxia; DES Desequilibrium syndrome; EAOH Early-onset ataxia with oculomotor apraxia and hypoalbuminemia FRDA Friedreich ataxia; IOSCA infantile onset spinocerebellar ataxia; LIKNS Lichtenstein-Knorr syndrome; MGCA5 3-methyglutaconic aciduria type 5; MIRAS mitochondrial recessive ataxia syndrome; MCSZ Microchephaly seizures developmental delay; MSS Marinesco-Sjogren syndrome; MTDPS7 mitochondrial DNA depletion syndrome 7; PEOA3 progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 3; PHARC polyneuropathy hearing loss ataxia retinitis pigmentosa and cataract; SANDO sensory ataxic neuropathy with dysarthria and ophthalmoparesis; SCAE spinocerebellar ataxia with epilepsy SCAN1 spinocerebellar ataxia with axonal neuropathy 1; SCAR Spinocerebellar ataxia, autosomal recessive; SeSAME Seizures sensorineural deafness ataxia mental retardation and electrolyte imbalance; SPAX spastic ataxia; UMN upper motor neuron.

Table 1.2 Other complex movement or multisystem recessive disorders that have prominent ataxia

Disorder Gene OMIM Clinical features and imaging findings Comment References Abetalipopro- MTTP 200100 Fat malabsorption symptoms, hypocholesterolemia, Multisystem (95) teinemia hypotriglyceridemia, acanthocytosis, Friedreich- like ataxia, neonatal onset, absence of cerebellar atrophy Nieman Pick NPC1 257220 Vertical supranuclear ophthalmoplegia, ataxia, Multisystem (96, 97) splenomegaly, childhood to adult onset, variable type C NPC2 607625 cerebellar or cerebral atrophy Refsum disease PAHX 266500 Retinitis pigmentosa, polyneuropathy, ataxia, Multisystem (98, 99) increased CSF protein, anosmia, deafness, ichtyosis, teenage onset, elevated serum phytanic acid, absence of cerebellar atrophy Late-onset HEXA 272800 Ataxia, dysarthria, intellectual impairment, Lysosomal (100-102) GM2 HEXB 268800 extrapyramidal signs, adult onset, cerebellar storage gangliosidosis atrophy disease (Tay-Sachs, Sandhoff) SPARCA1 SPTBN2 615386 Ataxia, cognitive impairment, eye-movement Allelic to (9, 103) abnormalities, early childhood onset, cerebellar SCA5 atrophy SPAX5 AFG3L2 614487 Ataxia, spasticity, oculomotor apraxia, myoclonic Allelic to (104, 105)

epilepsy, neuropathy, dystonia, optic atrophy, SCA28 childhood onset, cerebellar atrophy Boucher- PNPLA6 215470 Ataxia, hypogonadotropic hypogonadism, Allelic to (106, 107) chorioretinal dystrophy or brisk reflexes, childhood Neuhauser/ HSP39 Gordon Holmes onset, atrophy of cerebellum and pons syndrome Gillespie ITPR1 206700 Non-progressive cerebellar ataxia, iris hypoplasia, Allelic to (108) syndrome cognitive impairment, neonatal onset, progressive SCA15/29 cerebellar atrophy SPAX2/ SPG58 KIF1C 611302 Spastic paraparesis, cerebellar ataxia, childhood or Spasticity (109, 110) teenage onset, white matter changes in the internal predominant capsule SPG7 SPG7 607259 Spasticity, pyramidal signs, cerebellar signs, optic HSP (111, 112) neuropathy, ptosis, teenage or adult onset, cerebellar atrophy SPG5 CYP7B1 270800 Spasticity, cerebellar and sensory ataxia, childhood HSP (113, 114) or teenage onset, white matter lesions SPG11 KIAA1840 604360 Spasticity, ataxia, cognitive impairment, HSP (115, 116) sensorimotor neuropathy, childhood or teenage onset, thin corpus callosum, signal abnormalities in cervical cord SPG46 GBA2 614409 Cerebellar ataxia, spastic dysarthria, mild cognitive HSP (117, 118) impairment, hearing loss, cataracts, childhood onset, cerebellar and cerebral atrophy, thin corpus callosum Congenital PMM2 212065 Psychomotor retardation, axial hypotonia, Neonatal (119, 120) disorders of abnormal eye movements, peripheral neuropathy, onset, glycosylation congenital onset, cerebellar hypoplasia complex type 1A syndrome LBSL DARS2 611105 Cerebellar ataxia, tremor, spasticity, dorsal column Leukoence- (121, 122) dysfunction, axonal neuropathy, childhood to adult phalopathy onset, signal abnormalities in cerebral white matter and specific brainstem and spinal cord tracts Mitochondrial COX20 220110 Cerebellar ataxia, dystonia, sensory axonal Dystonia (123) complex IV neuropathy, variable, childhood or teenage onset, predominant deficiency cerebellar atrophy Aceruloplas- CP 604290 Diabetes, dementia, movement disorder, cerebellar Metabolic (124) minemia ataxia, retinal degeneration, late onset, decreased disorder signal intensity in thalamus, basal ganglia and dentate nucleus Neurodegene- PLA2G6 256600 Cerebellar ataxia, psychomotor retardation, Neurodege- (125, 126) ration with psychiatric features, axonal sensorimotor neration brain iron neuropathy, infantile or teenage onset, cerebellar with brain accumulation atrophy and variable iron accumulation in globus iron pallidus 2A and 2B accumulation Poretti- LAMA1 615960 Nonprogressive ataxia, oculomotor ataxia, Dystrogly- (127) Botshauser psychomotor retardation, early childhood onset, canopathy syndrome cerebellar dysplasia with cysts Posterior FLVCR1 609033 Posterior column degeneration and retinitis Sensory (128, 129) column ataxia pigmentosa, childhood onset, signal abnormalities ataxia with retinitis in cervical spinal cord pigmentosa HSP hereditary spastic paraplegia; LBSL leukoencephalopathy with brainstem and spinal cord involvement and lactate elevation; SPARCA1 spectrin-associated autosomal recessive cerebellar ataxia type 1; SPAX spastic ataxia; SPG spastic paraplegia.

Table 1.3 Recessive disorders that may occasionally present with ataxia, but where ataxia is a secondary feature

Disorder Gene OMIM Clinical features and imaging findings Comment References Neuronal ceroid CLN5 256731 Psychomotor retardation, visual failure, seizures, Ataxia is a (130, 131) childhood to teenage onset, cerebellar and lipofuscinoses CLN6 601780 rare cerebral atrophy feature Sialic acid storage SLC17A5 604369 Hypotonia, cerebellar ataxia and mental Complex (132, 133) retardation, infantile to adult onset, cerebellar diseases (ISSD and 269920 syndrome Salla disease) atrophy and demyelination Joubert syndrome AHI1, Many Ataxia, hypotonia, neonatal breathing Complex (134, 135) ARL13B, abnormalities, mental retardation, neonatal CC2D2A, nephronophtisis, congenital onset, agenesis of the polygenic others cerebellar vermis syndrome Hartnup disorder SLC6A19 234500 Transient manifestations of pellagra, cerebellar Metabolic (136) ataxia and psychosis, amino aciduria, early onset disorder Childhood ataxia elF2B 603896 Cerebellar ataxia with spasticity. Rapid Leukodys- (137, 138) with central deterioration following head trauma or febrile trophy nervous system illness, infantile to adult onset, diffusely hypomyelination/va abnormal cerebral white matter ni-shing white matter disease L-2-Hydroxyglu- L2HGDH 236792 Psychomotor retardation, epilepsy, Metabolic (139, 140) taric aciduria macrocephaly, cerebellar ataxia, infantile onset, disorder subcortical leukoencephalopathy and cerebellar atrophy GOSR2-linked GOSR2 614018 Ataxia, myoclonic epilepsy, raised creatine Epileptic (141) progressive kinase, early childhood onset, variable cerebellar disorder myoclonus epilepsy and cerebral atrophy Tremor-ataxia with POLR3A 607694 Tremor, cerebellar ataxia, cognitive regression, Leukodys- (142) central hypomyeli- UMN signs, childhood onset, hypomyelination of trophy nation deep white matter, cerebellar atrophy, thin corpus callosum Recessive Behr’s OPA1 210000 Optic atrophy, ataxia, peripheral neuropathy, Optic (143, 144) syndrome digestive symptoms, infantile or childhood onset, atrophy cerebellar atrophy

ISSD infantile sialic acid storage disease

1.9 Figures

Figure 1.1 Flow diagram

Records identified through Additional records identified through database searching reference lists, OMIM and GeneReviews (n = 3750) (n = 49)

Records after duplicates removed (n = 2354)

Records screened Records excluded (n = 2354) (n = 2224)

Studies included in qualitative synthesis (n = 130)

Figure 1.2 Clinical algorithm of autosomal recessive ataxias

1.10 Supplementary material

Search strategy for MEDLINE/Pubmed 1. recessive[TIAB] OR sporadic[TIAB] 2. ataxi*[TIAB] OR “spinocerebellar degenerations”[MeSH Major topic] OR “cerebellar ataxia”[MeSH Major topic] 3. gene[TIAB] OR genes[TIAB] OR locus[TIAB] 4. animals[MeSH] NOT humans[MeSH] 1 AND 2 AND 3 NOT 4

1.11 References 1. Online Mendelian Inheritance in Man, OMIM®. McKusick-Nathans Institute of Genetic Medicine, Johns Hopkins University, Baltimore MD. http://omim.org/. Accessed 15 Sep 2016. 2. Greenfield JG. The spinocerebellar degenerations. Oxford: Blackwell; 1954. 3. Harding AE. Classification of the hereditary ataxias and paraplegias. Lancet. 1983;1(8334):1151-5. 4. Orr HT, Chung MY, Banfi S, Kwiatkowski TJ, Jr., Servadio A, Beaudet AL, et al. Expansion of an unstable trinucleotide CAG repeat in spinocerebellar ataxia type 1. Nat Genet. 1993;4(3):221-6. 5. Campuzano V, Montermini L, Molto MD, Pianese L, Cossee M, Cavalcanti F, et al. Friedreich's ataxia: autosomal recessive disease caused by an intronic GAA triplet repeat expansion. Science. 1996;271(5254):1423-7. 6. Bird TD. Hereditary Ataxia Overview. In: Pagon RA, Adam MP, Ardinger HH, Wallace SE, Amemiya A, Bean LJH, et al., editors. GeneReviews(R). Seattle (WA)1993. 7. Anheim M, Tranchant C, Koenig M. The autosomal recessive cerebellar ataxias. N Engl J Med. 2012;366(7):636-46. 8. Vermeer S, van de Warrenburg BP, Willemsen MA, Cluitmans M, Scheffer H, Kremer BP, et al. Autosomal recessive cerebellar ataxias: the current state of affairs. J Med Genet. 2011;48(10):651-9. 9. Nemeth AH, Kwasniewska AC, Lise S, Parolin Schnekenberg R, Becker EB, Bera KD, et al. Next generation sequencing for molecular diagnosis of neurological disorders using ataxias as a model. Brain. 2013;136(Pt 10):3106-18. 10. Ankala A, da Silva C, Gualandi F, Ferlini A, Bean LJ, Collins C, et al. A comprehensive genomic approach for neuromuscular diseases gives a high diagnostic yield. Ann Neurol. 2015;77(2):206-14. 11. Rhoads A, Au KF. PacBio Sequencing and Its Applications. Genomics Proteomics Bioinformatics. 2015;13(5):278-89. 12. MacArthur DG, Manolio TA, Dimmock DP, Rehm HL, Shendure J, Abecasis GR, et al. Guidelines for investigating causality of sequence variants in human disease. Nature. 2014;508(7497):469-76. 13. Bayat V, Thiffault I, Jaiswal M, Tetreault M, Donti T, Sasarman F, et al. Mutations in the mitochondrial methionyl-tRNA synthetase cause a neurodegenerative phenotype in flies and a recessive ataxia (ARSAL) in humans. PLoS Biol. 2012;10(3):e1001288. 14. Cinesi C, Aeschbach L, Yang B, Dion V. Contracting CAG/CTG repeats using the CRISPR-Cas9 nickase. Nat Commun. 2016;7:13272. 15. Loomis EW, Eid JS, Peluso P, Yin J, Hickey L, Rank D, et al. Sequencing the unsequenceable: expanded CGG-repeat alleles of the fragile X gene. Genome Res. 2013;23(1):121- 8. 16. Marras C, Lang A, van de Warrenburg BP, Sue CM, Tabrizi SJ, Bertram L, et al. Nomenclature of genetic movement disorders: Recommendations of the international Parkinson and movement disorder society task force. Mov Disord. 2016;31(4):436-57. 17. Cali JJ, Hsieh CL, Francke U, Russell DW. Mutations in the bile acid biosynthetic enzyme sterol 27-hydroxylase underlie cerebrotendinous xanthomatosis. J Biol Chem. 1991;266(12):7779- 83. 18. Leitersdorf E, Reshef A, Meiner V, Levitzki R, Schwartz SP, Dann EJ, et al. Frameshift and splice-junction mutations in the sterol 27-hydroxylase gene cause cerebrotendinous xanthomatosis in Jews or Moroccan origin. J Clin Invest. 1993;91(6):2488-96. 19. Ouahchi K, Arita M, Kayden H, Hentati F, Ben Hamida M, Sokol R, et al. Ataxia with isolated vitamin E deficiency is caused by mutations in the alpha-tocopherol transfer protein. Nat Genet. 1995;9(2):141-5.

20. Yokota T, Shiojiri T, Gotoda T, Arita M, Arai H, Ohga T, et al. Friedreich-like ataxia with retinitis pigmentosa caused by the His101Gln mutation of the alpha-tocopherol transfer protein gene. Ann Neurol. 1997;41(6):826-32. 21. Savitsky K, Bar-Shira A, Gilad S, Rotman G, Ziv Y, Vanagaite L, et al. A single ataxia telangiectasia gene with a product similar to PI-3 kinase. Science. 1995;268(5218):1749-53. 22. Wright J, Teraoka S, Onengut S, Tolun A, Gatti RA, Ochs HD, et al. A high frequency of distinct ATM gene mutations in ataxia-telangiectasia. Am J Hum Genet. 1996;59(4):839-46. 23. Durr A, Cossee M, Agid Y, Campuzano V, Mignard C, Penet C, et al. Clinical and genetic abnormalities in patients with Friedreich's ataxia. N Engl J Med. 1996;335(16):1169-75. 24. Stewart GS, Maser RS, Stankovic T, Bressan DA, Kaplan MI, Jaspers NG, et al. The DNA double-strand break repair gene hMRE11 is mutated in individuals with an ataxia-telangiectasia- like disorder. Cell. 1999;99(6):577-87. 25. Pitts SA, Kullar HS, Stankovic T, Stewart GS, Last JI, Bedenham T, et al. hMRE11: genomic structure and a null mutation identified in a transcript protected from nonsense-mediated mRNA decay. Hum Mol Genet. 2001;10(11):1155-62. 26. Engert JC, Berube P, Mercier J, Dore C, Lepage P, Ge B, et al. ARSACS, a spastic ataxia common in northeastern Quebec, is caused by mutations in a new gene encoding an 11.5-kb ORF. Nat Genet. 2000;24(2):120-5. 27. Criscuolo C, Banfi S, Orio M, Gasparini P, Monticelli A, Scarano V, et al. A novel mutation in SACS gene in a family from southern Italy. Neurology. 2004;62(1):100-2. 28. Moreira MC, Barbot C, Tachi N, Kozuka N, Uchida E, Gibson T, et al. The gene mutated in ataxia-ocular apraxia 1 encodes the new HIT/Zn-finger protein aprataxin. Nat Genet. 2001;29(2):189-93. 29. Date H, Onodera O, Tanaka H, Iwabuchi K, Uekawa K, Igarashi S, et al. Early-onset ataxia with ocular motor apraxia and hypoalbuminemia is caused by mutations in a new HIT superfamily gene. Nat Genet. 2001;29(2):184-8. 30. Takashima H, Boerkoel CF, John J, Saifi GM, Salih MA, Armstrong D, et al. Mutation of TDP1, encoding a topoisomerase I-dependent DNA damage repair enzyme, in spinocerebellar ataxia with axonal neuropathy. Nat Genet. 2002;32(2):267-72. 31. El-Khamisy SF, Saifi GM, Weinfeld M, Johansson F, Helleday T, Lupski JR, et al. Defective DNA single-strand break repair in spinocerebellar ataxia with axonal neuropathy-1. Nature. 2005;434(7029):108-13. 32. Bomar JM, Benke PJ, Slattery EL, Puttagunta R, Taylor LP, Seong E, et al. Mutations in a novel gene encoding a CRAL-TRIO domain cause human Cayman ataxia and ataxia/dystonia in the jittery mouse. Nat Genet. 2003;35(3):264-9. 33. Manzoor H, Brüggemann N, Hinrichs F, Hussain HMJ, Wajid M, Bäumer T, et al. Exome sequencing reveals homozygous mutations in SACS, ATCAY, and MCOLN1 in three Pakistani families with complex dystonia. Movement Disorders. 2016;31:S535. 34. Van Goethem G, Martin JJ, Dermaut B, Lofgren A, Wibail A, Ververken D, et al. Recessive POLG mutations presenting with sensory and ataxic neuropathy in compound heterozygote patients with progressive external ophthalmoplegia. Neuromuscul Disord. 2003;13(2):133-42. 35. Winterthun S, Ferrari G, He L, Taylor RW, Zeviani M, Turnbull DM, et al. Autosomal recessive mitochondrial ataxic syndrome due to mitochondrial polymerase gamma mutations. Neurology. 2005;64(7):1204-8. 36. Moreira MC, Klur S, Watanabe M, Nemeth AH, Le Ber I, Moniz JC, et al. Senataxin, the ortholog of a yeast RNA helicase, is mutant in ataxia-ocular apraxia 2. Nat Genet. 2004;36(3):225- 7. 37. Le Ber I, Bouslam N, Rivaud-Pechoux S, Guimaraes J, Benomar A, Chamayou C, et al. Frequency and phenotypic spectrum of ataxia with oculomotor apraxia 2: a clinical and genetic study in 18 patients. Brain. 2004;127(Pt 4):759-67.

38. Boycott KM, Flavelle S, Bureau A, Glass HC, Fujiwara TM, Wirrell E, et al. Homozygous deletion of the very low density lipoprotein receptor gene causes autosomal recessive cerebellar hypoplasia with cerebral gyral simplification. Am J Hum Genet. 2005;77(3):477-83. 39. Moheb LA, Tzschach A, Garshasbi M, Kahrizi K, Darvish H, Heshmati Y, et al. Identification of a nonsense mutation in the very low-density lipoprotein receptor gene (VLDLR) in an Iranian family with dysequilibrium syndrome. Eur J Hum Genet. 2008;16(2):270-3. 40. Nikali K, Suomalainen A, Saharinen J, Kuokkanen M, Spelbrink JN, Lonnqvist T, et al. Infantile onset spinocerebellar ataxia is caused by recessive mutations in mitochondrial proteins Twinkle and Twinky. Hum Mol Genet. 2005;14(20):2981-90. 41. Hakonen AH, Isohanni P, Paetau A, Herva R, Suomalainen A, Lonnqvist T. Recessive Twinkle mutations in early onset encephalopathy with mtDNA depletion. Brain. 2007;130(Pt 11):3032-40. 42. Anttonen AK, Mahjneh I, Hamalainen RH, Lagier-Tourenne C, Kopra O, Waris L, et al. The gene disrupted in Marinesco-Sjogren syndrome encodes SIL1, an HSPA5 cochaperone. Nat Genet. 2005;37(12):1309-11. 43. Senderek J, Krieger M, Stendel C, Bergmann C, Moser M, Breitbach-Faller N, et al. Mutations in SIL1 cause Marinesco-Sjogren syndrome, a cerebellar ataxia with cataract and myopathy. Nat Genet. 2005;37(12):1312-4. 44. Davey KM, Parboosingh JS, McLeod DR, Chan A, Casey R, Ferreira P, et al. Mutation of DNAJC19, a human homologue of yeast inner mitochondrial membrane co-chaperones, causes DCMA syndrome, a novel autosomal recessive Barth syndrome-like condition. J Med Genet. 2006;43(5):385-93. 45. Al Teneiji A, Siriwardena K, George K, Mital S, Mercimek-Mahmutoglu S. Progressive cerebellar atrophy and a novel homozygous pathogenic DNAJC19 variant as a cause of dilated cardiomyopathy ataxia syndrome. Pediatr Neurol. 2016;62:58-61. 46. Gros-Louis F, Dupre N, Dion P, Fox MA, Laurent S, Verreault S, et al. Mutations in SYNE1 lead to a newly discovered form of autosomal recessive cerebellar ataxia. Nat Genet. 2007;39(1):80-5. 47. Izumi Y, Miyamoto R, Morino H, Yoshizawa A, Nishinaka K, Udaka F, et al. Cerebellar ataxia with SYNE1 mutation accompanying motor neuron disease. Neurology. 2013;80(1). 48. Lagier-Tourenne C, Tazir M, Lopez LC, Quinzii CM, Assoum M, Drouot N, et al. ADCK3, an ancestral kinase, is mutated in a form of recessive ataxia associated with coenzyme Q10 deficiency. Am J Hum Genet. 2008;82(3):661-72. 49. Mollet J, Delahodde A, Serre V, Chretien D, Schlemmer D, Lombes A, et al. CABC1 gene mutations cause ubiquinone deficiency with cerebellar ataxia and seizures. Am J Hum Genet. 2008;82(3):623-30. 50. Bockenhauer D, Feather S, Stanescu HC, Bandulik S, Zdebik AA, Reichold M, et al. Epilepsy, ataxia, sensorineural deafness, tubulopathy, and KCNJ10 mutations. N Engl J Med. 2009;360(19):1960-70. 51. Scholl UI, Choi M, Liu T, Ramaekers VT, Hausler MG, Grimmer J, et al. Seizures, sensorineural deafness, ataxia, mental retardation, and electrolyte imbalance (SeSAME syndrome) caused by mutations in KCNJ10. Proc Natl Acad Sci U S A. 2009;106(14):5842-7. 52. Turkmen S, Guo G, Garshasbi M, Hoffmann K, Alshalah AJ, Mischung C, et al. CA8 mutations cause a novel syndrome characterized by ataxia and mild mental retardation with predisposition to quadrupedal gait. PLoS Genet. 2009;5(5):e1000487. 53. Kaya N, Aldhalaan H, Al-Younes B, Colak D, Shuaib T, Al-Mohaileb F, et al. Phenotypical spectrum of cerebellar ataxia associated with a novel mutation in the CA8 gene, encoding carbonic anhydrase (CA) VIII. Am J Med Genet B Neuropsychiatr Genet. 2011;156b(7):826-34. 54. Assoum M, Salih MA, Drouot N, H'Mida-Ben Brahim D, Lagier-Tourenne C, AlDrees A, et al. Rundataxin, a novel protein with RUN and diacylglycerol binding domains, is mutant in a new recessive ataxia. Brain. 2010;133(Pt 8):2439-47.

55. Assoum M, Salih MA, Drouot N, Hnia K, Martelli A, Koenig M. The Salih ataxia mutation impairs Rubicon endosomal localization. Cerebellum. 2013;12(6):835-40. 56. Fiskerstrand T, H'Mida-Ben Brahim D, Johansson S, M'Zahem A, Haukanes BI, Drouot N, et al. Mutations in ABHD12 cause the neurodegenerative disease PHARC: An inborn error of endocannabinoid metabolism. Am J Hum Genet. 2010;87(3):410-7. 57. Eisenberger T, Slim R, Mansour A, Nauck M, Nurnberg G, Nurnberg P, et al. Targeted next-generation sequencing identifies a homozygous nonsense mutation in ABHD12, the gene underlying PHARC, in a family clinically diagnosed with Usher syndrome type 3. Orphanet J Rare Dis. 2012;7:59. 58. Crosby AH, Patel H, Chioza BA, Proukakis C, Gurtz K, Patton MA, et al. Defective mitochondrial mRNA maturation is associated with spastic ataxia. Am J Hum Genet. 2010;87(5):655-60. 59. Wilson WC, Hornig-Do HT, Bruni F, Chang JH, Jourdain AA, Martinou JC, et al. A human mitochondrial poly(A) polymerase mutation reveals the complexities of post-transcriptional mitochondrial gene expression. Hum Mol Genet. 2014;23(23):6345-55. 60. Vermeer S, Hoischen A, Meijer RP, Gilissen C, Neveling K, Wieskamp N, et al. Targeted next-generation sequencing of a 12.5 Mb homozygous region reveals ANO10 mutations in patients with autosomal-recessive cerebellar ataxia. Am J Hum Genet. 2010;87(6):813-9. 61. Chamova T, Florez L, Guergueltcheva V, Raycheva M, Kaneva R, Lochmuller H, et al. ANO10 c.1150_1151del is a founder mutation causing autosomal recessive cerebellar ataxia in Roma/Gypsies. J Neurol. 2012;259(5):906-11. 62. Doi H, Yoshida K, Yasuda T, Fukuda M, Fukuda Y, Morita H, et al. Exome sequencing reveals a homozygous SYT14 mutation in adult-onset, autosomal-recessive spinocerebellar ataxia with psychomotor retardation. Am J Hum Genet. 2011;89(2):320-7. 63. Gulsuner S, Tekinay AB, Doerschner K, Boyaci H, Bilguvar K, Unal H, et al. Homozygosity mapping and targeted genomic sequencing reveal the gene responsible for cerebellar hypoplasia and quadrupedal locomotion in a consanguineous kindred. Genome Res. 2011;21(12):1995-2003. 64. Komara M, John A, Suleiman J, Ali BR, Al-Gazali L. Clinical and molecular delineation of dysequilibrium syndrome type 2 and profound sensorineural hearing loss in an inbred Arab family. Am J Med Genet A. 2016;170a(2):540-3. 65. Al Tassan N, Khalil D, Shinwari J, Al Sharif L, Bavi P, Abduljaleel Z, et al. A missense mutation in PIK3R5 gene in a family with ataxia and oculomotor apraxia. Hum Mutat. 2012;33(2):351-4. 66. Guergueltcheva V, Azmanov DN, Angelicheva D, Smith KR, Chamova T, Florez L, et al. Autosomal-recessive congenital cerebellar ataxia is caused by mutations in metabotropic glutamate receptor 1. Am J Hum Genet. 2012;91(3):553-64. 67. Davarniya B, Hu H, Kahrizi K, Musante L, Fattahi Z, Hosseini M, et al. The Role of a Novel TRMT1 Gene Mutation and Rare GRM1 Gene Defect in Intellectual Disability in Two Azeri Families. PLoS One. 2015;10(8):e0129631. 68. Onat OE, Gulsuner S, Bilguvar K, Nazli Basak A, Topaloglu H, Tan M, et al. Missense mutation in the ATPase, aminophospholipid transporter protein ATP8A2 is associated with cerebellar atrophy and quadrupedal locomotion. Eur J Hum Genet. 2013;21(3):281-5. 69. Sun Y, Almomani R, Breedveld GJ, Santen GW, Aten E, Lefeber DJ, et al. Autosomal recessive spinocerebellar ataxia 7 (SCAR7) is caused by variants in TPP1, the gene involved in classic late-infantile neuronal ceroid lipofuscinosis 2 disease (CLN2 disease). Hum Mutat. 2013;34(5):706-13. 70. Dy ME, Sims KB, Friedman J. TPP1 deficiency: Rare cause of isolated childhood-onset progressive ataxia. Neurology. 2015;85(14):1259-61.

71. Margolin DH, Kousi M, Chan YM, Lim ET, Schmahmann JD, Hadjivassiliou M, et al. Ataxia, dementia, and hypogonadotropism caused by disordered ubiquitination. N Engl J Med. 2013;368(21):1992-2003. 72. Santens P, Van Damme T, Steyaert W, Willaert A, Sablonniere B, De Paepe A, et al. RNF216 mutations as a novel cause of autosomal recessive Huntington-like disorder. Neurology. 2015;84(17):1760-6. 73. Hills LB, Masri A, Konno K, Kakegawa W, Lam AT, Lim-Melia E, et al. Deletions in GRID2 lead to a recessive syndrome of cerebellar ataxia and tonic upgaze in humans. Neurology. 2013;81(16):1378-86. 74. Van Schil K, Meire F, Karlstetter M, Bauwens M, Verdin H, Coppieters F, et al. Early- onset autosomal recessive cerebellar ataxia associated with retinal dystrophy: new human hotfoot phenotype caused by homozygous GRID2 deletion. Genet Med. 2015;17(4):291-9. 75. Shi Y, Wang J, Li JD, Ren H, Guan W, He M, et al. Identification of CHIP as a novel causative gene for autosomal recessive cerebellar ataxia. PLoS One. 2013;8(12):e81884. 76. Synofzik M, Schule R, Schulze M, Gburek-Augustat J, Schweizer R, Schirmacher A, et al. Phenotype and frequency of STUB1 mutations: next-generation screenings in Caucasian ataxia and spastic paraplegia cohorts. Orphanet J Rare Dis. 2014;9:57. 77. Mallaret M, Synofzik M, Lee J, Sagum CA, Mahajnah M, Sharkia R, et al. The tumour suppressor gene WWOX is mutated in autosomal recessive cerebellar ataxia with epilepsy and mental retardation. Brain. 2014;137(Pt 2):411-9. 78. Ben-Salem S, Al-Shamsi AM, John A, Ali BR, Al-Gazali L. A novel whole exon deletion in WWOX gene causes early epilepsy, intellectual disability and optic atrophy. J Mol Neurosci. 2015;56(1):17-23. 79. Baple EL, Chambers H, Cross HE, Fawcett H, Nakazawa Y, Chioza BA, et al. Hypomorphic PCNA mutation underlies a human DNA repair disorder. J Clin Invest. 2014;124(7):3137-46. 80. Thomas AC, Williams H, Seto-Salvia N, Bacchelli C, Jenkins D, O'Sullivan M, et al. Mutations in SNX14 cause a distinctive autosomal-recessive cerebellar ataxia and intellectual disability syndrome. Am J Hum Genet. 2014;95(5):611-21. 81. Akizu N, Cantagrel V, Zaki MS, Al-Gazali L, Wang X, Rosti RO, et al. Biallelic mutations in SNX14 cause a syndromic form of cerebellar atrophy and lysosome-autophagosome dysfunction. Nat Genet. 2015;47(5):528-34. 82. Burns R, Majczenko K, Xu J, Peng W, Yapici Z, Dowling JJ, et al. Homozygous splice mutation in CWF19L1 in a Turkish family with recessive ataxia syndrome. Neurology. 2014;83(23):2175-82. 83. Nguyen M, Boesten I, Hellebrekers DM, Vanoevelen J, Kamps R, de Koning B, et al. Pathogenic CWF19L1 variants as a novel cause of autosomal recessive cerebellar ataxia and atrophy. Eur J Hum Genet. 2016;24(4):619-22. 84. Synofzik M, Haack TB, Kopajtich R, Gorza M, Rapaport D, Greiner M, et al. Absence of BiP co-chaperone DNAJC3 causes diabetes mellitus and multisystemic neurodegeneration. Am J Hum Genet. 2014;95(6):689-97. 85. Guissart C, Li X, Leheup B, Drouot N, Montaut-Verient B, Raffo E, et al. Mutation of SLC9A1, encoding the major Na(+)/H(+) exchanger, causes ataxia-deafness Lichtenstein-Knorr syndrome. Hum Mol Genet. 2015;24(2):463-70. 86. Bras J, Alonso I, Barbot C, Costa MM, Darwent L, Orme T, et al. Mutations in PNKP cause recessive ataxia with oculomotor apraxia type 4. Am J Hum Genet. 2015;96(3):474-9. 87. Paucar M, Malmgren H, Taylor M, Reynolds JJ, Svenningsson P, Press R, et al. Expanding the ataxia with oculomotor apraxia type 4 phenotype. Neurol Genet. 2016;2(1):e49. 88. Jobling RK, Assoum M, Gakh O, Blaser S, Raiman JA, Mignot C, et al. PMPCA mutations cause abnormal mitochondrial protein processing in patients with non-progressive cerebellar ataxia. Brain. 2015;138(Pt 6):1505-17.

89. Choquet K, Zurita-Rendon O, La Piana R, Yang S, Dicaire MJ, Boycott KM, et al. Autosomal recessive cerebellar ataxia caused by a homozygous mutation in PMPCA. Brain. 2016;139(Pt 3):e19. 90. Schmidt WM, Rutledge SL, Schule R, Mayerhofer B, Zuchner S, Boltshauser E, et al. Disruptive SCYL1 mutations underlie a syndrome characterized by recurrent episodes of liver failure, peripheral neuropathy, cerebellar atrophy, and ataxia. Am J Hum Genet. 2015;97(6):855-61. 91. Kawarai T, Tajima A, Kuroda Y, Saji N, Orlacchio A, Terasawa H, et al. A homozygous mutation of VWA3B causes cerebellar ataxia with intellectual disability. J Neurol Neurosurg Psychiatry. 2016;87(6):656-62. 92. Gomez-Herreros F, Schuurs-Hoeijmakers JH, McCormack M, Greally MT, Rulten S, Romero-Granados R, et al. TDP2 protects transcription from abortive topoisomerase activity and is required for normal neural function. Nat Genet. 2014;46(5):516-21. 93. Duan R, Shi Y, Yu L, Zhang G, Li J, Lin Y, et al. UBA5 Mutations Cause a New Form of Autosomal Recessive Cerebellar Ataxia. PLoS One. 2016;11(2):e0149039. 94. Edvardson S, Elbaz-Alon Y, Jalas C, Matlock A, Patel K, Labbe K, et al. A mutation in the THG1L gene in a family with cerebellar ataxia and developmental delay. Neurogenetics. 2016. 95. Sharp D, Blinderman L, Combs KA, Kienzle B, Ricci B, Wager-Smith K, et al. Cloning and gene defects in microsomal triglyceride transfer protein associated with abetalipoproteinaemia. Nature. 1993;365(6441):65-9. 96. Carstea ED, Morris JA, Coleman KG, Loftus SK, Zhang D, Cummings C, et al. Niemann- Pick C1 disease gene: homology to mediators of cholesterol homeostasis. Science. 1997;277(5323):228-31. 97. Naureckiene S, Sleat DE, Lackland H, Fensom A, Vanier MT, Wattiaux R, et al. Identification of HE1 as the second gene of Niemann-Pick C disease. Science. 2000;290(5500):2298-301. 98. Mihalik SJ, Morrell JC, Kim D, Sacksteder KA, Watkins PA, Gould SJ. Identification of PAHX, a Refsum disease gene. Nat Genet. 1997;17(2):185-9. 99. Jansen GA, Ofman R, Ferdinandusse S, Ijlst L, Muijsers AO, Skjeldal OH, et al. Refsum disease is caused by mutations in the phytanoyl-CoA hydroxylase gene. Nat Genet. 1997;17(2):190- 3. 100. O'Dowd BF, Klavins MH, Willard HF, Gravel R, Lowden JA, Mahuran DJ. Molecular heterogeneity in the infantile and juvenile forms of Sandhoff disease (O-variant GM2 gangliosidosis). J Biol Chem. 1986;261(27):12680-5. 101. Myerowitz R, Costigan FC. The major defect in Ashkenazi Jews with Tay-Sachs disease is an insertion in the gene for the alpha-chain of beta-hexosaminidase. J Biol Chem. 1988;263(35):18587-9. 102. Mahuran DJ. The biochemistry of HEXA and HEXB gene mutations causing GM2 gangliosidosis. Biochim Biophys Acta. 1991;1096(2):87-94. 103. Lise S, Clarkson Y, Perkins E, Kwasniewska A, Sadighi Akha E, Schnekenberg RP, et al. Recessive mutations in SPTBN2 implicate beta-III spectrin in both cognitive and motor development. PLoS Genet. 2012;8(12):e1003074. 104. Pierson TM, Adams D, Bonn F, Cherikuri PF, Teer JK, Hanson NF, et al. Whole exome sequencing identifies AFG3L2 mutation in a novel recessive progressive myoclonic epilepsy- ataxia-neuropathy syndrome. Annals of Neurology. 2010;68:S68-S9. 105. Toro C, Landis D, DiBella D, Magri S, Lee P, Adams D, et al. Phenotypic variation in AFG3L2-associated disorders. Annals of Neurology. 2015;78:S110. 106. Synofzik M, Gonzalez MA, Lourenco CM, Coutelier M, Haack TB, Rebelo A, et al. PNPLA6 mutations cause Boucher-Neuhauser and Gordon Holmes syndromes as part of a broad neurodegenerative spectrum. Brain. 2014;137(Pt 1):69-77. 107. Koh K, Kobayashi F, Miwa M, Shindo K, Isozaki E, Ishiura H, et al. Novel mutations in the PNPLA6 gene in Boucher-Neuhauser syndrome. J Hum Genet. 2015;60(4):217-20.

108. Gerber S, Alzayady KJ, Burglen L, Bremond-Gignac D, Marchesin V, Roche O, et al. Recessive and Dominant De Novo ITPR1 Mutations Cause Gillespie Syndrome. Am J Hum Genet. 2016;98(5):971-80. 109. Dor T, Cinnamon Y, Raymond L, Shaag A, Bouslam N, Bouhouche A, et al. KIF1C mutations in two families with hereditary spastic paraparesis and cerebellar dysfunction. J Med Genet. 2014;51(2):137-42. 110. Caballero Oteyza A, Battaloglu E, Ocek L, Lindig T, Reichbauer J, Rebelo AP, et al. Motor protein mutations cause a new form of hereditary spastic paraplegia. Neurology. 2014;82(22):2007- 16. 111. Casari G, De Fusco M, Ciarmatori S, Zeviani M, Mora M, Fernandez P, et al. Spastic paraplegia and OXPHOS impairment caused by mutations in paraplegin, a nuclear-encoded mitochondrial metalloprotease. Cell. 1998;93(6):973-83. 112. van Gassen KL, van der Heijden CD, de Bot ST, den Dunnen WF, van den Berg LH, Verschuuren-Bemelmans CC, et al. Genotype-phenotype correlations in spastic paraplegia type 7: a study in a large Dutch cohort. Brain. 2012;135(Pt 10):2994-3004. 113. Tsaousidou MK, Ouahchi K, Warner TT, Yang Y, Simpson MA, Laing NG, et al. Sequence alterations within CYP7B1 implicate defective cholesterol homeostasis in motor-neuron degeneration. Am J Hum Genet. 2008;82(2):510-5. 114. Lan MY, Yeh TH, Chang YY, Kuo HC, Sun HS, Lai SC, et al. Clinical and genetic analysis of Taiwanese patients with hereditary spastic paraplegia type 5. Eur J Neurol. 2015;22(1):211-4. 115. Stevanin G, Santorelli FM, Azzedine H, Coutinho P, Chomilier J, Denora PS, et al. Mutations in SPG11, encoding spatacsin, are a major cause of spastic paraplegia with thin corpus callosum. Nat Genet. 2007;39(3):366-72. 116. Schule R, Schlipf N, Synofzik M, Klebe S, Klimpe S, Hehr U, et al. Frequency and phenotype of SPG11 and SPG15 in complicated hereditary spastic paraplegia. J Neurol Neurosurg Psychiatry. 2009;80(12):1402-4. 117. Hammer MB, Eleuch-Fayache G, Schottlaender LV, Nehdi H, Gibbs JR, Arepalli SK, et al. Mutations in GBA2 cause autosomal-recessive cerebellar ataxia with spasticity. Am J Hum Genet. 2013;92(2):245-51. 118. Votsi C, Zamba-Papanicolaou E, Middleton LT, Pantzaris M, Christodoulou K. A novel GBA2 gene missense mutation in spastic ataxia. Ann Hum Genet. 2014;78(1):13-22. 119. Matthijs G, Schollen E, Pardon E, Veiga-Da-Cunha M, Jaeken J, Cassiman JJ, et al. Mutations in PMM2, a phosphomannomutase gene on chromosome 16p13, in carbohydrate- deficient glycoprotein type I syndrome (Jaeken syndrome). Nat Genet. 1997;16(1):88-92. 120. Kjaergaard S, Skovby F, Schwartz M. Absence of homozygosity for predominant mutations in PMM2 in Danish patients with carbohydrate-deficient glycoprotein syndrome type 1. Eur J Hum Genet. 1998;6(4):331-6. 121. Scheper GC, van der Klok T, van Andel RJ, van Berkel CG, Sissler M, Smet J, et al. Mitochondrial aspartyl-tRNA synthetase deficiency causes leukoencephalopathy with brain stem and spinal cord involvement and lactate elevation. Nat Genet. 2007;39(4):534-9. 122. Tzoulis C, Tran GT, Gjerde IO, Aasly J, Neckelmann G, Rydland J, et al. Leukoencephalopathy with brainstem and spinal cord involvement caused by a novel mutation in the DARS2 gene. J Neurol. 2012;259(2):292-6. 123. Doss S, Lohmann K, Seibler P, Arns B, Klopstock T, Zuhlke C, et al. Recessive dystonia- ataxia syndrome in a Turkish family caused by a COX20 (FAM36A) mutation. J Neurol. 2014;261(1):207-12. 124. Yoshida K, Furihata K, Takeda S, Nakamura A, Yamamoto K, Morita H, et al. A mutation in the ceruloplasmin gene is associated with systemic hemosiderosis in humans. Nat Genet. 1995;9(3):267-72.

125. Gregory A, Westaway SK, Holm IE, Kotzbauer PT, Hogarth P, Sonek S, et al. Neurodegeneration associated with genetic defects in phospholipase A(2). Neurology. 2008;71(18):1402-9. 126. Salih MA, Mundwiller E, Khan AO, AlDrees A, Elmalik SA, Hassan HH, et al. New findings in a global approach to dissect the whole phenotype of PLA2G6 gene mutations. PLoS One. 2013;8(10):e76831. 127. Aldinger KA, Mosca SJ, Tetreault M, Dempsey JC, Ishak GE, Hartley T, et al. Mutations in LAMA1 cause cerebellar dysplasia and cysts with and without retinal dystrophy. Am J Hum Genet. 2014;95(2):227-34. 128. Rajadhyaksha AM, Elemento O, Puffenberger EG, Schierberl KC, Xiang JZ, Putorti ML, et al. Mutations in FLVCR1 cause posterior column ataxia and retinitis pigmentosa. Am J Hum Genet. 2010;87(5):643-54. 129. Ishiura H, Fukuda Y, Mitsui J, Nakahara Y, Ahsan B, Takahashi Y, et al. Posterior column ataxia with retinitis pigmentosa in a Japanese family with a novel mutation in FLVCR1. Neurogenetics. 2011;12(2):117-21. 130. Klockars T, Savukoski M, Isosomppi J, Peltonen L. Positional cloning of the CLN5 gene defective in the Finnish variant of the LINCL. Mol Genet Metab. 1999;66(4):324-8. 131. Faruq M, Narang A, Kumari R, Pandey R, Garg A, Behari M, et al. Novel mutations in typical and atypical genetic loci through exome sequencing in autosomal recessive cerebellar ataxia families. Clin Genet. 2014;86(4):335-41. 132. Verheijen FW, Verbeek E, Aula N, Beerens CE, Havelaar AC, Joosse M, et al. A new gene, encoding an anion transporter, is mutated in sialic acid storage diseases. Nat Genet. 1999;23(4):462- 5. 133. Aula N, Salomaki P, Timonen R, Verheijen F, Mancini G, Mansson JE, et al. The spectrum of SLC17A5-gene mutations resulting in free sialic acid-storage diseases indicates some genotype- phenotype correlation. Am J Hum Genet. 2000;67(4):832-40. 134. Ferland RJ, Eyaid W, Collura RV, Tully LD, Hill RS, Al-Nouri D, et al. Abnormal cerebellar development and axonal decussation due to mutations in AHI1 in Joubert syndrome. Nat Genet. 2004;36(9):1008-13. 135. Cantagrel V, Silhavy JL, Bielas SL, Swistun D, Marsh SE, Bertrand JY, et al. Mutations in the cilia gene ARL13B lead to the classical form of Joubert syndrome. Am J Hum Genet. 2008;83(2):170-9. 136. Kleta R, Romeo E, Ristic Z, Ohura T, Stuart C, Arcos-Burgos M, et al. Mutations in SLC6A19, encoding B0AT1, cause Hartnup disorder. Nat Genet. 2004;36(9):999-1002. 137. Leegwater PA, Vermeulen G, Konst AA, Naidu S, Mulders J, Visser A, et al. Subunits of the translation initiation factor eIF2B are mutant in leukoencephalopathy with vanishing white matter. Nat Genet. 2001;29(4):383-8. 138. Fogli A, Schiffmann R, Bertini E, Ughetto S, Combes P, Eymard-Pierre E, et al. The effect of genotype on the natural history of eIF2B-related leukodystrophies. Neurology. 2004;62(9):1509- 17. 139. Topcu M, Jobard F, Halliez S, Coskun T, Yalcinkayal C, Gerceker FO, et al. L-2- Hydroxyglutaric aciduria: identification of a mutant gene C14orf160, localized on chromosome 14q22.1. Hum Mol Genet. 2004;13(22):2803-11. 140. Steenweg ME, Jakobs C, Errami A, van Dooren SJ, Adeva Bartolome MT, Aerssens P, et al. An overview of L-2-hydroxyglutarate dehydrogenase gene (L2HGDH) variants: a genotype- phenotype study. Hum Mutat. 2010;31(4):380-90. 141. Corbett MA, Schwake M, Bahlo M, Dibbens LM, Lin M, Gandolfo LC, et al. A mutation in the Golgi Qb-SNARE gene GOSR2 causes progressive myoclonus epilepsy with early ataxia. Am J Hum Genet. 2011;88(5):657-63.

142. Bernard G, Chouery E, Putorti ML, Tetreault M, Takanohashi A, Carosso G, et al. Mutations of POLR3A encoding a catalytic subunit of RNA polymerase Pol III cause a recessive hypomyelinating leukodystrophy. Am J Hum Genet. 2011;89(3):415-23. 143. Bonneau D, Colin E, Oca F, Ferre M, Chevrollier A, Gueguen N, et al. Early-onset Behr syndrome due to compound heterozygous mutations in OPA1. Brain. 2014;137(Pt 10):e301. 144. Lee J, Jung SC, Hong YB, Yoo JH, Koo H, Lee JH, et al. Recessive optic atrophy, sensorimotor neuropathy and cataract associated with novel compound heterozygous mutations in OPA1. Mol Med Rep. 2016;14(1):33-40.

Chapter 2 Building a conceptual framework: a new classification for recessive cerebellar ataxias

Original title The Classification of Autosomal Recessive Cerebellar Ataxias: A consensus statement from the Society for Research on the Cerebellum and Ataxias Task Force

2.1 Résumé Introduction Il n’y a pas de classification reconnue des ataxies cérébelleuses récessives, un groupe de maladies caractérisé par une importante hétérogénéité génétique et des phénotypes complexes. L’objectif du groupe de travail était de développer un consensus sur la classification des ataxies récessives afin de définir une approche clinique structurée au patient se présentant pour ataxie, de regrouper les ataxies selon la symptomatologie clinique et de définir ce champ de recherche en identifiant des mécanismes physiopathologiques communs aux différentes maladies.

Méthode Le groupe de travail s’est basé sur la revue systématique de la littérature présentée précédemment pour identifier les pathologies récessives caractérisées principalement par un syndrome moteur cérébelleux et une évidence de dégénérescence cérébelleuse. Cette revue de littérature a été mise à jour pour inclure les nouveaux articles publiés après la rédaction du premier article et pour prendre en compte les critères d’inclusion redéfinis par le groupe de travail. Celui-ci regroupait 12 experts internationaux qui se sont penchés sur les orientations générales de la classification et les enjeux spécifiques soulevés en cours de la réalisation.

Résultats Au total, 59 maladies génétiques ont été incluses dans la liste mise à jour des ataxies récessives primaires. Pour chaque ataxie, la distribution géographique est présentée en plus des caractéristiques cliniques et radiologiques discriminantes. Les ataxies récessives primaires ont été classifiées selon le tableau clinique et selon le mécanisme physiopathologique impliqué. Une approche clinique structurée au patient se présentant pour ataxie est détaillée. Nous avons également identifié 48 maladies génétiques additionnelles associées avec une présentation ataxique et qui devraient être incluses dans le diagnostic différentiel des ataxies héréditaires récessives.

Conclusion Cette classification est le produit d’un consensus d’experts internationaux et elle permet une compréhension unifiée des ataxies récessives pour les cliniciens et les chercheurs.

2.2 Abstract Introduction There is currently no accepted classification of recessive cerebellar ataxias, a group of disorders characterized by important genetic heterogeneity and complex phenotypes. The objective of this task force was to build a consensus on the classification of recessive ataxias in order to develop a general approach to a patient presenting with ataxia, organize disorders according to clinical presentation, and define this field of research by identifying common pathogenic molecular mechanisms in recessive ataxias.

Methods The work of this task force was based on the previously presented systematic scoping review of the literature that identified recessive disorders characterized primarily by cerebellar motor dysfunction and cerebellar degeneration. This review was updated to include the articles published after the previous article and to account for redefined inclusion criteria by the task force. The latter regrouped 12 international ataxia experts who decided on general orientation and specific issues.

Results We identified 59 disorders that are classified as primary recessive ataxias. For each of these disorders, we present geographical and ethnical specificities along with distinctive clinical and imagery features. The primary recessive ataxias were organized in a clinical and a pathophysiological classification, and we present a general clinical approach to the patient presenting with ataxia. We also identified a list of 48 complex multisystem disorders that are associated with ataxia and should be included in the differential diagnosis of recessive ataxias.

Conclusion This classification is the result of a consensus among a panel of international experts, and it promotes a unified understanding of recessive cerebellar disorders for clinicians and researchers.

2.3 Introduction The classification of hereditary ataxias represents a significant challenge due to the large number of neurological and metabolic diseases that present with cerebellar dysfunction and the phenotypic

heterogeneity in known genetically defined disorders. Indeed, ataxia is a presenting feature in degenerative disorders that target mainly the cerebellum, but it may be present in hereditary spastic paraplegias, inborn errors of metabolism, and various encephalopathies. Proper classification and phenotypic understanding is of primary importance in this field where the high prevalence of repeat expansion disorders, which are not adequately covered by next generation sequencing (NGS) techniques (1, 2), precludes NGS as a first diagnostic step and requires phenotypic evaluation to perform custom gene testing when applicable. Nevertheless, autosomal recessive ataxias have remained an ill-defined and disorganized group of disorders for two main reasons. First, unlike the dominant ataxias that have been organized with a numerical naming system, recessive disorders presenting with ataxia have been named in a highly heterogeneous manner according to clinical features, physicians’ surname, or regions of high prevalence. Second, several recessive multisystemic or complex metabolic disorders present with ataxia, such that it is difficult to properly circumscribe this group of disorders and classify it in a meaningful way for both clinicians and researchers. Hence, the Society for Research on the Cerebellum and Ataxias (SRCA) Task Force on the Classification of Recessive Cerebellar Ataxias was created in 2016 to regroup a panel of international ataxia experts in order to propose a classification relevant to clinical practice and researchers. As a first step, we undertook a systematic scoping review of the literature to identify all recessive disorders presenting with ataxia, select those in which cerebellar degeneration was a core feature, and propose a first classification. This systematic scoping review has been previously published (3), and served as the basis for the current work.

Recently, the Movement Disorder Society Task Force on Classification and Nomenclature of Genetic Movement Disorders proposed a revised naming system based on the gene name associated with a phenotypical prefix. They presented a list of 92 gene-defined recessive disorders associated with ataxia for which this naming system would be applied and an exhaustive list of disorders that may occasionally present with ataxia (4). This represents a useful reference for interpretation of NGS results. However, in a significant number of listed disorders, the cerebellum is only one of many affected organs in multisystemic and metabolic disorders. For example, maple syrup urine disease, caused by BCKDHB mutations, and congenital disorders of glycosylation 1a, 1c, and 1q have been included. These disorders are inborn errors of metabolism characterized by developmental delay, hypotonia, and metabolic defects, and ataxia is only mild, found in a minority of patients, or present solely during episodes of metabolic decompensation. Hence, there remains a need for a classification system that focuses on disorders affecting primarily the cerebellum and

organizes clinical and paraclinical information to promote an understanding of cerebellar disorders useful not only to ataxia experts, but also to general neurologists, learners, patients, and researchers.

The objective of this task force was to build a consensus on the classification of recessive ataxias in order to develop a general approach to a patient presenting with ataxia, organize disorders according to clinical presentation, and define this field of research by identifying common pathophysiological mechanisms in recessive disorders presenting with ataxia. This aims at bringing together clinicians and researchers to promote a common understanding of recessive cerebellar disorders in order to advance research and improve patient care.

2.4 Methods The first step was to identify all recessive disorders presenting with ataxia. Recessive cerebellar ataxias were defined as disorders with autosomal recessive inheritance characterized by a cerebellar motor syndrome of gait ataxia, dysmetria, adiadochokinesia, nystagmus, and dysarthria associated with cerebellar degeneration as demonstrated by imagery or pathology. A pathogenic mutation had to be identified in at least two independent families for a specific gene to be included. Purely malformative disorders were excluded, and disorders with complex phenotypes where ataxia is a secondary or late feature were also excluded. We conducted a systematic scoping review of the literature to identify relevant reports. The methodology and results of this systematic scoping review have been published previously (3). In the first publication, this review process had allowed the identification of 2354 records and was current as of September 2016. The literature search was updated and is current as of October 2018.

The second step was to regroup a panel of 12 international ataxia experts to create a logical classification system and build a consensus. Ataxia experts were identified from various geographical regions and areas of expertise within the field of ataxias, ensuring proper representation of regional differences in prevalence and clinical approach to ataxias. Discussions spanned over two years, included meetings at two SRCA international conferences, and concerned general orientation, clinical approach, specific disorders, classification issues, and regional specificities. The first author (MB) reviewed identified records for inclusion, extracted clinical, epidemiological, and molecular data to build the classifications and wrote the text integrating all authors’ input and comments. All authors approved the final manuscript and list of included disorders.

2.5 Results The final list of included recessive cerebellar ataxias is presented in Table 2.1 and includes 59 primary recessive ataxias, which regroup 15 disorders that are more prevalent and widely distributed and 44 disorders that are less frequent and reported only in certain populations or few families. Because ethnic and regional specificities are an essential element to consider in the appraisal of a patient with a recessive ataxia, areas where the disorder has been reported to date are listed. Metabolic or mitochondrial disorders where ataxia is only a secondary non-specific finding in a multisystemic phenotype were excluded, as cerebellar pathology is not central in these disorders. However, clinicians must bear in mind that some of these disorders may present with a milder juvenile or adult onset phenotype where cerebellar ataxia may predominate, for example in Niemann Pick disease type C, Tay-Sachs disease, sialic acid storage disorders, congenital disorders of glycosylation, and Zellweger spectrum disorders. As some of these metabolic disorders may benefit from early treatment, clinicians must keep a high index of suspicion to test for these disorders, and they should be included in large NGS gene panels for ataxia. These and other complex disorders that may occasionally present with ataxia are presented in Table 2.2. This second list is not exhaustive and presents only the main or most frequent disorders occasionally associated with ataxia. Disorders in which the cerebellar phenotype is not clearly established have been excluded.

Table 2.1 Primary autosomal recessive ataxias

Table 2.2 Other metabolic or complex disorders that have ataxia as an associated feature

Clinical approach to a patient presenting with ataxia 1° The first step in evaluating a patient with ataxia is to perform a detailed clinical evaluation that includes a clinical history, a family history, a targeted neurological and systemic physical evaluation, and relevant paraclinical tests. The temporal course is a central element in determining the underlying etiology. Indeed, a chronic progressive evolution over months to years, without trauma or toxin exposure, is suggestive of a hereditary disorder, whereas acute or subacute onset points towards an acquired etiology. A clinical history and physical examination are essential to assess the severity of the cerebellar syndrome and the presence of associated neurological features or systemic involvement. Headache, fever, or an associated autoimmune disorder should prompt the consideration of acquired etiologies. A detailed family history should be obtained to search for relatives with similar symptomatology. Laboratory tests may be useful to rule out acquired causes or as biomarkers for certain disorders. Neuroimaging, preferably with magnetic resonance imaging,

is an essential tool to evaluate the presence of cerebellar atrophy or signal anomalies, to search for associated pontine atrophy, and to rule out space-occupying lesions. Electromyography and nerve conduction studies can prove the presence of clinically suspected or subclinical neuropathy and provide evidence of associated myopathy.

2° Following the clinical assessment, one should verify that acquired and treatable causes for ataxia have been excluded. These include vascular disease, trauma, infection, primary or metastatic tumor, excess alcohol consumption, vitamin deficiency, Creutzfeldt-Jakob disease, and immune mediated- cerebellar ataxias such as multiple sclerosis, celiac disease, anti-GAD (glutamic acid decarboxylase) ataxia, and paraneoplastic cerebellar degenerations. Clinical evaluation should reveal previous exposure to toxins or traumatic injuries, along with specific signs and symptoms suggestive of infectious, vascular or metastatic disease. Laboratory tests are useful to identify vitamin deficiencies or autoimmune conditions. Specifically, testing for antibodies involved in paraneoplastic or autoimmune cerebellar degeneration may be particularly useful for patients with a subacute progression, older age at onset and absence of family history. The paraneoplastic antibodies most associated with cerebellar degeneration are anti-Yo, anti-Hu, anti-Tr, and anti- mGluR1 antibodies; the tumors most often involved are breast and gynaecological tumors, Hodgkin lymphoma, and small cell lung carcinoma (5). Large paraneoplastic autoantibodies panels are now available and may reduce the delay associated with serial testing.

3° Once acquired causes have been ruled out, a genetic etiology may be considered, especially in the presence of a positive family history, early onset, chronic progressive course, or with a set of clinical signs and symptoms that is reminiscent of a well-described genetic disorder. One should bear in mind that a negative family history does not rule out a genetic cause, and sporadic cases may be due to recessive or mitochondrial inheritance, de novo mutations, genetic anticipation, incomplete penetrance, variability in disease expression, paternity error, gonadic mosaicism, or incomplete phenotyping of family members. Indeed, recessive disorders may appear as sporadic in small kindred or with incomplete family history. In other cases, a complete family history should allow identification of the mode of transmission.

4° If recessive inheritance is suspected, the next step in clinical evaluation is to consider age at onset and clinical signs and symptoms to evaluate if the clinical picture is reminiscent of a well- described disorder. Presentation in infancy suggests ataxia-telangiectasia (AT) or autosomal recessive ataxia of Charlevoix Saguenay (ARSACS). Childhood or teenage onset should raise the suspicion for Friedreich ataxia (FRDA), ataxia with oculomotor apraxia 1 (AOA1) and 2 (AOA2),

and POLG-related disorders. Finally, recessive ataxia with onset in adulthood is evocative of SYNE1-related autosomal recessive cerebellar ataxia 1 (ARCA1), autosomal recessive cerebellar ataxia 3 (ARCA3) associated with ANO10 mutations and spastic paraplegia 7. However, there are large variations in the age at onset of most of the presented disorders, and FRDA is one of the best examples with some patients presenting with late-onset FRDA (>25 years of age) or very-late-onset FRDA (>40 years of age).

Clinical signs and symptoms may provide clues to identify the mutated gene. Indeed, certain discriminating clinical features or combinations of neurological symptoms may be helpful to guide the clinician towards specific genes (Figure 2.1 and Table 2.1). As one may observe in Figure 2.1, none of the recessive ataxias reported up to now presents with a pure cerebellar phenotype. Even ARCA1, which used to be the prototype of a pure cerebellar phenotype (6), has recently been reported to be associated with upper and/or lower motor neuron involvement in 58% of cases, with some rare patients presenting with a very severe early-onset neuromuscular phenotype (7). The presence of motor neuron involvement, polyneuropathy, extra-pyramidal movement disorders, eye movement abnormalities such as oculomotor apraxia, intellectual impairment, and associated multisystemic involvement may guide the clinician towards a particular diagnosis. Some clinical syndromes are particularly evocative of specific disorders. Multisystemic involvement with sensory loss, muscle weakness, cardiomyopathy, diabetes, optic atrophy and sensorineuronal hearing loss is characteristic of FRDA, which is the prototype of a disorder associated with mitochondrial dysfunction. Other associated disorders present with similar features and occasionally epilepsy, retinal involvement, or ophthalmoplegia, such as POLG-related disorders, ARCA2, ataxia with vitamin E deficiency (AVED), Marinesco-Sjogren Syndrome (MSS), and others. Extra-pyramidal involvement with oculomotor apraxia, elevated α-foetoprotein, and occasional polyneuropathy are typical findings of AT, AT-like disorder, AOA1, AOA2, AOA4 and Spinocerebellar ataxia recessive 26 (SCAR26). All these disorders are associated with genes involving DNA repair systems, which highlights how clinical symptoms may reflect the underlying genetic defect. Nevertheless, recessive ataxias are characterized by important phenotypic variability and significant clinical overlap between different pathologies, such that predicting the mutated gene according to the clinical phenotype is prone to errors even for ataxia experts (8). Some laboratory tests may serve as useful biomarkers for recessive ataxias. Altered levels of vitamin E, α-foetoprotein, albumin, coenzyme Q10, cholesterol, cholestanol, lactate, sex hormones and gonadotropins have been associated with specific disorders (see Table 2.1). Dosing of immunoglobulins, very long chain fatty acids and hexosaminidase may be relevant according to clinical suspicion.

Figure 2.1 Clinical classification of autosomal recessive ataxias

Figure 2.2 Graphical summary of the clinical approach to a patient presenting with ataxia

5° Once the clinical assessment is complete, genetic testing is indicated to confirm the mutated gene or allow a more specific diagnosis if the clinical picture is nonspecific. Initial testing should include searching for the Friedreich ataxia-associated trinucleotide repeat expansion in the FXN gene considering the high prevalence of this mutation, its incomplete coverage through next-generation sequencing methods (1), and the heterogeneous clinical phenotype. Searching for a FXN repeat expansion can be done with frataxin protein analysis or gene analysis with Southern blot or PCR. Moreover, clinicians may consider testing for another specific gene through Sanger sequencing or Multiplex Ligation-dependant Probe Amplification (MLPA) if the clinical and paraclinical data is highly evocative of a particular disorder, if there is a confirmed mutation in a relative, or in isolated populations where selected disorders are highly prevalent. Finally, a panel for the dominantly inherited CAG-repeat expansion spinocerebellar ataxias may also be considered as part of the initial assessment if family history is inconclusive regarding the mode of inheritance and considering the high prevalence of these mutations and their incomplete coverage through next-generation sequencing methods (1).

6° If single gene testing does not provide a molecular diagnosis, one should consider high- throughput NGS methods either with a multigene panel, whole exome sequencing or whole genome sequencing. Several studies have demonstrated the efficacy and cost efficiency of multigene panels (9), targeted exome sequencing (8, 10), or whole exome sequencing (11, 12), with a diagnostic yield varying between 18% and 80%. Highest yield is obtained for patients with early-onset ataxia, positive family history and consanguinity among parents. NGS panels allow for better coverage of included genes and reduce the volume of genetic variants that are unrelated to the clinical phenotype, while exome sequencing may reveal mutations in genes that were not previously known to be associated with ataxia (1). Whole genome sequencing may be considered in selected cases with appropriate genetic counseling, but its diagnostic yield is uncertain (13). Once genetic testing is completed and a pathogenic mutation has been identified, it is of primary importance to provide specialized genetic counseling for the patient and his or her relatives along with symptoms management and disease treatment when available.

Pathophysiological mechanisms underlying recessive cerebellar ataxias The importance of a proper recessive ataxia classification goes beyond the clinical diagnosis perspective. Recessive ataxias can be regrouped according to the deficient cellular and metabolic pathways involved, which provides a better understanding of cerebellar physiology and of its selective vulnerability to certain metabolic processes. This is also essential from a therapeutic perspective, as disorders that belong to the same metabolic pathway may respond to the same treatment options, which presents drug repurposing potential. Figure 2.3 presents the main pathways involved in cerebellar ataxias. Certain genes are presented more than once since some proteins are involved in several metabolic pathways or may interfere with other cellular processes as they accumulate in neurons or glial cells.

Figure 2.3 Classification of autosomal recessive ataxias according to molecular pathogenesis

Certain pathways are predominantly involved, notably mitochondrial dysfunction, which may result from increased production of reactive oxygen species and oxidative stress (ATM, FXN, TTPA), deficient Coenzyme Q10 metabolism (APTX, COQ8A), abnormal mitochondrial DNA maintenance with progressive mutagenesis (PNKP, POLG, TWNK), defective mitochondrial protein synthesis or quality control (AFG3L2, PMPCA, SPG7), altered mitochondrial dynamics (SACS, VPS13D), defective mitochondrial respiratory chain assembly (COA7, COX20), or abnormal mitochondrial RNA maturation and processing (DARS2, MTPAP). Interestingly, many of these disorders also present with a mitochondrial clinical syndrome as shown in Figure 1. Disorders of DNA repair mechanisms are also common, with double strand break repair pathway (ATM, MRE11A, SETX, TDP2) or single strand break repair complexes (APTX, PNKP, XRCC1) predominantly involved. Most of these genes are also associated with a susceptibility to ionizing radiations and predisposition for cancers, but the neurological syndrome is characterized by cerebellar involvement and extra-pyramidal movement disorders. Hence, the cerebellum seems to have a peculiar susceptibility to DNA damage, but the underlying mechanism is not understood. Finally, altered synaptic morphology or synaptic dysfunction of Purkinje cells (PC) is frequently involved in recessive ataxias, and is characterized by aberrant morphology at the PC/parallel fibers synapse (CA8, CAPN1, GRID2, ITPR1), impaired dendritic architecture (SPTBN2, SYNE1), or dysregulation of glutamate transmission (ATCAY, GRM1). Other disorders have been implicated in synaptic dysfunction through indirect evidence, for example SLC9A1, which localizes in presynaptic terminals and is involved in the modulation of synaptic activity (14). Of interest, many of these disorders are characterized by significant cognitive impairment that goes beyond what is expected in the cerebellar cognitive-affective syndrome and cause intellectual disability,

developmental delay or dementia, highlighting the importance of synaptogenesis in cognitive development.

2.6 Discussion We present a new clinical classification of recessive ataxias in parallel with a pathophysiological classification. The objective of this classification is to provide a tool for clinicians and researchers that facilitates the understanding of this complex group of disorders and defines this field of research. This work is based on the results of our systematic scoping review of the literature (3). We updated this literature review and regrouped a panel of 12 international ataxia experts to build a consensus on the definition and classification of cerebellar ataxias. The task force vision is that a classification goes beyond the listing of disorders, and must organize diseases in a way that allows better understanding and clinical mastery of this group of disorders. Hence, we proposed a clinical classification along with a pathophysiological classification, which enabled us to observe that there is significant overlap between these two classifications, highlighting how clinical presentation is in some cases a good projection of the underlying biochemical defect. This has potential applications from bench to bedside since treatments that address a specific pathogenic pathway may have therapeutic potential in all disorders in which this pathway is affected. The clinical classification is presented along with a structured clinical approach to a patient presenting with ataxia, which is intended as a clinical tool for expert and non-expert clinicians. Despite the increasing accessibility of NGS techniques, there remains a critical place for clinical judgment in the prescription of genetic tests and interpretation of results, taking into account the technical limitations and risk of finding variants of unknown significance. Recently, Renaud and colleagues published the results of a diagnostic algorithm for recessive ataxias that integrates 124 clinical features to propose three potential diagnoses among a list of 67 recessive disorders that may present with ataxia (15). This is a very promising tool, but its pragmatic impact on molecular testing strategy, final diagnostic rate, patient management, or time-efficiency remains to be validated. In the meantime, it is essential for clinicians to be at ease with a general approach to recessive ataxias with NGS techniques often permitting molecular diagnosis when the clinical picture is non-specific.

One of the major strengths of this classification proposal is that it is based on a consensus from a panel of international ataxia experts, thereby ensuring a proper representation of regional differences in the prevalence and clinical approach to ataxias. Moreover, the literature search was based on a systematic scoping review of the literature whose methodology has been published before and which permitted an unbiased appraisal of all potentially relevant articles. Nevertheless, there are some limitations to this classification proposal that are inherent to classifying a group of

diseases that evolves very rapidly and that is highly heterogeneous. First, as new evidence emerges regarding the identification of novel ataxia-associated genes and as new phenotypes are described for previously described disorders, this classification will need to be updated. This was highlighted by the significant additions to the list of primary recessive ataxias since the original systematic review was conducted in 2016. Indeed, many new genes and new phenotypes of previously described genes have been reported in only two years, which suggests that there is a need for periodic updates to the present classification or an online resource. Moreover, several decisions were made in the elaboration of this classification regarding general orientation, purpose of a classification, inclusion of specific disorders, and classification categories. The lists presented here offer in our opinion the best compromise between synthesis and exhaustiveness for the expert and non-expert clinician.

Compared to a previously published report by the Movement Disorders Society Task Force (4), we decided to exclude disorders in which cerebellar involvement is a minor or late finding in a complex multisystem phenotype or disorders that are already classified on their own such as genes associated with Joubert syndrome. The objective was to identify the core disorders that are involved in recessive ataxias in order to define this field of research and build a classification that would be accessible for all clinicians. Indeed, with the progressive advent of affordable NGS diagnostic testing, we believe that it is most important for clinicians to be at ease with one classification and familiar with the most frequent disorders in their unique ethnical and clinical context. Disorders in which ataxia has been reported as a rare or late finding should be included in large NGS testing strategies, but in our opinion should not be categorized as primary ataxias per se. From this perspective, our classification complements the proposal by the Movement Disorders Society Task Force.

There remain some important challenges to be addressed in the field of recessive ataxias. First, the issue of a proper nomenclature system has been much debated. Recently, the Movement Disorders Society Task Force proposed a revised naming system based on an ataxia prefix associated with the gene name (4); this was part of a larger effort to revise the nomenclature of all genetic movement disorders. This system overcomes the limitations of the numbered nomenclature, notably unconfirmed genes and erroneously attributed phenotypes, but its ease of use by non-experts and patients remains uncertain. Moreover, some disorders were assigned as many as three phenotypic prefixes while some other disorders that are among the most prevalent causes of recessive ataxia, such as POLG, were not assigned an ataxia prefix. Hence, there remains a debate concerning the attribution of prefixes and the integration of this naming system with other fields in neurology and

other specialties as many genes involved in ataxia have very complex multisystem phenotypes. Finally, one of the most important challenges in this field of orphan diseases is to develop targeted treatment strategies that address the pathogenic mechanism underlying symptoms progression. To this end, we believe that identifying common pathophysiological pathways may provide an opportunity for drug repurposing or enlarge the number of patients that are admissible for drug trials in order to find treatments for these rare but debilitating diseases.

2.7 Conclusion We present a clinical and a pathophysiological classification of autosomal recessive ataxias along with a clinical approach to a patient presenting with ataxia. This classification is the result of a consensus among a panel of international experts, and it promotes a unified understanding of recessive cerebellar disorders for clinicians and researchers.

2.8 Tables

Table 2.1 Primary recessive cerebellar ataxias MDS Alternate OMIM Geographic specificities Additional clinical clues and neuroimaging findings References Nomencla- nomencla- ture1 or gene ture2 name Most prevalent ataxias Most prevalent in Bilateral Babinski sign, square-wave jerks, scoliosis, populations of European hypertrophic cardiomyopathy, sensory involvement, ATX-FXN FRDA 229300 descent, Middle East and (16, 17) teenage onset, spinal cord atrophy, absence of North Africa; absent in Far cerebellar atrophy East populations Second most common Telangiectasias, oculomotor apraxia, cause of recessive ataxia photosensitivity, immunodeficiency, predisposition ATX-ATM AT 208900 worldwide, especially in for cancer, dystonia, myoclonus, (18-20) regions with low choreoathetosis,tremor, elevation of α-foetoprotein, inbreeding infantile onset, cerebellar atrophy Oculomotor apraxia, cognitive impairment, axonal Most prevalent in Japan; motor polyneuropathy, late onset of ATX- AOA1/E 208920 second most prevalent hypoalbuminemia, elevated α-fetoprotein and (21-23) APTX AOH ataxia in Portugal hypercholesterolemia, childhood onset, cerebellar atrophy Axonal sensorimotor polyneuropathy, pyramidal Worldwide, second most ATX- signs, oculomotor apraxia, head tremor, chorea, AOA2 606002 prevalent in Eastern (24-26) dystonia, elevation of α-foetoprotein, teenage onset, SETX France cerebellar atrophy Spastic paraparesis, retinal striation with thickened retinal nerve fibres, sensorimotor neuropathy, pes ATX/HSP- ARSACS 270550 Worldwide cavus, infantile or childhood onset, anterior superior (27, 28) SACS cerebellar atrophy, occasional T2-weighted linear hypointensities in pons MIRAS, Prevalent in populations of Cerebellar and sensory ataxia, dysarthria, European descent, progressive external ophthalmoplegia, myoclonus, POLG SANDO, 607459 (29, 31) especially Scandinavia, epilepsy, myopathy, migraine, variable age at onset, SCAE UK and Belgium. signal abnormalities in cerebellum and thalamus Pure cerebellar ataxia with occasional upper and/or ATX- ARCA1 610743 Worldwide lower motor neuron involvement, cognitive (6, 7, 32) SYNE1 impairment, late onset, cerebellar atrophy Spasticity, pyramidal signs, optic neuropathy, ptosis, HSP/ATX- Described worldwide, SPG7 607259 ophthalmoparesis, bladder dysfunction, adult onset, (33, 34) frequent in Europe SPG7 cerebellar atrophy COQ8A European descent, Algeria, Exercise intolerance, epilepsy, myoclonus, ARCA2 612016 (35, 36) (ATX- Middle East developmental delay, intellectual disability,

ADCK3) childhood onset, cerebellar atrophy, occasional stroke-like cerebral lesions Pure cerebellar ataxia with occasional upper motor ATX- European descent, Middle neuron signs, cognitive impairment, epilepsy, ARCA3 613728 (37-39) ANO10 East, West Indies, Japan nystagmus, teenage or adult onset, cerebellar atrophy Dorsal column involvement, areflexia, retinitis Worldwide, high ATX- pigmentosa, head titubation, low serum vitamin E, AVED 277460 prevalence around (40-42) skeletal difformities, teenage onset, spinal cord TTPA Mediterranean sea atrophy, occasional cerebellar atrophy Dementia, pyramidal signs, tendon xanthomas, atherosclerosis, cataracts, diarrhea, elevated serum ATX- CTX 213700 Worldwide cholestanol, polyneuropathy, childhood to adult (43-45) CYP27A1 onset, variable cerebellar atrophy, cerebellar or cerebral white matter anomalies Cataracts, intellectual disability, myopathy, short ATX-SIL1 MSS 248800 Worldwide (46-47) stature, childhood onset, cerebellar atrophy Athetosis, sensory axonal neuropathy, hypotonia, TWNK Described worldwide, optic atrophy, ophthalmoplegia, sensorineural IOSCA/ (ATX- 271245 highly prevalent in deafness, epilepsy, hypogonadism, liver (48-49) MTDPS7 C10orf2) Finland involvement, infantile onset, atrophy of brainstem and cerebellum Rare ataxias or described only in few families Demyelinating sensorimotor neuropathy, pes cavus, ATX- Europe, USA, Middle PHARC 612674 cataracts, hearing loss, retinitis pigmentosa, teenage (50-51) East, Algeria ABHD12 onset, cerebellar atrophy Ataxia, spasticity, oculomotor apraxia, myoclonic epilepsy, neuropathy, extrapyramidal involvement, ATX/HSP optic atrophy, severe cases with developmental SPAX5 614487 Colombia, Saudi Arabia (52, 53) -AFG3L2 regression, microcephaly, hypsarrythmia and intractable epilepsy, infantile to childhood onset, cerebellar atrophy Psychomotor retardation, hypotonia, strabismus, Cayman Grand Caiman Island, ATCAY 601238 bradykinesia, occasional dystonia, neonatal or (54, 55) Pakistan ataxia infantile onset, cerebellar hypoplasia Mild intellectual disability, occasional quadrupedal Iran, Saudi Arabia, gait, tremor, hyperreflexia, congenital onset, ATX-CA8 CAMRQ3 613227 (56, 57) Syria cerebellar atrophy, periventricular white matter anomalies Pyramidal signs, pes cavus, dysarthria, ataxia, slow HSP/ATX- Europe, Middle East, SPG76 616907 saccades, cognitive impairment, teenage to adult (58, 59) Brazil, Japan, Punjab CAPN1 onset, vermian cerebellar atrophy Chorioretinopathy, optic neuropathy, learning Leucoence- disability, headaches, occasional mild spasticity, HSP/ATX- Europe, North Africa, phalopathy 615651 childhood to adult onset, T2 hypersignal in (60, 61) CLCN2 Turkey, Japan with ataxia cerebellar and cerebral peduncles with internal capsule, myelin microvacuolation Sensorimotor neuropathy, hyporeflexia, mild cognitive impairment, elevated serum creatine MC4D, kinase, elevated lactate and pyruvate, ragged red COA7 220110 Italy, Japan (62, 63) SCAN3 fibers, infantile to childhood onset, cerebellar atrophy, supra-tentorial leucopathy, spinal cord atrophy Mitochondr Growth retardation, pyramidal signs, sensory ATX- ial complex neuropathy, extra-pyramidal features, elevation of 220110 Turkey (64, 65) COX20 IV blood lactate, childhood or teenage onset, cerebellar deficiency atrophy ATX- Intellectual disability, congenital to infantile onset, SCAR17 616127 Turkey, Netherlands (66, 67) CWF19L1 cerebellar atrophy Pyramidal signs, dorsal column sensory deficits, HSP/ATX- Worldwide, prevalent in SPG5A 270800 urge incontinence or voiding, childhood or teenage (68, 69) Europe CYP7B1 onset, white matter lesions Pyramidal signs, dorsal column dysfunction, axonal neuropathy, tremor, cerebral lactic acidosis, ATX/HSP- Worldwide, high carrier LBSL 611105 seizures, infantile to adult onset, signal (70, 71) rate in Finland DARS2 abnormalities in cerebral white matter and specific brainstem and spinal cord tracts Dilated cardiomyopathy, non-progressive cerebellar Canadian Hutterite ATX- DCMA/ ataxia, intellectual disability, testicular dysgenesis, 610198 population, Finland, (72-74) anemia, increased urinary 3-methylglutaconic acid, DNAJC19 MGCA5 Turkey infantile onset, progressive cerebellar atrophy HSP/ATX- Tunisia, Cyprus, Italy, Pyramidal signs, spastic dysarthria, cognitive SPG46 614409 (75, 76) GBA2 Norway impairment, hearing loss, cataracts, urge

incontinence, axonal sensorimotor neuropathy, childhood onset, cerebellar and cerebral atrophy, thin corpus callosum Belgium, Dutchland, Pyramidal signs, cognitive impairment, adult onset, GDAP2 - - (77) Egypt cerebellar atrophy HLD2 or Pelizaeus- Nystagmus, hypotonia progressing to spastic ATX/HSP- Merzbacher 608804 Worldwide tetraparesis, developmental delay, dystonia, chorea, (78, 79) GJC2 -like neonatal to infantile onset, diffuse hypomyelination disease Progressive Areflexia, myoclonic seizures, scoliosis, late MYC/ATX cognitive impairment, axonal sensory neuropathy myoclonic 614018 North Sea region (80, 81) -GOSR2 and anterior horn cell involvement, raised creatine epilepsy 6 kinase, infantile onset, occasional cerebellar atrophy Tonic upgaze, vertical nystagmus, oculomotor ATX- Middle East, Mexico, apraxia, intellectual disability, developmental delay, SCAR18 616204 (82, 83) GRID2 Morocco hypotonia, infantile onset, cerebellar atrophy. Possible autosomal dominant transmission. Developmental delay, intellectual disability, Roma ethnic group in occasional pyramidal signs, short stature, seizures, GRM1 SCAR13 614831 (84, 85) Bulgaria congenital onset, cerebellar atrophy; allelic with SCA44 Myoclonic epilepsy, retinopathy, dementia, adult ATX-GRN CLN11 614706 Italy, Portugal, Brazil (86, 87) onset, cerebellar atrophy Autosomal recessive and dominant transmission. Brazil, Europe, North Non-progressive cerebellar ataxia, iris hypoplasia, ATX- Gillespie 206700 Africa, Middle East, hypotonia, intellectual disability, facial (88, 89) ITPR1 syndrome Asia, Caribbean islands dysmorphism, neonatal onset, progressive cerebellar atrophy; allelic with SCA15 and SCA29 Spastic paraparesis with pyramidal signs, tremor, HSP/ATX- SPAX2/SP Palestine, Morocco, childhood or teenage onset, T2 hyperintensity in 611302 (90, 91) KIF1C G58 Turkey, Germany internal capsules, parietal and occipital white matter, cerebellar peduncles, and pyramidal tracts Epilepsy, sensorineural deafness, intellectual EAST/ Africa, Middle East, disability, tubulopathy and electrolyte imbalance, ATX- SeSAME 612780 India, Caucasian, Afro- hypotonia progressing to spasticity, infantile onset, (92-94) KCNJ10 syndrome Caribbean population cerebellar hypoplasia, signal anomaly in dentate nuclei L-2- Developmental delay, macrocephaly, hypotonia, elevated levels of L-2-hydroxyglutaric acid, infantile ATX- hydroxyglu 236792 Worldwide to adult onset, subcortical white matter, dentate (95, 96) L2HGDH taric nucleus and basal ganglia signal anomalies, aciduria cerebellar atrophy Described in Europe, Oculomotor apraxia, extra-pyramidal movement ATX- ATLD 604391 Saudi Arabia, Canada, disorders, occasional myoclonus, childhood onset, (97, 98) MRE11A Pakistan and Japan. cerebellar atrophy Pyramidal signs, optic atrophy, sensibility to MTPAP SPAX4 613672 Amish families ionizing radiations, developmental delay, cognitive (99, 100) impairment, growth failure, infantile onset Axonal motor or sensorimotor neuropathy, variable ATX- PBD 6B or cognitive impairment, nystagmus, hypo or 614871 Caucasians, Japan (101, 102) PEX10 ZSD hyperreflexia, childhood to adolescent onset, cerebellar atrophy Intellectual disability, hypotonia, short stature, ATX- Lebanon, France, severe phenotype with lactic academia and SCAR2 213200 (103-105) PMPCA French Canadians ophthalmoplegia, congenital or infantile onset, cerebellar atrophy 61626 Dystonia, oculomotor apraxia, sensorimotor PNKP AOA4 European descent polyneuropathy, cognitive impairment, childhood (106-108) 7 onset, cerebellar atrophy 215470 Hypogonadotropic hypogonadism, chorioretinal ATX/HSP- BNS/ GHS/ , Worldwide dystrophy, pyramidal signs, childhood onset, (109, 110) PNPLA6 OMCS 275400 atrophy of cerebellum and pons; allelic to HSP39 Tremor, variable cognitive impairment, spasticity, hyperreflexia, variable hypodontia and dysmorphism, hypogonadotropic hypogonadism, ATX/HSP- HLD7, 4H 607694 Worldwide myopia, short stature, infantile to childhood onset, (111, 112) POLR3A syndrome diffuse cerebral hypomyelination, cerebellar atrophy, thin corpus callosum, T2 hypointense thalamus Japan, Caucasians, Intellectual disability, vertical gaze limitation, ATX- HLD8 614381 Syria, African hypodontia, hypogonadotropic hypogonadism, (113, 114) POLR3B American, myopia, mild hyperreflexia, short stature, infantile

Mediterranean to childhood onset, diffuse cerebral hypomyelination with partly myelinated internal capsule, cerebellar atrophy, thin corpus callosum, T2 hypointense thalamus Ataxia and Hypogonadotropic hypogonadism, dementia, ATX- hypogona- 212840 Middle East, Caucasians occasional chorea, childhood to young adult onset, (115, 116) RNF216 dotropism/ cerebellar atrophy, cerebral white matter anomalies GHS Transient episodes of liver failure, intention tremor, European, Middle East, peripheral sensorimotor neuropathy, mild cognitive SCYL1 SCAR21 616719 Cuba, Ashkenazi Jews (117, 118) impairment, occasional short stature, infantile to

childhood onset, cerebellar vermis atrophy Intellectual disability, developmental delay, Portugal, Middle East, ATX- macrocephaly, dysmorphism, hypotonia, skeletal SCAR20 616354 North Africa, Central (119, 120) anomalies, occasional sensorineural hearing loss, SNX14 Asia infantile onset, cerebellar atrophy Occasional sensorineural hearing loss, mild LIKNS/ SLC9A1 616291 Turkey, Han Chinese psychomotor delay, infantile to childhood onset, (121, 122) SCAR19 progressive cerebellar atrophy Cognitive impairment, developmental delay, ATX- SCAR14/ Middle East, Egypt, nystagmus, hypotonia, occasional tremor, infantile 615386 (123, 124) SPTBN2 SPARCA1 North America to childhood onset, cerebellar atrophy; allelic to SCA5 Pyramidal signs, variable cognitive impairment, ATX- China, Middle East, SCAR16 615768 occasional hypogonadism, variable age at onset, (125, 126) Caucasians STUB1 cerebellar atrophy; allelic to SCA48 Seizures, developmental delay, dysmorphism, TDP2 SCAR23 616949 Ireland, USA hypotonia, hypersomnia, failure to thrive, infantile (127, 128) to childhood onset, absence of cerebellar atrophy Occasional pyramidal signs, posterior column The Nertherlands, involvement, tremor, square-wave jerks, nystagmus, ATX-TPP1 SCAR7 609270 African American (129, 130) childhood to adolescent onset, pontocerebellar population atrophy; allelic to CLN2 Optic atrophy, nystagmus, intention tremor, HSP/ATX- pyramidal signs, dorsal column involvement, mild SPG79 615491 Norway, Turkey (131, 132) UCHL1 cognitive impairment, childhood onset, cerebellar atrophy Non-progressive cerebellar ataxia, moderate to severe intellectual disability, hypotonia, strabismus, North American ATX- CAMRQ1/ delayed ambulation with occasional quadripedal 224050 Hutterite population, (133, 134) gait, seizures, congenital to infantile onset, inferior VLDLR DES Middle East, Europe cerebellar hypoplasia, pontine hypoplasia, cortical gyral simplification Pyramidal signs, axial hypotonia, oculomotor Europe, USA, French abnormalities, chorea or dystonia, cognitive VPS13D SCAR4 607317 Canadian, Egyptian, (135, 136) impairment, infantile to adult onset, cerebellar Javanese atrophy, basal ganglia T2 hyperintensity Occasional quadrupedal gait, intellectual disability, ATX- CAMRQ2/ congenital onset, cerebellar hypoplasia; allelic with 610185 Turkey, Yemen (137, 138) WDR81 DES2 Congenital hydrocephalus type 3 with brain anomalies Oculomotor apraxia with nystagmus, peripheral sensorimotor axonal neuropathy, cognitive XRCC1 SCAR26 617633 India, Pakistan (139, 140) impairment, childhood to adult onset, progressive cerebellar atrophy. In part inspired from (3). 1MDS nomenclature: Nomenclature proposed by the Movement Disorder Society Task Force on Classification and Nomenclature of Genetic Movement Disorders (4) with a phenotypical prefix followed by the gene name. ATX Ataxia ; HSP Hereditary spastic paraplegia ; MYC Myoclonus. 2Acronyms: AOA ataxia with oculomotor apraxia; ARCA autosomal recessive cerebellar ataxia; ARSACS autosomal recessive spastic ataxia of Charlevoix-Saguenay; AT ataxia-telangiectasia; ATLD ataxia-telangiectasia-like disorder; AVED ataxia with vitamin E deficiency; BNS Boucher-Neuhäuser syndrome; CA Cayman ataxia; CAMRQ cerebellar ataxia mental retardation with or without quadrupedal locomotion; DCMA Dilated cardiomyopathy with ataxia; DES Desequilibrium syndrome; EAOH Early-onset ataxia with oculomotor apraxia and hypoalbuminemia FRDA Friedreich ataxia; GHS Gordon Holmes Syndrome; HLD hypomyelinating leukodystrophy; IOSCA infantile onset spinocerebellar ataxia; LIKNS Lichtenstein-Knorr syndrome; MGCA5 3-methyglutaconic aciduria type 5; MIRAS mitochondrial recessive ataxia syndrome; Mitochondrial complex 4 deficiency; MSS Marinesco-Sjogren syndrome; MTDPS7 mitochondrial DNA depletion syndrome 7; NBIA Neurodegeneration with brain iron accumulation; OMCS Oliver McFarlane Syndrome; PBD Peroxisome biogenesis disorder; PEOA3 progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 3; PHARC polyneuropathy hearing loss ataxia retinitis pigmentosa and cataract; SANDO sensory ataxic neuropathy with dysarthria and ophthalmoparesis; SCAE spinocerebellar ataxia with epilepsy SCAN1 spinocerebellar ataxia with axonal

neuropathy 1; SCAR Spinocerebellar ataxia, autosomal recessive; SeSAME Seizures sensorineural deafness ataxia mental retardation and electrolyte imbalance; SPAX spastic ataxia; SPG spastic paraplegiaUMN upper motor neuron; ZSD Zellweger Spectrum Disorder.

Table 2.3 Other metabolic or complex recessive disorders that have ataxia as an associated feature MDS Alternate OMIM Additional clinical clues References Nomenclature1 or nomenclature 2 gene name ATX-AHI1 ATX-ARL13B ATX-CEP290 Joubert Developmental delay, ataxia, hypotonia, neonatal breathing ATX-CC2D2A syndrome Many, abnormalities, intellectual disability, nephronophtisis, congenital onset, ATX-OFD1 (including see agenesis of the cerebellar vermis with molar tooth sign; in COACH (141, 142) ATX-TMEM231 COACH 213300 syndrome, associated with ocular colobomas and hepatic fibrosis ATX-TMEM67 syndrome) ATX-RPGRIP1L others Succininc Developmental delay, intellectual disability, language dysfunction, semialdehyde hypotonia, hyporeflexia, autistic behavior and hallucinations, infantile ATX-ALDH5A1 603147 (143, 144) dehydrogenase to childhood onset, T2 hypersignal in globi pallidi deficiency Developmental delay, hypotonia, seizures, protein-losing enteropathy, psychiatric manifestations, nystagmus, strabismus, failure to thrive, ATX-ALG6 CDG1c 603147 (145, 146) dysmorphic features, neonatal to infantile onset, occasional brain atrophy Tremor, dystonia, parkinsonism, choreoathetosis, liver disease, DYT/ATX- Wilson disease 277900 psychiatric involvement, Kayser-Fleischer rings, childhood to adult (147) ATP7B onset, T2 hypersignal in basal ganglia or brainstem Global development delay, cognitive impairment, microcephaly, ataxia ATP8A2 CAMRQ4 615268 or quadrupedal gait, choreoathetoid movement, congenital onset, (148, 149) cerebellar and cerebral atrophy or delay in myelination Pyramidal signs, amyotrophy, progressive hyporeflexia, cognitive HSP/ATX- impairment, axonal peripheral neuropathy, occasional cerebellar ataxia SPG26 609195 (150) B4GALNT1 and extrapyramidal signs, scoliosis, childhood to teenage onset, cerebral cortical atrophy, T2 white matter hypertintensity Seizures, hypotonia, developmental delay, optic atrophy, sensorineural Biotinidase hearing loss, skin rash, alopecia, hepatosplenomegaly, optic atrophy, ATX-BTD 253260 (151, 152) deficiency exacerbation during infections, infantile to childhood onset, white matter anomalies including delayed demyelination Myoclonic epilepsy, psychomotor retardation or regression, ataxia, MYC-CLN5 CLN 256731 visual loss, ataxia, infantile to adult onset, cerebellar and cortical (153) atrophy Diabetes, dementia, parkinsonism, dystonia, cerebellar ataxia, retinal NBIA/DYT/ Aceruloplasmi- degeneration, involuntary movements, anemia, low serum and urinary 604290 (154) PARK-CP nemia copper, adult onset, decreased signal intensity in thalamus, basal ganglia and dentate nucleus Unverricht and Stimulus-sensitive and action-sensitive myoclonus, tonic-clonic MYC/ATX- Lundborg 254800 generalized seizures, mild cerebellar ataxia, cognitive impairment, (155) CSTB1 disease/EPM1 emotional lability, childhood to adolescent onset, normal brain MRI EIF2B1, EIF2B2, Cerebellar ataxia with spasticity, clinical deterioration following head Vanishing white trauma, febrile illness or surgery, infantile to adult onset, symmetric EIF2B3, EIF2B4, 603896 (156, 157) matter disease and diffusely abnormal cerebral white matter that appears isointense to EIF2B5 cerebrospinal fluid MYC/ATX- Myoclonus, generalised tonic-clonic seizures, occipital seizures, EPM2A headaches, behavioural deterioration, rapidly progressive dementia, Lafora disease 607566 (158, 159) MYC/ATX- cerebellar ataxia, spasticity, adolescent onset, normal initial brain MRI NHLRC1 with progressive diffuse atrophy Xeroderma Photosensitivity, solar lentigines growth retardation, microcephaly, Pigmentosum/ ERCC4 278760 ataxia, chorea, cognitive impairment, adolescent to adult onset, (160, 161) Cockayne cerebellar and brainstem atrophy syndrome Spastic paraparesis, pyramidal signs, dystonia, ataxia, dysarthria, optic HSP/ATX/NBIA- atrophy, seizures, cognitive impairment, childhood to adolescent onset, SPG35/ FAHN 612319 (162) FA2H T2 subcortical and periventricular white matter hyperintensity, atrophy of cerebellum and brainstem Neurodegene- Developmental regression, hypotonia, myoclonic, tonic or astatic ATX/HSP- ration due to seizures, cerebellar ataxia, chorea, tremor, autism spectrum disorder, 613068 (163, 164) FOLR1 cerebral folate occasional pyramidal signs, infantile onset, delayed myelination in transport cerebral white matter, cerebellar atrophy

deficiency Peripheral sensorimotor neuropathy, weakness, amyotrophy, areflexia, Giant axonal pes cavus, typical frizzly hair, ataxia, nystagmus, pyramidal signs, HSP/ATX-GAN1 256850 (165, 166) neuropathy 1 seizures, cognitive impairment, childhood onset, cerebellar or cerebral white matter T2 hypersignal GM1 Developmental regression in childhood with gait disorder and cognitive DYT/PARK- impairment, dystonia, hepatosplenomegaly, ataxia, skeletal dysplasia, gangliosidosis 230600 (167, 168) GLB1 cardiomyopathy, infantile to childhood onset, progressive diffuse brain type II atrophy Infantile form with weakness, motor regression, startle reaction, Tay-Sachs myoclonic jerks, decreased attentiveness, cherry-red spots, dementia, ATX/HSP-HEXA 272800 (169, 170) disease blindness. Juvenile form with ataxia, dysarthria, incoordination; adult form with ALS-like symptomatology Sandhoff ATX/HSP-HEXB 268800 Similar to Tay-Sachs with organomegaly (171) disease Perreault syndrome1, D- Sensorineural hearing loss, ovarian dysfunction, ataxia, dysarthria, HSD17B4 bifunctional 233400 dysmetria, hyperreflexia, cognitive impairment, sensory neuropathy, (172, 173) protein childhood onset, cerebellar atrophy deficiency Spasticity, ataxia, cognitive impairment, sensorimotor neuropathy, HSP- KIAA1840 SPG11 604360 childhood or teenage onset, thin corpus callosum, signal abnormalities (174, 175) in cervical cord Multifocal myoclonic seizures, status myoclonus, motor and language MYC/ATX- regression, intellectual disability, cerebellar ataxia, infantile onset, EPM3/CLN14 611726 (176, 177) KCTD7 diffuse cerebral and cerebellar atrophy, T2 periventricular white matter hyperintensity Dysmorphism, skeletal abnormalities, visceromegaly, sensorineuronal Alpha- hearing loss, immunodeficiency, cognitive impairment, psychosis, ATX-MAN2B1 248500 (178) mannosidosis ataxia, prenatal to adult onset, cerebellar atrophy, partially empty sella turcica, white matter abnormalities Megalencepha- lic Macrocephaly, initial radiological-clinical discrepancy, eventual motor leukoencephalo- HSP/ATX-MLC1 604004 regression, ataxia, spasticity, epilepsy, cognitive decline, infantile (179) pathy with onset, diffuse supratentorial white matter signal anomalies subcortical cysts Myalgia, proximal muscle weakness, psychiatric manifestations, ATX-MSTO1 MMYAT 617619 developmental delay, tremor, dysmetria, pigmentary retinopathy, (180, 181) growth retardation, neonatal to childhood onset, cerebellar atrophy Fat malabsorption symptoms, hypocholesterolemia, Abetalipoprotei- MTTP 200100 hypotriglyceridemia, acanthocytosis, sensory loss, hyporeflexia, ataxia, (182) nemia neonatal onset, absence of cerebellar atrophy Neuraminidase Myoclonic epilepsy, visual impairment, cherry red spots, ataxia, hyperreflexia, severe phenotype with dysmorphic features, dysostosis MYC/ATX- deficiency or 256550 multiplex, hepatomegaly, developmental delay, increased urinary (183, 184) NEU1 sialidosis type I bound sialic acid, variable age at onset, diffuse cerebellar and cerebral and II atrophy SPAX8 with Nystagmus, developmental delay, hypotonia followed by rapidly hypomyelina- progressive spasticity, weakness, dystonia, dysphagia, ataxia, visual NKX6-2 617560 (185, 186) ting impairment, infantile to childhood onset, brain hypomyelination, leukodystrophy occasional cerebellar atrophy Vertical supranuclear ophthalmoplegia, gelastic cataplexy, premature ATX-NPC1 Niemann-Pick 257220 cognitive decline, dystonia, hepatosplenomegaly, respiratory failure, (187-189) ATX-NPC2 type C 607625 seizures, psychiatric features, neonatal to adult onset, variable cerebellar or cerebral atrophy Optic atrophy, pyramidal signs, sensorimotor peripheral neuropathy, cerebellar ataxia, developmental delay, gastrointestinal symptoms, OPA1 Behr syndrome 210000 (190, 191) infantile or childhood onset, cerebellar atrophy; allelic to dominant optic atrophy 1 PBD5B/Zellwe Hypotonia, seizures, inability to feed, ataxia, hyporeflexia, slow PEX2 ger-spectrum 614867 saccades, sensorimotor neuropathy, childhood to adult onset, cerebellar (192, 193) disorder atrophy Retinitis pigmentosa, polyneuropathy, ataxia, anosmia, pes cavus, skeletal abnormalities, ichtyosis, hearing loss, cataracts, ATX-PEX7 PBD9B 614879 (194) cardiomyopathy, elevated phytanic acid, childhood or teenage onset, absence of cerebellar atrophy Retinitis pigmentosa, polyneuropathy, increased cerebrospinal fluid ATX-PHYH Refsum disease 266500 protein, anosmia, sensorineural hearing loss, ichtyosis, ataxia, teenage (195) onset, elevated serum phytanic acid, absence of cerebellar atrophy NBIA/DYT/PAR Psychomotor retardation or regression, hypotonia followed by spastic NBIA 2A 256600 (196, 197) K-PLA2G6 quadriparesis, ataxia, strabismus, nystagmus, infantile to teenage onset,

cerebellar atrophy and variable iron accumulation in globi pallidi with associated T2 hypointensity Intellectual disability, axial hypotonia, visceral involvement with feeding difficulties and cardiac involvement, dysmorphic features, ATX-PMM2 CDG 1a 212065 cerebellar ataxia, strabismus, peripheral neuropathy, retinitis (198, 199) pigmentosa, skeletal abnormalities, infantile to adult onset, cerebellar hypoplasia or atrophy Episodic Seizures, paroxysmal non-kinesigenic dyskinesia, paroxysmal vertigo, PxMD/DYT/AT kinesigenic 614386 episodic ataxia, hemiplegic migraine, rare progressive ataxia, infantile (200, 201) X-PRRT2 dyskinesia 1 to childhood onset, occasional cerebellar atrophy Developmental delay, intellectual disability, hypotonia, muscular weakness, demyelinating sensorimotor neuropathy, dysmorphism, ATX-PTRH2 IMNEPD 616263 (202, 203) ataxia, microcephaly, growth retardation, sensorineural deafness, pancreatic insufficiency, infantile onset, variable cerebellar atrophy Developmental delay, intellectual disability, hypotonia, nystagmus, SEPSECS PCH 2D 613811 microcephaly, seizure, ataxia, spasticity, chorea, congenital to infantile (204, 205) onset, cerebellar and cerebral atrophy, thinning of corpus callosum Severe neonatal phenotype with ascites, failure to thrive and early Sialic acid 604369 death. Milder infantile phenotype with hypotonia, cerebellar ataxia and ATX-SLC17A5 (206-208) storage diseases 269920 intellectual disability, infantile to adult onset, hypomyelination, cerebellar atrophy Epileptic encephalopathy, psychomotor retardation, hypotonia, GLUT1 SLC2A1 606777 dystonia, microcephaly, ataxia, spasticity, seizures, infantile onset, (209, 210) deficiency absence of cerebellar atrophy Sensorimotor neuropathy, optic atrophy, blindness, sensorineural SCAR3/ 271250 hearing loss, respiratory insufficiency, bulbar involvement, childhood ATX-SLC52A2 (211-213) BVVLS2 614707 onset, absence of cerebellar atrophy; ataxia is on a spectrum between Brown-Vialetto-Van Laere syndrome type 2 and SCAR3 Transient manifestations of pellagra, cerebellar ataxia, psychosis, Hartnup SLC6A19 234500 nystagmus and ophthalmoparesis, cognitive impairment, amino (214) disorder aciduria, early onset Optic atrophy, blindness, severe sensorimotor neuropathy, hyporeflexia, amyotrophy, pes cavus, sensory loss in lower limbs, SLC25A46 CMT6B 616505 sensitive and cerebellar ataxia, nystagmus, divergent strabismus, (215, 216) neonatal to childhood onset, cerebellar and brain atrophy, T2 hyperintensity in cerebellar white matter Hypotonia, intellectual disability, optic nerve atrophy, nystagmus, ATX-SRD5A3 CDG 1q 612379 ocular colobomas, ichtyosis, palmoplantar keratodermia, mild (217, 218) ataxia,congenital to childhood onset, cerebellar vermis hypoplasia Muscular hypotonia progressing to spasticity, developmental delay, neurological regression with loss of language and ambulation, cognitive ATX-TTC19 MC3DN2 615157 regression, rapid evolution, axonal motor neuropathy, psychiatric (219-221) features, infantile to adult onset, cerebral and cerebellar atrophy, T2 hypersignal in basal ganglia, bilateral inferior olive involvement Intellectual disability, nephrotic syndrome, microcephaly, hypotonia, ATX-WDR73 GMS/ SCAR5 251300 epilepsy, optic atrophy, skin abnormalities, infantile to childhood onset, (222, 223) cerebellar and cerebral atrophy Diabetes mellitus, optic atrophy, diabetes insipidus, deafness, renal Wolfram WFS1 222300 abnormalities, ataxia, intellectual disability, psychiatric features, (224) syndrome childhood to adolescent onset, generalized brain and cerebellar atrophy Tonic-clonic epilepsy, intellectual disability, spasticity, neonatal to childhood onset, variable cerebellar or cerebral atrophy, phenotypic WWOX SCAR12 614322 (225, 226) spectrum with infantile epileptic encephalopathy associated with psychomotor retardation and growth retardation 1MDS nomenclature: Nomenclature proposed by the Movement Disorder Society Task Force on Classification and Nomenclature of Genetic Movement Disorders (4) with a phenotypical prefix followed by the gene name. ATX Ataxia ; DYT Dystonia ; HSP Hereditary spastic paraplegia ; MYC Myoclonus ; NBIA Neurodegeneration with brain iron accumulation PARK Parkinsonism. 2Acronyms: ALS Amyotrophic lateral sclerosis ; BVVLS2 Brown-Vialetto-Van Laere syndrome type 2 ; CAMRQ cerebellar ataxia mental retardation with or without quadrupedal locomotion; CDG Congenital disorder of glycosylation ; CLN Neuronal ceroid lipofuscinosis; CMT Charcot-Marie-Tooth; COACH Cerebellar vermis hypoplasia, oligophrenia, congenital ataxia, ocular coloboma, and hepatic fibrosis; EPM Progressive myoclonic epilepsy; FAHN Fatty acid hydroxylase-associated neurodegeneration; GMS Galloway- Mowat syndrome; IMNEPD Infantile-onset multisystem neurologic, endocrine, and pancreatic disease; MC3DN2 Mitochondrial complex III deficiency, nuclear type 2; MMYAT Mitochondrial myopathy and ataxia; NBIA Neurodegeneration with brain iron accumulation; PBD Peroxisome biogenesis disorder; PCH Pontocerebellar hypoplasia; SCAR Spinocerebellar ataxia; autosomal recessive; SPAX Spastic ataxia; SPG Spastic paraplegia.

2.9 Figures

Figure 2.1 Clinical classification of autosomal recessive ataxias

The gene associated with each primary recessive ataxia is classified according to the most frequent clinical syndrome described for this disorder. Note that some disorders have more complex or variable phenotypes and are placed in the overlapping areas between two categories. Genes presented in larger font represent the most prevalent ataxias.

Figure 2.2 Graphical summary of the clinical approach to a patient presenting with ataxia

WES whole exome sequencing; WGS whole genome sequencing.

Figure 2.3 Classification of autosomal recessive ataxias according to molecular pathogenesis

ALTERED SYNAPSE MORPHOLOGY ATCAY, CA8, CAPN1, GOSR2, GRID2, GRM1, ITPR1, RNF216, SLC9A1, SPTBN2, SYNE1, UCHL1 FROM MOSSY FIBERS

LYSOSOMAL DYSFUNCTION GRN, TPP1 DISRUPTED AUTOPHAGY SNX14, VPS13D UBIQUITIN-PROTEASOME PATHWAY RNF216, UCHL1, STUB1 CYTOSKELETON ARCHITECTURE SACS, SYNE1 PROTEIN FOLDING OR QUALITY CONTROL SACS, SIL1, STUB1

GOLGI DYSFUNCTION COQ8A, GOSR2, SCYL1

DNA DOUBLE STRAND BREAK REPAIR ATM, MRE11A, SETX, TDP2 MITOCHONDRIAL DEFECT ALTERED INTRACELLULAR DNA SINGLE STRAND BREAK REPAIR DNA MAINTENANCE TRAFFICKING APTX, PNKP, XRCC1 PNKP, POLG, TWNK GOSR2, SCYL1, SPTBN2, SYNE1, TTPA OXIDATIVE STRESS ATM, FXN, TTPA OTHER MITOCHONDRIAL RNA PROCESSING AFG3L2, APTX, COA7, COQ8A, COX20, CWF19L1, POLR3A, POLR3B, SETX DARS2, DNAJC19, L2HGDH, MTPAP, PMPCA, SACS, SPG7, STUB1, VPS13D +

LIPID METABOLISM CALCIUM HOMEOSTATIS ABHD12,CYP27A1, CYP7B1, DNAJC19, AFG3L2, ANO10, CA8, GBA2, PNPLA6, SNX14, TTPA ITPR1, SPG7

AXONAL DYSFUNCTION DARS2, GJC2, KCNJ10, PNPLA6, SLC9A1

ABNORMAL MYELIN OTHERS STRUCTURE OR COMPOSITION GDAP2, PEX10, WDR81, VLDLR ABHD12, CLCN2, GJC2, KCNJ10, KIF1C, L2HGDH, POLR3A, POLR3B

INTRINSIC PURKINJE CELL FIRING SACS, SPTBN2

TO DEEP CEREBELLAR NUCLEI

A Purkinje cell is depicted along with a granule cell and parallel fibers. Subcellular organelles and structures are represented graphically. Each gene is classified at one or more subcellular localizations according to the different metabolic pathways involved.

2.10 References 1. Klein CJ, Foroud TM. Neurology individualized medicine: when to use next-generation sequencing panels. Mayo Clin Proc. 2017;92(2):292-305. 2. Bahlo M, Bennett MF, Degorski P, Tankard RM, Delatycki MB, Lockhart PJ. Recent advances in the detection of repeat expansions with short-read next-generation sequencing. F1000Res. 2018;7. 3. Beaudin M, Klein CJ, Rouleau GA, Dupre N. Systematic review of autosomal recessive ataxias and proposal for a classification. Cerebellum Ataxias. 2017;4:3. 4. Rossi M, Anheim M, Durr A, Klein C, Koenig M, Synofzik M, et al. The genetic nomenclature of recessive cerebellar ataxias. Mov Disord. 2018;33(7):1056-76. 5. Dalmau J, Rosenfeld MR. Paraneoplastic syndromes of the CNS. Lancet Neurol. 2008;7(4):327-40. 6. Gros-Louis F, Dupre N, Dion P, Fox MA, Laurent S, Verreault S, et al. Mutations in SYNE1 lead to a newly discovered form of autosomal recessive cerebellar ataxia. Nat Genet. 2007;39(1):80-5. 7. Synofzik M, Smets K, Mallaret M, Di Bella D, Gallenmuller C, Baets J, et al. SYNE1 ataxia is a common recessive ataxia with major non-cerebellar features: a large multi-centre study. Brain. 2016;139(Pt 5):1378-93. 8. Coutelier M, Hammer MB, Stevanin G, Monin ML, Davoine CS, Mochel F, et al. Efficacy of exome-targeted capture sequencing to detect mutations in known cerebellar ataxia genes. JAMA Neurol. 2018. 9. Nemeth AH, Kwasniewska AC, Lise S, Parolin Schnekenberg R, Becker EB, Bera KD, et al. Next generation sequencing for molecular diagnosis of neurological disorders using ataxias as a model. Brain. 2013;136(Pt 10):3106-18. 10. Sun M, Johnson AK, Nelakuditi V, Guidugli L, Fischer D, Arndt K, et al. Targeted exome analysis identifies the genetic basis of disease in over 50% of patients with a wide range of ataxia- related phenotypes. Genet Med. 2018. 11. Valence S, Cochet E, Rougeot C, Garel C, Chantot-Bastaraud S, Lainey E, et al. Exome sequencing in congenital ataxia identifies two new candidate genes and highlights a pathophysiological link between some congenital ataxias and early infantile epileptic encephalopathies. Genet Med. 2018. 12. Fogel BL, Lee H, Deignan JL, Strom SP, Kantarci S, Wang X, et al. Exome sequencing in the clinical diagnosis of sporadic or familial cerebellar ataxia. JAMA Neurol. 2014;71(10):1237-46. 13. Kang C, Liang C, Ahmad KE, Gu Y, Siow SF, Colebatch JG, et al. High degree of genetic heterogeneity for hereditary cerebellar ataxias in Australia. Cerebellum. 2018. 14. Liu Y, Zaun HC, Orlowski J, Ackerman SL. CHP1-mediated NHE1 biosynthetic maturation is required for Purkinje cell axon homeostasis. J Neurosci. 2013;33(31):12656-69. 15. Renaud M, Tranchant C, Martin JVT, Mochel F, Synofzik M, van de Warrenburg B, et al. A recessive ataxia diagnosis algorithm for the next generation sequencing era. Ann Neurol. 2017;82(6):892-9. 16. Campuzano V, Montermini L, Molto MD, Pianese L, Cossee M, Cavalcanti F, et al. Friedreich's ataxia: autosomal recessive disease caused by an intronic GAA triplet repeat expansion. Science. 1996;271(5254):1423-7. 17. Durr A, Cossee M, Agid Y, Campuzano V, Mignard C, Penet C, et al. Clinical and genetic abnormalities in patients with Friedreich's ataxia. N Engl J Med. 1996;335(16):1169-75. 18. Savitsky K, Bar-Shira A, Gilad S, Rotman G, Ziv Y, Vanagaite L, et al. A single ataxia telangiectasia gene with a product similar to PI-3 kinase. Science. 1995;268(5218):1749-53. 19. Wright J, Teraoka S, Onengut S, Tolun A, Gatti RA, Ochs HD, et al. A high frequency of distinct ATM gene mutations in ataxia-telangiectasia. Am J Hum Genet. 1996;59(4):839-46.

20. Levy A, Lang AE. Ataxia-telangiectasia: A review of movement disorders, clinical features, and genotype correlations. Mov Disord. 2018. 21. Date H, Onodera O, Tanaka H, Iwabuchi K, Uekawa K, Igarashi S, et al. Early-onset ataxia with ocular motor apraxia and hypoalbuminemia is caused by mutations in a new HIT superfamily gene. Nat Genet. 2001;29(2):184-8. 22. Moreira MC, Barbot C, Tachi N, Kozuka N, Uchida E, Gibson T, et al. The gene mutated in ataxia-ocular apraxia 1 encodes the new HIT/Zn-finger protein aprataxin. Nat Genet. 2001;29(2):189-93. 23. Renaud M, Moreira MC, Ben Monga B, Rodriguez D, Debs R, Charles P, et al. Clinical, biomarker, and molecular delineations and genotype-phenotype correlations of ataxia with oculomotor apraxia type 1. JAMA Neurol. 2018;75(4):495-502. 24. Moreira MC, Klur S, Watanabe M, Nemeth AH, Le Ber I, Moniz JC, et al. Senataxin, the ortholog of a yeast RNA helicase, is mutant in ataxia-ocular apraxia 2. Nat Genet. 2004;36(3):225- 7. 25. Le Ber I, Bouslam N, Rivaud-Pechoux S, Guimaraes J, Benomar A, Chamayou C, et al. Frequency and phenotypic spectrum of ataxia with oculomotor apraxia 2: a clinical and genetic study in 18 patients. Brain. 2004;127(Pt 4):759-67. 26. Anheim M, Fleury M, Monga B, Laugel V, Chaigne D, Rodier G, et al. Epidemiological, clinical, paraclinical and molecular study of a cohort of 102 patients affected with autosomal recessive progressive cerebellar ataxia from Alsace, Eastern France: implications for clinical management. Neurogenetics. 2010;11(1):1-12. 27. Engert JC, Berube P, Mercier J, Dore C, Lepage P, Ge B, et al. ARSACS, a spastic ataxia common in northeastern Quebec, is caused by mutations in a new gene encoding an 11.5-kb ORF. Nat Genet. 2000;24(2):120-5. 28. Criscuolo C, Banfi S, Orio M, Gasparini P, Monticelli A, Scarano V, et al. A novel mutation in SACS gene in a family from southern Italy. Neurology. 2004;62(1):100-2. 29. Van Goethem G, Martin JJ, Dermaut B, Lofgren A, Wibail A, Ververken D, et al. Recessive POLG mutations presenting with sensory and ataxic neuropathy in compound heterozygote patients with progressive external ophthalmoplegia. Neuromuscul Disord. 2003;13(2):133-42. 30. Winterthun S, Ferrari G, He L, Taylor RW, Zeviani M, Turnbull DM, et al. Autosomal recessive mitochondrial ataxic syndrome due to mitochondrial polymerase gamma mutations. Neurology. 2005;64(7):1204-8. 31. Cohen BH, Chinnery PF, Copeland WC. POLG-related disorders. In: Adam MP, Ardinger HH, Pagon RA, Wallace SE, Bean LJH, Stephens K, et al., editors. GeneReviews((R)). Seattle (WA)1993. 32. Izumi Y, Miyamoto R, Morino H, Yoshizawa A, Nishinaka K, Udaka F, et al. Cerebellar ataxia with SYNE1 mutation accompanying motor neuron disease. Neurology. 2013;80(1). 33. Casari G, De Fusco M, Ciarmatori S, Zeviani M, Mora M, Fernandez P, et al. Spastic paraplegia and OXPHOS impairment caused by mutations in paraplegin, a nuclear-encoded mitochondrial metalloprotease. Cell. 1998;93(6):973-83. 34. Pfeffer G, Pyle A, Griffin H, Miller J, Wilson V, Turnbull L, et al. SPG7 mutations are a common cause of undiagnosed ataxia. Neurology. 2015;84(11):1174-6. 35. Lagier-Tourenne C, Tazir M, Lopez LC, Quinzii CM, Assoum M, Drouot N, et al. ADCK3, an ancestral kinase, is mutated in a form of recessive ataxia associated with coenzyme Q10 deficiency. Am J Hum Genet. 2008;82(3):661-72. 36. Mollet J, Delahodde A, Serre V, Chretien D, Schlemmer D, Lombes A, et al. CABC1 gene mutations cause ubiquinone deficiency with cerebellar ataxia and seizures. Am J Hum Genet. 2008;82(3):623-30.

37. Vermeer S, Hoischen A, Meijer RP, Gilissen C, Neveling K, Wieskamp N, et al. Targeted next-generation sequencing of a 12.5 Mb homozygous region reveals ANO10 mutations in patients with autosomal-recessive cerebellar ataxia. Am J Hum Genet. 2010;87(6):813-9. 38. Chamova T, Florez L, Guergueltcheva V, Raycheva M, Kaneva R, Lochmuller H, et al. ANO10 c.1150_1151del is a founder mutation causing autosomal recessive cerebellar ataxia in Roma/Gypsies. J Neurol. 2012;259(5):906-11. 39. Renaud M, Anheim M, Kamsteeg EJ, Mallaret M, Mochel F, Vermeer S, et al. Autosomal recessive cerebellar ataxia type 3 due to ANO10 mutations: delineation and genotype-phenotype correlation study. JAMA Neurol. 2014;71(10):1305-10. 40. Ouahchi K, Arita M, Kayden H, Hentati F, Ben Hamida M, Sokol R, et al. Ataxia with isolated vitamin E deficiency is caused by mutations in the alpha-tocopherol transfer protein. Nat Genet. 1995;9(2):141-5. 41. Yokota T, Shiojiri T, Gotoda T, Arita M, Arai H, Ohga T, et al. Friedreich-like ataxia with retinitis pigmentosa caused by the His101Gln mutation of the alpha-tocopherol transfer protein gene. Ann Neurol. 1997;41(6):826-32. 42. El Euch-Fayache G, Bouhlal Y, Amouri R, Feki M, Hentati F. Molecular, clinical and peripheral neuropathy study of Tunisian patients with ataxia with vitamin E deficiency. Brain. 2014;137(Pt 2):402-10. 43. Cali JJ, Hsieh CL, Francke U, Russell DW. Mutations in the bile acid biosynthetic enzyme sterol 27-hydroxylase underlie cerebrotendinous xanthomatosis. J Biol Chem. 1991;266(12):7779- 83. 44. Leitersdorf E, Reshef A, Meiner V, Levitzki R, Schwartz SP, Dann EJ, et al. Frameshift and splice-junction mutations in the sterol 27-hydroxylase gene cause cerebrotendinous xanthomatosis in Jews or Moroccan origin. J Clin Invest. 1993;91(6):2488-96. 45. Wong JC, Walsh K, Hayden D, Eichler FS. Natural history of neurological abnormalities in cerebrotendinous xanthomatosis. J Inherit Metab Dis. 2018;41(4):647-56. 46. Anttonen AK, Mahjneh I, Hamalainen RH, Lagier-Tourenne C, Kopra O, Waris L, et al. The gene disrupted in Marinesco-Sjogren syndrome encodes SIL1, an HSPA5 cochaperone. Nat Genet. 2005;37(12):1309-11. 47. Senderek J, Krieger M, Stendel C, Bergmann C, Moser M, Breitbach-Faller N, et al. Mutations in SIL1 cause Marinesco-Sjogren syndrome, a cerebellar ataxia with cataract and myopathy. Nat Genet. 2005;37(12):1312-4. 48. Nikali K, Suomalainen A, Saharinen J, Kuokkanen M, Spelbrink JN, Lonnqvist T, et al. Infantile onset spinocerebellar ataxia is caused by recessive mutations in mitochondrial proteins Twinkle and Twinky. Hum Mol Genet. 2005;14(20):2981-90. 49. Park MH, Woo HM, Hong YB, Park JH, Yoon BR, Park JM, et al. Recessive C10orf2 mutations in a family with infantile-onset spinocerebellar ataxia, sensorimotor polyneuropathy, and myopathy. Neurogenetics. 2014;15(3):171-82. 50. Fiskerstrand T, H'Mida-Ben Brahim D, Johansson S, M'Zahem A, Haukanes BI, Drouot N, et al. Mutations in ABHD12 cause the neurodegenerative disease PHARC: An inborn error of endocannabinoid metabolism. Am J Hum Genet. 2010;87(3):410-7. 51. Eisenberger T, Slim R, Mansour A, Nauck M, Nurnberg G, Nurnberg P, et al. Targeted next-generation sequencing identifies a homozygous nonsense mutation in ABHD12, the gene underlying PHARC, in a family clinically diagnosed with Usher syndrome type 3. Orphanet J Rare Dis. 2012;7:59. 52. Pierson TM, Adams D, Bonn F, Cherikuri PF, Teer JK, Hanson NF, et al. Whole exome sequencing identifies AFG3L2 mutation in a novel recessive progressive myoclonic epilepsy- ataxia-neuropathy syndrome. Annals of Neurology. 2010;68:S68-S9. 53. Eskandrani A, AlHashem A, Ali ES, AlShahwan S, Tlili K, Hundallah K, et al. Recessive AFG3L2 mutation causes progressive microcephaly, early onset seizures, spasticity, and basal ganglia involvement. Pediatr Neurol. 2017;71:24-8.

54. Bomar JM, Benke PJ, Slattery EL, Puttagunta R, Taylor LP, Seong E, et al. Mutations in a novel gene encoding a CRAL-TRIO domain cause human Cayman ataxia and ataxia/dystonia in the jittery mouse. Nat Genet. 2003;35(3):264-9. 55. Manzoor H, Bruggemann N, Hussain HMJ, Baumer T, Hinrichs F, Wajid M, et al. Novel homozygous variants in ATCAY, MCOLN1, and SACS in complex neurological disorders. Parkinsonism Relat Disord. 2018. 56. Paternoster L, Soblet J, Aeby A, Vilain C, Smits G, Deconinck N. A new mutation of carbonic anhydrase 8 gene expanding the cerebellar ataxia, mental retardation and disequilibrium syndrome (CAMRQ) subtype 3. Journal of the Neurological Sciences. 2017;381:1136-7. 57. Kaya N, Aldhalaan H, Al-Younes B, Colak D, Shuaib T, Al-Mohaileb F, et al. Phenotypical spectrum of cerebellar ataxia associated with a novel mutation in the CA8 gene, encoding carbonic anhydrase (CA) VIII. Am J Med Genet B Neuropsychiatr Genet. 2011;156b(7):826-34. 58. Gan-Or Z, Bouslam N, Birouk N, Lissouba A, Chambers DB, Veriepe J, et al. Mutations in CAPN1 cause autosomal-recessive hereditary spastic paraplegia. Am J Hum Genet. 2016;98(6):1271. 59. Wang Y, Hersheson J, Lopez D, Hammer M, Liu Y, Lee KH, et al. Defects in the CAPN1 gene result in alterations in cerebellar development and cerebellar ataxia in mice and humans. Cell Rep. 2016;16(1):79-91. 60. Depienne C, Bugiani M, Dupuits C, Galanaud D, Touitou V, Postma N, et al. Brain white matter oedema due to ClC-2 chloride channel deficiency: an observational analytical study. Lancet Neurol. 2013;12(7):659-68. 61. Zeydan B, Uygunoglu U, Altintas A, Saip S, Siva A, Abbink TEM, et al. Identification of 3 novel patients with CLCN2-related leukoencephalopathy due to CLCN2 mutations. Eur Neurol. 2017;78(3-4):125-7. 62. Martinez Lyons A, Ardissone A, Reyes A, Robinson AJ, Moroni I, Ghezzi D, et al. COA7 (C1orf163/RESA1) mutations associated with mitochondrial leukoencephalopathy and cytochrome c oxidase deficiency. J Med Genet. 2016;53(12):846-9. 63. Higuchi Y, Okunushi R, Hara T, Hashiguchi A, Yuan J, Yoshimura A, et al. Mutations in COA7 cause spinocerebellar ataxia with axonal neuropathy. Brain. 2018. 64. Szklarczyk R, Wanschers BF, Nijtmans LG, Rodenburg RJ, Zschocke J, Dikow N, et al. A mutation in the FAM36A gene, the human ortholog of COX20, impairs cytochrome c oxidase assembly and is associated with ataxia and muscle hypotonia. Hum Mol Genet. 2013;22(4):656-67. 65. Doss S, Lohmann K, Seibler P, Arns B, Klopstock T, Zuhlke C, et al. Recessive dystonia- ataxia syndrome in a Turkish family caused by a COX20 (FAM36A) mutation. J Neurol. 2014;261(1):207-12. 66. Burns R, Majczenko K, Xu J, Peng W, Yapici Z, Dowling JJ, et al. Homozygous splice mutation in CWF19L1 in a Turkish family with recessive ataxia syndrome. Neurology. 2014;83(23):2175-82. 67. Nguyen M, Boesten I, Hellebrekers DM, Vanoevelen J, Kamps R, de Koning B, et al. Pathogenic CWF19L1 variants as a novel cause of autosomal recessive cerebellar ataxia and atrophy. Eur J Hum Genet. 2016;24(4):619-22. 68. Tsaousidou MK, Ouahchi K, Warner TT, Yang Y, Simpson MA, Laing NG, et al. Sequence alterations within CYP7B1 implicate defective cholesterol homeostasis in motor-neuron degeneration. Am J Hum Genet. 2008;82(2):510-5. 69. Schols L, Rattay TW, Martus P, Meisner C, Baets J, Fischer I, et al. Hereditary spastic paraplegia type 5: natural history, biomarkers and a randomized controlled trial. Brain. 2017;140(12):3112-27. 70. Scheper GC, van der Klok T, van Andel RJ, van Berkel CG, Sissler M, Smet J, et al. Mitochondrial aspartyl-tRNA synthetase deficiency causes leukoencephalopathy with brain stem and spinal cord involvement and lactate elevation. Nat Genet. 2007;39(4):534-9.

71. van Berge L, Hamilton EM, Linnankivi T, Uziel G, Steenweg ME, Isohanni P, et al. Leukoencephalopathy with brainstem and spinal cord involvement and lactate elevation: clinical and genetic characterization and target for therapy. Brain. 2014;137(Pt 4):1019-29. 72. Al Teneiji A, Siriwardena K, George K, Mital S, Mercimek-Mahmutoglu S. Progressive Cerebellar Atrophy and a Novel Homozygous Pathogenic DNAJC19 Variant as a Cause of Dilated Cardiomyopathy Ataxia Syndrome. Pediatr Neurol. 2016;62:58-61. 73. Davey KM, Parboosingh JS, McLeod DR, Chan A, Casey R, Ferreira P, et al. Mutation of DNAJC19, a human homologue of yeast inner mitochondrial membrane co-chaperones, causes DCMA syndrome, a novel autosomal recessive Barth syndrome-like condition. J Med Genet. 2006;43(5):385-93. 74. Ucar SK, Mayr JA, Feichtinger RG, Canda E, Coker M, Wortmann SB. Previously Unreported Biallelic Mutation in DNAJC19: Are Sensorineural Hearing Loss and Basal Ganglia Lesions Additional Features of Dilated Cardiomyopathy and Ataxia (DCMA) Syndrome? JIMD Rep. 2017;35:39-45. 75. Hammer MB, Eleuch-Fayache G, Schottlaender LV, Nehdi H, Gibbs JR, Arepalli SK, et al. Mutations in GBA2 cause autosomal-recessive cerebellar ataxia with spasticity. Am J Hum Genet. 2013;92(2):245-51. 76. Votsi C, Zamba-Papanicolaou E, Middleton LT, Pantzaris M, Christodoulou K. A novel GBA2 gene missense mutation in spastic ataxia. Ann Hum Genet. 2014;78(1):13-22. 77. Eidhof I, Baets J, Kamsteeg EJ, Deconinck T, van Ninhuijs L, Martin JJ, et al. GDAP2 mutations implicate susceptibility to cellular stress in a new form of cerebellar ataxia. Brain. 2018;141(9):2592-604. 78. Uhlenberg B, Schuelke M, Ruschendorf F, Ruf N, Kaindl AM, Henneke M, et al. Mutations in the gene encoding gap junction protein alpha 12 (connexin 46.6) cause Pelizaeus-Merzbacher- like disease. Am J Hum Genet. 2004;75(2):251-60. 79. Henneke M, Combes P, Diekmann S, Bertini E, Brockmann K, Burlina AP, et al. GJA12 mutations are a rare cause of Pelizaeus-Merzbacher-like disease. Neurology. 2008;70(10):748-54. 80. Corbett MA, Schwake M, Bahlo M, Dibbens LM, Lin M, Gandolfo LC, et al. A mutation in the Golgi Qb-SNARE gene GOSR2 causes progressive myoclonus epilepsy with early ataxia. Am J Hum Genet. 2011;88(5):657-63. 81. van Egmond ME, Verschuuren-Bemelmans CC, Nibbeling EA, Elting JW, Sival DA, Brouwer OF, et al. Ramsay Hunt syndrome: clinical characterization of progressive myoclonus ataxia caused by GOSR2 mutation. Mov Disord. 2014;29(1):139-43. 82. Utine GE, Haliloglu G, Salanci B, Cetinkaya A, Kiper PO, Alanay Y, et al. A homozygous deletion in GRID2 causes a human phenotype with cerebellar ataxia and atrophy. J Child Neurol. 2013;28(7):926-32. 83. Hills LB, Masri A, Konno K, Kakegawa W, Lam AT, Lim-Melia E, et al. Deletions in GRID2 lead to a recessive syndrome of cerebellar ataxia and tonic upgaze in humans. Neurology. 2013;81(16):1378-86. 84. Guergueltcheva V, Azmanov DN, Angelicheva D, Smith KR, Chamova T, Florez L, et al. Autosomal-recessive congenital cerebellar ataxia is caused by mutations in metabotropic glutamate receptor 1. Am J Hum Genet. 2012;91(3):553-64. 85. Rossi PI, Musante I, Summa M, Pittaluga A, Emionite L, Ikehata M, et al. Compensatory molecular and functional mechanisms in nervous system of the Grm1(crv4) mouse lacking the mGlu1 receptor: a model for motor coordination deficits. Cereb Cortex. 2013;23(9):2179-89. 86. Smith KR, Damiano J, Franceschetti S, Carpenter S, Canafoglia L, Morbin M, et al. Strikingly different clinicopathological phenotypes determined by progranulin-mutation dosage. Am J Hum Genet. 2012;90(6):1102-7. 87. Almeida MR, Macario MC, Ramos L, Baldeiras I, Ribeiro MH, Santana I. Portuguese family with the co-occurrence of frontotemporal lobar degeneration and neuronal ceroid lipofuscinosis phenotypes due to progranulin gene mutation. Neurobiol Aging. 2016;41:200.e1-5.

88. Gerber S, Alzayady KJ, Burglen L, Bremond-Gignac D, Marchesin V, Roche O, et al. Recessive and dominant de novo ITPR1 mutations cause Gillespie syndrome. Am J Hum Genet. 2016;98(5):971-80. 89. Paganini L, Pesenti C, Milani D, Fontana L, Motta S, Sirchia SM, et al. A novel splice site variant in ITPR1 gene underlying recessive Gillespie syndrome. Am J Med Genet A. 2018. 90. Dor T, Cinnamon Y, Raymond L, Shaag A, Bouslam N, Bouhouche A, et al. KIF1C mutations in two families with hereditary spastic paraparesis and cerebellar dysfunction. J Med Genet. 2014;51(2):137-42. 91. Yucel-Yilmaz D, Yucesan E, Yalnizoglu D, Oguz KK, Sagiroglu MS, Ozbek U, et al. Clinical phenotype of hereditary spastic paraplegia due to KIF1C gene mutations across life span. Brain Dev. 2018;40(6):458-64. 92. Bockenhauer D, Feather S, Stanescu HC, Bandulik S, Zdebik AA, Reichold M, et al. Epilepsy, ataxia, sensorineural deafness, tubulopathy, and KCNJ10 mutations. N Engl J Med. 2009;360(19):1960-70. 93. Scholl UI, Choi M, Liu T, Ramaekers VT, Hausler MG, Grimmer J, et al. Seizures, sensorineural deafness, ataxia, mental retardation, and electrolyte imbalance (SeSAME syndrome) caused by mutations in KCNJ10. Proc Natl Acad Sci U S A. 2009;106(14):5842-7. 94. Celmina M, Micule I, Inashkina I, Audere M, Kuske S, Pereca J, et al. EAST/SeSAME syndrome: Review of the literature and introduction of four new Latvian patients. Clin Genet. 2018. 95. Topcu M, Jobard F, Halliez S, Coskun T, Yalcinkayal C, Gerceker FO, et al. L-2- Hydroxyglutaric aciduria: identification of a mutant gene C14orf160, localized on chromosome 14q22.1. Hum Mol Genet. 2004;13(22):2803-11. 96. Steenweg ME, Jakobs C, Errami A, van Dooren SJ, Adeva Bartolome MT, Aerssens P, et al. An overview of L-2-hydroxyglutarate dehydrogenase gene (L2HGDH) variants: a genotype- phenotype study. Hum Mutat. 2010;31(4):380-90. 97. Stewart GS, Maser RS, Stankovic T, Bressan DA, Kaplan MI, Jaspers NG, et al. The DNA double-strand break repair gene hMRE11 is mutated in individuals with an ataxia-telangiectasia- like disorder. Cell. 1999;99(6):577-87. 98. Pitts SA, Kullar HS, Stankovic T, Stewart GS, Last JI, Bedenham T, et al. hMRE11: genomic structure and a null mutation identified in a transcript protected from nonsense-mediated mRNA decay. Hum Mol Genet. 2001;10(11):1155-62. 99. Crosby AH, Patel H, Chioza BA, Proukakis C, Gurtz K, Patton MA, et al. Defective mitochondrial mRNA maturation is associated with spastic ataxia. Am J Hum Genet. 2010;87(5):655-60. 100. Martin NT, Nakamura K, Paila U, Woo J, Brown C, Wright JA, et al. Homozygous mutation of MTPAP causes cellular radiosensitivity and persistent DNA double-strand breaks. Cell Death Dis. 2014;5:e1130. 101. Regal L, Ebberink MS, Goemans N, Wanders RJ, De Meirleir L, Jaeken J, et al. Mutations in PEX10 are a cause of autosomal recessive ataxia. Ann Neurol. 2010;68(2):259-63. 102. Yamashita T, Mitsui J, Shimozawa N, Takashima S, Umemura H, Sato K, et al. Ataxic form of autosomal recessive PEX10-related peroxisome biogenesis disorders with a novel compound heterozygous gene mutation and characteristic clinical phenotype. J Neurol Sci. 2017;375:424-9. 103. Jobling RK, Assoum M, Gakh O, Blaser S, Raiman JA, Mignot C, et al. PMPCA mutations cause abnormal mitochondrial protein processing in patients with non-progressive cerebellar ataxia. Brain. 2015;138(Pt 6):1505-17. 104. Choquet K, Zurita-Rendon O, La Piana R, Yang S, Dicaire MJ, Boycott KM, et al. Autosomal recessive cerebellar ataxia caused by a homozygous mutation in PMPCA. Brain. 2016;139(Pt 3):e19. 105. Joshi M, Anselm I, Shi J, Bale TA, Towne M, Schmitz-Abe K, et al. Mutations in the substrate binding glycine-rich loop of the mitochondrial processing peptidase-alpha protein

(PMPCA) cause a severe mitochondrial disease. Cold Spring Harb Mol Case Stud. 2016;2(3):a000786. 106. Bras J, Alonso I, Barbot C, Costa MM, Darwent L, Orme T, et al. Mutations in PNKP cause recessive ataxia with oculomotor apraxia type 4. Am J Hum Genet. 2015;96(3):474-9. 107. Paucar M, Malmgren H, Taylor M, Reynolds JJ, Svenningsson P, Press R, et al. Expanding the ataxia with oculomotor apraxia type 4 phenotype. Neurol Genet. 2016;2(1):e49. 108. Schiess N, Zee DS, Siddiqui KA, Szolics M, El-Hattab AW. Novel PNKP mutation in siblings with ataxia-oculomotor apraxia type 4. J Neurogenet. 2017;31(1-2):23-5. 109. Synofzik M, Gonzalez MA, Lourenco CM, Coutelier M, Haack TB, Rebelo A, et al. PNPLA6 mutations cause Boucher-Neuhauser and Gordon Holmes syndromes as part of a broad neurodegenerative spectrum. Brain. 2014;137(Pt 1):69-77. 110. Wiethoff S, Bettencourt C, Paudel R, Madon P, Liu YT, Hersheson J, et al. Pure Cerebellar Ataxia with Homozygous Mutations in the PNPLA6 Gene. Cerebellum. 2016. 111. Bernard G, Chouery E, Putorti ML, Tetreault M, Takanohashi A, Carosso G, et al. Mutations of POLR3A encoding a catalytic subunit of RNA polymerase Pol III cause a recessive hypomyelinating leukodystrophy. Am J Hum Genet. 2011;89(3):415-23. 112. Wolf NI, Vanderver A, van Spaendonk RM, Schiffmann R, Brais B, Bugiani M, et al. Clinical spectrum of 4H leukodystrophy caused by POLR3A and POLR3B mutations. Neurology. 2014;83(21):1898-905. 113. Saitsu H, Osaka H, Sasaki M, Takanashi J, Hamada K, Yamashita A, et al. Mutations in POLR3A and POLR3B encoding RNA Polymerase III subunits cause an autosomal-recessive hypomyelinating leukoencephalopathy. Am J Hum Genet. 2011;89(5):644-51. 114. Tetreault M, Choquet K, Orcesi S, Tonduti D, Balottin U, Teichmann M, et al. Recessive mutations in POLR3B, encoding the second largest subunit of Pol III, cause a rare hypomyelinating leukodystrophy. Am J Hum Genet. 2011;89(5):652-5. 115. Margolin DH, Kousi M, Chan YM, Lim ET, Schmahmann JD, Hadjivassiliou M, et al. Ataxia, dementia, and hypogonadotropism caused by disordered ubiquitination. N Engl J Med. 2013;368(21):1992-2003. 116. Alqwaifly M, Bohlega S. Ataxia and hypogonadotropic hypogonadism with intrafamilial variability caused by RNF216 mutation. Neurol Int. 2016;8(2):6444. 117. Schmidt WM, Rutledge SL, Schule R, Mayerhofer B, Zuchner S, Boltshauser E, et al. Disruptive SCYL1 mutations underlie a syndrome characterized by recurrent episodes of liver failure, peripheral neuropathy, cerebellar atrophy, and ataxia. Am J Hum Genet. 2015;97(6):855-61. 118. Shohet A, Cohen L, Haguel D, Mozer Y, Shomron N, Tzur S, et al. Variant in SCYL1 gene causes aberrant splicing in a family with cerebellar ataxia, recurrent episodes of liver failure, and growth retardation. Eur J Hum Genet. 2018. 119. Thomas AC, Williams H, Seto-Salvia N, Bacchelli C, Jenkins D, O'Sullivan M, et al. Mutations in SNX14 cause a distinctive autosomal-recessive cerebellar ataxia and intellectual disability syndrome. Am J Hum Genet. 2014;95(5):611-21. 120. Akizu N, Cantagrel V, Zaki MS, Al-Gazali L, Wang X, Rosti RO, et al. Biallelic mutations in SNX14 cause a syndromic form of cerebellar atrophy and lysosome-autophagosome dysfunction. Nat Genet. 2015;47(5):528-34. 121. Guissart C, Li X, Leheup B, Drouot N, Montaut-Verient B, Raffo E, et al. Mutation of SLC9A1, encoding the major Na(+)/H(+) exchanger, causes ataxia-deafness Lichtenstein-Knorr syndrome. Hum Mol Genet. 2015;24(2):463-70. 122. Iwama K, Osaka H, Ikeda T, Mitsuhashi S, Miyatake S, Takata A, et al. A novel SLC9A1 mutation causes cerebellar ataxia. J Hum Genet. 2018;63(10):1049-54. 123. Lise S, Clarkson Y, Perkins E, Kwasniewska A, Sadighi Akha E, Schnekenberg RP, et al. Recessive mutations in SPTBN2 implicate beta-III spectrin in both cognitive and motor development. PLoS Genet. 2012;8(12):e1003074.

124. Yildiz Bolukbasi E, Afzal M, Mumtaz S, Ahmad N, Malik S, Tolun A. Progressive SCAR14 with unclear speech, developmental delay, tremor, and behavioral problems caused by a homozygous deletion of the SPTBN2 pleckstrin homology domain. Am J Med Genet A. 2017;173(9):2494-9. 125. Shi Y, Wang J, Li JD, Ren H, Guan W, He M, et al. Identification of CHIP as a novel causative gene for autosomal recessive cerebellar ataxia. PLoS One. 2013;8(12):e81884. 126. Synofzik M, Schule R, Schulze M, Gburek-Augustat J, Schweizer R, Schirmacher A, et al. Phenotype and frequency of STUB1 mutations: next-generation screenings in Caucasian ataxia and spastic paraplegia cohorts. Orphanet J Rare Dis. 2014;9:57. 127. Gomez-Herreros F, Schuurs-Hoeijmakers JH, McCormack M, Greally MT, Rulten S, Romero-Granados R, et al. TDP2 protects transcription from abortive topoisomerase activity and is required for normal neural function. Nat Genet. 2014;46(5):516-21. 128. Zagnoli-Vieira G, Bruni F, Thompson K, He L, Walker S, de Brouwer APM, et al. Confirming TDP2 mutation in spinocerebellar ataxia autosomal recessive 23 (SCAR23). Neurol Genet. 2018;4(4):e262. 129. Sun Y, Almomani R, Breedveld GJ, Santen GW, Aten E, Lefeber DJ, et al. Autosomal recessive spinocerebellar ataxia 7 (SCAR7) is caused by variants in TPP1, the gene involved in classic late-infantile neuronal ceroid lipofuscinosis 2 disease (CLN2 disease). Hum Mutat. 2013;34(5):706-13. 130. Dy ME, Sims KB, Friedman J. TPP1 deficiency: Rare cause of isolated childhood-onset progressive ataxia. Neurology. 2015;85(14):1259-61. 131. Bilguvar K, Tyagi NK, Ozkara C, Tuysuz B, Bakircioglu M, Choi M, et al. Recessive loss of function of the neuronal ubiquitin hydrolase UCHL1 leads to early-onset progressive neurodegeneration. Proc Natl Acad Sci U S A. 2013;110(9):3489-94. 132. Rydning SL, Backe PH, Sousa MML, Iqbal Z, Oye AM, Sheng Y, et al. Novel UCHL1 mutations reveal new insights into ubiquitin processing. Hum Mol Genet. 2017;26(6):1217-8. 133. Boycott KM, Flavelle S, Bureau A, Glass HC, Fujiwara TM, Wirrell E, et al. Homozygous deletion of the very low density lipoprotein receptor gene causes autosomal recessive cerebellar hypoplasia with cerebral gyral simplification. Am J Hum Genet. 2005;77(3):477-83. 134. Ali BR, Silhavy JL, Gleeson MJ, Gleeson JG, Al-Gazali L. A missense founder mutation in VLDLR is associated with Dysequilibrium syndrome without quadrupedal locomotion. BMC Med Genet. 2012;13:80. 135. Gauthier J, Meijer IA, Lessel D, Mencacci NE, Krainc D, Hempel M, et al. Recessive mutations in VPS13D cause childhood onset movement disorders. Ann Neurol. 2018;83(6):1089- 95. 136. Seong E, Insolera R, Dulovic M, Kamsteeg EJ, Trinh J, Bruggemann N, et al. Mutations in VPS13D lead to a new recessive ataxia with spasticity and mitochondrial defects. Ann Neurol. 2018;83(6):1075-88. 137. Gulsuner S, Tekinay AB, Doerschner K, Boyaci H, Bilguvar K, Unal H, et al. Homozygosity mapping and targeted genomic sequencing reveal the gene responsible for cerebellar hypoplasia and quadrupedal locomotion in a consanguineous kindred. Genome Res. 2011;21(12):1995-2003. 138. Komara M, John A, Suleiman J, Ali BR, Al-Gazali L. Clinical and molecular delineation of dysequilibrium syndrome type 2 and profound sensorineural hearing loss in an inbred Arab family. Am J Med Genet A. 2016;170a(2):540-3. 139. Hoch NC, Hanzlikova H, Rulten SL, Tetreault M, Komulainen E, Ju L, et al. XRCC1 mutation is associated with PARP1 hyperactivation and cerebellar ataxia. Nature. 2017;541(7635):87-91. 140. O'Connor E, Vandrovcova J, Bugiardini E, Chelban V, Manole A, Davagnanam I, et al. Mutations in XRCC1 cause cerebellar ataxia and peripheral neuropathy. J Neurol Neurosurg Psychiatry. 2018.

141. Ferland RJ, Eyaid W, Collura RV, Tully LD, Hill RS, Al-Nouri D, et al. Abnormal cerebellar development and axonal decussation due to mutations in AHI1 in Joubert syndrome. Nat Genet. 2004;36(9):1008-13. 142. Parisi M, Glass I. Joubert syndrome and related disorders. In: Pagon RA, Adam MP, Ardinger HH, Wallace SE, Amemiya A, Bean LJH, et al., editors. GeneReviews(R). Seattle (WA): University of Washington, Seattle 143. Pearl PL, Gibson KM, Acosta MT, Vezina LG, Theodore WH, Rogawski MA, et al. Clinical spectrum of succinic semialdehyde dehydrogenase deficiency. Neurology. 2003;60(9):1413-7. 144. Trettel F, Malaspina P, Jodice C, Novelletto A, Slaughter CA, Caudle DL, et al. Human succinic semialdehyde dehydrogenase. Molecular cloning and chromosomal localization. Adv Exp Med Biol. 1997;414:253-60. 145. Imbach T, Burda P, Kuhnert P, Wevers RA, Aebi M, Berger EG, et al. A mutation in the human ortholog of the Saccharomyces cerevisiae ALG6 gene causes carbohydrate-deficient glycoprotein syndrome type-Ic. Proc Natl Acad Sci U S A. 1999;96(12):6982-7. 146. Morava E, Tiemes V, Thiel C, Seta N, de Lonlay P, de Klerk H, et al. ALG6-CDG: a recognizable phenotype with epilepsy, proximal muscle weakness, ataxia and behavioral and limb anomalies. J Inherit Metab Dis. 2016;39(5):713-23. 147. Bull PC, Thomas GR, Rommens JM, Forbes JR, Cox DW. The Wilson disease gene is a putative copper transporting P-type ATPase similar to the Menkes gene. Nat Genet. 1993;5(4):327- 37. 148. Onat OE, Gulsuner S, Bilguvar K, Nazli Basak A, Topaloglu H, Tan M, et al. Missense mutation in the ATPase, aminophospholipid transporter protein ATP8A2 is associated with cerebellar atrophy and quadrupedal locomotion. Eur J Hum Genet. 2013;21(3):281-5. 149. Alsahli S, Alrifai MT, Al Tala S, Mutairi FA, Alfadhel M. Further delineation of the clinical phenotype of cerebellar ataxia, mental retardation, and disequilibrium syndrome Type 4. J Cent Nerv Syst Dis. 2018;10:1179573518759682. 150. Boukhris A, Schule R, Loureiro JL, Lourenco CM, Mundwiller E, Gonzalez MA, et al. Alteration of ganglioside biosynthesis responsible for complex hereditary spastic paraplegia. Am J Hum Genet. 2013;93(1):118-23. 151. Pomponio RJ, Reynolds TR, Cole H, Buck GA, Wolf B. Mutational hotspot in the human biotinidase gene causes profound biotinidase deficiency. Nat Genet. 1995;11(1):96-8. 152. Wolf B. Biotinidase deficiency. In: Adam MP, Ardinger HH, Pagon RA, Wallace SE, Bean LJH, Stephens K, et al., editors. GeneReviews((R)). Seattle (WA)1993. 153. Klockars T, Savukoski M, Isosomppi J, Peltonen L. Positional cloning of the CLN5 gene defective in the Finnish variant of the LINCL. Mol Genet Metab. 1999;66(4):324-8. 154. Yoshida K, Furihata K, Takeda S, Nakamura A, Yamamoto K, Morita H, et al. A mutation in the ceruloplasmin gene is associated with systemic hemosiderosis in humans. Nat Genet. 1995;9(3):267-72. 155. Pennacchio LA, Lehesjoki AE, Stone NE, Willour VL, Virtaneva K, Miao J, et al. Mutations in the gene encoding cystatin B in progressive myoclonus epilepsy (EPM1). Science. 1996;271(5256):1731-4. 156. Leegwater PA, Vermeulen G, Konst AA, Naidu S, Mulders J, Visser A, et al. Subunits of the translation initiation factor eIF2B are mutant in leukoencephalopathy with vanishing white matter. Nat Genet. 2001;29(4):383-8. 157. Fogli A, Schiffmann R, Bertini E, Ughetto S, Combes P, Eymard-Pierre E, et al. The effect of genotype on the natural history of eIF2B-related leukodystrophies. Neurology. 2004;62(9):1509- 17. 158. Minassian BA, Lee JR, Herbrick JA, Huizenga J, Soder S, Mungall AJ, et al. Mutations in a gene encoding a novel protein tyrosine phosphatase cause progressive myoclonus epilepsy. Nat Genet. 1998;20(2):171-4.

159. Chan EM, Young EJ, Ianzano L, Munteanu I, Zhao X, Christopoulos CC, et al. Mutations in NHLRC1 cause progressive myoclonus epilepsy. Nat Genet. 2003;35(2):125-7. 160. Sijbers AM, de Laat WL, Ariza RR, Biggerstaff M, Wei YF, Moggs JG, et al. Xeroderma pigmentosum group F caused by a defect in a structure-specific DNA repair endonuclease. Cell. 1996;86(5):811-22. 161. Doi H, Koyano S, Miyatake S, Nakajima S, Nakazawa Y, Kunii M, et al. Cerebellar ataxia- dominant phenotype in patients with ERCC4 mutations. J Hum Genet. 2018;63(4):417-23. 162. Edvardson S, Hama H, Shaag A, Gomori JM, Berger I, Soffer D, et al. Mutations in the fatty acid 2-hydroxylase gene are associated with leukodystrophy with spastic paraparesis and dystonia. Am J Hum Genet. 2008;83(5):643-8. 163. Steinfeld R, Grapp M, Kraetzner R, Dreha-Kulaczewski S, Helms G, Dechent P, et al. Folate receptor alpha defect causes cerebral folate transport deficiency: a treatable neurodegenerative disorder associated with disturbed myelin metabolism. Am J Hum Genet. 2009;85(3):354-63. 164. Grapp M, Just IA, Linnankivi T, Wolf P, Lucke T, Hausler M, et al. Molecular characterization of folate receptor 1 mutations delineates cerebral folate transport deficiency. Brain. 2012;135(Pt 7):2022-31. 165. Bomont P, Cavalier L, Blondeau F, Ben Hamida C, Belal S, Tazir M, et al. The gene encoding gigaxonin, a new member of the cytoskeletal BTB/kelch repeat family, is mutated in giant axonal neuropathy. Nat Genet. 2000;26(3):370-4. 166. Kuhlenbaumer G, Timmerman V, Bomont P. Giant axonal neuropathy. In: Adam MP, Ardinger HH, Pagon RA, Wallace SE, Bean LJH, Stephens K, et al., editors. GeneReviews((R)). Seattle (WA)1993. 167. Nishimoto J, Nanba E, Inui K, Okada S, Suzuki K. GM1-gangliosidosis (genetic beta- galactosidase deficiency): identification of four mutations in different clinical phenotypes among Japanese patients. Am J Hum Genet. 1991;49(3):566-74. 168. Karimzadeh P, Naderi S, Modarresi F, Dastsooz H, Nemati H, Farokhashtiani T, et al. Case reports of juvenile GM1 gangliosidosisis type II caused by mutation in GLB1 gene. BMC Med Genet. 2017;18(1):73. 169. Myerowitz R, Costigan FC. The major defect in Ashkenazi Jews with Tay-Sachs disease is an insertion in the gene for the alpha-chain of beta-hexosaminidase. J Biol Chem. 1988;263(35):18587-9. 170. Gort L, de Olano N, Macias-Vidal J, Coll MA, Spanish GMWG. GM2 gangliosidoses in Spain: analysis of the HEXA and HEXB genes in 34 Tay-Sachs and 14 Sandhoff patients. Gene. 2012;506(1):25-30. 171. O'Dowd BF, Klavins MH, Willard HF, Gravel R, Lowden JA, Mahuran DJ. Molecular heterogeneity in the infantile and juvenile forms of Sandhoff disease (O-variant GM2 gangliosidosis). J Biol Chem. 1986;261(27):12680-5. 172. Pierce SB, Walsh T, Chisholm KM, Lee MK, Thornton AM, Fiumara A, et al. Mutations in the DBP-deficiency protein HSD17B4 cause ovarian dysgenesis, hearing loss, and ataxia of Perrault Syndrome. Am J Hum Genet. 2010;87(2):282-8. 173. Matsukawa T, Koshi KM, Mitsui J, Bannai T, Kawabe M, Ishiura H, et al. Slowly progressive d-bifunctional protein deficiency with survival to adulthood diagnosed by whole-exome sequencing. J Neurol Sci. 2017;372:6-10. 174. Stevanin G, Santorelli FM, Azzedine H, Coutinho P, Chomilier J, Denora PS, et al. Mutations in SPG11, encoding spatacsin, are a major cause of spastic paraplegia with thin corpus callosum. Nat Genet. 2007;39(3):366-72. 175. Schule R, Schlipf N, Synofzik M, Klebe S, Klimpe S, Hehr U, et al. Frequency and phenotype of SPG11 and SPG15 in complicated hereditary spastic paraplegia. J Neurol Neurosurg Psychiatry. 2009;80(12):1402-4.

176. Van Bogaert P, Azizieh R, Desir J, Aeby A, De Meirleir L, Laes JF, et al. Mutation of a potassium channel-related gene in progressive myoclonic epilepsy. Ann Neurol. 2007;61(6):579-86. 177. Kousi M, Anttila V, Schulz A, Calafato S, Jakkula E, Riesch E, et al. Novel mutations consolidate KCTD7 as a progressive myoclonus epilepsy gene. J Med Genet. 2012;49(6):391-9. 178. Malm D, Nilssen O. Alpha-mannosidosis. Orphanet J Rare Dis. 2008;3:21. 179. Leegwater PA, Yuan BQ, van der Steen J, Mulders J, Konst AA, Boor PK, et al. Mutations of MLC1 (KIAA0027), encoding a putative membrane protein, cause megalencephalic leukoencephalopathy with subcortical cysts. Am J Hum Genet. 2001;68(4):831-8. 180. Nasca A, Scotton C, Zaharieva I, Neri M, Selvatici R, Magnusson OT, et al. Recessive mutations in MSTO1 cause mitochondrial dynamics impairment, leading to myopathy and ataxia. Hum Mutat. 2017;38(8):970-7. 181. Gal A, Balicza P, Weaver D, Naghdi S, Joseph SK, Varnai P, et al. MSTO1 is a cytoplasmic pro-mitochondrial fusion protein, whose mutation induces myopathy and ataxia in humans. EMBO Mol Med. 2017;9(7):967-84. 182. Sharp D, Blinderman L, Combs KA, Kienzle B, Ricci B, Wager-Smith K, et al. Cloning and gene defects in microsomal triglyceride transfer protein associated with abetalipoproteinaemia. Nature. 1993;365(6441):65-9. 183. Bonten E, van der Spoel A, Fornerod M, Grosveld G, d'Azzo A. Characterization of human lysosomal neuraminidase defines the molecular basis of the metabolic storage disorder sialidosis. Genes Dev. 1996;10(24):3156-69. 184. Lai SC, Chen RS, Wu Chou YH, Chang HC, Kao LY, Huang YZ, et al. A longitudinal study of Taiwanese sialidosis type 1: an insight into the concept of cherry-red spot myoclonus syndrome. Eur J Neurol. 2009;16(8):912-9. 185. Dorboz I, Aiello C, Simons C, Stone RT, Niceta M, Elmaleh M, et al. Biallelic mutations in the homeodomain of NKX6-2 underlie a severe hypomyelinating leukodystrophy. Brain. 2017;140(10):2550-6. 186. Chelban V, Patel N, Vandrovcova J, Zanetti MN, Lynch DS, Ryten M, et al. Mutations in NKX6-2 Cause Progressive Spastic Ataxia and Hypomyelination. Am J Hum Genet. 2017;100(6):969-77. 187. Carstea ED, Morris JA, Coleman KG, Loftus SK, Zhang D, Cummings C, et al. Niemann- Pick C1 disease gene: homology to mediators of cholesterol homeostasis. Science. 1997;277(5323):228-31. 188. Nadjar Y, Hutter-Moncada AL, Latour P, Ayrignac X, Kaphan E, Tranchant C, et al. Adult Niemann-Pick disease type C in France: clinical phenotypes and long-term miglustat treatment effect. Orphanet J Rare Dis. 2018;13(1):175. 189. Naureckiene S, Sleat DE, Lackland H, Fensom A, Vanier MT, Wattiaux R, et al. Identification of HE1 as the second gene of Niemann-Pick C disease. Science. 2000;290(5500):2298-301. 190. Schaaf CP, Blazo M, Lewis RA, Tonini RE, Takei H, Wang J, et al. Early-onset severe neuromuscular phenotype associated with compound heterozygosity for OPA1 mutations. Mol Genet Metab. 2011;103(4):383-7. 191. Bonneau D, Colin E, Oca F, Ferre M, Chevrollier A, Gueguen N, et al. Early-onset Behr syndrome due to compound heterozygous mutations in OPA1. Brain. 2014;137(Pt 10):e301. 192. Shimozawa N, Suzuki Y, Orii T, Moser A, Moser HW, Wanders RJ. Standardization of complementation grouping of peroxisome-deficient disorders and the second Zellweger patient with peroxisomal assembly factor-1 (PAF-1) defect. Am J Hum Genet. 1993;52(4):843-4. 193. Sevin C, Ferdinandusse S, Waterham HR, Wanders RJ, Aubourg P. Autosomal recessive cerebellar ataxia caused by mutations in the PEX2 gene. Orphanet J Rare Dis. 2011;6:8. 194. van den Brink DM, Brites P, Haasjes J, Wierzbicki AS, Mitchell J, Lambert-Hamill M, et al. Identification of PEX7 as the second gene involved in Refsum disease. Am J Hum Genet. 2003;72(2):471-7.

195. Mihalik SJ, Morrell JC, Kim D, Sacksteder KA, Watkins PA, Gould SJ. Identification of PAHX, a Refsum disease gene. Nat Genet. 1997;17(2):185-9. 196. Morgan NV, Westaway SK, Morton JE, Gregory A, Gissen P, Sonek S, et al. PLA2G6, encoding a phospholipase A2, is mutated in neurodegenerative disorders with high brain iron. Nat Genet. 2006;38(7):752-4. 197. Salih M, Mundwiller E, Khan A, Al Drees A, Elmalik S, Hassan H, et al. PLA2G6 gene mutations cause evolving spinocerebellar ataxia influenced by the genotype. Journal of Neurology. 2013;260:S10-S1. 198. Matthijs G, Schollen E, Pardon E, Veiga-Da-Cunha M, Jaeken J, Cassiman JJ, et al. Mutations in PMM2, a phosphomannomutase gene on chromosome 16p13, in carbohydrate- deficient glycoprotein type I syndrome (Jaeken syndrome). Nat Genet. 1997;16(1):88-92. 199. Schiff M, Roda C, Monin ML, Arion A, Barth M, Bednarek N, et al. Clinical, laboratory and molecular findings and long-term follow-up data in 96 French patients with PMM2-CDG (phosphomannomutase 2-congenital disorder of glycosylation) and review of the literature. J Med Genet. 2017;54(12):843-51. 200. Meneret A, Gaudebout C, Riant F, Vidailhet M, Depienne C, Roze E. PRRT2 mutations and paroxysmal disorders. Eur J Neurol. 2013;20(6):872-8. 201. Delcourt M, Riant F, Mancini J, Milh M, Navarro V, Roze E, et al. Severe phenotypic spectrum of biallelic mutations in PRRT2 gene. J Neurol Neurosurg Psychiatry. 2015;86(7):782-5. 202. Hu H, Matter ML, Issa-Jahns L, Jijiwa M, Kraemer N, Musante L, et al. Mutations in PTRH2 cause novel infantile-onset multisystem disease with intellectual disability, microcephaly, progressive ataxia, and muscle weakness. Ann Clin Transl Neurol. 2014;1(12):1024-35. 203. Picker-Minh S, Mignot C, Doummar D, Hashem M, Faqeih E, Josset P, et al. Phenotype variability of infantile-onset multisystem neurologic, endocrine, and pancreatic disease IMNEPD. Orphanet J Rare Dis. 2016;11(1):52. 204. Agamy O, Ben Zeev B, Lev D, Marcus B, Fine D, Su D, et al. Mutations disrupting selenocysteine formation cause progressive cerebello-cerebral atrophy. Am J Hum Genet. 2010;87(4):538-44. 205. van Dijk T, Vermeij JD, van Koningsbruggen S, Lakeman P, Baas F, Poll-The BT. A SEPSECS mutation in a 23-year-old woman with microcephaly and progressive cerebellar ataxia. J Inherit Metab Dis. 2018;41(5):897-8. 206. Verheijen FW, Verbeek E, Aula N, Beerens CE, Havelaar AC, Joosse M, et al. A new gene, encoding an anion transporter, is mutated in sialic acid storage diseases. Nat Genet. 1999;23(4):462- 5. 207. Aula N, Salomaki P, Timonen R, Verheijen F, Mancini G, Mansson JE, et al. The spectrum of SLC17A5-gene mutations resulting in free sialic acid-storage diseases indicates some genotype- phenotype correlation. Am J Hum Genet. 2000;67(4):832-40. 208. Barmherzig R, Bullivant G, Cordeiro D, Sinasac DS, Blaser S, Mercimek-Mahmutoglu S. A new patient with intermediate severe Salla disease with hypomyelination: a literature review for Salla disease. Pediatr Neurol. 2017;74:87-91 e2. 209. Seidner G, Alvarez MG, Yeh JI, O'Driscoll KR, Klepper J, Stump TS, et al. GLUT-1 deficiency syndrome caused by haploinsufficiency of the blood-brain barrier hexose carrier. Nat Genet. 1998;18(2):188-91. 210. Hully M, Vuillaumier-Barrot S, Le Bizec C, Boddaert N, Kaminska A, Lascelles K, et al. From splitting GLUT1 deficiency syndromes to overlapping phenotypes. Eur J Med Genet. 2015;58(9):443-54. 211. Johnson JO, Gibbs JR, Megarbane A, Urtizberea JA, Hernandez DG, Foley AR, et al. Exome sequencing reveals riboflavin transporter mutations as a cause of motor neuron disease. Brain. 2012;135(Pt 9):2875-82.

212. Foley AR, Menezes MP, Pandraud A, Gonzalez MA, Al-Odaib A, Abrams AJ, et al. Treatable childhood neuronopathy caused by mutations in riboflavin transporter RFVT2. Brain. 2014;137(Pt 1):44-56. 213. Guissart C, Drouot N, Oncel I, Leheup B, Gershoni-Barush R, Muller J, et al. Genes for spinocerebellar ataxia with blindness and deafness (SCABD/SCAR3, MIM# 271250 and SCABD2). Eur J Hum Genet. 2016;24(8):1154-9. 214. Kleta R, Romeo E, Ristic Z, Ohura T, Stuart C, Arcos-Burgos M, et al. Mutations in SLC6A19, encoding B0AT1, cause Hartnup disorder. Nat Genet. 2004;36(9):999-1002. 215. Abrams AJ, Hufnagel RB, Rebelo A, Zanna C, Patel N, Gonzalez MA, et al. Mutations in SLC25A46, encoding a UGO1-like protein, cause an optic atrophy spectrum disorder. Nat Genet. 2015;47(8):926-32. 216. Hammer MB, Ding J, Mochel F, Eleuch-Fayache G, Charles P, Coutelier M, et al. SLC25A46 mutations associated with autosomal recessive cerebellar ataxia in North African families. Neurodegener Dis. 2017;17(4-5):208-12. 217. Cantagrel V, Lefeber DJ, Ng BG, Guan Z, Silhavy JL, Bielas SL, et al. SRD5A3 is required for converting polyprenol to dolichol and is mutated in a congenital glycosylation disorder. Cell. 2010;142(2):203-17. 218. Wheeler PG, Ng BG, Sanford L, Sutton VR, Bartholomew DW, Pastore MT, et al. SRD5A3-CDG: Expanding the phenotype of a congenital disorder of glycosylation with emphasis on adult onset features. Am J Med Genet A. 2016;170(12):3165-71. 219. Ghezzi D, Arzuffi P, Zordan M, Da Re C, Lamperti C, Benna C, et al. Mutations in TTC19 cause mitochondrial complex III deficiency and neurological impairment in humans and flies. Nat Genet. 2011;43(3):259-63. 220. Morino H, Miyamoto R, Ohnishi S, Maruyama H, Kawakami H. Exome sequencing reveals a novel TTC19 mutation in an autosomal recessive spinocerebellar ataxia patient. BMC Neurol. 2014;14:5. 221. Ardissone A, Granata T, Legati A, Diodato D, Melchionda L, Lamantea E, et al. Mitochondrial complex III deficiency caused by TTC19 defects: report of a novel mutation and review of literature. JIMD Rep. 2015;22:115-20. 222. Colin E, Huynh Cong E, Mollet G, Guichet A, Gribouval O, Arrondel C, et al. Loss-of- function mutations in WDR73 are responsible for microcephaly and steroid-resistant nephrotic syndrome: Galloway-Mowat syndrome. Am J Hum Genet. 2014;95(6):637-48. 223. Vodopiutz J, Seidl R, Prayer D, Khan MI, Mayr JA, Streubel B, et al. WDR73 Mutations cause infantile neurodegeneration and variable glomerular kidney disease. Hum Mutat. 2015;36(11):1021-8. 224. Strom TM, Hortnagel K, Hofmann S, Gekeler F, Scharfe C, Rabl W, et al. Diabetes insipidus, diabetes mellitus, optic atrophy and deafness (DIDMOAD) caused by mutations in a novel gene (wolframin) coding for a predicted transmembrane protein. Hum Mol Genet. 1998;7(13):2021-8. 225. Mallaret M, Lagha Boukbiza O, Drouot N, Renaud M, Klein FAC, Anheim M, et al. The tumor suppressor gene WWOX is mutated in autosomal recessive cerebellar ataxia with epilepsy and mental retardation. Movement Disorders. 2013;28:S398. 226. Mignot C, Lambert L, Pasquier L, Bienvenu T, Delahaye-Duriez A, Keren B, et al. WWOX-related encephalopathies: delineation of the phenotypical spectrum and emerging genotype-phenotype correlation. J Med Genet. 2015;52(1):61-70.

Chapter 3 Contributing to the evidence: the phenotypical description of a cerebellar ataxia in the French-Canadian population

Titre original de l’article Characterization of the phenotype with neurocognitive impairment and protein mislocalization in ELOVL4-associated Spinocerebellar ataxia 34

3.1 Résumé Introduction L’ataxie spinocérébelleuse 34 est une ataxie dominante causée par des mutations du gène ELOVL4 et dont l’atteinte neurologique et neurocognitive demeure partiellement caractérisée. Les études précédentes n’ont pas démontré d’anomalies biochimiques supportant le rôle pathogénique de la protéine ELOVL4 dans le développement de la maladie. L’objectif principal de cette étude était de caractériser le profil d’atteinte neurologique et neurocognitive chez les patients symptomatiques porteurs de la mutation c.504 G>C dans ELOVL4. L’objectif secondaire était de démontrer la présence d’anomalies dans la localisation et la distribution subcellulaire de la protéine ELOVL4 dans la peau de patients atteints de la maladie.

Méthode Nous avons étudié une grande famille multi-générationnelle canadienne-française présentant un tableau d’ataxie cérébelleuse dominante tardive. Le devis de l’étude était une série de cas génétique avec analyse cas-témoin de l’atteinte cognitive et comportementale. Neuf patients atteints et 10 parents asymptomatiques ont accepté de participer à l’étude. Cinq témoins appariés pour l’âge et l’éducation ont été recrutés pour analyser les résultats des évaluations neuropsychologiques. Une analyse immunohistochimique des fibroblastes dermiques isolés de la peau d’une patiente atteinte a été effectuée pour évaluer la présence d’anomalies de la protéine ELOVL4.

Résultats Les patients avaient un syndrome cérébelleux tardif et lentement progressif (âge moyen du début des symptômes, 47 ans; étendue, 32 à 60 ans) caractérisé par une ataxie tronculaire et appendiculaire, une dysarthrie, des saccades hypométriques et des poursuites saccadiques. Aucun patient ne présentait d’atteinte suggestive d’érythrokératodermie variable, ce qui avait été rapporté dans les études précédentes. L’imagerie par résonance magnétique a révélé une atrophie cérébelleuse associée à une atrophie protubérantielle (4 patients sur 6), et un hypersignal cruciforme

de la protubérance (2 patients sur 6). La tomographie par émission de positrons au Fluorodéoxyglucose a mis en évidence un hypométabolisme cérébelleux diffus chez les cinq patients testés et un hypométabolisme pariétal léger chez trois patients. Des déficits cognitifs significatifs ont été notés dans la sphère exécutive, ainsi que des déficits apparents dans les sphères visuospatiale et attentionnelle. Trois patients présentaient une atteinte psychiatrique caractérisée par la désinhibition, l’euphorie, l’impulsivité et l’anxiété. L’analyse des fibroblastes dermiques a démontré que la protéine ELOVL4 est délocalisée et forme des agrégats pathologiques dans la peau des patients atteints, ce qui supporte un effet dominant négatif de la mutation sur la localisation de la protéine.

Conclusions Les résultats présentés supportent le rôle pathogénique des mutations de ELOVL4 dans l’atteinte cérébelleuse et dressent un portrait détaillé du phénotype de l’ataxie spinocérébelleuse 34 avec une atteinte neurocognitive et neurocomportementale typique du syndrome cognitif et affectif du cervelet. Les cliniciens devraient considérer le diagnostic d’ataxie spinocérébelleuse 34 même en l’absence d’érythrokératodermie variable et devraient rechercher systématiquement la présence d’atteinte cognitive et psychiatrique.

3.2 Abstract Introduction ELOVL4-associated Spinocerebellar ataxia 34 (SCA34) is a recently described dominant ataxia with poorly defined neurologic and neurocognitive features. Previous studies have failed to demonstrate biochemical anomalies supporting the pathogenic role of ELOVL4 in the disorder. The primary objective of this study was to characterize the neurological and neurocognitive profile of patients with the c.504 G>C mutation in ELOVL4. The secondary objective was to demonstrate the presence of ELOVL4 cellular abnormalities in the skin of patients.

Methods We investigated a large multi-generational French-Canadian kindred presenting with a late-onset pure cerebellar ataxia. The design is a genetic case series with case-control analysis of cognitive and behavioral impairments. Immunohistochemistry of dermal fibroblasts from the skin of an affected patient was performed to evaluate the presence of ELOVL4 protein cellular localization and distribution anomalies in this disorder.

Results Nine affected and 10 unaffected family members agreed to participate in the study. Five age- and education-matched controls were recruited to analyze results of neuropsychological evaluations. Patients had a late-onset slowly progressive cerebellar syndrome (mean age at onset, 47 years; range, 32 to 60 years) characterized by truncal and limb ataxia, dysarthria, hypometric saccades, and saccadic pursuits. No patient had past or current signs of erythrokeratodermia variabilis, which had been reported in previous studies. Magnetic resonance imaging revealed cerebellar atrophy, associated with pontine atrophy (4 of 6 patients), and cruciform hypersignal in the pons (2 of 6 patients). Fluorodeoxyglucose Positron Emission Tomography showed diffuse cerebellar hypometabolism in all five tested patients with subtle parietal hypometabolism in three patients. Significant cognitive deficits were found in executive functioning, along with apparent visuospatial and attention deficits. Three patients had associated psychiatric features with disinhibition, euphoria, impulsiveness, and anxiety. Immunohistochemistry of dermal fibroblasts showed mislocalization of the ELOVL4 protein, which appeared punctate and aggregated, supporting a dominant negative effect of the mutation on protein localization.

Conclusions Our findings support the pathogenicity of ELOVL4 mutations in cerebellar dysfunction and provide a detailed characterization of the SCA34 phenotype, with neurocognitive and neurobehavioral changes typical of the cerebellar cognitive-affective syndrome. Clinicians should consider SCA34 even in the absence of erythrokeratodermia variabilis and should systematically assess for cognitive and psychiatric manifestations.

3.3 Introduction The dominantly inherited spinocerebellar ataxias are a heterogeneous group of disorders characterized by cerebellar and pontine dysfunction. Although a growing number of genes harboring pathogenic mutations have recently been associated with hereditary ataxias, approximately half of patients remain without a specific molecular diagnosis (1), highlighting the need for better clinical characterization of patients in order to guide clinical and molecular investigations, as well as management.

Spinocerebellar ataxia 34 (SCA34) was recently described by Cadieux-Dion and colleagues (2) in a French-Canadian family that had previously been characterized with dominant ataxia and skin lesions typical of erythrokeratodermia variabilis (EKV) (3). The first mutation described was the non-synonymous c.504 G>C substitution in ELOVL4, which encodes the elongation of very long

chain fatty acids protein 4 (ELOVL4). Since then, three other reports have described dominant ataxia cases attributed to different ELOVL4 mutations. Ozaki et al. reported two Japanese families presenting with a cerebellar disorder associated with multisystem atrophy-like features on magnetic resonance imaging (MRI), but lacking cutaneous manifestations (4), while Bourassa et al. and Bourque et al. both reported single Brazilian and English Canadian patients with neurocutaneous involvement (5, 6). Besides the motor and cutaneous phenotype, little is known on the impact of ELOVL4 mutations on other neurological functions, including cognition.

Cognitive and affective dysfunction in relation with cerebellar disease has first been described by Schmahmann (7), who regrouped the associated symptoms in the cerebellar cognitive-affective syndrome (CCAS). Recent functional imaging studies have shown that the cerebellum is divided into functionally distinct areas: the sensorimotor region in the anterior lobe and lobule VIII, the cognitive region in the posterior lobes, and the affective region in the posterior vermis (8-10). The CCAS is characterized by impairment in executive functioning, visuospatial organization, and language, along with psychiatric features (7, 11). It is expected to result from disruption of cerebro- cerebellar loops, particularly cerebellar projections to association cortices in the dorsolateral prefrontal and parietal lobes as well as to the limbic regions (9, 10, 12). Previous studies have shown significant neurocognitive and neurobehavioral involvement in selected degenerative hereditary ataxias (13-15), but previous reports of SCA34 patients either reported apparent normal cognition (2) or did not report on neurocognitive involvement (4-6). Hence, the presence of cognitive dysfunction in SCA34 patients had never been formally tested before.

To date, biological validation of biochemical anomalies in ELOVL4-linked SCA34 remains elusive. ELOVL4 is a member of the elongase family of proteins that is involved in the elongation of very long chain fatty acids (VLCFA) with carbon chains of 24 atoms or longer. Previous reports have demonstrated that serum levels and ratios of VLCFA (C22 to C26), corresponding to the ELOVL4 substrates and products, remained within normal limits in patients affected by SCA34 (2, 4). Slightly elevated blood linoleic acid (C18) levels were reported in two individuals, but the signification of this remained uncertain (2). The ELOVL4 protein catalyzes the rate-limiting reaction in the production of two products that have relative tissue-specificity: very long chain saturated fatty acids (VLC-SFA), which are involved in skin barrier formation and sphingolipid production, and very long chain poly-unsaturated fatty acids (VLC-PUFA), which are essential for photoreceptor cells of the macula and also for production of sphingolipids (16). The structure of ELOVL4 is composed of seven helicoidal transmembrane (TM) domains (4), a conserved dilysine endoplasmic reticulum signal, and a histidine dideoxy binding motif (HXXHH) that has enzymatic

activity in fatty acid condensation. Little is known on the function of ELOVL4 protein in the brain. However, mouse studies have shown that the protein is widely expressed with a regional and cell type-specific distribution (17). In the cerebellum, the protein is located in all parts of the cerebellar cortex and in the deep cerebellar nuclei, and it is mainly expressed in neurons and oligodendrocytes, which is compatible with the role of VLC-SFA in myelin production. Skin appears to be a relevant tissue to investigate the biochemical anomalies associated with ELOVL4 mutations considering that the brain and skin are the two human organs with the highest concentrations of sphingolipids, some of which are dependent on the presence of ELOVL4 for synthesis (18).

Our primary objective was to characterize the neurological and neurocognitive phenotype of patients bearing the ELOVL4 c.504 G>C mutation from a large five-generation French-Canadian family in order to better define disease manifestations. The secondary objective was to demonstrate that skin fibroblasts of patients with the mutated ELOVL4 allele had subcellular localization or distribution anomalies supporting ELOVL4 dysfunction as the cause of SCA34.

3.4 Methods Clinical and cognitive assessment We investigated a large five-generation French-Canadian kindred presenting with a late-onset pure cerebellar ataxia with pontocerebellar atrophy on MRI. A total of 19 individuals, 9 affected and 10 unaffected, provided written informed consent to participate in the study. We collected genomic DNA and conducted clinical interviews and neurological evaluations for all participants. All participants were evaluated in December 2013, and six affected patients had regular clinical follow- up until July 2018 when they were evaluated by an ophthalmologist to search for retinal abnormalities and had a formal SARA score rating. MRI was performed in six affected individuals, and three underwent nerve conduction studies. All patients were specifically questioned regarding the presence of cutaneous involvement, and one self-reporting patient had a thorough evaluation by a dermatologist.

Five patients and as many cognitively healthy controls underwent formal neurocognitive and neuropsychiatric assessment at the CHU de Québec Memory Clinic (www.cliniquedememoire.ca). Controls were family caregivers and were age- and education-matched to participants. The Mini- Mental State Examination (MMSE) was performed with each participant. Data derived from the Montreal Cognitive Assessment (MoCA) (19) and additional local cognitive measures was summarized according to composite scores for the main cognitive domains : attention (digit span, numeric substitution), executive functions (abstract thinking, lexical verbal fluency, Go/No-Go,

Luria, Trail Making B, Rey complex figure test [RCFT] copy), visuospatial skills (block copy, clock drawing), memory (5-word list free and cued recall), and language (Alzheimer's disease assessment scale-cognitive subscale – naming, comprehension, and sentence repetition tasks). Key neuropsychiatric symptoms were assessed clinically. Patients’ scores were compared to controls’ using the paired sample t-test. The youngest patient (V-1) underwent a detailed neuropsychological assessment (California Verbal Learning Test-II, Delis-Kaplan Executive Function System, DO-80, Taylor complex figure, Minnesota Multiphasic Personality Inventory, Ruff 2&7, Tower of London test and WAIS-IV). Functional imaging with [18F]-fluorodeoxyglucose positron emission tomography (FDG-PET) was performed in the five patients who underwent cognitive evaluation.

This project was approved by the research ethics committee of the CHU de Québec (PEJ-299, 2012- 1311). The participants received no financial compensation.

Whole exome sequencing and genetic analysis In order to identify the genetic mutation underlying ataxia in this family, whole-exome sequencing was carried out on five affected members. Genomic DNA was extracted from peripheral blood leucocytes following the manufacturer’s protocol (Puregene; Gentra Systems, Inc). WES was carried out on five affected members of the family. Exome capture was carried out using SeqCap EZ Exome Library v3 kit (Nimblegen, Roche) with 1µg of genomic DNA. Exon-enriched DNA libraries from these five individuals were sequenced on the Illumina HiSeq2000 with a paired-end 100 bp length configuration. Reads were mapped against the Human Reference Genome hg19 using the Burrows-Wheeler Aligner (BWA) (v0.7.5). Single nucleotide variations and copy number variations, including insertions/deletions (indels) were called using The Genome Analysis Toolkit (GATK) (v2.6) (20) and annotated using ANNOVAR13 (21). The exomes were analyzed using step-by-step filtering strategies. Basic filters were used to remove low quality variants: minimum position coverage >6, minimum reads supporting the variant >3, minimum mutation frequency >0.15. Genetic variants were then filtered to retain only variants respecting the following criteria: 1) shared by all 5 affected family members sequenced by WES, 2) non-synonymous single nucleotide variants, splicing site variants or coding indels, 3) with a minor allele frequency (MAF) < 0.1% in Exome Aggregation Consortium (ExAC), and 4) not present in 186 controls from our in- house dataset. In order to validate our results and examine segregation of the identified ELOVL4 DNA variations with the disease in the family, we used specific PCR primer pairs (forward: CATTGCTTTCCACTGAACACA; reverse CATGCCTTGTACATTTTGTGC) to amplify DNA from 18 family members and sequenced them by Sanger sequencing (Applied Biosystem’s 3730xl

DNA Analyzer technology). One additional family member was tested with commercially available Sanger sequencing of ELOVL4 from Prevention Genetics™.

Fibroblast cells isolation and culture A skin biopsy was performed on the patient who reported cutaneous involvement. The fibroblast cells were isolated from skin biopsies and kept in liquid nitrogen until used as previously described (22). Briefly, fibroblasts were cultivated in DMEM with 10% Fetal Bovin Serum (FBS) (Seradigm) with 100 IU/mL penicillin G (Sigma-Aldrich) and 25 µg/mL gentamicin (Gemini Bio-product) in

8% CO2 at 37 °C. They were cultured in flasks until confluency (100%) prior to be split and seeded in 6-well plate containing sterile glass coverslips.

Immunofluorescence analyses Fibroblasts cells, grown on glass coverslips, were fixed in 4% (w/v) paraformaldehyde in phosphate-buffered saline for 20 minutes and blocked for 1 hour in 5%(w/v) goat serum 0.1% Triton X-100 in phosphate-buffered saline at room temperature. Immunofluorescence was performed using antibodies recognizing ELOVL4 (rabbit polyclonal, Abcam ab224608) and calnexin (mouse monoclonal, Invitrogen MA3-027), and used at 1:200 diluted in blocking solution overnight at 4 °C. Fluorescent signal distribution was visualized by epifluorescence microscopy after incubation with secondary antibodies, anti-mouse or anti-rabbit IgG conjugated to Alexa Fluor 488 (green) or 594 (red) (Invitrogen mouse 488 #A11001 and rabbit 594 #A21207) diluted 1:500 for 2 hours at room temperature and mounted in Prolong (Fluoromont G with Dapi Invitrogen #00- 4959-52).

3.5 Results Genetic results A total of 19 individuals (9 affected and 10 unaffected) underwent a complete neurological evaluation and genetic testing (Table 3.1). Routine biochemical investigations were normal and initial genetic screening had excluded SCA1, 2, 3, 6, 7, 8, 17, and Fragile X syndrome for this family. WES in five affected individuals revealed 426,715 DNA variations. Only one variant, a heterozygous missense mutation in the ELOVL fatty acid elongase 4 gene (ELOVL4), (NM_022726.3 c.504G>C, p.L168F), fulfilled the filtering criteria. This variant had already been reported to cause SCA34 (2), and the L168F amino acid substitution was located at a highly conserved residue in the third transmembrane domain of the protein. This mutation was predicted to be possibly damaging with a score of 0.867 according to the PolyPhen-2 website (http://genetics.bwh.harvard.edu/pph2/)(23). This mutation was confirmed in four additional

affected family members, but was absent in the 10 unaffected relatives. Hence, perfect segregation of the identified c.504 G>C mutation with the disease status in the family was observed (Figure 3.1).

Table 3.1 Detailed neurological findings in affected individuals with ELOVL4 mutation

Figure 3.1 Pedigree of a French-Canadian Family with the c.504 G>C mutation in ELOVL4

Clinical assessment The disorder was characterized by a late-onset cerebellar syndrome (mean age at onset 47 years; range 32 to 60 years) with slow progression. Patients generally required a walker in their 70s and became wheelchair-bound in their 80s. Truncal and gait ataxia, along with dysmetria and dysarthria, were remarkable in all patients (Table 3.1). The median SARA score was 16 (range 8 to 21.5), and scores increased with advancing age. Hypometric saccades and saccadic pursuits were remarkable upon examination. Most patients denied current or previous dermatologic involvement, but one patient (IV-18) reported erythematous dry skin lesions on the lower limbs during winter beginning in her fifth decade (Figure 3.2). Nummular dermatitis was diagnosed, but there was no typical EKV lesion. Two other patients reported occasional dry skin on the lower limbs in winter, but none had erythematous lesions, and there were no active lesions at the time of evaluation. Moreover, three patients reported a history of severe gingivitis that occurred in the second decade and caused a generalized edentation that required dentures. One patient (V-1) had bilateral pale pisciform perimacular retinal lesions upon ophthalmologic examination. She had no complains of visual loss, and was examined by a retinal disease specialist who concluded that there was no evidence of Stargardt disease or retinitis pigmentosa. All other evaluated patients had a normal ophthalmologic exam. Three patients had mild sensory deficits upon evaluation, two of whom also had decreased deep tendon reflexes (DTR). Polyneuropathy was confirmed in two out of three tested patients (Table 3.1).

Figure 3.2 Dermatologic lesion in a SCA34 patient

MRI was performed in six patients and revealed mild (1/6) to severe (5/6) vermian and hemispheric cerebellar atrophy in all patients along with pontine atrophy in four (Figure 3.3). Cruciform hypersignal in the pons, also called the hot cross bun sign, was present in two patients (III-27 and IV-3). Other findings were reported only in selected patients, notably mild diffuse cerebral cortical (2/6) or sub-cortical (2/6) atrophy and leukoencephalopathy (2/6). FDG-PET revealed diffuse cerebellar hypometabolism in all five patients. Three patients also had a very subtle bilateral (2/5)

or right (1/5) parietal hypometabolism (Figure 3.3). One other patient had heterogeneous cerebral hypometabolism with preserved basal ganglia, brainstem, and mesiotemporal regions, which was possibly secondary to diffuse vascular involvement. In this patient, MRI had shown subcortical atrophy, but no evidence of previous stroke.

Figure 3.3 Neuroimaging findings in patients with the c.504 G>C mutation in ELOVL4

Cognitive assessment Five patients were evaluated at the Clinique Interdisciplinaire de Mémoire du CHU de Québec. Their performance was compared to five age- and education-matched controls (mean education for patients=12.4±1.51 years vs 13.4±2.07 for controls). The cognitive involvement was homogeneous within affected patients with significant deficits in executive functioning and apparent impairment in visuospatial skills and attention that did not reach statistical significance (Table 3.2). Working memory, psychomotor speed, set shifting, inhibition, and planning skills were particularly affected as revealed by failure to perform backward digit span, decreased lexical verbal fluency, and impaired trail making, Luria sequence, Go/No-go, and RCFT (Figure 3.4). Visuoconstructive skills and attention were also impaired in all patients, but this did not reach statistical significance. Patients did not present deficits in memory and language. Detailed neuropsychological testing in the youngest patient (V-1) revealed a mild impairment in selective attention and working memory. Psychiatric features were remarkable in three patients, two of whom exhibited frank disinhibition and euphoria, while impulsiveness and anxiety were noted in a third patient. Detailed descriptions of cognitive evaluations are available in the Supplementary Material.

Table 3.2 Results of the clinical evaluation in SCA34 patients and controls

Figure 3.4 Impaired copy of the RCFT in three patients with the c.504 G>C mutation in ELOVL4

Aberrant ELOVL4 localization in patient fibroblasts Immunofluorescence analysis of fibroblasts from a healthy control showed homogeneous staining of ELOVL4 seemingly colocalizing with the endoplasmic reticulum marker Calnexin at the perinuclear space (Figure 3.5A). However, mislocalization of the ELOVL4 protein beyond the perinuclear region, as well as abnormal punctates and aggregates can be observed in patient-derived fibroblasts carrying the c.504G>C mutation (Figure 3.5B).

Figure 3.5 Immunofluorescence staining of dermal fibroblasts from a SCA34 patient compared with fibroblasts from a healthy control

3.6 Discussion We report a large family with a c.504 G>C mutation in ELOVL4 associated with cerebellar ataxia and cognitive impairment with prominent executive dysfunction. Our findings provide additional support to the putative role of ELOVL4 mutation in cerebellar function. Moreover, we provide the first evidence of ELOVL4 cellular abnormalities in SCA34 by demonstrating mislocalization and abnormal aggregation of the protein in a patient’s dermal fibroblasts.

In our cohort, all patients presented with a prominent cerebellar syndrome of late onset and slow progression. So far, ELOVL4-linked SCA34 has only been reported in patients of Canadian, Japanese, and Brazilian origins, and clinical features vary significantly amongst described patients (Table 3.3). Notably, decreased DTR and peripheral neuropathy were both observed in two patients from the present study, while 4 out of 8 of patients tested by Cadieux-Dion et al. had a mild peripheral neuropathy (2). However, patients from Ozaki et al. rather presented with increased DTR and positive Babinski signs, upper motor neuron findings that may be associated with the multiple system atrophy-like findings on imagery (4). Interestingly, two patients from the present study also presented with a hot cross bun sign, but DTR and plantar reflexes were normal. Hence, it appears that the cerebellar syndrome may be associated with peripheral polyneuropathy or pyramidal signs in patients with SCA34.

Table 3.3 Clinical and paraclinical characteristics of patients with mutations in ELOVL4 in present and previous studies

For the first time, we report SCA34 patients with deficits in executive functioning that were statistically different from age- and education-matched controls, along with apparent visuospatial and attention deficits. This was associated with psychiatric features in three patients. These findings appear typical of the CCAS (7, 11), and provide additional evidence of neurocognitive and neurobehavioral impairment in hereditary degenerative ataxias. Functional imaging showed cerebellar hypometabolism, which was associated with mild parietal hypometabolism in three patients. This could be attributable to a diaschisis phenomenon, wherein severe damage to the cerebellar hemispheres could result in reduced cerebral metabolic activity through deactivation of the cerebello-thalamic-cortical projections (24). Indeed, the parietal lobe has important afferent and efferent connections with the cerebellum. These appear to be involved in the pathophysiology of parietal ataxia, or crossed cerebellar diaschisis, a phenomenon in which patients with a primary parietal lesion develop secondary contralateral cerebellar dysfunction (25). The parietal hypometabolism observed here could reflect the opposite phenomenon, i.e., parietal dysfunction

secondary to a primary cerebellar lesion. A previous report of parietal hypometabolism in a pure recessive cerebellar ataxia phenotype caused by SYNE1 recessive mutations supports this hypothesis (13). This phenomenon may contribute to the visuospatial and attention deficits observed in our patients and may be amenable to potential treatments targeting diaschisis (24).

As opposed to previously reported patients with the same mutation (2), our patients did not report any history of skin lesions associated with EKV. Absence of EKV may reflect either the role of a second modifier gene involved in cutaneous disease or a milder disease severity that would have gone unnoticed. The late-onset skin dryness and nummular dermatitis reported by a few patients, along with the early gingivitis episodes in three patients, may either represent milder mucocutaneous involvement or coincidental findings. Absence of EKV in ELOVL4-linked families has previously been reported in patients of Japanese origin (4).

Of particular interest, immunofluorescence analyses using dermal fibroblasts from an affected patient revealed mislocalization and aggregation of the ELOVL4 protein. Previous studies had failed to demonstrate significant serum lipid anomalies in SCA34 patients and none had evaluated alterations in human tissue (2, 4). The mislocalization and aggregation of the ELOVL4 protein observed in the patient’s fibroblast cells appear similar to those found in previous studies of Stargardt-like macular dystrophy type 3 (STGD3), which is associated with ELOVL4 dominant mutations (26-28). More specifically, Logan et al. demonstrated that ELOVL4 mutations associated with STGD3 cause mislocalization of the protein beyond the endoplasmic reticulum in a punctate and aggregated appearance very similar to what we observed (26). In this study, the mutant protein was shown to interact with wild type ELOVL4 to alter the localization of the protein and to exert a dominant negative effect on enzymatic activity that worsened if the protein was redirected to the endoplasmic reticulum (26). Therefore, it is likely that the c.504 G>C ELOVL4 mutation may also exert its pathogenic effect through a dominant negative mechanism that involves interaction with wild type ELOVL4, mislocalization, and possibly reduction in the production of VLCFA.

As expected in the evaluation of a rare disease, this study is limited by the small number of patients that originated from a single family, such that the clinical features described here may not reflect the range of clinical involvement in patients with different mutations or from different families. This was highlighted by the comparison between the findings from the actual and previous studies (Table 3.3), which showed the broad range of clinical findings in SCA34 patients. Nevertheless, it is likely that the neurocognitive impairment described here transcends single mutations and could be found in all patients with a cerebellar motor syndrome, since the cognitive deficits are also a

direct consequence of prominent cerebellar degeneration. Similarly, the skin biopsy findings would have to be confirmed in tissue specimens from additional patients, including some with different mutations, to confirm that the dominant negative effect on protein localization observed here is a ubiquitous mechanism in this disorder.

3.7 Conclusion Our findings support the role of ELOVL4 in cerebellar function and present a more precise and exhaustive characterization of the SCA34 phenotype. Clinicians should consider the diagnosis of SCA34 even in the absence of EKV and systematically assess cognitive and psychiatric features with specific emphasis on executive, visuospatial and attention deficits. Analysis of dermal fibroblasts from a SCA34 patient supports a dominant-negative effect on ELOVL4 localization. More research is needed to understand the specific role of ELOVL4 and VLCFA in the cerebellum in order to better understand the specific pathological mechanisms of selective cerebellar dysfunction in SCA34.

3.8 Tables Table 3.1 Detailed neurological findings in affected individuals with ELOVL4 mutations

ncal ataxia ncal

ID onset at age Reported evaluation last at Age tru and Limb Dysarthria SARAscore Nystagmus & saccades Hypometric saccadicpursuit Tremor Strength Sensibilities EMG/NCS Evolution Others dDTR, III-3 60 82 +++ ++ 16.5 + + + N LOT Slow*(*) EPR III-7 50 86 +++ ++ 20.5 + + - N LOVPT SMPN Slow* III-20 50 83 +++ + N/A + + - N N Slow** III-24 N/A 93 +++ +++ N/A N/A N/A N/A N/A N/A Slow** SCI III-27 45 79 + ++ N/A + + - N N MPN Slow* IV-3 40 74 ++ ++ 21.5 + + - N N Slow* IV-6 50 72 + + 16 + + - N N Slow UI IV- UI, ND, 50 66 ++ ++ 11 + + + N LOV Slow 18 dDTR V-1 32 44 + + 8 - + + N N N Slow

+: present/mild; ++ moderate; +++ severe; *uses a walker;** uses a wheelchair; dDTR decreased deep tendon reflexes; EPR extra-pyramidal rigidity; N normal; N/A not available; ND nummular dermatitis; LO(V)(P)(T) loss of vibration, proprioception, temperature; SCI severe cognitive impairment with decreased cooperation; (S)MPN (sensitivo)motor polyneuropathy; UI urinary incontinence

Table 3.2 Results of the clinical evaluation in SCA34 patients and controls Clinical domains Patients (n=5) Controlsa (n=5) p valueb Cognitive – Mean±sd Attention 5.6±1.5 6.8±0.4 0.138 Executive 2.4±2.1 5.8±0.4 0.042 Visuospatial 9.2±1.1 10.6±0.5 0.053 Memory 4.2±0.4 4.2±0.4 N/A Language 3±0 3±0 N/A Psychiatric – No. (%) Disinhibition 2 (40) 0 Euphoria 2 (40) 0

Impulsiveness 3 (60) 0 Anxiety 1 (20) 0 Panic 1 (20) 0 aControls are age- and education-matched to patients. bP values are calculated with the paired sample t-test.

Table 3.3 Clinical and paraclinical characteristics of patients with mutations in ELOVL4 in present and previous studies Present Study Giroux et al. Ozaki et al. Bourassa et Bourque et al. 1972(3) Cadieux- 2015(4) al. 2015(5) 2018(6) Characteristic Dion et al. 2014(2) No of 9 19 9 1 1 patients, n Ethnic origin French- French-Canadian Japanese Brazil English Canadian Canadian Mutation c.504G>C, c.504G>C, c.736T>G, c.539A>C, c.698C>T, p.L168F p.L168F p.W246G p.Q180P p.T233M Mean age at 47 51 33.9 Mid 20s 15 onset, y Ataxia Gait and limb Gait ataxia Gait and limb Gait and Gait ataxia ataxia with (12/19) limb ataxia with limb ataxia (1/1), absence dysarthria (9/9) ataxia (9/19) and dysarthria (9/9) with of limb ataxia dysarthria (6/19) dysarthria or dysarthria (1/1) Oculomotor Nystagmus (7/8) Nystagmus (7/19) Nystagmus (7/9) Bilateral Square wave abnormalities hypometric slow pursuit supranuclear ophtalmo- jerks, periodic saccades and (5/19), slow gaze palsy (3/9), plegia, alternating saccadic pursuit saccades (3/19) altered smooth diplopia, skew (8/8) pursuit (5/9) horizontal deviation, gaze-evoked saccadic nystagmus pursuit (1/1) (1/1) Motor neuron Decreased DTR Decreased DTR Increased DTR None Decreased involvement (2/9) (7/19) or Babinski DTR (1/1) (8/9) Dermatologic Nummular Active or past None Past EKV Active EK involvement dermatitis (1/9) EKV (14/19) Absence of EKV (9/9) Cognitive Alterations in Cognition Not reported Not reported Not reported involvement executive, appeared normal visuospatial attention (5/5), psychiatric features (3/5)

Neuroimaging Mild to severe Cerebellar (6/9), Cerebellar and Cerebellar Mild cerebellar (5/5) pontine (5/9) pontine atrophy and pontine cerebellar and and pontine and/or cerebral (8/8), hot cross atrophy (1/1) pontine (3/5) atrophy. (4/9) atrophy, bun sign (4/6) or atrophy (1/1) Hot cross bun normal MRI (3/9) pontine linear sign (2/5) hyperintensity (2/6) Electrophy- Peripheral Mild peripheral None Not reported Normal (1/1) siological neuropathy axonal neuropathy anomalies (2/3), normal (4/8) (1/3) DTR deep tendon reflexes; EK(V) erythrokeratodermia (variabilis); MRI Magnetic resonance imaging; VLCFA very long chain fatty acids; VLC-SFA very long chain saturated fatty acids

3.9 Figures

Figure 3.1 Pedigree of a French-Canadian Family with the c.504 G>C mutation in ELOVL4

Symbols with a + sign in the right corner indicate that the patients is bearing the identified L168F mutation in the ELOVL4 gene, the genotype is indicated below the symbol. Symbols with a – sign indicate the absence of a mutated allele in ELOVL4.

Figure 3.2 Dermatologic lesion in a SCA34 patient

Evaluation by a dermatologist revealed nummular dermatitis, but no sign of erythrokeratodermia variabilis.

Figure 3.3 Neuroimaging findings in patients with the c.504 G>C mutation in ELOVL4

A B

(A) Sagittal MRI of a 68-year-old male (IV-3) showing severe cerebellar atrophy with pontine atrophy. (B) Axial MRI from the same patient showing T2 cruciform hypersignal in the pons (indicated by red arrow). (C) FDG-PET of a 70-year-old female (IV-6) showing severe cerebellar hypometabolism and minimal biparietal hypometabolism.

Figure 3.4 Impaired copy of the RCFT in three patients with the c.504 G>C mutation in ELOVL4

A. RCFT model. B. 64-year-old female with 12 years of education (IV-18). C. 72-year-old male with 11 years of education (IV-3) shows significant juxtaposition of details D. 80-year-old male with 21 years of education (III-3) with a severe dysexecutive syndrome.

Figure 3.5 Immunofluorescence staining of dermal fibroblasts from a SCA34 patient compared with fibroblasts from a healthy control

(A) ELOVL4 staining in healthy control’s fibroblasts showed homogeneous staining that appears to colocalize with the endoplasmic reticulum marker Calnexin at the perinuclear space. The nucleus marker Dapi is shown in blue. The magnification is 40x. (B) ELOVL4 staining in patient’s fibroblasts showed mislocalization of the protein beyond the perinuclear region with a punctate and aggregated appearance.

3.10 Supplementary Material Detailed cognitive evaluations of SCA34 patients Case III-3 This patient first came to our attention at 80 years of age. He had achieved theology studies and worked as a pastor. He was independent for activities of daily living but lived in a supervised religious housing community. Upon examination, the patient showed euphoria. He insisted on meeting the secretary who scheduled his medical appointment. There were no language deficits. He scored 27/30 on the MMSE, losing one point on calculation and two points on memory recall. He scored 24/30 on the MoCA, losing 3 points for the trail making, cube copy, and clock drawing. He also lost 3 points on memory recall, which improved with cueing. He failed on the Luria test, alternating graphic sequence and Go/No-Go task. The RCFT was significantly impaired, and he proceeded by juxtaposition of details. On praxis assessment tasks, the patient presented body-part- as-object gesture.

Case IV-3 This patient was first evaluated at 72 years of age; he was a male with a grade 11 education. He used to be an iron worker. He was mildly impaired on instrumental activities of daily living and lost his driver’s licence following a road test examination. He scored 25/30 on the MMSE, losing 4 points on calculation and one point on memory recall, which improved with cueing. On follow-up, his MMSE dropped to 21. MoCA score was 22/30, he failed the trail making and cube copy. Clock drawing was mildly impaired. Working memory was altered, he failed backward digit span and months backward. Lexical verbal fluency was significantly decreased. Abstract thinking was slightly diminished. He correctly performed the Luria but failed the Go/No-Go task. The RCFT was impaired, and he proceeded by juxtaposition of details. Language was preserved. There was no apraxia.

Case IV-6 This patient was first evaluated at 70 years of age; she was a female with a grade 12 education. She worked as a secretary. She complained about attention deficits from an early age. She had trouble finding her way while driving over five years ago, but did not report other functional impairment. Her MMSE score was 23/30. She lost her points on calculation, pentagons drawing and memory recall, which improved with cueing. She scored 24/30 on the MoCA. She failed the cube copy and her lexical verbal fluency was impaired. She failed the Go/No-Go and Luria tests. She missed 4 of

16 words on naming task. Copying of the RCFT was performed with mild errors. She did well on praxis assessment.

Case IV-18 This was a 64-year-old female with a grade 12 education. She worked as a transcriptionist but had been dismissed because of reduced performance. When questioned, she claimed that she had character incompatibility with her manager. On examination, she showed euphoric affects and lack of insight. She was talkative and disinhibited; she made inappropriate comments about physical appearance of physicians. She scored 27/30 on MMSE, losing one point on calculation and two points on memory recall. She scored 24/30 on the MoCA, she failed the trail making and cube copy. Her lexical verbal fluency was altered. She was unable to perform the Go/No-Go and Luria test. The RCFT was significantly impaired. Praxis assessment tasks were performed correctly.

Case V-1 This was a 42-year-old female with 14 years of education. She had had a diagnosis of attention deficit-hyperactivity disorder at the age of 30, which was treated with methylphenidate, and has also been diagnosed with panic disorder. She scored 28/30 on the MMSE, losing two points on memory recall, which were recovered by cueing. Her MoCA score was 29/30, she missed one point on the lexical verbal fluency. She showed impaired working memory and selective attention on detailed neuropsychological assessment. The RCFT was drawn perfectly. Subtle impulsiveness was noted.

3.11 References 1. Ruano L, Melo C, Silva MC, Coutinho P. The global epidemiology of hereditary ataxia and spastic paraplegia: a systematic review of prevalence studies. Neuroepidemiology. 2014;42(3):174- 83. 2. Cadieux-Dion M, Turcotte-Gauthier M, Noreau A, Martin C, Meloche C, Gravel M, et al. Expanding the clinical phenotype associated with ELOVL4 mutation: study of a large French- Canadian family with autosomal dominant spinocerebellar ataxia and erythrokeratodermia. JAMA Neurol. 2014;71(4):470-5. 3. Giroux JM, Barbeau A. Erythrokeratodermia with ataxia. Arch Dermatol. 1972;106(2):183- 8. 4. Ozaki K, Doi H, Mitsui J, Sato N, Iikuni Y, Majima T, et al. A novel mutation in ELOVL4 leading to spinocerebellar ataxia (SCA) with the hot cross bun sign but lacking erythrokeratodermia: a broadened spectrum of SCA34. JAMA Neurol. 2015;72(7):797-805. 5. Bourassa CV, Raskin S, Serafini S, Teive HA, Dion PA, Rouleau GA. A new ELOVL4 mutation in a case of spinocerebellar ataxia with erythrokeratodermia. JAMA Neurol. 2015;72(8):942-3. 6. Bourque PR, Warman-Chardon J, Lelli DA, LaBerge L, Kirshen C, Bradshaw SH, et al. Novel ELOVL4 mutation associated with erythrokeratodermia and spinocerebellar ataxia (SCA 34). Neurol Genet. 2018;4(4):e263.

7. Schmahmann JD, Sherman JC. The cerebellar cognitive affective syndrome. Brain. 1998;121 ( Pt 4):561-79. 8. Kansal K, Yang Z, Fishman AM, Sair HI, Ying SH, Jedynak BM, et al. Structural cerebellar correlates of cognitive and motor dysfunctions in cerebellar degeneration. Brain. 2017;140(3):707- 20. 9. Stoodley CJ, Valera EM, Schmahmann JD. Functional topography of the cerebellum for motor and cognitive tasks: an fMRI study. Neuroimage. 2012;59(2):1560-70. 10. Stoodley CJ, Schmahmann JD. Evidence for topographic organization in the cerebellum of motor control versus cognitive and affective processing. Cortex. 2010;46(7):831-44. 11. Manto M, Marien P. Schmahmann's syndrome - identification of the third cornerstone of clinical ataxiology. Cerebellum Ataxias. 2015;2:2. 12. Salmi J, Pallesen KJ, Neuvonen T, Brattico E, Korvenoja A, Salonen O, et al. Cognitive and motor loops of the human cerebro-cerebellar system. J Cogn Neurosci. 2010;22(11):2663-76. 13. Laforce R, Jr., Buteau JP, Bouchard JP, Rouleau GA, Bouchard RW, Dupre N. Cognitive impairment in ARCA-1, a newly discovered pure cerebellar ataxia syndrome. Cerebellum. 2010;9(3):443-53. 14. Pedroso JL, Franca MC, Jr., Braga-Neto P, D'Abreu A, Saraiva-Pereira ML, Saute JA, et al. Nonmotor and extracerebellar features in Machado-Joseph disease: a review. Mov Disord. 2013;28(9):1200-8. 15. Fancellu R, Paridi D, Tomasello C, Panzeri M, Castaldo A, Genitrini S, et al. Longitudinal study of cognitive and psychiatric functions in spinocerebellar ataxia types 1 and 2. J Neurol. 2013;260(12):3134-43. 16. Agbaga MP. Different mutations in ELOVL4 affect very long chain fatty acid biosynthesis to cause variable neurological disorders in humans. Adv Exp Med Biol. 2016;854:129-35. 17. Sherry DM, Hopiavuori BR, Stiles MA, Rahman NS, Ozan KG, Deak F, et al. Distribution of ELOVL4 in the developing and adult mouse brain. (1662-5129 (Print)). 18. Brush RS, Tran JT, Henry KR, McClellan ME, Elliott MH, Mandal MN. Retinal sphingolipids and their very-long-chain fatty acid-containing species. Invest Ophthalmol Vis Sci. 2010;51(9):4422-31. 19. Nasreddine ZS, Phillips NA, Bedirian V, Charbonneau S, Whitehead V, Collin I, et al. The Montreal Cognitive Assessment, MoCA: a brief screening tool for mild cognitive impairment. J Am Geriatr Soc. 2005;53(4):695-9. 20. McKenna A, Hanna M, Banks E, Sivachenko A, Cibulskis K, Kernytsky A, et al. The Genome Analysis Toolkit: a MapReduce framework for analyzing next-generation DNA sequencing data. Genome Res. 2010;20(9):1297-303. 21. Wang K, Li M, Hakonarson H. ANNOVAR: functional annotation of genetic variants from high-throughput sequencing data. Nucleic Acids Res. 2010;38(16):e164. 22. Pare B, Touzel-Deschenes L, Lamontagne R, Lamarre MS, Scott FD, Khuong HT, et al. Early detection of structural abnormalities and cytoplasmic accumulation of TDP-43 in tissue- engineered skins derived from ALS patients. Acta Neuropathol Commun. 2015;3:5. 23. Adzhubei IA, Schmidt S, Peshkin L, Ramensky VE, Gerasimova A, Bork P, et al. A method and server for predicting damaging missense mutations. Nat Methods. 2010;7(4):248-9. 24. Carrera E, Tononi G. Diaschisis: past, present, future. Brain. 2014;137(Pt 9):2408-22. 25. Morihara R, Yamashita T, Deguchi K, Kurata T, Nomura E, Sato K, et al. Familial and sporadic chronic progressive degenerative parietal ataxia. J Neurol Sci. 2018;387:70-4. 26. Logan S, Agbaga MP, Chan MD, Kabir N, Mandal NA, Brush RS, et al. Deciphering mutant ELOVL4 activity in autosomal-dominant Stargardt macular dystrophy. Proc Natl Acad Sci U S A. 2013;110(14):5446-51. 27. Grayson C, Molday RS. Dominant negative mechanism underlies autosomal dominant Stargardt-like macular dystrophy linked to mutations in ELOVL4. J Biol Chem. 2005;280(37):32521-30.

28. Maugeri A, Meire F, Hoyng CB, Vink C, Van Regemorter N, Karan G, et al. A novel mutation in the ELOVL4 gene causes autosomal dominant Stargardt-like macular dystrophy. Invest Ophthalmol Vis Sci. 2004;45(12):4263-7.

Conclusion

In this master thesis, I presented three articles that expand our knowledge and understanding of hereditary cerebellar ataxias to address the issue of underdiagnosis in affected patients. The first two chapters had a common objective: to identify and classify recessive cerebellar ataxias in order for expert and non-expert physicians to better navigate this group of disorders, recognize clinical presentations, and understand underlying pathophysiology. This was a two-step process. The first chapter was a systematic scoping review of the literature that allowed the identification of 45 gene- defined disorders in which ataxia and cerebellar degeneration were central features through the retrieval of 2354 references and revision of 130 full-text articles. Thirty additional disorders were identified which presented with prominent or occasional ataxia but belonged to other disease categories or had a complex multisystem phenotype. We also included a tentative proposal of categorisation and a clinical algorithm for clinicians. The explicit objective was for this review of the evidence to serve as a basis for the work of a dedicated task force on the classification of recessive cerebellar ataxias.

From thereon, we gathered a group of 12 international ataxia experts and launched a reflection process that spanned over two years, including two in-person meetings at the Society for Research on the Cerebellum and Ataxias Symposiums in 2017 and 2018. The Task Force members contributed with personal clinical and research experience, along with individual perspective to elaborate a classification that would represent a consensus from experts in this field. The second chapter presented this new conceptual framework for recessive ataxias with a clinical classification and a pathophysiological classification, which were accompanied by a stepwise approach to the diagnosis of a patient presenting with ataxia. In this final iteration, 59 gene-defined disorders were included in the list of primary recessive ataxias along with 48 complex multisystem disorders that should be included in the differential diagnosis of hereditary ataxia. This expanded number of included disorders reflected the update of the systematic review between 2016 and 2018, during which time new mutated genes and new phenotypes for previously known genes were associated with ataxia. It also reflected modified inclusion criteria following discussions within the task force, notably the decision that genes already classified in other disease categories could be included in the primary recessive ataxias if ataxia was a core element. On the opposite, certain disorders were excluded from the list following the decision that only disorders described in at least two distinct families could be included. This consensus paper aimed at providing a unique classification for recessive ataxias that expert and non-expert physicians could refer to for clinical and research purposes.

The methodology used had advantages for the elaboration of a classification. First, it was based on a systematic scoping review, which increased the likelihood of including disorders described only in specific populations and allowed an unbiased consideration of all disorders. Second, the final classification presented in chapter two was based on a consensus of international experts in the field, which ensured adequate representation of ethnical and geographical specificities in the prevalence, clinical presentation, and diagnosis of ataxia patients. It also increased the likelihood that other ataxia experts and physicians in general would adopt this classification system. Third, we developed both a clinical and a pathophysiological classification to bring together the clinical and molecular perspectives, which appeared to shed light upon one another. Indeed, we observed that the two classification systems presented significant overlap and that underlying disease mechanism was often reflected in the associated symptomatology. Finally, we worked on developing visually appealing graphic classification summaries that represent user-friendly pocket tools that are complemented by detailed tables for reference purposes. This represents a further step to promote use of this classification system by physicians in everyday practice, which is essential for the classification to serve its purpose.

There are nevertheless some limitations to this work. First, nosology and classifications are dynamic processes. As articles are published that present new genes involved in recessive ataxias or new phenotypes for previously known genes, this list of included disorders and classification will probably evolve. This was demonstrated by the modifications in the list of included disorders between the systematic review publication and the consensus proposal. Indeed, several new genes were associated with cerebellar ataxias in the two-year period before the systematic review update, notably GDAP2 (26), VPS13D (27), XRCC1 (28), and predominant ataxic phenotypes were newly described in genes previously associated with other disease categories, such as CYP7B1 (29), GRN (30), PNPLA6 (31).Therefore, this classification will have to be regularly updated to stay up to date and relevant to clinical practice. Another limitation was that the inclusion criteria of the systematic review included the element of ataxia as a central element in the clinical picture, which relies on a partly subjective appraisal of the importance of the cerebellar phenotype in the global clinical picture. This criterion is also dependent on the number and quality of described cases. For example, some articles focusing on biochemical anomalies or genetic findings only mentioned gait abnormalities, falls or ataxia in general without providing sufficient details to infer if it was due to cerebellar or sensory dysfunction (for example, (32, 33)). Hence, it remains possible that other experts could have a different opinion regarding the inclusion of certain disorders. This was minimized by the consensual development of the list of included disorders that ensured that all task

force members approved the final selection of disorders. The other methodological limitation was associated with the extent of the literature review required to cover this very large field. As a result, the search strategy was built to have a reasonable balance between sensitivity and specificity, but we could not aim for perfect sensitivity, as it would have been unrealistic to evaluate all identified articles. Therefore, it occurred that some relevant articles were not retrieved by the initial search strategy, but in these cases, we did identify subsequent related research articles or editorial comments. From there on, the revision of references allowed to identify other relevant articles concerning the same gene, such that it seems unlikely that major articles were omitted.

Previous articles had included classification proposals for recessive ataxias. Anheim et al. (22) reviewed the most frequent cerebellar ataxias in a narrative review and separated them according to the presence and type of associated neuropathy. However, they did not include the less frequent ataxias and those described only in specific geographical areas. They also included some complex multisystemic disorders in which ataxia appears as a late or minor finding, such as congenital disorder of glycosylation 1a, which is characterised by intellectual disability, hypotonia, and visceral involvement with congenital onset. In our opinion and according to task force members, these disorders do not belong to the same diagnostic category, and should rather be approached as inborn errors of metabolism. Several book chapters have also been written on recessive cerebellar ataxias, which are essential to bring awareness to this group of disorders for clinicians (23, 34). However, they were based on narrative reviews of the literature, discussing again mainly the most prevalent ataxias. Moreover, all represented the opinion of a single or small number of authors on this matter, which did not ensure a proper representation of geographical and ethnical specificities.

The most comprehensive review besides the work presented here was conducted by the International Parkinson and Movement Disorder Society Task Force on Classification and Nomenclature of Genetic Movement Disorders. They undertook a global effort to revise the nomenclature system of all genetic movement disorders in order to overcome the limitations associated with the numbering systems, and proposed a phenotype prefix associated with the gene name (35). Following the publication of our systematic review, this group published a nomenclature and classification proposal for recessive ataxias in 2018. They presented a very exhaustive list of 92 disorders to which they attributed an ataxia prefix, along with 89 disorders with predominantly non- ataxia phenotypes that should be included in the differential diagnosis. This highly exhaustive list is a useful reference, but unfortunately the authors included many disorders in which the ataxia phenotype is very secondary to the global multisystem involvement, such as congenital disorders of glycosylation or myoclonic epilepsies. Moreover, they included genes associated with Joubert

syndrome, which is usually classified on its own since it is associated with mutations in 35 separate genes and has very typical neurological and renal anomalies. This exhaustiveness and the absence of organization of the included disorders reduced it to a heavy-going list of disorders that does not serve the purposes of a classification. Therefore, it constitutes a complementary reference to the classification proposed here, but can hardly be considered a classification system per se.

The third chapter of this master thesis addressed the issue of proper phenotypic characterization of hereditary ataxias, which is the basis for recognition of atypical phenotypes and classifications. We studied a large five-generation family affected with Spinocerebellar ataxia 34 (SCA34) caused by a pathogenic mutation in ELOVL4. This disorder had previously only been reported in three families from Quebec and Japan, and two individuals of Brazilian and English Canadian origin (36-39). The family studied herein presented some distinctive features, notably the absence of erythrokeratodermia variabilis, which had been reported in previous articles, the presence of neuropathy, and multiple system atrophy-like findings on imagery in some individuals. We also proceeded to in-depth characterization of the neurocognitive and neurobehavioral involvement in affected patients, which had been overlooked in previous studies. This showed significant executive dysfunction in affected patients along with apparent visuospatial, attention, and psychiatric involvement, which are typical findings of the cerebellar cognitive-affective syndrome (CCAS). This was the first evidence of neurocognitive impairment in this disorder, and it provided additional validation to the applicability of the universal cerebellar transform theory to hereditary ataxias. Indeed, this theory suggests that the unifying role of the cerebellum in motor, cognitive and emotional processes is to dampen variations around a homeostatic state in order to smoothen the resulting behaviour, which underlies the motor ataxia and dysmetria of thought symptomatology in cerebellar lesions (40). Before the present study, CCAS findings had mostly been reported in a few prevalent hereditary ataxias, notably SCA3 (41, 42), FRDA (43), SCA1 and SCA2 (44), which are disorders with considerable supratentorial involvement that may confound the association between cerebellar dysfunction and the cognitive deficits. Only one previous study had thoroughly evaluated cognitive impairment in patients with a pure cerebellar phenotype caused by a SYNE1 mutation, and this study had shown deficits in attention, verbal working memory, and visuospatial skills, but absence of psychiatric involvement as measured by standardized anxiety and depression questionnaires (45). These results are in line with those obtained here, and demonstrate that attention, executive function, and visuospatial skills appear to be most affected in degenerative hereditary ataxias that target mainly the cerebellum. The absence of psychiatric involvement in patients reported by Laforce et al. (45) may be due to a different evaluation method. Indeed, the

most prevalent psychiatric features reported in our patients were disinhibition and euphoria, which are likely to be overlooked by patients in self-reported questionnaires testing for anxiety and depression. Future studies should consider combining self-reported symptoms with evaluator’s assessment or proxy questionnaires to overcome this limitation.

As part of this study, we also presented immunofluorescence results of dermal fibroblasts showing the first conclusive evidence of ELOVL4 mislocalization and abnormal aggregation in this disorder. We demonstrated a dominant-negative effect on protein localization, which was an important step in the understanding of ELOVL4 pathology. These findings were similar to those obtained in patients with ELOVL4-associated Stargardt-like macular dystrophy type 3, in which researchers additionally demonstrated a dominant negative effect on enzymatic activity (46). This appears as a possible pathogenic mechanism in SCA34; an alternative hypothesis would be that protein mislocalization and aggregation causes cellular stress and exerts a toxic effect on essential cell functions. Hence, future studies should aim at evaluating the downstream mechanism through which protein mislocalization causes prominent cerebellar degeneration and which cerebellar cell types are predominantly affected.

This clinical genetic case series enabled to better define the phenotype of a little-known disorder, with in-depth characterization of the clinical involvement in a large family including specialised neurological, ophthalmologic, dermatologic, and cognitive evaluations along with functional imagery. It brought to light some atypical features and advanced our clinical and pathophysiological understanding of the impact of ELOVL4 mutations. As discussed previously, it is mainly limited by the small sample size and the fact that all patients harboured the same mutation and originated from the same family. Moreover, certain specific tests were only performed in a small number of patients, including the skin biopsy, nerve conduction studies, and ophthalmologic evaluation. This was due to the complexity of these tests and limited availability of patients to participate in all the steps of the evaluation since many participants traveled from distant cities. Hence, some of the conclusions are based on a small number of observations, and it is possible that the proportion of patients with certain specific findings may vary as more patients are described. Nevertheless, these are expected limitations in the evaluation of a very rare disease, and this study still constitutes a significant step in the understanding of this disorder.

There remain important challenges to be addressed to improve diagnostic yield in the field of hereditary ataxias. There is an enduring need for more clinical and pathophysiological studies of patients with rare disorders to obtain a clear spectrum of the typical and atypical phenotypes. As

regards to the classification and organization of disorders, there may be a place for algorithms and artificial intelligence to assist clinicians in the diagnosis of difficult patients. Recently, Renaud et al. developed a diagnostic algorithm for recessive ataxias that ranked the correct molecular diagnosis within a top 3 likely diagnoses with >90% sensitivity for 84% of genetic entities and >90% specificity for 91% of genetic entities, outperforming a panel of ataxia experts (47). This performance was limited by significant overlap (74% of the validation cohort) in the patients included in the derivation and validation cohorts, which probably overestimated the algorithm accuracy. Moreover, this algorithm probably requires significant time to perform with 124 necessary clinical and paraclinical features, and it has not demonstrated pragmatic impact on management or final diagnostic yield. Nevertheless, it is possible that diagnostic algorithms and eventually artificial intelligence may become useful assistants to suggest possible diagnoses to guide clinicians in the ordering and interpretation of genetic tests. However, these diagnostic aids will still rely on the clinician’s assessment of the presence of neurologic and systemic signs that patients often cannot report themselves.

The other major advance that will likely contribute to improving diagnostic yields is the increased accessibility and technological improvements of next-generation sequencing techniques. Indeed, some of the major limitations of these tests are the difficulty to identify repeat expansion mutations and the incomplete coverage of certain parts of the genome (48). Novel techniques have been developed to increase detection of repeat expansion mutations (49), which should facilitate prescription of genetic testing in the future. It will still remain essential for clinicians to have a good knowledge and understanding of this group of disorders to interpret the results of such tests, which often identify variants of unknown significance that have to be correlated to the clinical and paraclinical data for adequate interpretation and counseling.

Ultimately, it appears essential to ensure better diffusion of knowledge to expert and non-expert clinicians because the basis of a diagnostic process is to raise the possibility of a specific disease category. To that end, options include web-based references that can be regularly updated, graphic classification systems or pocket summaries that can be kept at hand for everyday practice. Despite technologic advances, it remains the mainstay of physicians to evaluate a patient and navigate through the range of potential diagnoses in order to obtain a definitive diagnosis. For this task, clinicians are guided by the available evidence in the literature, which must be accurate and exhaustive regarding each specific diagnosis, but also classified and organized to promote understanding and usefulness.

Bibliographie

1. Blumenfeld H. Neuroanatomy through clinical cases. 2nd ed. Sunderland, Mass.: Sinauer Associates; 2010. xxiii, 1006 p. 2. Ashizawa T, Xia G. Ataxia. CONTINUUM: Lifelong Learning in Neurology. 2016;22(4):1208-26. 3. Ruano L, Melo C, Silva MC, Coutinho P. The global epidemiology of hereditary ataxia and spastic paraplegia: a systematic review of prevalence studies. Neuroepidemiology. 2014;42(3):174- 83. 4. Sanchez-Lopez CR, Perestelo-Perez L, Escobar A, Lopez-Bastida J, Serrano-Aguilar P. Health-related quality of life in patients with spinocerebellar ataxia. Neurologia. 2017;32(3):143-51. 5. Jacobi H, du Montcel ST, Bauer P, Giunti P, Cook A, Labrum R, et al. Long-term evolution of patient-reported outcome measures in spinocerebellar ataxias. J Neurol. 2018;265(9):2040-51. 6. Paulsen EK, Friedman LS, Myers LM, Lynch DR. Health-related quality of life in children with Friedreich ataxia. Pediatr Neurol. 2010;42(5):335-7. 7. Tai G, Yiu EM, Corben LA, Delatycki MB. A longitudinal study of the Friedreich Ataxia Impact Scale. J Neurol Sci. 2015;352(1-2):53-7. 8. Arias Merino G, Sánchez Díaz G, Villaverde-Hueso A, Posada de la Paz M, Alonso Ferreira V. Mortality statistics and their contribution to improving the knowledge of rare diseases epidemiology: the example of hereditary ataxia in Europe. In: Posada de la Paz M, Taruscio D, Groft SC, editors. Rare diseases epidemiology: update and overview. Cham: Springer International Publishing; 2017. p. 521-33. 9. Giunti P, Greenfield J, Stevenson AJ, Parkinson MH, Hartmann JL, Sandtmann R, et al. Impact of Friedreich's Ataxia on health-care resource utilization in the United Kingdom and Germany. Orphanet J Rare Dis. 2013;8:38. 10. Soong BW, Morrison PJ. Spinocerebellar ataxias. Handb Clin Neurol. 2018;155:143-74. 11. Erichsen AK, Koht J, Stray-Pedersen A, Abdelnoor M, Tallaksen CM. Prevalence of hereditary ataxia and spastic paraplegia in southeast Norway: a population-based study. Brain. 2009;132(Pt 6):1577-88. 12. Kraft S, Furtado S, Ranawaya R, Parboosingh J, Bleoo S, McElligott K, et al. Adult onset spinocerebellar ataxia in a Canadian movement disorders clinic. Can J Neurol Sci. 2005;32(4):450- 8. 13. Coutelier M, Hammer MB, Stevanin G, Monin ML, Davoine CS, Mochel F, et al. Efficacy of exome-targeted capture sequencing to detect mutations in known cerebellar ataxia genes. JAMA Neurol. 2018. 14. Klockgether T. Sporadic ataxia with adult onset: classification and diagnostic criteria. Lancet Neurol. 2010;9(1):94-104. 15. Zurynski Y, Deverell M, Dalkeith T, Johnson S, Christodoulou J, Leonard H, et al. Australian children living with rare diseases: experiences of diagnosis and perceived consequences of diagnostic delays. Orphanet J Rare Dis. 2017;12(1):68. 16. O'Brien MR, Whitehead B, Jack BA, Mitchell JD. From symptom onset to a diagnosis of amyotrophic lateral sclerosis/motor neuron disease (ALS/MND): experiences of people with ALS/MND and family carers - a qualitative study. Amyotroph Lateral Scler. 2011;12(2):97-104. 17. Johnston M, Earll L, Mitchell E, Morrison V, Wright S. Communicating the diagnosis of motor neurone disease. Palliat Med. 1996;10(1):23-34. 18. Durr A. Autosomal dominant cerebellar ataxias: polyglutamine expansions and beyond. Lancet Neurol. 2010;9(9):885-94. 19. Rossi M, Perez-Lloret S, Doldan L, Cerquetti D, Balej J, Millar Vernetti P, et al. Autosomal dominant cerebellar ataxias: a systematic review of clinical features. Eur J Neurol. 2014;21(4):607- 15.

20. Online Mendelian Inheritance in Man, OMIM®. McKusick-Nathans Institute of Genetic Medicine, Johns Hopkins University, Baltimore MD. http://omim.org/. Accessed 17 Jan 2019. 21. Fogel BL, Perlman S. Clinical features and molecular genetics of autosomal recessive cerebellar ataxias. Lancet Neurol. 2007;6(3):245-57. 22. Anheim M, Tranchant C, Koenig M. The autosomal recessive cerebellar ataxias. N Engl J Med. 2012;366(7):636-46. 23. Beaudin M, Dupré N. Autosomal Recessive Ataxias. In: Gruol DL, Koibuchi N, Manto M, Molinari M, Schmahmann JD, Shen Y, editors. Essentials of cerebellum and cerebellar disorders: a primer for graduate students. Cham: Springer International Publishing; 2016. p. 545-51. 24. Dupré N, Gros-Louis F, Chrestian N, Verreault S, Brunet D, de Verteuil D, et al. Clinical and genetic study of autosomal recessive cerebellar ataxia type 1. Annals of neurology. 2007;62(1):93-8. 25. Synofzik M, Smets K, Mallaret M, Di Bella D, Gallenmuller C, Baets J, et al. SYNE1 ataxia is a common recessive ataxia with major non-cerebellar features: a large multi-centre study. Brain. 2016;139(Pt 5):1378-93. 26. Eidhof I, Baets J, Kamsteeg EJ, Deconinck T, van Ninhuijs L, Martin JJ, et al. GDAP2 mutations implicate susceptibility to cellular stress in a new form of cerebellar ataxia. Brain. 2018;141(9):2592-604. 27. Seong E, Insolera R, Dulovic M, Kamsteeg EJ, Trinh J, Bruggemann N, et al. Mutations in VPS13D lead to a new recessive ataxia with spasticity and mitochondrial defects. Annals of neurology. 2018;83(6):1075-88. 28. Hoch NC, Hanzlikova H, Rulten SL, Tetreault M, Komulainen E, Ju L, et al. XRCC1 mutation is associated with PARP1 hyperactivation and cerebellar ataxia. Nature. 2017;541(7635):87-91. 29. Schols L, Rattay TW, Martus P, Meisner C, Baets J, Fischer I, et al. Hereditary spastic paraplegia type 5: natural history, biomarkers and a randomized controlled trial. Brain. 2017;140(12):3112-27. 30. Almeida MR, Macario MC, Ramos L, Baldeiras I, Ribeiro MH, Santana I. Portuguese family with the co-occurrence of frontotemporal lobar degeneration and neuronal ceroid lipofuscinosis phenotypes due to progranulin gene mutation. Neurobiol Aging. 2016;41:200 e1- e5. 31. Wiethoff S, Bettencourt C, Paudel R, Madon P, Liu YT, Hersheson J, et al. Pure cerebellar ataxia with homozygous mutations in the PNPLA6 gene. Cerebellum. 2017;16(1):262-7. 32. Lenz D, McClean P, Kansu A, Bonnen PE, Ranucci G, Thiel C, et al. SCYL1 variants cause a syndrome with low gamma-glutamyl-transferase cholestasis, acute liver failure, and neurodegeneration (CALFAN). Genet Med. 2018;20(10):1255-65. 33. Devgan SS, Sanal O, Doil C, Nakamura K, Nahas SA, Pettijohn K, et al. Homozygous deficiency of ubiquitin-ligase ring-finger protein RNF168 mimics the radiosensitivity syndrome of ataxia-telangiectasia. Cell Death Differ. 2011;18(9):1500-6. 34. Fogel BL. Autosomal-recessive cerebellar ataxias. Handb Clin Neurol. 2018;147:187-209. 35. Marras C, Lang A, van de Warrenburg BP, Sue CM, Tabrizi SJ, Bertram L, et al. Nomenclature of genetic movement disorders: Recommendations of the international Parkinson and movement disorder society task force. Mov Disord. 2016;31(4):436-57. 36. Cadieux-Dion M, Turcotte-Gauthier M, Noreau A, Martin C, Meloche C, Gravel M, et al. Expanding the clinical phenotype associated with ELOVL4 mutation: study of a large French- Canadian family with autosomal dominant spinocerebellar ataxia and erythrokeratodermia. JAMA Neurol. 2014;71(4):470-5. 37. Ozaki K, Doi H, Mitsui J, Sato N, Iikuni Y, Majima T, et al. A novel mutation in ELOVL4 leading to spinocerebellar ataxia (SCA) with the hot cross bun sign but lacking erythrokeratodermia: a broadened spectrum of SCA34. JAMA Neurol. 2015;72(7):797-805.

38. Bourassa CV, Raskin S, Serafini S, Teive HA, Dion PA, Rouleau GA. A new ELOVL4 mutation in a case of spinocerebellar ataxia with erythrokeratodermia. JAMA Neurol. 2015;72(8):942-3. 39. Bourque PR, Warman-Chardon J, Lelli DA, LaBerge L, Kirshen C, Bradshaw SH, et al. Novel ELOVL4 mutation associated with erythrokeratodermia and spinocerebellar ataxia (SCA 34). Neurol Genet. 2018;4(4):e263. 40. Schmahmann JD. Disorders of the cerebellum: ataxia, dysmetria of thought, and the cerebellar cognitive affective syndrome. J Neuropsychiatry Clin Neurosci. 2004;16(3):367-78. 41. Pedroso JL, Franca MC, Jr., Braga-Neto P, D'Abreu A, Saraiva-Pereira ML, Saute JA, et al. Nonmotor and extracerebellar features in Machado-Joseph disease: a review. Mov Disord. 2013;28(9):1200-8. 42. Braga-Neto P, Pedroso JL, Gadelha A, Laureano MR, de Souza Noto C, Garrido GJ, et al. Psychosis in Machado-Joseph disease: clinical correlates, pathophysiological discussion, and functional brain imaging. Expanding the cerebellar cognitive affective syndrome. Cerebellum. 2016;15(4):483-90. 43. Nieto A, Correia R, de Nobrega E, Monton F, Hess S, Barroso J. Cognition in Friedreich ataxia. Cerebellum. 2012;11(4):834-44. 44. Fancellu R, Paridi D, Tomasello C, Panzeri M, Castaldo A, Genitrini S, et al. Longitudinal study of cognitive and psychiatric functions in spinocerebellar ataxia types 1 and 2. J Neurol. 2013;260(12):3134-43. 45. Laforce R, Jr., Buteau JP, Bouchard JP, Rouleau GA, Bouchard RW, Dupré N. Cognitive impairment in ARCA-1, a newly discovered pure cerebellar ataxia syndrome. Cerebellum. 2010;9(3):443-53. 46. Logan S, Agbaga MP, Chan MD, Kabir N, Mandal NA, Brush RS, et al. Deciphering mutant ELOVL4 activity in autosomal-dominant Stargardt macular dystrophy. Proc Natl Acad Sci U S A. 2013;110(14):5446-51. 47. Renaud M, Tranchant C, Martin JVT, Mochel F, Synofzik M, van de Warrenburg B, et al. A recessive ataxia diagnosis algorithm for the next generation sequencing era. Annals of neurology. 2017;82(6):892-9. 48. Klein CJ, Foroud TM. Neurology individualized medicine: when to use next-generation sequencing panels. Mayo Clin Proc. 2017;92(2):292-305. 49. Bahlo M, Bennett MF, Degorski P, Tankard RM, Delatycki MB, Lockhart PJ. Recent advances in the detection of repeat expansions with short-read next-generation sequencing. F1000Res. 2018;7.