DOCSLIB.ORG

Early Life History and Stock Identity of Horse Mackerel Species

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Early Life History and Stock Identity of Horse Mackerel Species EARLY LIFE HISTORY AND STOCK IDENTITY OF HORSE MACKEREL SPECIES LMR-PEL-09-09 In Angola: in the past Largest fisheries landing in volume; it Trachurus trecae reached 40% of the total fish catches. Currently < 10% of total catch. High national demand In Namibia: ~ 60% of Trachurus capensis total catch Objecves ü Determine the stock identity of Cunene horse mackerel found in northern/central Angola and southern Angola; ü Determine the stock identity of Cape horse mackerel found in southern Angola and northern Namibia; ü Identification of the main spawning and nursery areas of the two species of horse mackerel; ü Recommend on appropriate management strategy for the northern Benguela horse mackerel stocks. Idenficaon of the main spawning and nursery areas of the two species of horse mackerel Ø Data types available: Ø Biological commercial sampling • High temporal coverage • Daily • Low spatial resolution • 3 ports Ø Survey data • Low temporal coverage • 1 month/year • High spatial resolution • Whole coast When do they spawn? -Spawning cycle- Sampling and fishing among regions -Luanda 80 70 60 50 40 2007 30 2008 2009 20 Proporon of spwaning females 10 0 Jan Feb Mar Apr May Jun Jul Aug Set Out Nov Dez Axis Title Proportion of macroscopic spawning stage 4 (Spawning) Benguela 60 50 40 Versus time 30 2007 2008 20 2009 10 0 Jan Feb Mar Apr May Jun Jul Agu Set Out Nov Dez Proporon of spawning stage Axis Title 1,2 Proportion of 1 Versus Fish size macroscopic spawning 0,8 stage 4 (Spawning) 0,6 2007 n=298 0,4 2008 n=273 0,2 2009- n=160 % Freq of Spawning females 0 23 26 29 32 35 38 41 Lt(cm) Spa:al distribu:on – Spawning Evoluon with me (Last 5 years) Cabinda Cabinda Cabinda Cabinda Cabinda 6 6 6 6 6 - - Rio Congo - Rio Congo Rio Congo - Rio Congo - Rio Congo NZeto NZeto NZeto NZeto NZeto Ambriz Ambriz Ambriz Ambriz Ambriz 8 8 8 8 8 - - - - - GIS 2011 Luanda Luanda Luanda Luanda GSI GIS GSI Luanda Pta. 2008 Pta. Pta. Pta. 2007 Palmerinhas Palmerinhas 2009 Palmerinhas GSI Palmerinhas Pta. 2010 Palmerinhas 7 0 0 0 0 7 0 1 1 7 1 1 1 - - - - - 6 6 6 7 Porto 7 Porto Porto Porto 5 Porto Amboim Amboim Amboim Amboim 5 5 6 6 Amboim Sumbe Sumbe Sumbe Sumbe 4 4 4 5 5 Sumbe 3 2 2 2 2 4 2 1 1 3 1 3 1 - - 4 1 - - Lobito - 2 Lobito Lobito 3 Lobito 2 Lobito 2 Benguela Benguela 3 Benguela Benguela 2 1 Benguela 1 1 2 1 0 0 0 S. Marta 1 0 S. Marta 4 S. Marta 4 4 4 S. Marta 4 1 1 1 S. Marta 1 - - - 1 - 0 - Namibe Namibe Namibe Namibe Namibe 6 6 Tombwa Tombwa 6 Tombwa 6 Tombwa 6 1 1 1 Tombwa 1 - - - 1 - - Baia dos Tigres Baia dos Tigres Baia dos Tigres Baia dos Tigres Baia dos Tigres Rio Cunene Rio Cunene Rio Cunene Rio Cunene Rio Cunene 8 8 8 8 8 1 1 1 - - 1 - 1 - 10 12 14 10 12 14 10 12 14 - 10 12 14 10 12 14 Distribuon of recruits In trawl samples Spawning and recruitment seem to be concentrated in a few areas Does this mean they are different populaons? Stock iden:ty of horse mackerel in northern BCLME region ü A total of 63 individuals from the whole T. trecae distribution and 82 of T. capensis were used for DNA isolation, purification and sequencing; ü The total DNA isolation and was performed using kit GE (GE Healthcare, Brazil); ü Cytochrome b from mitochondrial DNA was amplified using the primers: L-14841 5’AAAAAGCTTCCATCCAACATCTCAGCATGATGAAA 3’ H-15149 3’AAACTGCAGCCCCTCAGAATGATATTTGTCCTCA 3’ Molecular Methodologies ü Genetic variability was estimated using the following parameters: Nucleotide and haplotype diversities using DnaSP package. ü Inter population variability was in silico evaluated using AMOVA implemented by Arlenquin version 3.5.1.2. Results: Trachurus trecae Genetic Variability Characterisc North Center South Total The observed values of Sequence 25 22 16 63 diversity nucleotide are Number bellow of variation reviewed for marine fish Total sites 350 350 350 that varies 0,8-3,20%. Total number 10 12 9 22 of nutaon Diversity 0,00448 0,00549 0,00557 0,00501 nucleode (±SD) (±0,001) (±0,0010) (±0,001) (±0,009) Diversity haplotype for Number of 10 10 8 23 northern and central haplotype region are bellow of the Diversity 0,690 0,662 0,800 0,707 variation demonstrated haplotype (±SD) (±0,102) (±0,116) (±0,0920 (±0,065) for marine fish (h=0,7-1,0). For the southern region is D Tajima -1.70678* -1.82659* -1.50615 NS 2,16013* within the variation. *significative values (p<0,05); NS no significative value(p>0,05) Results: Trachurus trecae Genetic Variability ü According to the classification Grant e Bowen, 1998 Trachurus trecae seems to be a population with high diversity haplotypes and low diversity nucleotide is characteristic for population over exploited. For stable population both diversity haplotypes and nucleotide are high. ü The effective number of inbreeding females (Nef) calculated from the ΘS indicates 371.000 female. The effective population size is always considerably smaller than census size. Frequency of haplotype of Cytochrome b Trachurus trecae haplotype N North (%) Center (%) South(%) Hap_1 34 41 38 21 Hap_2 1 100 0 0 Hap_3 4 25 0 75 ü Only the haplotype number one Hap_4 1 100 0 0 is present in the three Hap_5 2 100 0 0 populations; Hap_6 3 66 34 0 Hap_7 1 100 0 0 ü Haplotype 3 is present in the Hap_8 1 100 0 0 north and south population; Hap_9 2 50 50 0 Hap_10 1 100 0 0 Hap_11 1 0 100 0 ü haplotype 6 and 9 are present in Hap_12 1 0 100 0 the north e center; Hap_13 1 0 100 0 Hap_14 1 0 100 0 ü The presence of several unique Hap_15 1 0 100 0 haplotype can be an indication Hap_16 1 0 100 0 that the abundance of Hap_17 1 0 100 0 population is fluctuating leading Hap_18 1 0 0 100 Hap_19 1 0 0 100 probably the accumulation of Hap_20 1 0 0 100 new mutation. Hap_21 1 0 0 100 Hap_22 1 0 0 100 Hap_23 1 0 0 100 Genec structure of populaons Trachurus trecae Source variaon Variance % Φ P- componen variance Stascs value ts ü High genetic variability is found Inter- 0.00069 0.10 0.00096 >0,05 within each population; populaons ü No genetic differentiation is Intra- 0.71613 99.90 >0,05 found between population. populaon The lack of genetic differentiation can be attributed to high level of genetic flow characteristic for species with high capacity of dispersion as horse mackerel. Results: Trachurus capensis Genetic Variability Characterisc Angola Namíbia Total Sequence Number 29 53 82 Total sites 350 350 350 Total number of 14 23 30 nutaon Diversity 0,00872 0,00838 0,00067 nucleode Number of 8 21 27 haplotype Diversity 0,8867 0,96807 0,94640 haplotype D Tajima -1,27328 * 1,33640 * 1,9906 * The observed values ​​of haplotype and nucleotide diversity are within the variation demonstrated in reviews of the mitochondrial DNA of marine teleost fish (h=0,7-1,0 and π = 0.8 to 3.20%). Frequency of haplotype of Cytochrome b 3 haplotype N Angola Namibia Trachurus capensis Hap_1 19 52 48 Hap_2 38 63 37 Hap_3 1 100 0 Hap_4 1 100 0 Hap_5 1 100 0 Hap_6 1 100 0 Hap_7 1 100 0 Hap_8 1 100 0 Hap_9 1 100 0 ü Only two haplotypes are present in the two Hap_10 1 100 0 populations the others are unique to each Hap_11 1 100 0 the population; Hap_12 1 100 0 Hap_13 1 0 100 ü The presence of several unique haplotype Hap_14 1 0 100 Hap_15 1 0 100 can be an indication that the abundance of Hap_16 1 0 100 population is fluctuating leading probably the Hap_17 1 0 100 accumulation of new mutations. Hap_18 1 0 100 Hap_19 1 100 0 Hap_20 1 100 0 Hap_21 1 100 0 Hap_22 1 100 0 Hap_23 1 100 0 Hap_24 1 100 0 Hap_25 1 100 0 Hap_26 1 100 0 Hap_27 1 100 0 Genec structure of populaons Trachurus capensis Source variaon Variance % Φ P-value components variance Stascs Inter-populaons -0,00246 -0,67 -0,0067 >0,05 Intra- populaons 0,36955 100,67 >0,05 ü A large genetic variation is found within each population, in this case, Angola and Namibia ; ü No genetic differentiation was found among populations. Final Remarks ü According to Sardinha and Naeval (2002) studies with using isozymes was suggested the existence of two genetic groups on the Angola coast, one in tropical waters and another group in the south. However, the present study based on a different molecular marker did not show genetic differentiation among populations of T. trecae; ü The genetic variability is within the range for fish marine species, there was no signal for decrease due to fisheries activity , at least using the Cytochrome b; ü For T. capensis, the analysis showed no difference among populations caught in Angola and Namibia, suggesting that no oceanographic barriers exist that prevent gene flow between stocks captured in Angola and Namibia; ü Due to the economic importance of T. tracea and T. capensis for fisheries along the Angola and Namibia coast, it is pivotal to develop other more polymorphic molecular markers, such as Microsatellites, specific for the species to further genetic monitoring of Trachurus populations for their sustainable use.
Load more

Recommended publications
  • Angola 3727 R4 HR
    K Brazzaville asa CONGO i Kinshasa ANGOLA A D IN re B i Kikwit A a DEMOCRATIC C Z K K w REPUBLIC w i Cabinda a l OF THE u n g e o CONGO ng Nóqui oa K L Soyo M'banza Congo w e ZAIREZAIRE e Quimbele n ANGOLA dg Damba C W g K ri e b u a a M s a m a UÍGEUÍGE n L i Bembe g b o a u N'zeto Bungo a n e g Dundo og u L Uíge e a Negage p Ambriz a U Cuilo c Andrada i a de Marimba m h an Camabatela C Caxito D b Lucapa L LUNDA o LUNDA u KUANZAKUANZA Luremo a c b s O a s Luanda m NORTE NORTE l NORTE O NORTE a a a Cuango L G N'dalatando C C u G Quela Lubalo l LUANDA N u N Malanje o a Lucala l E Dondo i E u Saurimo Cabo Ledo uanza Cangandala Xá-Muteba B C C M DEMOCRATIC Cabo de São Bráz ALA LUNDALUNDA L KUANZAKUANZA L N REPUBLIC on ua J Cacolo SUL ga n E SUL OF THE Mussende do Quibala Quirima Muconda Porto Amboim SUL u CONGO SUL o a t Lu Gabela a ATLANTIC t Quimbango sai Cuvo ou Uaco u lo s Q du a Sumbe C n C u Cungo A vo OCEAN u Bimbe Nharea Lumeje Cassongue e Camacupa Luena ez HUAMBO Chicala b Cazombo Balombo Luatamba m Lobito Cuemba a Lucusse Z Benguela BENGUELA Huambo Kuito L o ung ng Lumbala Ponta das Salinas ué-Bu C Cubal op or olo Ganda Cuima Sambo BIÉ L Cabo de MOXICO un Santa Maria gw Zambezi C e bu Chitembo C u n Cabo de Caconda u a g i n u Santa Marta t Lumbala Quilengues o Q d u o N'guimbo Cubango e NAMIBE Menongue m HUÍLAHUÍLA Cuchi b o Bibala Matala C u b Lubango Techamutete a Chiume e n Chibia n g Cuíto ZAMBIA Namibe e o n Cuanavale u Virei Chiange C Cuvelai Mavinga Tombua KUANDO-KUBANGO U Curoc KUANDO-KUBANGO te a CUNENECUNENE m Cahama bo Savate Z Xangongo C am u b n i e ne Ondjiva to z u i C Chitado Santa Clara Cuangar Luiana Cubango NAMIBIA Mucusso National capital International boundary Provincial capital Provincial boundary BOTSWANA Town, village Road 0 50 100 150 200 km The boundaries and names shown and the Airport Track designations used on this map do not imply official endorsement or acceptance by the Railroad 0 50 100 150 mi United Nations.
    [Show full text]
  • Project Brown Field Ambriz Yard
    CSR Field Trip – Angola, November 2014 PROJECT BROWN FIELD AMBRIZ YARD ZONE D’IMAGE Denis Pascal PBF HSE Manager CSR Field Trip – Angola, November 2014 1 “Projectos Brown Field” in a nutshell An innovative project organization • PBF team set up in 2012 within Total E&P Angola • Objective to increase recovery rates on Block 17 – Optimizing existing installations – Developing satellite fields • Enhancing synergies and consistency • In charge of Girassol Resources Initiative (GirRI), Dalia Infills, Dalia Debottlenecking, Pazflor Infills and Zinia Phase 2 An approach prioritizing local content • Team based in Angola from start-up to ensure skills and knowledge transfer • Local companies used for basic engineering studies – More than 100,000 hours commissioned • Local fabrication by Petromar yard in Ambriz Maximizing production through high-tech local content CSR Field Trip – Angola, November 2014 2 Block 17 PBF, a high technology project GirRI Rosa MPP Dalia phase 1A Acacia infills 42 Mb 52 Mb 17 Mb 20 kb/d plateau 24 kb/d plateau 12 kb/d peak • 2 high boost multiphase • 3 producers and 1 injector pump modules • 7 producer well systems well systems • Multiphase pump module • 3 flowbases • 2 satellite manifolds integration on Girassol • Dalia FPSO subsea control • Configuration of Pazflor • Power interconnection system upgrade FPSO control system between Girassol and Dalia CSR Field Trip – Angola, November 2014 3 GirRi Rosa MPP, a show-case for local content Local content in GirRI Rosa MPP project Inside contracts, end of project forecast Local
    [Show full text]
  • Nocturnal Feeding of Pacific Hake and Jack Mackerel Off the Mouth of the Columbia River, 1998-2004: Implications for Juvenile Salmon Predation Robert L
    This article was downloaded by: [Oregon State University] On: 16 August 2011, At: 13:01 Publisher: Taylor & Francis Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer House, 37-41 Mortimer Street, London W1T 3JH, UK Transactions of the American Fisheries Society Publication details, including instructions for authors and subscription information: http://www.tandfonline.com/loi/utaf20 Nocturnal Feeding of Pacific Hake and Jack Mackerel off the Mouth of the Columbia River, 1998-2004: Implications for Juvenile Salmon Predation Robert L. Emmett a & Gregory K. Krutzikowsky b a Northwest Fisheries Science Center, NOAA Fisheries, 2030 South Marine Science Drive, Newport, Oregon, 97365, USA b Cooperative Institute of Marine Resource Studies, Oregon State University, 2030 South Marine Science Drive, Newport, Oregon, 97365, USA Available online: 09 Jan 2011 To cite this article: Robert L. Emmett & Gregory K. Krutzikowsky (2008): Nocturnal Feeding of Pacific Hake and Jack Mackerel off the Mouth of the Columbia River, 1998-2004: Implications for Juvenile Salmon Predation, Transactions of the American Fisheries Society, 137:3, 657-676 To link to this article: http://dx.doi.org/10.1577/T06-058.1 PLEASE SCROLL DOWN FOR ARTICLE Full terms and conditions of use: http://www.tandfonline.com/page/terms-and- conditions This article may be used for research, teaching and private study purposes. Any substantial or systematic reproduction, re-distribution, re-selling, loan, sub-licensing, systematic supply or distribution in any form to anyone is expressly forbidden. The publisher does not give any warranty express or implied or make any representation that the contents will be complete or accurate or up to date.
    [Show full text]
  • Simulations of Fishing Effects on the Southern Benguela Fish Community Using an Individual-Based Model: Learning from a Comparison with Ecosim
    Ecosystem Approaches to Fisheries in the Southern Benguela Afr. J. mar. Sci. 26: 95–114 2004 95 SIMULATIONS OF FISHING EFFECTS ON THE SOUTHERN BENGUELA FISH COMMUNITY USING AN INDIVIDUAL-BASED MODEL: LEARNING FROM A COMPARISON WITH ECOSIM Y-J. SHIN*, L. J. SHANNON† and P. M. CURY* By applying an individual-based model (OSMOSE) to the southern Benguela ecosystem, a multispecies analysis is proposed, complementary to that provided by the application of ECOPATH/ECOSIM models. To reconstruct marine foodwebs, OSMOSE is based on the hypothesis that predation is a size-structured process. In all, 12 fish species, chosen for their importance in terms of biomass and catches, are explicitly modelled. Growth, repro- duction and mortality parameters are required to model their dynamics and trophic interactions. Maps of mean spatial distribution of the species are compiled from published literature. Taking into account the spatial component is necessary because spatial co-occurrence determines potential interactions between predatory fish and prey fish of suitable size. To explore ecosystem effects of fishing, different fishing scenarios, previously examined using ECOSIM, are simulated using the OSMOSE model. They explore the effects of targeting fish species in the southern Benguela considered to be predators (Cape hake Merluccius capensis and M. paradoxus) or prey (anchovy Engraulis encrasicolus, sardine Sardinops sagax, round herring Etrumeus whiteheadi). Simulation results are compared and are generally consistent with those obtained using an ECOSIM model. This cross-validation appears to be a promising means of evaluating the robustness of model outputs, when separate validation of marine ecosystem models are still difficult to perform.
    [Show full text]
  • Superintendência De Organização E Atendimento Educacional PROCESSO N
    20 – sexta-feira, 21 de Março de 2014 diário do exeCutivo Minas Gerais - Caderno 1 RESPLENDOR PARECER SEE N . 88/2014 À vista do exposto, somos por que esta Secretaria de Estado de Educa- O número e a data de publicação deste parecer deverão constar da docu- 44890 – E .E . Comendador Nascimento Nunes Leal PROCESSO N . 00011575 .1561 .2014 ção considere equivalentes à conclusão do ensino médio brasileiro os mentação escolar da interessada . MASP 803329-2, Gleisson Vilela de Souza, PEBIA - admissão 1, a con- Examina pedido de equivalência dos estudos realizados no exterior estudos realizados por Antônio Pedro Sebastião Gavião Neto, na Escola Belo Horizonte, 20 de fevereiro de 2014 . tar da publicação . porKATHLEEN CARVALHO PORTES . do II Ciclo de Ensino Secundário nº 1097 ex - 3030 - Ingombota, em VALDÊMIA BARBOSA DE A . MOREIRA DESIGNAÇÃO DIRETOR - ATO Nº 738/2014 CONCLUSÃO: Luanda, Angola, para fins de prosseguimento de estudos. Diretora da Diretoria de Funcionamento e Regularidade da Escola A Secretária de Estado de Educação, no uso da competência que lhe À vista do exposto, somos por que esta Secretaria de Estado de Edu- O número e a data de publicação deste parecer deverão constar da docu- atribui o inciso VI do artigo 93, da Constituição do Estado, o artigo 28 cação considere equivalentes à conclusão do ensino médio brasileiro mentação escolar do interessado . PARECER SEE N . 110/2014 do Decreto nº 33 .336, de 23 de janeiro de 1992 e considerando a Reso- os exames GED (Testes de Desenvolvimento Educacional Geral) reali- Belo Horizonte, 17 de fevereiro de 2014 . PROCESSO N .
    [Show full text]
  • Statoil-Environment Impact Study for Block 39
    Technical Sheet Title: Environmental Impact Study for the Block 39 Exploratory Drilling Project. Client: Statoil Angola Block 39 AS Belas Business Park, Edifício Luanda 3º e 4º andar, Talatona, Belas Telefone: +244-222 640900; Fax: +244-222 640939. E-mail: [email protected] www.statoil.com Contractor: Holísticos, Lda. – Serviços, Estudos & Consultoria Rua 60, Casa 559, Urbanização Harmonia, Benfica, Luanda Telefone: +244-222 006938; Fax: +244-222 006435. E-mail: [email protected] www.holisticos.co.ao Date: August 2013 Environmental Impact Study for the Block 39 Exploratory Drilling Project TABLE OF CONTENTS 1. INTRODUCTION ............................................................................................................... 1-1 1.1. BACKGROUND ............................................................................................................................. 1-1 1.2. PROJECT SITE .............................................................................................................................. 1-4 1.3. PURPOSE AND SCOPE OF THE EIS .................................................................................................... 1-5 1.4. AREAS OF INFLUENCE .................................................................................................................... 1-6 1.4.1. Directly Affected area ...................................................................................................... 1-7 1.4.2. Area of direct influence ..................................................................................................
    [Show full text]
  • Status of the South African and Namibian Horse Mackerel
    Oceana Sustainability Report 2019 Status and Management of Horse mackerel in South Africa and Namibia, 2019 Capricorn Marine Environmental (Pty) Ltd David Japp, Daniel Droste and Zonke Gumede South Africa Biology and Stock Dynamics Horse mackerel (Trachurus capensis), better known as ‘maasbanker’ in the Western Cape, are similar to other Trachurus species caught globally in many other parts of the world. They are also classified as carangids which typically are game fish and fast swimmers (such as the kingfish commonly caught in the warmer waters of the South African east coast). Maasbanker, however, differ somewhat in that they are primarily filter feeders, although they do have a fairly broad diet that includes plankton and small swimming crustaceans (such as krill) and small fish and squid. What makes them a good commercial species is their shoaling behaviour, with large aggregations occurring in areas where plankton is abundant. Such is the case with the South African fishery, particularly on the east coast around the Agulhas Bank where adult maasbanker shoal and are targeted by the mid-water trawl fishery. Maasbanker are difficult to catch, as they are strong swimmers and migrate up and down in the water column and occur from the shallowest waters out to the deep waters of the continental shelf. In South Africa, the fisheries for massbanker can be broadly separated between three fishery sectors – a fishery using midwater trawls, a second using bottom trawls (typically for hake) and a third fishery targeting juvenile maasbanker using purse seine gear such as that used for sardine and anchovy. These variations, combined with the behaviour of maasbanker, require specific management interventions to ensure that the fishery remains sustainable into the future.
    [Show full text]
  • Yellow Fever Outbreak in Angola, 01 September 2016
    YELLOW FEVER OUTBREAK WEEKLY SITUATION REPORT, INCIDENT MANAGEMENT TEAM—ANGOLA YELLOW FEVER OUTBREAK IN ANGOLA INCIDENT MANAGEMENT Vol: 8-03 SITUATION REPORT W35, 01 September 2016 I. Key Highlights A total of 2,807,628 (94 %) individuals 6 months and above have been vaccinated in the 22 most recently vaccinated districts as of 01 September 2016, 15 districts out of 22 achieved 90% or more of vaccination coverage. 4 districts achieved between 80-90%. Three districts did not reach 80% coverage and the vaccination campaign was extended there for another one week : Dirico, Namacunde and Sumbe in Currently the IM System is supporting the Ministry of Health in the preparation of the upcoming campaign in 21 districts in 12 provinces. The total population targeted in this new phase is 3,189,392 and requires 3,986,019 doses of vaccines. Is expected the arrival of 1.98 M doses from the last request approved by ICG. The ICG did not communicate yet the date of shipment but is already on process. The preparation of the coverage survey is ongoing. Table 1: National Summary of Yellow Fever Outbreak II. Epidemiological Situation as of 01 September 2016 Yellow Fever Outbreak Summary 26 Aug — 01 Sep 2016, (W35) Reported cases 24 Samples tested 24 Week 35 statistics (26 August to 1 September 2016): Confirmed cases 0 Of 24 suspected cases reported, all of them were tested by the National Total Deaths 1 Laboratory. None of them was positive for yellow fever Total provinces that reported cases 8 One(1) death was reported among the suspected cases during this period.
    [Show full text]
  • Acdsee Print
    COMO PODEM AS COMUNIDADES COSTEIRAS ENVOLVER-SE E BENEFICIAR DO PROGRAMA BCLME : UMA ANÁLISE I. RELATÓRIO DA VISITA A ANGOLA Fevereiro 2004 Como Podem as Comunidades Costeiras Envolver-se e Beneficiar do Programa BCLME: Uma Análise I. Relatório da Visita a Angola i O Programa do Grande Ecossistema Marinho da Corrente de Benguela (BCLME) visa a gestão deste ecossistema único de afloramento costeiro que acompanha as costas de Angola, Namíbia e África do Sul. Financiado pelo portfólio de Águas Internacionais do Fundo para o Ambiente Mundial (GEF), o Programa é implementado pelo Programa das Nações Unidas para o Desenvolvimento (PNUD), sendo o Gabinete das Nações Unidas para os Serviços de Apoio aos Projectos (UNOPS) a agência executora. Os três países membros asseguram financiamento adicional através de contribuições em espécie. Ao longo dos 4 000 km de costa vivem comunidades que dependem, a diferentes níveis, dos recursos naturais deste ecossistema, desempenhando um papel importante na gestão e saúde dos recursos costeiros. Ainda que o envolvimento das comunidades costeiras não seja o foco principal do Programa, é cada vez mais aceite que as actividades ao nível comunitário podem contribuir significativamente para o sucesso global do Programa, ao mesmo tempo que criam oportunidades para desenvolvimento comunitário. Foi neste contexto que a EcoAfrica Environmental Consultants realizou um estudo de ‘primeira paroximação’ para analisar como as comunidades costeiras podem contribuir para a gestão do BCLME e posicionar-se de modo a obter o máximo proveito dos recursos costeiros, bem como para recomendar qual o papel que o Programa BCLME pode desempenhar para atingir este objectivo.
    [Show full text]
  • Angola - Remote Monitoring Report: Wed, 2014-04-16
    4/17/2014 Angola - Remote Monitoring Report: Wed, 2014-04-16 Published on Famine Early Warning Systems Network (http://www.fews.net) Southern Africa Angola This country is monitored by FEWS NET staff in a neighboring country Remote Monitoring Report Continued dryness could worsen the food security situation in Benguela and Kwanza Sul April 2014 Key Messages: After a late start of the seasonal rains in Benguela and Kwanza-Sul Provinces, irregular rainfall and dryness has been experienced in these areas throughout much of the season. According to the local cabinet for food security (GSA), this will be the fourth consecutive year of abnormal http://www.fews.net/print/southern-africa/angola/remote-monitoring-report/wed-2014-04-16 1/4 4/17/2014 Angola - Remote Monitoring Report: Wed, 2014-04-16 rainfall patterns in these areas. This dryness has resulted in lower river levels and the drying up of small rivers, which might negatively impact Nacas or flood recession cultivation in these provinces. Even though government food assistance is being provided to households in Cunene and Namibe Provinces, the assistance has not improved household food security outcomes in the targeted areas due to the inefficiency of the distribution system. In parts of Benguela and Kwanza-Sul cropping is no longer viable due to dryness and poor households continue to abandon their small plots and migrate into the cities. Stressed (IPC Phase 2) acute food insecurity outcomes are expected to persist in all four areas through September. SEASONAL CALENDAR FOR A TYPICAL YEAR Source: FEWS NET Zone current anomalies projected anomalies The cumulative effect of 2 The area of food crops planted in consecutive droughts and the current Southern Cunene and Namibe is significantly rainfall deficits might continue to livestock, lower this season and there is erode the ability of local pastoralists Millet and reduced availability of staple foods in to produce milk, meat, and cereals sorghum the homestead areas that in order to sustain their livelihoods Pastoralists migrated from.
    [Show full text]
  • Payment Systems in Angola
    THE PAYMENT SYSTEM IN ANGOLA Table of Contents OVERVIEW OF THE NATIONAL PAYMENT SYSTEM IN ANGOLA ............................... 5 1. INSTITUTIONAL ASPECTS .............................................................................................. 5 1.1 General legal aspects ................................................................................................... 5 1.2 Roles of financial intermediaries that provide payment services ........................... 6 1.3 Roles of the central bank ............................................................................................ 6 1.4 Roles of other private sector and public sector bodies ............................................ 7 2. SUMMARY INFORMATION ON PAYMENT MEDIA USED BY NON-BANKS ....... 7 2.1 Cash payments ............................................................................................................ 7 2.2 Non-cash payments ..................................................................................................... 8 2.2.1 Cheques ............................................................................................................... 8 2.2.2 Credit transfer orders ......................................................................................... 8 2.2.3 Standing/stop order drafts .................................................................................. 8 2.2.4 Other documents to be cleared ........................................................................... 8 2.2.5 Other transfer documents ..................................................................................
    [Show full text]
  • Angola Fisheries Sector Support Project
    GENERAL PROCUREMENT NOTICE Republic of Angola Fisheries Sector Support Project 1. The Republic of Angola has received a loan from the African Development Fund to finance the Fisheries Sector Support Project. 2. The principal objectives of this project are to support sustainable exploitation of maritime artisanal fishery; to create infrastructure for fish landings and conservation; improve the fish distribution chain for frozen, salted and dried fish; and, improve the fish quality assurance and inspection system in line with the overall sector objectives formulated by the Government of Angola. The purpose of the project is to increase the income of artisanal fishing communities through investments in fishery infrastructure and its management (including marine resources and safety at sea). Civil works for the construction and rehabilitation of landing sites in Gilco, Egipto Praia, Salinas- Sumbe and Yembe and civil works for the construction of Yembe and Egipto Praia roads will be carried out under International Competitive Bidding (ICB). Equipment and goods for Gilco, Egipto Praia, Salinas-Sumbe and Yembe as well as essential equipment for Damba Maria and Ambriz shall be procured through ICB. Technical Assistance for hazard analysis and critical control points, TA for training of trainers, design and supervision services for construction works will be acquired using Quality and Cost Based Selection (QCBS) method. 3. The project includes the following components: (A) Fishery Monitoring, Control and Management; (B) Fishery Infrastructure Development; and, (C) Project Management. 4. Procurement of goods and/or works will be in accordance with the Bank's Rules of Procedure for the Procurement of Goods and Works, May 2008 edition and as amended from time to time.
    [Show full text]