DNMT3L) and Transmission Through the Murine Male and Female Germlines

The Effects of Overexpression of DNA Methyltransferase 3-like (DNMT3L) and Transmission Through the Murine Male and Female Germlines

A thesis submitted to McGill University in partial fulfillment of the requirements of the degree of Master of Science

Department of Human Genetics at McGill University Montreal, Quebec, Canada

July 2014

TABLE OF CONTENTS

Table of Contents 2 Abstract 6 Résumé 7 List of Figures 9 List of Tables 10 List of Abbreviations 11 Acknowledgements 13 Contribution of Authors 17 Introduction 18 o Epigenetics 18  DNA methylation 18 o Biochemistry 18 o Genomic distribution of CpGs 19 o CpG islands 19 o Non-CpG methylation 20 o Role of DNA methylation in transcriptional regulation 20 o Genomic imprinting 21 o X-inactivation 21 o Disorders linked to abnormal methylation 22 o DNA methylating enzymes 22 o DNMT1 22 o DNMT2 23 o DNMT3 23 o DNMT3L 24 o Interaction between DNMT3L and DNMT3a2 24  Developmental dynamics of DNA methylation 25 o Disorders due to Dnmt deficiency 25 o DNA methylation dynamics in embryogenesis 25

o Spermatogenesis 26 o DNA methylation in male gametogenesis 28 o DNA methylation analysis using RRBS 30 o Recent DNA methylation studies using bisulfite sequencing 31 o Dnmt3L in male gametogenesis 31 o Studies of germline modulation of Dnmt3L expression 32 Project Outline 34 Materials and Methods 37  Mice 37  Characterization of transgene transmission to F1, F2 and F3 37 o Determination of transgene copy number 37 o Propagation of transgene from founder (F0) to F1, F2, and F3 37 o Measurement of reproductive organ weights 38 o Sperm collection 38 o Assessment of the quality of seminiferous tubules 38 o Sperm counts 38 o Assessment of transgene expression in testis cross-sections by fluorescence microscopy 39  Sperm DNA methylation analysis using RRBS 39 o RRBS library preparation 39 o RRBS library sequencing and methylation data analysis 40  Dnmt3L (-/-) infertility rescue experiment using the EF1α-Dnmt3L transgene 40 o Generation of EF1α-Dnmt3L transgenic, Dnmt3L (-/-) males and females 40  Statistical Analysis 41 Results 42  Outcomes of Dnmt3L transgene overexpression, transmission through the male germline 42 o Matings produced F1, F2 and F3 animals in male germline transgene transmission study 42 o Transgene expression in male germ cells localized near basal lamina of

seminiferous tubules 42 o Rates of male germline transgene transmission to F1 and F2 were mostly normal in all lineages 42 o Significant decrease in average litter size from F1 to F2 in high copy lineage 43 o No difference in reproductive organ weights between transgenic and non- transgenic males 43 o No difference in sperm counts between F2 transgenic and non-transgenic males 44 o Decline in quality of seminiferous tubules in testis cross-sections of F1 males 44 o Decline in quality of seminiferous tubules in testes of high-copy transgenics from F1 to F2 45  Genome-wide DNA methylation analysis of transgenic, non-transgenic sperm in F1 and F2 45 o DNA methylation levels similar overall among transgenic, non-transgenic and control samples 45 o Predominance of differently methylated tiles found in intergenic, intronic, and exonic regions 46 o Methylation in DMRs found in exons higher in transgenics vs controls, and F2 vs F1 transgenics 46 o Methylation in DMRs in exons up in F2 non-transgenics vs controls, F2 vs F1 non-transgenics 47  Attempt to rescue infertility and methylation abnormalities in Dnmt3L deficient males 47 o Generation of TG+, Dnmt3L (-/-) and TG-, Dnmt3L (-/-) males for infertility rescue 47 o Infertility in low copy control males 48 o Lack of fertility rescue in TG+, Dnmt3L(-/-) males from the low copy lineage 48

o Infertility in high copy control males 48 o Lack of fertility rescue in TG+, Dnmt3L (-/-) females from low and high copy lineages 49 o No difference in paired testes weights of TG+, Dnmt3L (-/-) and TG-, Dnmt3L (-/-) males 49  Characterization of the transgene model upon transmission through female germline 50 o Low rate of transgene transmission from female founders to F1 in most lineages 50 o Trend to decrease in average litter size between birth and weaning age 50 Discussion 51  Reproductive effects of EF1α-Dnmt3L transgene transmission through the male germline 51  On the discrepancy between the apparent effect of Dnmt3L overexpression on testicular histology, and the lack of effect on organ weights and sperm counts 53  Effects of EF1α-Dnmt3L transgene overexpression on mature sperm DNA methylation 56  Attempt to correct infertility in Dnmt3L (-/-) males using the EF1α-Dnmt3L transgene 61  Comparison of outcomes upon EF1α-Dnmt3L transgene transmission through male and female germlines 63 References 65 Figures 81 Tables 103

ABSTRACT

The DNA methyltransferase 3-like (DNMT3L) enzyme is critical to proper de novo DNA methylation acquisition in germ cells and to gametogenesis. In mice, Dnmt3L deficiency or haploinsufficiency leads to reproductive abnormalities and germ cell methylation defects. Dnmt3L heterozygous males sire offspring with an increased incidence of aneuploidy, and Dnmt3L-deficient males and females are both infertile. These abnormal reproductive outcomes correlate with hypomethylation in germ cells of these animals. In terms of DNMT3L dosage then, it is known that lack/reduction of this enzyme in germ cells leads to DNA methylation and phenotypic defects. The reproductive effects of increased DNMT3L dosage are not known, however. Therefore we evaluated the outcome of Dnmt3L overexpression in male and female mouse germ cells, using an EF1α-Dnmt3L transgene previously created in our lab, and the effect of propagating the transgene through the male and female germlines for successive generations. In the female germline transmission experiment, 28.8% of all F1 pups died between birth and weaning, and the rate of transgene transmission to surviving pups was only 22.3%. The low number of transgenic pups in F1 led to termination of 5 of the 7 lineages in F1, and the 2 remaining lineages were terminated in F2. In the male germline transmission experiment, males from the lineage with the highest number of transgene copies displayed a significant decrease in average litter size at weaning from F1 to F2. Transgenic males from this lineage showed significantly more abnormal seminiferous tubules in their testis cross sections than controls, and a significant increase in abnormal tubules from F1 to F2. These findings prompted us to examine the DNA methylation patterns in the sperm of these males, using a genome-wide, sequencing method called reduced representation bisulfite sequencing (RRBS). RRBS analysis revealed that, overall, DNA methylation patterns in transgenic sperm were not different from non-transgenic or control sperm. However, some differentially methylated regions (DMRs) between transgenic and control sperm were found. DMRs located in exons were hypermethylated in transgenic versus control sperm, and hypermethylated in F2 vs F1 transgenic sperm. It therefore appears that transgenic overexpression of Dnmt3L in our model leads to subtle reproductive and sperm DNA methylation defects. Although preliminary, it is possible that the worsening of these defects from F1 to F2 is due to transgenerational epigenetic inheritance.

RÉSUMÉ

L’enzyme ADN méthyltransférase 3-like (DNMT3L) est essentiel durant l’établissement initial de la méthylation de l’ADN dans les cellules germinales mâles et femelles, ainsi que dans le développement de ces dernières. Chez la souris, une déficience de cet enzyme mène à des troubles au niveau de la reproduction, ainsi qu’à des défaults de méthylation d’ADN dans la lignée germinale. La progéniture de mâles hétérozygotes démontre un taux plus élevé d’aneuploïdies, et les mâles et femelles homozygotes mutants sont infertiles. Ces anomalies reproductives sont liées à une hypométhylation de l’ADN dans la lignée germinale de ces animaux. Donc, en terme de dose de DNMT3L, nous savons qu’une réduction donne lieu à des défauts de méthylation d’ADN ainsi qu’à certains phénotypes. Par contre, nous ne connaissons pas l’effet d’une augmentation de la dose de DNMT3L. Nous avons donc évalué l’issue d’une surexpression de Dnmt3L dans la lignée germinale mâle et femelle chez la souris, en utilisant un transgène, EF1α-Dnmt3L, que nous avons propagé à travers la lignée germinale durant plusieurs générations. Dans l’expérience de transmission du transgène à travers la lignée germinale femelle, 28.8% de tous les descendants à la génération F1 sont morts entre la naissance et l’âge de sevrage, et le taux de transmission du transgène aux descendants qui ont survécu jusqu’au sevrage était de 22.3%. Le manque de descendantes femelles à la génération F1 nous a fait mettre fin à 5 des 7 lignées, tandis que nous avons mis fin aux 2 autres lignées à la génération F2. Dans l’expérience de transmission du transgène à travers la lignée germinale femelle, les mâles issus de la lignée contenant le plus haut nombre de copies du transgène ont démontré une diminution significative du nombre de descendants par portée au sevrage de la génération F1 à F2. Les mâles transgéniques de cette lignée ont aussi démontré un nombre significativement plus élevé de tubes séminifères anormaux dans les coupes transversales de leurs testicules comparativement aux contrôles, ainsi qu’une augmentation significative de tubes séminifères anormaux de la génération F1 à F2. Ces observations nous ont mené à examiner les patrons de méthylation d’ADN dans le sperme de ces mâles, en utilisant le séquençage à l’échelle du génome entier par technique de représentation réduite de séquençage bisulfite (RRBS). Les résultats de l’analyse par RRBS ont révelé que, globalement, les patrons de méthylation d’ADN dans le sperme de mâles transgéniques n’étaient pas différents de ceux du sperme de mâles non-

transgéniques ou contrôles. Par contre, certaines régions méthylées différemment (DRMs) ont été découvertes. Les DMRs localisées dans les exons étaient hyperméthylées dans le sperme de mâles transgéniques comparativement aux contrôles, ainsi qu’hyperméthylées dans le sperme de mâles transgéniques à la génération F2 comparativement à F1. Il semble donc que la surexpression transgénique de Dnmt3L dans notre modèle donne lieu à de subtiles anomalies reproductives et défauts de méthylation d’ADN. Quoique préliminaire, il est possible que l’augmentation de ces défauts de F1 à F2 soit dûe à un effet d’héritage épigénétique transgénérationnel.

LIST OF FIGURES

Figure 1. Schematic representation of DNMT3L enzymes.

Figure 2. DNA methylation dynamics in male and female gametogenesis.

Figure 3. Pattern of expression of DNA methyltransferase in male and female gametogenesis.

Figure 4. Schematic representation of EF1α-Dnmt3L transgene construction.

Figure 5. Breeding scheme for transgene transmission through male and female germlines.

Figure 6. Fluorescence microscopy images showing transgene expression in testis sections.

Figure 7. Rate of transgene transmission through male germline to F1 and F2.

Figure 8. Average litter sizes in F1 and F2, male germline transgene transmission experiment.

Figure 9. Average paired testes weights and sperm counts in transgenic, non-transgenic males.

Figure 10. Quantification of normal, abnormal, and Sertoli-cell-only seminiferous tubules in testis cross-sections of transgenic, non-transgenic, and control males.

Figure 11. CpG methylation clustering analysis performed for RRBS comparisons of sperm DNA methylation between transgenic, non-transgenic, and control sperm.

Figure 12. Distribution of differentially methylated tiles and average DMR methylation levels in RRBS comparisons of transgenic versus control sperm.

Figure 13. Distribution of differentially methylated tiles and average DMR methylation levels in RRBS comparisons of non-transgenic versus control sperm.

Figure 14. Breeding scheme to obtain TG+, Dnmt3L (-/-) males and females.

Figure 15. Body weight of TG+ and TG-, Dnmt3L (-/-) females after mating to wild-type males, and body weight of wild-type females after mating to TG+ and TG-, Dnmt3L (-/-) males.

Figure 16. Reproductive organ weights of TG+, Dnmt3L (-/-) and TG-, Dnmt3L (-/-) males compared to each other and to that of TG-, Dnmt3L (+/+) males.

Figure 17. Rate of transgene transmission and average litter size in female germline transgene transmission experiment. 9

LIST OF TABLES

Table 1. Average male reproductive organ weights and body weights in male germline transgene transmission experiment.

Table 2. Number of hypermethylated and hypomethylated tiles in RRBS comparisons of sperm DNA methylation.

Table 3. Levels of DNA methylation difference in hypermethylated tiles in RRBS comparisons.

Table 4. Levels of DNA methylation differences in hypomethylated tiles in RRBS comparisons.

Table 5. Distribution of hypermethylated tiles in RRBS comparisons by genomic region.

Table 6. Distribution of hypomethylated tiles in RRBS comparisons by genomic region.

Table 7. List of Dnmt3L transgenic and Dnmt3L knock-out PCR primers used in mouse colony genotyping.

LIST OF ABBREVIATIONS

5caC: 5-carboxycytosine 5fC: 5-formylcytosine 5hmC: 5-hydroxymethylcytosine 5mC: 5-methylcytosine AID: activation-induced deaminase ANOVA: analysis of variance APOBEC1: apolipoprotein B mRNA-editing enzyme catalytic polypeptide 1 BER: base pair excision repair cDNA: complementary DNA

CH3: methyl group CpG: 5’-cytosine-guanine-3’ dinucleotide DMRs: differentially methylated regions DNA: deoxyribonucleic acid DNMT: DNA methyltransferase EF1-α: Elongation Factor 1 Alpha ESC: embryonic stem cells GC: guanine-cytosine GFP: green fluorescent protein GS cells: germline stem cells H3K4: histone 3 lysine 4 H3K4me2: histone 3 lysine 4 dimethyl H3K9me2: histone 3 lysine 9 dimethyl H3K27me3: histone 3 lysine 27 trimethyl IAP: intracisternal A particle ICM: inner cell mass IRES: Internal Ribosomal Entry Sequence KO: knock-out LINEs: long interspersed nuclear elements

LTRs: long terminal repeats MBD4: methyl-CpG-binding domain protein 4 MeDIP-seq: methylated DNA immunoprecipitation sequencing MethylCap-seq: methylated DNA capture by affinity purification PBS: phosphate-buffered saline PCR: polymerase chain reaction PGC: primordial germ cell qRT-PCR: real-time reverse-transcription PCR RNA: ribonucleic acid RRBS: reduced representation bisulfite sequencing SAM: S-adenosyl methionine SAH: S-adenosyl homocysteine SEM: standard error of the mean SINE: short interspersed elements SSC: spermatogonial stem cell TDG: thymine-DNA glycosylase TET: ten-eleven translocation

ACKNOWLEDGEMENTS

Reflecting on the hardships and victories of the past two years, I cannot overlook the significant contributions of some very important people in my life. First and foremost, I would like to thank my supervisor and mentor, Dr. Jacquetta Trasler. I want to acknowledge the tremendous impact you have had on my life by offering me an opportunity to work in your lab and through the significant contributions you have made to my training as a scientist. I know that shaping the minds of tomorrow’s scientists is something which you have made a personal mission. I am privileged to have benefited not only from your wealth of knowledge, but also from the care and attention with which you honed my critical thinking skills. Professionally, my favourite moments of the past two years are undoubtedly those spent in your office engaged in thought experiments with you, to anticipate outcomes of my experiments and potential future directions. This was a clever, fun, and imaginative way to generate excitement and new ideas related to my project, and I will think fondly of those moments for some time to come. Perhaps even more significant is the impact which you have had on a personal level. I will miss our discussions and I will carry many memories from the lab with me wherever life takes me.

I would also like to thank Dr. Valerie Chappe, my undergraduate Honour’s supervisor. You gave me my first opportunity to work in a lab, and taught me to begin to think like a scientist. Your initial guidance and support paved the way for me, and I would not have had the chance to pursue graduate studies and write this thesis without your precious help in those early days.

I also want to thank my favourite professor as an undergraduate, Dr. Mark Johnston. It was not too difficult to get me interested in a topic like Evolutionary Biology, and from the very first class I was hooked. But beyond the classroom, I felt privileged that you invited me to your graduate lectures on the evolution of sex and recombination. You gave me an early taste of what graduate school was like, and of how exciting group discussions about cutting edge topics in Biology can be. You gave me an appreciation for the fact that, as important as is pursuing research with a practical application in mind, asking basic research questions out of simple

curiosity is at least as important, and that it is often those questions that lead to significant discoveries. You ask questions because you truly wish to know, and your innate curiosity has inspired me to pursue graduate studies. Also, thank you for playing jazz at the beginning of every lecture and for being such a captivating speaker!

Thank you to the members of my supervisory committee, Dr. Sarah Kimmins and Dr. Yojiro Yamanaka, for all your guidance and advice throughout this process. Dr. Kimmins, you were such an important collaborator, and I always enjoyed visiting your lab. Whenever I came by, you and your lab members always made me feel right at home, and you always took the time out of your busy schedule to discuss my research, or teach me a new technique. Dr. Yamanaka, I really enjoyed your stem cell class and discussions with you, whether in class or related to my project, were always very stimulating and informative. At the one-year mark, you provided some very insightful comments that have had a significant impact on my project thereafter, so thank you for being so involved.

I would like to thank my fellow lab members, past and present, who have made time spent in the lab seem more like play than work, really. Mena Farag, thank you for generating so much excitement on my part toward this project. I was in very capable hands when I came into the lab, and you made learning everything about the project and in the lab a very fun proposition indeed. Josée Martel, thank you for keeping the lab so well organized, and for all the great talks we have had, not the least of which were about food! I look forward to exchanging recipes with you in the future. Dr. Serge McGraw, thank you for providing such a great mix of vital help and entertainment. I could literally go to you to troubleshoot any problem I encountered in the lab, but I will remember our discussions and predictions before fight nights just as fondly. Dr. Donovan Chan, thank you for always being there for me, whether to help me out with my project regardless of how long it took, or to discuss anything else I needed to. Being a great listener is a rare quality in a person, and you provided such perceptive advice throughout the past two years. Lundi Ly, Mylène Landry, Jacques Zhang, and Pauline de Zeeuw, thank you so much for being great lab mates and for your jokes and entertainment. I have always felt that the people you work with are key to your happiness as much as the work you do, and you surely made laughter part of

the daily routine in the lab. Yasmine Ghorayeb, I really enjoyed having someone in the lab with whom to share my love of movies. Laura Whidden, thank you for indulging me in talking about video games, and for having such open chats about anything really, I will also miss our jokes!

Keith Siklenka, thank you for being my “brother from another supervisor” and my “histone homolog”. I loved our chats at conferences, and how we bounced ideas back and forth from our respective sides of the methylation equation. Whenever visiting the Kimmins lab, I always looked forward to our fun talks about training, nutrition, and anything else that either allowed to indulge our philosophical inclinations, or that warranted a good joke. I look forward to going biking with you sometime.

Everyone in the Human Genetics department, thank you for being such a lively, original, active, and colourful faction of McGill. You literally organized every imaginable group activity possible, and you clearly love what you do. It has also been inspiring to be part of such a group of progressive thinkers. Let’s not forget the softball team. I bet you all secretly wish you were gifted heavy hitters like myself and to that I say, dream on! Seriously now, I will forever consider myself a part of your team, and I will remember this group fondly long after I have graduated. A special thanks also goes to Ross Mackay, for being the face of the Human Genetics department, and a very professional one at that. I have rarely encountered someone as efficient and pleasant as you, Ross. Thank you for making every administrative task seem smooth and seamless from my end. I am still in disbelief that the time to receive every single one of your email replies can literally be measured in seconds.

I also wish to thank everyone at Place Toulon for providing such a stimulating and fun learning environment. Lynn, Marlene and Marie-Lyne, I will miss your talks and I sincerely hope that we will keep in touch over the years.

There are too many friends to thank all of you, but you know who you are, and my life would not be the same without you. I need to give special thanks to what is for me the Holy Trinity of friendship, Jérémie Vallee, Tarik Benachime, and Rebecca Crawford. To each and

every one of you, we go way back and I consider you family. Thank you for being the pillars of support that you have been for me for so long now. To my sister Caroline, I am so lucky to have grown up with you, and had we not been related, I know we would still be the best of friends. They say you don’t choose your family, but it is a rare gift when you would have picked precisely the one you do have, had you been given the choice. I am so proud of who you have become, and as you prepare for your journey around the world, I hope you have the time of your life. I know that when you come back home, it will be just as if we had seen each other the day before. Mom, you are the one person in the world who would literally sacrifice everything for me, and I know that my happiness and success matter more to you than all else. A mother’s love is an unbreakable bond, and I only hope that I continue to make you proud. Dad, you are the quiet warrior who speaks volumes with your actions rather than words, and you are the very definition of integrity and honesty. I wish to conduct myself with honor in life, and in that I could not ask for a better model.

To Justine, my confidante and best friend, I am so grateful that our paths crossed and merged henceforth. I am truly sorry for tightening every jar in the lab with an iron grip, and for otherwise driving you crazy in those early days in the lab. I will never forget those incubation periods in between immunohistochemistry steps, spent talking in the sun and getting to know you as I now do. When I first met you while visiting the Trasler lab for the first time, I could have never imagined what lay ahead for us. You never know what surprises lie around the corner. You must always go forth with an open heart, the presence of mind to recognize the extraordinary when it unfolds, and the readiness to act on it when it matters most, lest the best of life pass you by. Every day I am graced with your presence is a reaffirmation of that powerful truth for me. Asking you to go running on the Mount with me was the best decision I ever made, and I cannot even begin to thank you for being who you are.

CONTRIBUTION OF AUTHORS

The majority of the work described in this thesis was conducted by the candidate, with the exception of the following experiments: the EF1α-Dnmt3L transgene construction and creation of transgenic founders was performed by Mena Farag, the preparation of RRBS libraries from sperm extracted by the candidate was performed by Dr. Donovan Chan, the sequencing of sperm DNA methylation was performed by the Genome Quebec Innovation Centre (Montreal, QC), and the subsequent bioinformatics analysis was performed by Maxime Caron and Dr. Donovan Chan.

Many more people otherwise helped with experiments and/or project direction. My supervisor Dr. Jacquetta Trasler and committee members, Dr. Sarah Kimmins and Dr. Yojiro Yamanaka, provided critical feedback and advice as experiments progressed. Mena Farag provided guidance with the project background and suggested appropriate literature related to it. Mena Farag and Josée Martel taught me everything I needed to know to handle mice and to maintain mouse colonies, whereas Josée Martel and Mylène Landry taught me all things related to mouse colony management from an organizational standpoint. Donovan Chan taught me how to dissect mice and extract reproductive organs, as well as how to extract sperm. Lundi Ly taught me how to check for the presence of resorption sites in uteri. Dr. Louis Hermo and Dr. Charlie Smith provided guidance with histological analysis of testis cross-sections. Dr. Sarah Kimmins and Keith Siklenka taught me how to cryopreserve samples and perform testis cryosections. Justine Garner taught me how to use GraphPad and provided help with statistical analyses. Dr. Serge McGraw and Dr. Donovan Chan provided guidance with experiments and helped troubleshoot issues. Josée Martel helped with anything I might need in the lab and with protocol optimization. Dr. Jacquetta Trasler provided vital help in editing and improving this thesis.

The candidate was funded by RI-MUHC-Foundation of Stars studentship awards. Research for this thesis was funded by grants to Dr. Jacquetta Trasler from the Canadian Institutes of Health Research (CIHR) and the National Sciences and Engineering Research Council (NSERC).

INTRODUCTION

Epigenetics The term “epigenetics” refers to the set of heritable modifications to the genome which dynamically regulate gene expression, but without altering the underlying DNA base sequence. Epigenetic marks can modify the DNA directly by altering its biochemical structure, or indirectly via DNA-binding molecules or alterations to DNA packaging. The most important are modifications to DNA (Bestor & Tycko, 1996) and histones (Jenuwein & Allis, 2001; Li, 2002), as well as non-coding RNAs (Bayne & Allshire, 2005). A cell’s epigenome comprises all such modifications to DNA, which together influence the cell’s expression pattern, and its function.

Epigenetic modifications influence the processes of cellular programming and differentiation, which are key processes in development. Unlike the DNA sequences, or genomes, of cells which do not change during cellular differentiation, different cells types are associated with different epigenomes (Reik, 2007). Male and female gametes, which are terminally differentiated cells, associate to form a totipotent cell, the zygote, which represents the initial stage of embryogenesis. This single cell will then undergo dynamic changes in cellular programming and gene expression, and accompanying epigenetic reprogramming, to produce all cell types in an organism. As is the case with other epigenetic marks, DNA methylation is dynamically regulated during development, with profound changes during gametogenesis, fertilization and embryogenesis (Surani et al., 2007).

DNA methylation

Biochemistry

DNA methylation refers to the chemical addition of a methyl (-CH3) group to a cytosine base, often within a cytosine-guanine, or CpG, dinucleotide (Holliday & Pugh, 1975). DNA is mostly methylated on cytosines at symmetrical 5’-CpG-3’ dinucleotides, by covalent addition of the methyl group at position 5 of a cytosine ring (5mC, or 5’-Me-CpG-3’). The methyl group is provided by the universal methyl donor, S-adenosyl-methionine (SAM), which thereby becomes

S-adenosyl-homocysteine (SAH). A family of enzymes known at DNA methyltransferases, or DNMTs, is responsible for catalysis of DNA methylation reactions (Goll & Bestor, 2005).

Genomic distribution of CpGs There are approximately 20 (mouse) to 30 (human) million CpG dinucleotides in the genome (Lander et al., 2001). Despite the genome-wide distribution of CpGs, only about 1-2% of the total cytosines in the genome are methylated in a cell (Bestor & Tycko, 1996). By contrast, the proportion of methylated CpGs in a typical cell is much higher at about 60-80% (Ehrlich et al., 1982). This is because CpGs represent the rarest type of dinucleotide in the genome (Lander et al., 2001), as the process of deamination converts methylated cytosines to thymines (Bester & Coxon, 1993). Despite this relative paucity of CpGs in genomes, DNA methylation is evolutionarily conserved in species with genomes exceeding 5 x 108 base pairs in length (Bestor, 1990). This is because, despite the low abundance of methylated CpGs in the genome, proper CpG methylation is critical to normal development.

CpG islands This overall scarcity of CpG dinucleotides throughout the genome has exceptions, CpG- rich areas which have been called CpG islands. CpG islands average 1000 base pairs in length, show relative enrichment in GC content and lack of CpG depletion, by contrast to the rest of the genome (Deaton & Bird, 2011). Studies of CpG islands have found that CpG-rich areas are generally hypomethylated, and that overall there is an inverse relationship between CpG density and methylation level (Weber et al., 2007). Also, unmethylated CpG islands tend to be associated with histone H3K4me2. This histone methylation mark correlates with active transcription, and this suggests that CpG islands regulate transcriptional activity (Meissner et al., 2008). This association of unmethylated CpG islands with gene promoters and transcriptional permissiveness is in contrast to most other CpGs, where CpG methylation is usually associated with heterochromatin and transcriptional silencing (Rose & Klose, 2014). Roughly 70% of gene promoters are associated with CpG islands (Saxonov et al., 2006), and CpG islands distal to transcription start sites have also been found, which are nevertheless involved in promoter

function (Illingworth et al. 2010; Maunakea et al. 2010). This suggests a role of CpG islands in transcriptional initiation (Deaton & Bird, 2011).

Non-CpG methylation As mentioned above, the bulk of DNA methylation occurs on cytosines within CpG dinucleotides. Somatic cells are almost devoid of DNA methylation at non-CpG sites (Law & Jacobsen, 2010). It has been shown, however, that DNA can be methylated at non-CpG sites in the mouse, specifically in embryonic stem cells (Goll & Bestor, 2005). Whole genome methylation analyses have shown that non-CpG methylation is also found in human embryonic stem cells, representing about a quarter of DNA methylation. However, methylation at non-CpG sites was lost after differentiation, suggesting that it is specific to embryonic stem cells (Lister et al., 2009). Non-CpG methylation was not picked up at significant levels in sperm cells of mammals (Molaro et al., 2011).

Role of DNA methylation in transcriptional regulation DNA methylation plays several important biological roles, including modulation of gene expression, genomic imprinting and X-inactivation. A given cell’s pattern of gene expression will determine the fate of that cell. Different cell types have different levels of methylation at the same promoter (Suzuki & Bird, 2008). DNA methylation affects a cell’s pattern of gene expression via its role in transcriptional regulation and regulation of chromatin states. Generally, DNA methylation correlates with transcriptional repression, especially in promoter regions (Fouse et al., 2008); however, promoter hypermethylation does not always lead to transcriptional repression (Siegfried & Simon, 2010). DNA methylation also affects chromatin states, which in turn influence transcriptional activity (Bestor & Coxon, 1993). Euchromatin, or the “open state” of DNA, correlates with DNA hypomethylation and active transcription. Heterochromatin, by contrast, is the “closed state” of DNA and is associated with DNA hypermethylation. DNA methylation exerts its transcriptional repression either by affecting DNA directly, or the surrounding chromatin. DNA methylation can prevent DNA binding by transcription factors, or it can promote the binding of factors to methylated CpGs, which in turn affect chromatin structure (Siegfried & Simon, 2010). For instance, repeat elements found in intergenic regions

are mostly hypermethylated and transcriptionally repressed. They become reactivated when demethylated, which suggests that DNA methylation is involved in silencing these elements (Walsh & Bestor, 1999; Walsh, Chaillet & Bestor, 1998).

Genomic imprinting DNA methylation is also involved in genomic imprinting, a phenomenon whereby two alleles will have different methylation patterns in certain regions, depending upon which parent they were inherited from. This parent-of-origin methylation patterning leads to silencing of genes on one allele, and consequently monoallelic expression in these regions, referred to as differentially methylated regions (DMRs) (Reik et al., 2001). Proper genomic imprinting is critical to normal development, and the acquisition of associated DNA methylation at DMRs occurs during gametogenesis in a sex-specific manner (Smith et al., 2006). The bulk of DNA methylation associated with imprinting occurs on the maternal allele, and consequently most genes are expressed from the paternal allele. Some notable exceptions to this rule include Rasgrf1, Dlk1-Gtl2, and H19; those imprinted genes are paternally methylated (Bartolomei et al., 1991; Bartolomei et al., 1993; Ferguson-Smith et al., 1993; Tremblay et al., 1995; Takada et al., 2002; Yoon et al., 2002).

X-inactivation X-inactivation is the process whereby one X chromosome in organisms with two or more X chromosomes is transcriptionally repressed, in order to modulate dosage of X chromosome genes. This silencing is partially regulated by DNA methylation (Sado & Ferguson-Smith, 2005). The 5’ region of several genes on the silenced X chromosome has been shown to be hypomethylated (Panning & Jaenisch, 1996). DNA hypomethylation has also been shown to play a role in Xist gene activation on 1 of the X chromosomes, the transcription of which promotes transcriptional repression of the X that gets silenced. By contrast, hypermethylation of the Xist gene on the other X chromosome ensures that it does not get silenced (Norris et al., 2004; Sado et al., 2004). Differential methylation at CpGs regulating the genes Xite, Tsix, and Xist, between the active and inactive X chromosomes, leads to Xist expression and covering of the inactive X, whereas Xist repression is associated with the active X. On the active X, hypometylation of CG-

rich sequences associated with Xite, a positive regulator of Tsix, leads to Tsix expression, which in turn represses Xist, the major X-inactivation effector. On the inactive X, hypermethylation of the CG-rich sequences associated with Xite leads to downregulation of Tsix, which in turn leads to Xist expression and X-inactivation (Pollex & Heard, 2012).

Disorders linked to abnormal methylation As mentioned above, proper imprinting is crucial to normal development, as evidenced by imprinting disorders such as Prader-Willi, Angelman, and Beckwith-Wiedemann syndromes, which can arise from improper methylation at DMRs (Paulsen & al., 2001; Tycko & Morison, 2002). It should be noted, however, that these imprinting disorders can arises from many causes, such as a loss of function mutation on the single active allele, chromosomal deletion or duplication, and uniparental disomy. When these disorders arise from abnormal methylation, this can be due to improper DNA methylation erasure, establishment or maintenance at DMRs, which leads to a maternal imprint on a paternal chromosome, or vice versa. Such imprinting defects in turn lead to silencing of a normally active allele, or activation of a normally silent one (Horsthemke, 2014). Abnormal DNA methylation is also associated with cancer, as it can lead to oncogene activation or tumor-suppressor gene repression (Feinberg & Tycko, 2004).

DNA methylating enzymes A family of enzymes is responsible for methylating DNA. These proteins, called DNA methyltransferases (DNMTs), are grouped together based on conservation of a cytosine 5- methyltransferase motif in their catalytic domains, located in their C-terminus (Figure 1). These enzymes transfer a methyl group from the universal methyl donor SAM to DNA, using their catalytic methyltransferase activity. The family of DNA methyltransferases comprises three groups: DNMT1, DNMT2, and DNMT3 (Goll & Bestor, 2005).

DNMT1 DNMT1 is the enzyme mainly involved in maintenance methylation during DNA replication. This is evidenced by DNMT1’s much greater ability to bind hemimethylated DNA than other DNMTs (up to 30 times more) (Bestor, 1992; Bestor & al., 1988). Despite its main

function being maintenance methylation, studies also suggest that DNMT1 can also perform de novo methylation, as it can add a methyl group to DNA that is not methylated on either strand (Okano et al., 1998). Full-length DNMT1 represents the most common isoform, but there are also two other isoforms, specific to the oocyte (DNMT1o) and the pachytene spermatocyte (DNMT1p), respectively (Mertineit et al., 1998). In the mouse, DNMT1 is most abundant in gonads, although it is found at high levels in all tissues in the body. Gametogenesis in both sexes is characterized by tightly regulated expression of this enzyme (Benoit & Trasler, 1994; Jue et al., 1995; LaSalle et al., 2004; Mertineit et al., 1998; Ratnam et al., 2002, Trasler et al., 1992).

DNMT2 DNMT2 was previously thought of as an evolutionary relic, as it might have once been involved in methylation of other nucleic acids (Goll & Bestor, 2005). This enzyme is mostly associated with tRNA methylation (Yoder & Bestor, 1998). It was recently shown that small non-coding RNAs can act as transgenerational signalling molecules, by producing hereditary epigenetic variations. Dnmt2 expression was shown to be necessary for the acquisition and transgenerational maintenance of these methylation marks, making DNMT2 an essential mediator of RNA-driven epigenetic inheritance (Kiani et al., 2013).

DNMT3 The DNMT3 subgroup is itself further divided into three different types, DNMT3A, 3B, and 3L. These are the main enzymes responsible for de novo methylation acquisition (Aapola et al., 2001). DNMT3A has two isoforms, DNMT3a and DNMT3a2, both of which have catalytic methyltransferase activity. The genomic location and expression of these two isoforms is very different, however (Okano et al., 1998). DNMT3B also has catalytic methyltransferase activity. Due to alternative splicing of exons 11, 22, and 23, DNMT3B has eight isoforms, of which only two (DNMT3b1 and DNMT3b2) are presumed to have catalytic methyltransferase activity, owing to the loss of parts of the catalytic domain from exon 22 and 23 in other isoforms (Aoki et al., 2001; Chen et al., 2002; Weissenberger et al., 2004). The Dnmt3a and Dnmt3b genes produce similar proteins; however, they are not located on the same chromosome. The expression of these two genes also varies greatly. There is expression of both Dnmt3a and Dnmt3b in embryonic

stem cells. In adult tissues, however, Dnmt3b expression is largely confined to the pancreas, thymus, bone marrow, and testes, whereas Dnmt3a is expressed ubiquitously in somatic cells. This differential expression suggests that DNMT3A and DNMT3B play different roles (Okano et al., 1998).

DNMT3L In contrast to DNMT3A and DNMT3B, DNMT3L does not have catalytic methyltransferase activity, due to amino acid substitutions in its catalytic domain (Aapola et al., 2001; Chedin et al., 2002). DNMT3L is, however, similar to DNMT3A and DNMT3B in both its N- and C- terminus, and it is a co-factor that greatly enhances the catalytic activity of both DNMT3A and DNMT3B (Chedin et al., 2002; Margot et al., 2003; Suetake et al., 2004). DNMT3L expression is restricted to the ovaries, placenta, testes, and thymus (Aapola et al., 2001; Bourc’his et al., 2001; Hata et al., 2002). This enzyme has two isoforms. One isoform, the full-length DNMT3L, is expressed in spermatogonia, and is the isoform mostly involved in de novo methylation (Strausberg et al., 2002). The other isoform, the short form of DNMT3L, is solely expressed in oocytes (Shovlin et al., 2007).

Interaction between DNMT3L and DNMT3a2 There is an overlap in the timing and localization of DNMT3L and DNMT3a2 expression, which also correlates with the window of de novo methylation in the male germline (Hata et al., 2002; LaSalle et al., 2004; Sakai et al., 2004). This suggests an interaction between the two enzymes to methylate DNA. In fact, experiments done both in vitro and in vivo showed that the C-terminal domains of DNMT3L and that of DNMT3A/DNMT3B interact, which enhances de novo methylation activity (Chedin et al., 2002; Margot et al., 2003; Suetake et al., 2004). One presumed function of DNMT3L to enhance DNA methylation is by acting as a co-factor to DNMT3A. It has been shown that DNMT3L associates with DNMT3A in a tetramer complex containing two units of DNMT3L and two units of DNMT3A (3L:3A:3A:3L). This configuration allows the methylation of CpGs that are 8-10 base pairs apart, representing a turn of the DNA double helix. This distance between CpGs is common to maternally differentially

methylated regions (Jia et al., 2007). DNMT3L also has a preference for unmethylated histone H3K4, and is thought to recruit DNMT3A to histone tails (Ooi et al, 2007).

Developmental dynamics of DNA methylation

Disorders due to Dnmt deficiency DNA methylation is critical to normal development, as outlined by studies of Dnmt deficiency in mice. Homozygous Dnmt3a mutants die early post-natally. Homozygous Dnmt3b mutants die during embryonic development (Okano et al, 1999). Dnmt3a deficiency targeted to the germline leads to impaired spermatogenesis. DNMT3L deficiency leads to infertility due to meiotic arrest in spermatogenesis (Bourc’his & Bestor, 2004). Developmental abnormalities in DNMT3A and DNMT3B deficient mice correlate with loss of DNA methyltransferase activity and, consequently, DNA methylation. Dnmt3a/Dnmt3b double mutants lose de novo methylation activity of proviral DNA in embryonic stem cells (Okano et al., 1999). Dnmt3a mutation targeted to the germline results in loss of methylation at the H19 and Dlk1-Gtl2 genes (Kaneda et al., 2004). Dnmt3L mutation also results in loss of methylation at H19 (Kaneda et al., 2004), and primordial germ cells in Dnmt3L mutants are hypomethylated (LaSalle et al., 2007). In humans, DNMT3B deficiency leads to ICF syndrome in children (Immunodeficiency, Centromeric Instability, and Facial anomalies) (Geiman & Muegge, 2010). These studies show that normal development depends on proper DNA methylation, the acquisition and maintenance of which in turn depends on coordinated activity of the methylation machinery.

DNA methylation dynamics in embryogenesis The studies described above suggest that DNA methylation must be tightly regulated in development, and that dysregulation has severe consequences. Perhaps this is because the process of DNA methylation in development is a highly dynamic one, which is necessary to enable dynamic changes in gene expression across the different cell types. In embryogenesis, as unipotent, terminally differentiated germ cells come together to produce a totipotent zygote, there is a genome-wide demethylation event occurring in sperm. A period of global DNA methylation erasure indeed follows fertilization; this erasure is a rapid process in the male

pronucleus (Reik et al., 2001; Santos et al., 2002), whereas it is slower in the female pronucleus, being associated with DNA replication (Mayer et al., 2000). A study using genome-wide, DNA methylation sequencing techniques compared global DNA methylation in sperm, and in the zygote produced from that sperm. The bulk of sequences that were hypermethylated in sperm before fertilization had lower methylation levels in the zygote. By contrast, methylation levels remained stable from the zygote to the 2-cell stage. Long terminal repeat (LTR) retroelements and long interspersed elements (LINEs) were among the sequences that became demethylated in preimplantation development. Other repeat elements did not lose methylation during that same period. The majority of sequences that, prior to fertilization, were hypermethylated in sperm compared to oocytes, became hypomethylated in the zygote, relative to oocyte levels. By contrast, the sequences that were hypermethylated in oocytes versus sperm pre-fertilization, had intermediate levels of DNA methylation in the zygote. This suggests a greater contribution of the maternal DNA methylome to the zygote methylome, which is consistent with global methylation erasure in sperm (Smith et al., 2012). Also in support of sperm demethylation following fertilization is that TET2 and TET3 levels go up in preimplantation embryos. These enzymes are involved in active demethylation in the male pronucleus, by converting methylcytosines to 5- hydroxymethylcytosines, the latter being an intermediate in the demethylation process (Inoue & Zhang, 2011).

Another major change in global DNA methylation in embryogenesis is the significant methylation acquisition in cells of the inner cell mass (ICM) of the blastocyst specifically (Smith et al., 2012). This de novo methylation is carried out by DNMT3A and DNMT3B. Somatic tissues stably inherit these methylation marks due to maintenance methylation (Deaton et al., 2011). DNMT3L, by contrast, is not a key enzyme in the acquisition of methylation patterns in embryogenesis. Albeit delayed and at lower densities in some regions, DNA methylation does not fail to be acquired in embryogenesis in the absence of DNMT3L (Guenatri et al., 2013).

Spermatogenesis Spermatogenesis is the process which produces haploid male gametes from diploid germ cells (Sharpe, 1994). Primordial germ cells are male germ cell precursors that first become

distinguishable from other cells in the embryo around 6.5 days post-coitum (dpc). These cells first appear in the proximal region of the epiblast, and go through mitosis for several rounds; PGCs increase in number from roughly 6 to 40 in the period from 6.5 dpc to 7.25 dpc. They continue to proliferate and migrate to the developing genital ridge at 10.5 dpc, at which point seminiferous cords develop around them. Primordial germ cells also undergo epigenetic remodelling between 10.5 dpc and 12.5 dpc, such that they go through global DNA methylation erasure. At 12.5 dpc, PGCs are mitotically arrested, and these cells of the developing gonads are called “gonocytes”. In that period of mitotic quiescence, which will last until after birth, gonocytes will acquire methylation marks through de novo methylation. The timing and pattern of methylation acquisition differs in the male and female germlines (Figure 2). The period of mitotic quiescence in gonocytes will end at 2 dpp, at which point gonocytes migrate to the basement membrane of seminiferous tubules in the developing testes (Oatley & Brinster, 2008; Saitou et al., 2002; Steinberger & Steinberger, 1975; Surani et al., 2004). There the gonocytes, or prospermatogonia, resume mitosis to become spermatogonia and spermatogenesis proper begins.

Spermatogenesis itself is divided into 3 phases: the proliferative or mitotic phase, followed by the meiotic phase and then finally, spermiogenesis. In the proliferative phase, spermatogonia mitotically divide several times, which greatly expands the cell population. A small subpopulation of spermatogonia initially occupying the basement membrane, the spermatogonial stem cells (SSCs), will not differentiate, and will serve to replenish the male germ cell population for the life of the organism. The rest of spermatogonia will differentiate into type A spermatogonia, and more rounds of mitosis will successively produce the type Apaired,

Aaligned, A1, A2, A3, A4, Aintermediate, and type B spermatogonia, respectively. During this period, the spermatogonia remained linked to each other through cytoplasmic bridges, due to incomplete cytokinesis. This allows the exchange of material between cells, and synchronicity in their development. Mitosis in type B spermatogonia produces preleptotene spermatocytes, and thus begins the meiotic phase. The first round of meiosis produces secondary spermatocytes, and the second meiotic round produces spermatids. During this phase, the two meiotic divisions in the tetraploid spermatocytes results in haploid, round spermatids. The last phase, spermiogenesis, leads to the maturation of spermatids into spermatozoa through alterations in chromatin and

morphology. As the cells develop from spermatogonia to mature sperm, they move upwards from the basement membrane towards the lumen of the seminiferous tubules, where they are released. The sperm then travels through the epidydimis, where it matures and is stored until released as ejaculate (de Rooij & Russell, 2000; Huckins, 1971; Oatley & Brinster, 2008; Sharpe, 1994).

DNA methylation in male gametogenesis As mentioned above, PGCs migrate to the genital ridge at about 10.5 dpc (Saitou et al., 2002), and the period from 10.5 dpc to 12.5 dpc is one of genome-wide DNA methylation erasure, at which point methylation levels reach their lowest point in the life of the organism. Even the erasure period upon fertilization does not reach such low levels of methylation. Associated with this demethylation event are changes in chromatin, i.e. an increase in H3K27me3 and a decrease in H3K9me2 (Seki et al., 2005). Despite this demethylation being widespread and affecting different types of sequences, including repeat elements and imprinted as well as non-imprinted regions (Hajkova et al., 2002), it is not a complete erasure of methylation marks. Some sequences partially or fully escape demethylation. For instance, repeat elements such as LINE1, SINE1, and IAP are only partially demethylated (Hajkova et al., 2002; Kato et al., 1999; Lees-Murdock et al., 2005; Walsh et al., 1994). Some sequences were also found to completely escape methylation erasure, the bulk of which were repeats (mostly IAPs), according to a recent genome-wide study using bisulfite sequencing for methylation analysis (Hackett et al., 2012). This suggests that DNA methylation can be passed on from one generation to another through the germline, and is evidence of transgenerational epigenetic inheritance.

The process of demethylation involved in the global DNA methylation erasure in PGCs (and in early embryonic development) might involve one or many proposed active and passive mechanisms. Repression of DNA methylation maintenance, through DNMT1 or factors that recruit it to replication foci, is one proposed passive mechanism of 5hmC removal. It cannot be the sole mechanism, however, as it depends on several rounds of DNA replication, the rate of which does not match the rapid loss of DNA methylation in cells that are slowly dividing or non- dividing. An alternative, active mechanism that has been proposed is the deamination of 5mC to

thymine, catalyzed by either the activation-induced deaminase (AID) enzyme or apolipoprotein B mRNA-editing enzyme catalytic polypeptide 1 (APOBEC1). This conversion results in a T:G mismatch, such that the thymine base is recognized and removed by thymine-DNA glycosylase (TDG) or methyl-CpG-binding domain protein 4 (MBD4). The subsequent lack of a base at the site formerly occupied by the thymine triggers the restoration of an unmodified cytosine by the base pair excision repair (BER) machinery. This effectively results in removal of the 5-methyl mark from 5mC. Another proposed active mechanism is the conversion of 5-methylcytosine (5mC), to 5-hydroxymethylcytosine (5hmC), by the ten-eleven translocation (TET) family of dioxygenase enzymes. The 5-hydroxymethylcytosine mark is itself an intermediate in the demethylation pathway, and is then further converted by TET enzymes to 5-formylcytosine (5fC) and then to 5-carboxycytosine (5caC) (Messerschmidt et al., 2014). Another enzyme might then convert 5caC to unmethylated cytosine (Ito et al., 2010); alternatively, TDG, MBD4 or another glycosylase might remove one of the methylcytosine intermediates (He et al., 2011; Shen et al., 2013), the loss of the base then activating the BER pathway as described above (Messerschmidt et al., 2014). The TET enzymes display differential developmental expression (Tahiliani et al., 2009), with Tet1 and Tet2 being expressed in PGCs and ESCs and Tet3, in spermatozoa, oocytes, and early preimplantation embryos. The overlap between Tet1 and Tet2 expression has led to the suggestion of functional redundancy of the TET1 and TET2 enzymes (Messerschmidt et al., 2014). The reprogramming of PGCs resulting from one or several of those mechanisms resets the epigenome leading to totipotency in germline cells.

Following reprogramming, male PGCs reacquire DNA methylation shortly thereafter. As mentioned above, primordial germ cells become mitotically quiescent at about 15 dpc, and remain so until about 2 dpp. This period of mitotic quiescence is thought to be critical for the proper acquisition of methylation patterns in male germ cell development. The beginning of the window of DNMT3A and DNMT3L expression, and that of de novo methylation acquisition in the male germline, coincides with that of mitotic arrest in gonocytes. Male germ cells first acquire methylation around 15 dpc (Davis et al., 2000; Li et al., 2004; Niles et al., 2011; Ueda et al., 2000). DNMT3A and DNMT3L expression peaks between 15.5 dpc and 18.5 dpc (Figure 3), and this mirrors the peak of de novo methylation (LaSalle et al., 2004; Sakai et al., 2004). DNA

methylation in the male germline was first examined at the paternally methylated imprinted genes H19, Gtl2 and Rasgrf1. A 2-kb region at the H19 locus that is differentially methylated between male and female germlines was found to be methylated throughout spermatogenesis on the paternal allele, suggesting that methylation was acquired prior to mitotic resumption in male germ cells (Davis et al., 1999). The methylation acquisition of H19 in male germ cells was found to begin in fetal stages and extend to the post-natal window, up to the pachytene spermatocyte (Davis et al., 2000; Kato et al., 1999; Oakes et al., 2007). The methylation of Gtl2 and Rasgrf1, which begins pre-natally, also extends into the early post-natal window (Li, 2002). Most intergenic and intragenic regions acquire de novo methylation in the pre-natal window, but do acquire some early in the post-natal window as well (Niles et al., 2011; Oakes et al., 2007). This post-natal consolidation of methylation patterns initially acquired pre-natally is reflected in the dynamic and tightly regulated pattern of Dnmt3a2 and Dnmt3b expression in the post-natal window in spermatogenesis (LaSalle et al., 2006), as well Dnmt3L expression (LaSalle et al., 2007). Following the acquisition of methylation patterns in gonocytes and spermatogonia, DNMT1 ensures their maintenance through mitotic and meiotic divisions in spermatogenesis, such that they are retained in the mature sperm. Studies have revealed that the sperm methylome markedly differs from that in other tissues (Oakes et al., 2007).

DNA methylation analysis using RRBS Reduced Representation Bisulfite Sequencing, or RRBS, is a high-throughput sequencing technique that allows genome-wide methylation analysis at cytosine bases. The calling of the methylation status at cytosines uses bisulfite treatment, which converts unmethylated cytosines to thymines, but leaves methylated cytosines as cytosines. The genome has an average of 1 cytosine as part of a CpG dinucleotide at every 100 base pairs and is therefore relatively CpG- poor. This makes whole-genome bisulfite sequencing wasteful, as it generates very little methylation information for the large number of reads produced. Digestion with the Msp1 enzyme, which cuts between the two cytosines at CCGG recognition sites, addresses this issue by allowing every fragment in a genomic library to be flanked by CGG sequences, thus enriching the CpG content of RRBS libraries (Gu et al., 2011). This allows sequencing of at least 5 million CpGs of the 30 million found in the mouse genome. Reduced Representation Bisulfite

Sequencing has been shown to provide an accurate representation of genome-wide DNA methylation patterns, producing methylation data in accordance with previous findings using different techniques (Bock et al., 2010; Gu et al., 2011; Meissner et al., 2005; Smith et al., 2012).

Recent DNA methylation studies using bisulfite sequencing Recent studies have examined genome-wide DNA methylation using bisulfite sequencing. In the mouse, experiments have shown that sperm methylation levels inversely correlate with CpG density, a relationship also found in somatic cells. Methylation levels were found to be higher globally in sperm, compared to oocytes and cells in early embryogenesis (Smith et al., 2012). A study compared methylation between mature chimp and human sperm. CpG methylation averaged 70% and showed a high degree of conservation between the two species. Germ cell promoters enriched in transcription factors active in the testis were hypomethylated, whereas most repeats were hypermethylated. Other repeat elements were also hypomethylated, however (Molaro et al., 2011).

Dnmt3L in male gametogenesis As mentioned previously, DNMT3L is not critical to normal embryonic development, as are DNMT3A and DNMT3B. DNMT3L is, however, critical to gametogenesis in both sexes. This is evidenced by the infertility phenotype observed in Dnmt3L (-/-) mice. Dnmt3L (-/-) male mice are phenotypically normal, with the exception of their testes, which are markedly reduced compared to Dnmt3L (+/+) animals. Spermatogenesis is impaired in the testes of these animals. The seminiferous tubules of Dnmt3L (-/-) males are characterized by a Sertoli cell-only phenotype, due to the progressive depletion of germ cells in the tubules of these animals. This is because there is abnormal synapsis of homologous chromosomes, and consequently meiotic arrest in spermatocytes, followed by apoptosis (Bourc’his & Bestor, 2004). This is associated with global hypomethylation of germ cells in Dnmt3L (-/-) animals (LaSalle et al., 2007). Imprinted genes are severely hypomethylated, as are several intergenic and intragenic regions. Dnmt3L (-/-) females do produce oocytes and get pregnant; however they lose all of their embryos at midgestation, as a result of abnormal extraembryonic tissues which causes growth defects in embryos (Bourc’his et al., 2001). The infertility phenotypes in both male and female

Dnmt3L (-/-) males very closely resemble those observed in Dnmt3a (-/-) animals (Kaneda et al., 2004). Dnmt3L haploinsufficiency also leads to abnormal reproductive outcomes. Even though Dnmt3L (+/-) males are fertile, the offspring they produce have an increased incidence of aneuploidy (XO monosomy), despite the Dnmt3L (+/+) background of the offspring themselves (Chong et al., 2007). Thus Dnmt3L is a paternal effect gene, meaning that haploinsufficiency in the father will affect the wild-type offspring he sires. Another study showed that the spermatocytes of these Dnmt3L (-/-) males displayed greater XY body length in prophase I of meiosis, and that there was a higher incidence of non-disjunction in these males. The spermatogonia of these males also showed abnormal gene expression patterns (Zamudio et al., 2011). These phenotypes correlate with hypomethylation of Dnmt3L (+/-) male germ cells at intergenic regions in chromosomes 9 and X, at 16.5 dpc. Methylation levels in these regions mostly return to normal by 6 dpp (Niles et al., 2013). Interestingly, those sequences that are methylated earlier in the pre-natal window of de novo methylation seem to recover their methylation, whereas those that are methylated later in that window still exhibit lower methylation levels by 6 dpp. Mature germ cells of Dnmt3L (+/-) males, however, do not seem to exhibit these defects in the same regions.

Studies of germline modulation of Dnmt3L expression In a study using a conditional Dnmt3a/Dnmt3L knock-in model, methylation imprints were not prematurely acquired in non-growing oocytes, despite increased DNMT3A and DNMT3L levels. When levels of DNMT3A and DNMT3L were elevated in growing-oocytes, however, this caused accelerated acquisition of methylation imprints in some regions. This suggests that, not only is the dosage of DNMT3A and DNMT3L important for imprint acquisition, but the timing is also critical, and a permissive state to DNA methylation is also required (Hara et al., 2014). In other words, even in the presence of DNA methylating enzymes, it seems that imprint acquisition can only occur within a specific window in the female germline. This is relevant to my project, as one of my research interests is the timing of DNA methylation acquisition, and whether patterns of DNA methylation in the male germline can only be set during the de novo methylation window.

In addition to the idea of timing of DNA methylation acquisition, another area of focus in my research is the concept of DNMT3L dosage. Previous studies have shown that decreasing DNMT3L levels in the male germline produces reproductive phenotypes associated with male germ cell hypomethylation (Arima at al., 2006; Bourc’his et al., 2001; Bourc’his & Bestor, 2004; LaSalle et al., 2007; Niles et al., 2011). An open question is whether increasing DNMT3L levels in the male germline also leads to reproductive anomalies, presumably via male germ cells hypermethylation. One study looked at the effects of dosage manipulation of Dnmt expression on the developmental fate of spermatogonial stem cells (SSCs), or germline stem (GS) cells. In one experiment, Dnmt3L overexpression was induced in GS cells. Although methylation at imprinted gene DMRs was not significantly altered, some repetitive elements, namely major and minor satellites, were hypermethylated in GS cells overexpressing Dnmt3L compared to control GS cells. When Dnmt3L-overexpressing and control GS cells were transplanted into the seminiferous tubules of mutant males lacking differentiated germ cells, the SSCs seeded properly in both groups. However, recipients of Dnmt3L-overexpressing GS cells had significantly smaller testes than recipients of control GS cells three months after transplantation, suggesting impaired spermatogenesis in the Dnmt3L overexpressors. A histological examination of seminiferous tubules revealed complete spermatocyte arrest as a result of Dnmt3L overexpression (Takashima et al., 2009). Although Dnmt3L overexpression in male germ cells was induced in vitro, this does suggest that increasing levels of DNMT3L in the male germline leads to reproductive abnormalities and corresponding methylation defects. A central question to my research project is whether Dnmt3L overexpression in vivo leads to similar phenotypes and DNA methylation anomalies.

PROJECT OUTLINE

The focus of my research project is to assess the effects of overexpressing DNMT3L in the male and female germlines, both in terms of how it affects DNA methylation patterns in the germline, and what reproductive outcomes this leads to. To my knowledge, a transgenic mouse model of male germline DNMT3L overexpression in vivo has never been created or studied.

It is of interest to study such a model because previous research has shown that lack of normal DNMT3L expression in the mouse germline, whether through Dnmt3L deficiency of haploinsufficiency, leads to abnormal reproductive outcomes which correlate with hypomethylation of DNA in the germ cells of these animals (Arima at al., 2006; Bourc’his et al., 2001; Bourc’his & Bestor, 2004; LaSalle et al., 2007; Niles et al., 2011). This suggests that appropriate DNMT3L dosage is critical to proper methylation acquisition and normal reproduction. I therefore hypothesized that transgenic DNMT3L overexpression would lead to hypermethylation of germ cells, and would also cause abnormal reproductive outcomes. Also, looking at the propagation of a transgene overexpressing DNMT3L through multiple generations would be interesting because it allows the study of potential transgenerational inheritance of methylation defects. In a mouse model of Dnmt3L haploinsufficiency, male offspring of Dnmt3L (+/-) males had an increased incidence of aneuploidy, even though these offspring had a Dnmt3L (+/+) genotype, making Dnmt3L a paternal effect gene (Chong et al., 2007). I therefore hypothesized that the abnormal methylation patterns and reproductive outcomes, which I predict will result from transgenic DNMT3L overexpression, will worsen through successive generations of transgene transmission.

The first goal of my research project was to propagate a Dnmt3L transgene through the mouse male and female germlines, respectively, and assess any phenotypes in successive generations of transgene transmission. My predecessor on this project, Mena Farag, performed the transgene construction and generated the founder animals. The full details of the EF1α- Dnmt3L transgene construction are described in his Master’s thesis. This construct contains an Internal Ribosomal Entry Sequence (IRES) which is downstream of a human Elongation Factor

1 Alpha (EF1-α) promoter and Dnmt3L cDNA, and upstream of an enhanced Ac-GFP reporter (Figure 4). This allows for a single transcript of the Dnmt3L and Ac-GFP reporter genes from the same promoter, yet two separate protein products due to the separation by the IRES, such that the GFP protein does not interfere with the structure of DNMT3L. Ten transgene-positive animals were produced and made up the founder population, comprised of 3 males and 7 females. I have mated these founders to wild-type mice, and have characterized the outcomes for several generations. These experiments will allow us to assess the phenotypic consequences of a higher-than-normal dosage of DNMT3L in the germline for the first time, and will serve as the first model of transgenerational epigenetic inheritance based on overexpression of a DNMT.

The second goal of my research project was to analyze methylation of EF1α-Dnmt3L transgenic sperm, to determine the impact of DNMT3L overexpression in the male germline. I have chosen to analyze DNA methylation using Reduced Representation Bisulfite Sequencing (RRBS). RRBS is a high-throughput sequencing technique and is very cost-effective, as it uses an enzymatic digestion leading to CpG enrichment, which allows us to sequence at least 5 million of the 30 million CpGs (Gu et al., 2011). Its methylation data output has been found to match other techniques previously used (Bock et al., 2010; Gu et al., 2011; Meissner et al., 2005; Smith et al., 2012). RRBS libraries have been prepared and sequenced, using mature sperm from both EF1α-Dnmt3L transgenic and non-transgenic animals from the F2 generation of transgene transmission, and compared to controls. This study is the first high-throughput, genome-wide DNA methylation analysis of sperm from animals overexpressing a DNA methyltransferase, and will allow us to determine whether any reproductive abnormalities caused by DNMT3L overexpression are associated with DNA methylation defects.

The third aim of my research project was to attempt a rescue of the infertility phenotype in Dnmt3L (-/-) males, using the EF1α-Dnmt3L transgene. As mentioned previously, these males do not produce any sperm, owing to a meiotic defect which causes the progressive depletion of germ cells in their seminiferous tubules (Bourc’his et al., 2001). The EF1α-Dnmt3L transgene has been shown to be expressed in spermatogonia (Furuchi et al., 2001), and therefore after the window of de novo methylation acquisition (mostly prenatally) and endogenous DNMT3L

expression. I have carried out matings of transgenic males with Dnmt3L (+/-) females, to ultimately produce trangene-positive, Dnmt3L (-/-) males. These males are endogenously deficient for Dnmt3L, yet have transgenic copies of Dnmt3L. This experiment will allow me to determine whether it is possible to partially or fully rescue normal DNA methylation patterns and/or fertility in Dnmt3L-deficient males. Also, due to the lack of overlap between endogenous and exogenous (transgenic) DNMT3L expression, it will allow us to determine whether the normal window of de novo methylation, during which there is mitotic quiescence of germ cells, is critical for the proper acquisition of methylation patterns.

METHODS

Mice

Procedures for all experiments involving mice were approved by the McGill University Animal Care Ethics Committee and in accordance with the Canadian Council on Animal Care. Wild-type mice (C57BL/6NHsd) crossed with transgenic mice were purchased from Harlan Laboratories (Montreal, Quebec). Dnmt3L mutant (KO) mice were a gift from Drs. Timothy Bestor and Deborah Bourc’his (Dnmt3Ltm1Bes) and have been described elsewhere (Bourc’his & Bestor, 2004). Wild-type mice (C57BL/6NCrl) crossed with Dnmt3L mutant mice were purchased from Charles River Laboratories (St-Constant, Quebec).

Characterization of transgene transmission to F1, F2 and F3

Determination of transgene copy number The number of transgene copies was determined using the Custom TaqMan Copy Number Assay Kit by Life Technologies (Cat. #4400294). The experiment was performed twice by Mena Farag using DNA from founders, and twice by myself using DNA from F1 animals.

Propagation of transgene from founder (F0) to F1, F2, and F3 Transgenic founder males and females were mated to wild-type mice to produce F1 animals. The day a litter was born was designated post partum day 0 (0 dpp), and the number of male and female pups at birth was recorded. Litters were weaned from their mothers at 21 days post partum (21 dpp), and the number of pups was again recorded. All pups were genotyped using transgene-specific primers designed by Mena Farag (Table 7). At ~2-2.5 months of age, transgenic F1 males born to transgenic founder males, and transgenic F1 females born to transgenic founder females, were mated with wild-type mice, to keep transgene transmission separate between male and female germlines, and so on with each new generation.

Measurement of reproductive organ weights The testes, epididymides, and seminal vesicles of adult males were dissected and weighed. The cauda was isolated from epididymides and sperm was extruded (described in following section) and frozen, for later DNA methylation analysis using RRBS.

Sperm collection The cauda was excised from freshly harvested epididymides and placed in PBS, and was cut and shaken to allow sperm to swim out. The supernatant was collected, and centrifuged to collect the sperm. The pellet was washed and resuspended several times with 0.45% NaCl to remove blood. Once clean, the sperm pellet was then frozen and kept at -80oC until use.

Assessment of the quality of seminiferous tubules Testes used for histological analysis were embedded in paraffin, then cut into serial sections (with every fifth section analyzed) and stained in Hematoxylin & Eosin at the McGill Centre for Bone and Periodontal Research (Montreal, Quebec). Sections were examined by light microscopy (400X magnification) and seminiferous tubules were categorized as “normal”, “abnormal”, and “Sertoli-cell-only”. Tubules that contained all germ cell types (spermatogonia, spermatocytes, and spermatids) densely packed were deemed “normal”. Tubules that were either not densely packed and/or with gaps, or missing one or more germ cell type(s) were deemed “abnormal”. Tubules that appeared completely depleted of germ cells were considered “Sertoli- cell-only” tubules. It is important to note that this apparent “Sertoli-cell-only” phenotype was assessed solely by visual inspection; the apparent absence of germ cells was not verified with markers. For each sample, 100 tubules were randomly sampled (n=3 for each group).

Sperm counts Hematocytometric sperm counts were performed as outlined by Robb et al. (1978), with modifications by Kelly et al. (2003). Weighed portions of frozen testes were thawed and placed in 5 mL of a homogenizing solution containing 0.9% NaCl, 0.1% merthiolate (Sigma, cat# T- 5125), and 0.5% Triton X-100 (BDH Chemicals, code # R04680). They were homogenized for 3 intervals of 15 seconds, separated by 10-second periods. The homogenate was diluted into PBS

(1/2 dilution), and 10 uL of the dilute homogenate was used for counting on a hemacytometer (average of 3-4 grids). The sperm counts were normalized per testis, as per this equation: Average # sperm/10uL x 104uL/mL x 5mL homogenate x dilution factor (2) / fraction of testis

Assessment of transgene expression in testis cross-sections by fluorescence microscopy Freshly harvested testes of transgenic and non-transgenic males were incubated at 4oC overnight in 4% paraformaldehyde (in PBS), and transferred to 30% sucrose. The testes were placed in OCT medium, and frozen in vapors of liquid nitrogen. Frozen testes were cut into 5 μm sections in a cryostat (Leica CM1850 microtome), and mounted on slides using VECTASHIELD Mounting Medium with DAPI (Catalog #H-1200, Lot #V0612, Vector Laboratories Inc., Burlingame, CA). The cryosections were observed using fluorescence microscopy.

Sperm DNA methylation analysis using RRBS

RRBS library preparation RRBS library preparation followed the protocol outlined by Gu et al. (2011), with one important modification adapted for sequencing in our lab (Magnus et al., 2014): unique barcodes were introduced at the end of library preparation, allowing sequencing of different samples in a single lane. Briefly, a method previously described (Alcivar et al., 1989; Oakes et al., 2007), using 25 phenol: 24 chloroform: 1 isoamyl alcohol (Invitrogen #15593-031) and proteinase K (Invitrogen #25530) was used to extract DNA from sperm from adult males (n=4 for each group). The purified sperm DNA was digested with Msp1 (NEB #R0106S). A dNTP solution (10 mM dATP, 1mM dCTP, and 1 mM dGTP, Life Technologies #10297018) and Klenow fragment (3’→5’ exo, NEB #M0212L) were mixed with the fragmented DNA for end-repair and A- tailing. Illumina Methylated Paired-End Adapters were ligated to the A-tailed fragments by T4 DNA ligase (NEB Cat. #M0202M). The fragments underwent bisulfite conversion for two rounds with the EpiTect Bisulfite kit (QIAGEN #59104). The barcoding was introduced during PCR amplification. A PCR assay previously designed in our lab was used to amplify DNA libraries, using Illumina Truseq DNA Adaptor barcodes and primers (Integrated DNA Technologies (IDT), Coralville, Iowa). Pfu Turbo Polymerase and buffers (Agilent Technologies

#600412) were used for PCRs. The amplified library was purified with magnetic beads (Agencourt, #000130), and sequenced.

RRBS library sequencing and methylation data analysis Sequencing and initial bioinformatics were done at the Genome Quebec Innovation Centre (Montreal, QC). Sequencing was performed using Illumina Hi-Seq 2000 technology, and the bioinformatics analysis was performed by Maxime Caron and Dr. Donovan Chan, with a software designed to process read data from the Hi-Seq 2000 sequencer. The software bsmap v2.6 (Xi & Li, 2009) was used to call methylation at cytosines and to align reads. The methylKit software (Akalin et al., 2012) was used for statistical analysis of differently methylated regions. The percentage of methylation was calculated based on the C/(C+T) ratio at each base, with read number and depth accounted for. A minimum of 5 reads was required for a base to be included in the analysis. For any given region, samples are weighted differently based on their relative read depths. One hundred base pair tiles were used, with a minimum of 5 CpG’s required per tile, and differential methylation defined as at least a 20% methylation difference between the averages of two different groups. Bioinformatic analysis of RRBS datasets is further detailed elsewhere (Xi & Li, 2009; Akalin et al. 2012).

Dnmt3L (-/-) infertility rescue experiment using the EF1α-Dnmt3L transgene

Generation of EF1α-Dnmt3L transgenic, Dnmt3L (-/-) males and females Transgene-positive F1 males were mated to Dnmt3L heterozygous (+/-) females. The offspring produced were genotyped for the transgene with transgene-specific primers, and for endogenous Dnmt3L using Dnmt3L knockout primers (Table 7). Some offspring were male, transgene-positive, and Dnmt3L heterozygous (+/-). At maturity (~2-2.5 months old), they were mated with Dnmt3L heterozygous (+/-) females. The offspring were genotyped as described above. Some male and female offspring were transgene-positive and Dnmt3L deficient (-/-), and were mated with wild-type animals at maturity to test their fertility. Mated females were weighed for 20 days following a copulatory plug, and then monitored for birth of a litter. If no litter was produced, their uterine horns were removed and examined for the presence of resorption sites.

Statistical Analysis All data were analyzed using the GraphPad Prism 6 computer software (GraphPad Prism 6, GraphPad Software, La Jolla, CA, USA). Average litter sizes (birth and weaning, respectively), average paired testes weights (F1, F2, and F3, respectively), F2 male sperm counts, and the number of normal, abnormal, and Sertoli-cell-only seminiferous tubules (F1 vs F2 high-copy transgenics) were analyzed using unpaired t-tests, with the Holm-Sidak method of correction for multiple comparisons, with a threshold of p-value < 0.05, and presented as the mean ± SEM. The number of normal, abnormal, and Sertoli-cell-only seminiferous tubules (controls, low transgenics, low non-transgenics, high transgenics, high non-transgenics) and F3 average paired testes weights (3L (+/+), TG- vs 3L (-/-), TG+ vs 3L (-/-), TG-) were analyzed using the One-Way ANOVA test, with a threshold p-value < 0.05, and presented as the mean ± SEM. The differentially methylated tiles were analyzed by counting the number of methylated and unmethylated CpG reads for each genomic region, and then applying a chi-square test to compare the methylation levels between the two samples, with a significance threshold of p- value <0.01, as previously described (Li et al., 2010).

RESULTS

Outcomes of Dnmt3L transgene overexpression, transmission through the male germline

Matings produced F1, F2 and F3 animals in male germline transgene transmission study The EF1α-Dnmt3L transgenic founder population having been established previously, founder males and females were mated to wild-type animals of the opposite sex, to propagate the transgene through the germlines across several generations, and assess reproductive outcomes. In this study’s breeding scheme, the transgene propagation through the male germline was kept separate from that through the female germline (Figure 5). Matings were carried out from founders to the F3 generation. In the male germline transmission experiment, the F1 and F2 generations were characterized for a range of reproductive outcomes, including the rate of transgene transmission, average litter size, reproductive organ weights, the quality of seminiferous tubules, and sperm counts. For simplicity, the three lineages of male germline transmission will be called low, mid, and high copy lineages from now on, where low = 6, mid = 67, and high = 263 transgene copies, respectively.

Transgene expression in male germ cells localized near basal lamina of seminiferous tubules First, the localization of transgene expression was examined in seminiferous tubules from cross-sections of cryopreserved testes of F1 males. Fluorescence microscopy was used to detect the transgene’s GFP reporter. The tubules from sections of non-transgenic males, used as controls, exhibited very little fluorescence in any of their germ cells (Figure 6A). By contrast, fluorescence was clearly detected in tubules from sections of transgenic males from the mid copy lineage (67 transgene copies), in the periphery of the tubules, close to the basal lamina (Figure 6B). This suggests that the EF1α-Dnmt3L transgene is expressed in spermatogonia, or early spermatocytes.

Rates of male germline transgene transmission to F1 and F2 were mostly normal in all lineages The rate of transgene transmission from founder males to the F1 generation was close to 50% in the low and mid copy lineages, respectively. In the high copy lineage, the rate of

transgene transmission was slightly lower than expected, though not significantly different from transmission rates in the low and mid copy lineages (Figure 7A). The rate of transgene transmission from the F1 to the F2 generation was very close to 50% in all three lineages (Figure 7B).

Significant decrease in average litter size from F1 to F2 in high copy lineage The low level of transgene transmission from founder to F1 animals in the high copy lineage (and also in most lineages of female germline transgene transmission), and the observation that fewer pups were often counted at weaning (~21 dpp) than at birth, suggested that the low rate of transmission was due to high early post-natal lethality of transgenic pups. I therefore determined the average litter size at birth and weaning for F1 and F2, respectively. There was no significant difference between the litter size at birth and weaning in either F1 or F2 in any lineage. When the litter size at birth was compared between F1 and F2, there was no significant difference in any lineage, though the low and high copy lineages displayed a trend to decrease from F1 to F2 (low: p = 0.177; mid: p = 0.310; high: p = 0.897) (Figure 8A). When the litter size at weaning was compared between F1 and F2, the trend to decrease was still present in the low copy lineage, though not significant. However, in the high copy lineage there was a significant decrease in litter size at weaning from F1 to F2 (low: p = 0.071; mid: p = 0.359; high: p = 0.036) (Figure 8B). The average litter size remained stable from birth to weaning in F1, from 8.00 to 7.86 pups per litter, whereas it dropped from 7.00 to 4.40 pups in F2.

No difference in reproductive organ weights between transgenic and non-transgenic males The decrease in average litter size at weaning from F1 to F2 in the high copy lineage suggested abnormalities in the reproductive organs of males from this lineage. The next step was therefore to measure the weight of testes, epididymides, and seminal vesicles of offspring in all three copy number lineages. For each generation of transgene transmission, the average weights of the reproductive organs were compared between transgenic and non-transgenic males (preliminary in F3). In the F1 generation, there was no significant difference between the average paired testes weight of transgenic and non-transgenic males in any of the three lineages (Figure 9A), nor was there any significant difference in the average paired testes to body weight ratios

(Table 1). The average weights of seminal vesicles were also compared, and there was no difference between transgenic and non-transgenic animals in any of the copy number lineages (Table 1), suggesting no difference in testosterone levels. Similarly, there was no significant difference in average paired testes weight (Figure 9B), average paired testes/body weight and average seminal vesicle weight (Table 1) between transgenic and non-transgenic males in any of the lineages in F2. Although the results in F3 are preliminary, there was no significant difference in average paired testes weight (Figure 9C), average paired testes to body weight, and average seminal vesicle weight (Table 1) between transgenic and non-transgenic males in the high copy number lineage. In the low copy lineage, significance was not determined for the same three comparisons, due to the low biological replicate (2) in the transgenic males. However, there does not appear to be a difference in any of the reproductive organ weights between transgenic and non-transgenic males (Figure 9C, Table 1). Interestingly, matings of F2 transgenic males of the mid copy lineage with wild-type females did not produce offspring, with the exception of a single litter with a lone (transgene-positive) male. The comparisons of organ weights were therefore not performed for the mid transgene copy lineage in F3.

No difference in sperm counts between F2 transgenic and non-transgenic males The reproductive organs of transgenic and non-transgenic males not being significantly different, I then compared transgenic and non-transgenic sperm counts in F2. F2 was chosen over F1 for this analysis, as a later generation of transgene transmission may be more likely to contain reproductive abnormalities. However, sperm counts were not significantly different between F2 transgenic and non-transgenic males in the low, mid, or high copy lineages (Figure 9D).

Decline in quality of seminiferous tubules in testis cross-sections of F1 males The sperm counts not differing between transgenic and non-transgenic males, I next wanted to look at more subtle reproductive abnormalities that might affect sperm production and fertility in future generations. I therefore assessed the quality of seminiferous tubules in testes of transgenic and non-transgenic animals. I qualified seminiferous tubules as being either “normal”, “abnormal”, or “Sertoli-cell-only”, and quantified the proportion of each type in each cross- section. In F1, I compared transgenic and non-transgenic males from the low and high transgene

copy lineages, respectively, to controls. The transgenic and non-transgenic males of both lineages had, on average, significantly fewer normal tubules than controls. Also, the transgenic males in the high copy lineage had significantly more Sertoli-cell-only tubules than controls (Figure 10A). This suggests that a male born to a transgenic father will have fewer normal seminiferous tubules than a control male, whether or not this male is transgene-positive.

Decline in quality of seminiferous tubules in testes of high-copy transgenics from F1 to F2 The high transgene copy lineage having so far the most reproductive abnormalities (average litter size and quality of seminiferous tubules), I therefore decided to compare the proportion of normal, abnormal, and Sertoli-cell-only tubules in high copy transgenic males in the F1 versus F2 generation. The F2 males had significantly fewer normal seminiferous tubules than F1 males, and a significantly greater proportion of Sertoli-cell-only tubules (Figure 10B).

Genome-wide DNA methylation analysis of transgenic, non-transgenic sperm in F1 and F2

DNA methylation levels are similar overall among transgenic, non-transgenic and control samples Having observed reproductive abnormalities in the first two generations of transgene transmission, particularly in the high copy lineage, I wanted to know whether those outcomes correlated with DNA methylation defects in the germ cells of these animals. I therefore extracted sperm from F1 and F2 transgenics and non-transgenics from the high copy lineage, and from controls. Reduced Representation Bisulfite Sequencing libraries were prepared from these sperm samples, and sent to Genome Quebec for sequencing. Within each of the 8 comparisons made, all samples had Pearson correlation values of r2=0.99 when compared to each other (data not shown). The number of 100 base-pair tiles that were differentially methylated (hyper- or hypomethylated) by at least 20% was very low in each of the comparisons, ranging from 73 (out of 208772 total tiles, or 0.035%, in F2 non-transgenics vs F2 transgenics) to 193 (out of 206058 total tiles, or 0.094%, in controls vs F1 non-transgenics) tiles (Table 2). The level of hyper- or hypomethylation of the majority of these differentially methylated tiles was not high. Across the 8 comparisons, the proportion of hypermethylated tiles with only a 20 to 30% methylation

difference ranged from 85.1 to 100% (Table 3). The proportion of hypomethylated tiles with a 20 to 30% methylation difference ranged from 83.3 to 97.7% (Table 4). Overall then, all of the samples were very similar to each other in terms of their methylation status. Further evidence of the similarity in methylation status among samples is the fact that samples didn’t cluster together as a group in any of the 8 comparisons performed (Figure 11).

Predominance of differently methylated tiles found in intergenic, intronic, and exonic regions Despite most tiles not being differently methylated, a trend did emerge within those tiles that were differentially methylated. For all 8 comparisons made, whether the tiles were hypermethylated or hypomethylated, the regions with the greatest proportion of differently methylated tiles were intergenic regions, intronic regions and exons, with intergenic regions representing the majority of differentially methylated regions (DMRs) in each case. Overall, the proportion of hypermethylated tiles in intergenic regions ranged from 47.6% to 70.6 %, and the proportion of hypomethylated tiles in intergenic regions ranged from 51.0% and 77.3%. The proportion of hyper- and hypomethylated tiles found in introns ranged from 11.8% to 25.3% and from 12.5% and 30.6%, respectively. The proportion of hyper- and hypomethylated tiles found in exons ranged from 8.3 % to 24.3% and from 4.0% to 12.3%, respectively (Tables 5 and 6).

Methylation in DMRs found in exons higher in transgenics vs controls, and F2 vs F1 transgenics In addition to the trend observed in the location of most DMRs, a pattern emerged in the average methylation levels among the different groups. In F1, the average methylation level of DMRs found within intergenic regions was about 10% lower in transgenic compared to control samples, which represented a significant difference (p<0.001). It was almost 20% lower in transgenic vs control samples (p<0.001), in those tiles found in introns (Figure 12B). In the F1 transgenic vs control comparison, the differentially methylated tiles found in intergenic and intronic regions combined make up 79.6% of all differentially methylated tiles, i.e. the large majority. By contrast, the average methylation level of tiles found in exons was about 10% higher in transgenics vs controls (p<0.001) (Figure 12B). The total number of differentially methylated tiles in this comparison was 103 (Figure 12A). When comparing F2 transgenics to controls, the average methylation level of tiles found in introns was higher in transgenics

(p<0.001), as was once again the case in tiles founds in exons (p<0.001) (Figure 12D). In F2, differentially methylated tiles found in intergenic regions made up 62.8% of DMRs, so once again most tiles had lower average methylation in transgenics than in controls. The total number of differentially methylated tiles in this comparison was 86 (Figure 12C). Another pattern was found when comparing methylation levels of DMRs in F2 transgenics vs F1 transgenics. The average methylation level of DMRs in F2 transgenics was about 20% higher than in F1 transgenics (p<0.001) in those tiles found in intergenic regions (62.8% of DMRs) and about 10% higher in F2 vs F1 transgenics (p<0.001) in tiles found in exons (Figure 12F). The total number of differentially methylated tiles in this comparison was 99 (Figure 12E). So in exons, the average level of methylation is higher in transgenics compared to controls in F1 and F2, and the methylation level of those tiles also increases from F1 to F2.

Methylation in DMRs in exons up in F2 non-transgenics vs controls, F2 vs F1 non-transgenics I then wanted to know whether the trends found in transgenic sperm were also present in non-transgenic sperm. In the F1 non-transgenic vs control comparison, the average methylation level of differentially methylated tiles found in exons was very similar between the non- transgenic and control group (Figure 13B). In the comparison of F2 non-transgenics vs controls, however, the average methylation level in those same tiles was higher in non-transgenics compared to controls, which represented a significant difference (p<0.001) (Figure 13D). Also, the average methylation of differentially methylated tiles found in intergenic regions, introns, and exons, respectively, was higher in F2 than in F1 non-transgenics (p<0.001 for each comparison, respectively) (Figure 13F).

Attempt to rescue infertility and methylation abnormalities in Dnmt3L deficient males

Generation of TG+, Dnmt3L (-/-) and TG-, Dnmt3L (-/-) males for infertility rescue Another goal of this project was to use the transgene to try correcting infertility in Dnmt3L (-/-) males. Matings were carried out to generate males endogenously deficient for Dnmt3L, yet having transgenic copies of Dnmt3L (Figure 14). These TG+, Dnmt3L (-/-) males also had non-transgenic littermates which were also Dnmt3L deficient, or TG-, Dnmt3L (-/-)

males (controls). Matings in the low copy lineage produced 2 TG-, Dnmt3L (-/-) control and 2 TG+, Dnmt3L (-/-) experimental males. Matings in the high copy lineage produced 1 TG-, Dnmt3L (-/-) control male and did not produce any TG+, Dnmt3L (-/-) experimental male.

Infertility in low copy control males Each of the control males from the low copy lineage was mated to 2 wild-type females, for two mating rounds, for a total of 8 females mated to control males. Six of the 8 females had copulatory plugs, and none of these females displayed a gain in body weight in the 20 days following, nor did they give birth (Figure 15A). After the 20 days, females were dissected and their uteri were examined for the presence of resorption sites. None was found in any of the females that had copulatory plugs. These results suggest infertility in control males.

Lack of fertility rescue in TG+, Dnmt3L(-/-) males from the low copy lineage The experimental males from the low copy lineage were mated to 2 wild-type females for two rounds, for a total of 8 mated females. Again, 6 of those 8 females had copulatory plugs. None of these females, however, displayed a large increase in body weight in the 20 days following, nor did any of them give birth (Figure 15B). None of them had any resorption sites in their uteri after 20 days. The males were each mated once more to two wild-type females, all of which had copulatory plugs. Those females were dissected 10 days following a copulatory plug, to rule out the possibility that they might have lost embryos at mid-gestation. However, none of these females had resorption sites. This suggests infertility in experimental males.

Infertility in high copy control males Matings in the high copy lineage generated one TG-, Dnmt3L (-/-) control male, which was mated to two wild-type females for two rounds. 3 of the 4 females plugged, but none of them had a rise in body weight in the next 20 days, nor did they give birth, and none had resorption sites (Figure 15C). This suggests infertility in high copy controls. None of the matings of high copy transgenics with Dnmt3L (+/-) females produced TG+, Dnmt3L (-/-) males.

Lack of fertility rescue in TG+, Dnmt3L (-/-) females from low and high copy lineages The matings to generate TG+, Dnmt3L (-/-) and TG-, Dnmt3L (-/-) males also produced 2 TG-, Dnmt3L (-/-) control females, both from the high transgene copy lineage, and 2 TG+, Dnmt3L (-/-) experimental females, one with low and one with high transgene copies, respectively. The two control females were each mated to a wild-type male twice, and neither of them plugged, unfortunately. Each of the two TG+, Dnmt3L (-/-) females was mated to a wild- type male for two rounds, and each one plugged both times. The low transgene copy female displayed an increase in body weight until about mid-gestation, followed by a return to baseline (pre-copulatory plug) levels (Figure 15D). The high copy transgenic female displayed a similar pattern (Figure 15E). The pattern of weight gain until mid-gestation in these females, followed by a reversal to pre-copulatory levels, is consistent with the documented loss of embryos at mid- gestation in Dnmt3L-deficient females, which are infertile (Arima et al., 2006). Hence these females were not dissected to verify the presence of resorption sites in their uteri. These results suggest infertility in the TG+, Dnmt3L (-/-) females in the low and high copy lineages.

No difference in paired testes weights of TG+, Dnmt3L (-/-) and TG-, Dnmt3L (-/-) males As the low copy, TG+, Dnmt3L (-/-) males appeared to be infertile, the next step was to compare the average paired testes weights of TG+ Dnmt3L (-/-) and TG- Dnmt3L (-/-) males. Following the rescue experiment matings, an additional TG+ Dnmt3L (-/-) male, and an additional TG- Dnmt3L (-/-) male, both from the low copy lineage, were born, and were included in this analysis. TG- Dnmt3L (-/-) males had paired testes weights that were significantly lower than TG-, Dnmt3L (+/+) males. Similarly, the paired testes weights of TG+, Dnmt3L (-/-) males were significantly lower than Dnmt3L (+/+) males. There was no significant difference between paired testes weights of TG+ and TG- Dnmt3L (-/-) males (Figure 16A). The relationship among the average paired testes/body weight ratios of these three groups is the same as that of paired testes weight ratios (Figure 16B). There was no significant difference between the average seminal vesicle weights of these three groups (Figure 16C). This suggests a failure of the transgene to restore normal testis sizes in low copy, TG+, Dnmt3L (-/-) males.

Characterization of the transgene model upon transmission through female germline

Low rate of transgene transmission from female founders to F1 in most lineages The focus of this thesis was the characterization of transmission of the EF1α-Dnmt3L transgene through the male germline. Transgene transmission through the female germline was not as extensively characterized. The rates of transgene transmission and average litter sizes for F1 and F2 were calculated, however. The rate of transgene transmission from the 7 founder females to F1 was low in all but one lineage. The lineage with the highest transgene copy number, 33, had a normal rate of transgene transmission to F1 (Figure 17A). This low rate of transgene transmission was accompanied by high loss of pups between birth and weaning in F1, such that there were few transgenic pups to use to propagate the lineages to F1 and F2. Therefore, the two lineages with the highest rate of transgene transmission and highest number of transgenic pups, the lineages with 10 and 33 transgene copies, were propagated to F2. Both lineages had a rate of transgene transmission from F1 to F2 that was close to 50% (Figure 17B).

Trend to decrease in average litter size between birth and weaning age Most lineages had a lower F1 average litter size at weaning than at birth, though not significant due to the low biological replicates. The lineage with 22 transgene copies produced two litters in F1, in which all pups died between birth and weaning (Figure 17C). In F2, both the lineage with 10 and 33 transgene copies had a slight decrease in average litter size from birth to weaning, though not significant (Figure 17D). The lineage with 33 copies had a lower average litter size than that with 10 copies in F2, though this was not the case in F1 (Figures 17C, D).

DISCUSSION

As part of the broader study of DNMT3L dosage in our lab, the overall goal of my research project was to determine the outcome of overexpressing transgenic Dnmt3L in the male and female germlines across several generations. I aimed to assess the effects of transgene expression both on reproduction and methylation patterns, and to use the transgene to attempt a correction of infertility in Dnmt3L (-/-) mice.

Reproductive effects of EF1α-Dnmt3L transgene transmission through the male germline

My first aim was to study the reproductive impact of transgenic EF1α-Dnmt3L overexpression and transmission through germlines. Previous studies found that Dnmt3L deficiency or haploinsufficiency leads to abnormal reproductive outcomes (Bourc’his et al., 2001; Bourc’his & Bestor, 2004; Chong et al., 2007; LaSalle et al., 2007; Webster et al., 2005), suggesting that appropriate DNMT3L dosage is critical to reproduction. To further assess DNMT3L dosage, a mouse model of transgenic Dnmt3L overexpression was previously created in our lab. I carried out matings to propagate the EF1α-Dnmt3L transgene through the male and female germlines from founders to successive generations.

I first examined the timing and localization of expression of the EF1α-Dnmt3L transgene in the male germline, through activity of its GFP reporter by fluorescence microscopy. I detected fluorescence in cells located near the basal lamina of seminiferous tubules, in testis cross- sections from transgenic males from the mid copy lineage, whereas testis cross sections from non-transgenic males of the same lineage exhibited very low levels of fluorescence in comparison. This suggests that the EF1α-Dnmt3L transgene is expressed in spermatogonia and/or early spermatocytes, and is consistent with previous findings (Furuchi et al., 1996; S. Kimmins, personal communication). Also, this is not due to the insertion of the transgene, as the same pattern of expression was found in two independent lineages (low (data not shown) and mid transgene copy lineages). Note that the levels of DNMT3L expression have to be determined quantitatively in future experiments by qRT-PCR or Western Blot. Also, note that the truncated

form of the EF1α promoter, used in the transgene in our study, has been shown to be preferentially expressed in germ cells, in contrast to the EF1α gene being normally expressed in most tissues (Mizushima & Nagata, 1990; Uetsuki et al.,1989). The lack of EF1α-Dnmt3L transgene expression in tissues other than the germline will therefore have to be confirmed in future experiments.

I then determined the rate of transgene transmission from founder males to F1, and from F1 transgenic males to F2, as well as the average litter sizes at birth and weaning age (~21 days). The rate of transgene transmission was close to the expected rate of 50% in all lineages in F1 and F2, with the exception of a lower-than-expected rate of transmission of around 36% from from the high-copy founder male to F1. The high copy lineage also displayed a significant reduction in average litter size at weaning age from F1 to F2, going from 7.86 to 4.40 pups/litter, respectively. The latter value is quite low in comparison to the average litter size of 6.5 pups/litter for the C57BL/6NHsd mouse strain (Harlan Laboratories website), the background of EF1α-Dnmt3L transgenic mice in this study. This preliminary analysis suggested that overexpressing Dnmt3L in the high copy lineage might lead to reproductive abnormalities, and prompted a more in-depth look at organ weights and sperm counts.

When comparing the organ weights of transgenic and non-transgenic males, however, there was no significant difference in the average paired testes weights of the two groups in any of the lineages in F1, F2 or F3 (preliminary). Furthermore, there was no difference in sperm counts between transgenic and non-transgenic F2 males in any of the three lineages. This is interesting in terms of DNMT3L dosage, because Dnmt3L (-/-) animals have markedly reduced testis sizes, and don’t produce any sperm. Although transgene overexpression has yet to be confirmed in our model, the presumed increase in DNMT3L dosage in our EF1α-Dnmt3L transgenic males seems to have a much milder effect than Dnmt3L deficiency, as our transgenic males appear to have normal testis weights and sperm production, and are therefore able to reproduce. The average seminal vesicle weights were not significantly different between transgenic and non-transgenic males in any of the lineages either, suggesting normal testosterone levels in transgenic males.

The lack of an effect of EF1α-Dnmt3L transgene overexpression on male organ weights and sperm production prompted us to look for more subtle reproductive abnormalities which might explain the low rate of transgene transmission, and decrease in litter size from F1 to F2 seen in the high copy lineage. When comparing seminiferous tubules in testis cross sections from transgenic and non-transgenic F1 males from the low and high copy lineages to controls, each group had significantly fewer normal tubules, on average, than controls. The fact that this was true of non-transgenic as well as transgenic males is interesting, as it suggests that if a male was born to an EF1α-Dnmt3L transgenic father, that offspring will have spermatogenesis of lower quality, regardless of whether he himself bears the transgene. Dnmt3L has previously been described as the first identified “paternal effect gene”, when increased incidence of XO aneuploidy was found in wild-type males born to Dnmt3L haploinsufficient fathers. When comparing testis cross sections from F1 and F2 transgenic males in the high copy lineage, F2 males had significantly fewer normal tubules than F1 males, and significantly more tubules containing only Sertoli cells. This suggests a worsening trend from generation to generation. Also, Dnmt3L-deficient males are infertile because they do not produce any sperm (Bourc’his, 2001), and hence present the same phenotype in having tubules completely devoid of germ cells. The difference is that in our model, not all tubules contain only Sertoli cells, hence the fertility of these animals. However, the significant increase in Sertoli-cell-only tubules, from F1 to F2 in the high copy lineage, might lead to infertility if this trend continues in future generations.

On the discrepancy between the apparent effect of Dnmt3L overexpression on testicular histology, and the lack of effect of organ weights and sperm counts

It is interesting to note that overexpression of Dnmt3L in the present model leads to histological abnormalities in the testes, yet does not appear to have an effect on reproductive organ weights or germ cell production. Transgenic and non-transgenic males born to a transgenic father displayed a significant decrease in normal seminiferous tubules compared to control males, accompanied by a small (~10%) increase in tubules containing only Sertoli cells, and tubules where germ cell organization broke down and/or a germ cell type was missing. Furthermore, the number of such abnormal tubules significantly increased from F1 to F2 in the

high copy transgenics. Despite this apparent decline in the quality of spermatogenesis, the sperm counts in F2 transgenic males were not significantly different from those in F2 non-transgenic males. Furthermore, the testis and epididymidis weights in transgenic males were not significantly different from those in non-transgenic males in F1 or F2.

This discrepancy between the apparent effect of Dnmt3L overexpression on testicular histology, and the lack of effect of that same overexpression on reproductive organ weights and sperm counts, is in contrast to observations in two other studies, where modifying the dosage of a germline modulator of DNA methylation led not only to abnormal testicular histology, but also to abnormal testicular size and sperm counts. Dnmt3L-deficient male mice, for instance, also display impaired spermatogenesis. These males have seminiferous tubules containing only Sertoli cells, the result of a progressive depletion of germ cells due to meiotic arrest of spermatocytes. Unlike the Dnmt3L overexpressors of our model, however, Dnmt3L-deficient males show a marked reduction in testis size, and do not produce any sperm (Bourc’his & Bestor, 2004). Males in which Dnmt3a was conditionally knocked out only in the testes (full Dnmt3a knock-out males are not viable) display an almost identical phenotype to Dnmt3L- deficient males. These germline Dnmt3a-deficient males also have markedly smaller testes than wild-type counterparts, and are also azoospermic. Histological analysis of testes of these males reveals an almost complete absence of germ cells, with only a few spermatogonia, and no other germ cell type, present (Kaneda et al., 2004). Another study examined the function of MIWI2, a member of the Piwi clade of proteins, which are involved in transcriptional and post- transcriptional gene-silencing events. The other two members of the Piwi clade had been previously found to have key roles in spermatogenesis. Histological analysis revealed that testes of Miwi2-deficient mice lacked post-meiotic germ cell types, and there was a progressive depletion of germ cells with age, leading to many seminiferous tubules containing only Sertoli cells. These males did not produce mature sperm, and their testes were greatly reduced in size compared to wild-type males (Carmell et al., 2007). In another study, where a vector was used to target the Cbx3 gene, a hypomorphic allele was generated which led to barely detectable levels of HP1gamma, a structural heterochromatin protein. Males homozygous for this allele had severe hypogonadism, and testicular histology revealed impaired spermatogenesis, with most tubules

having very few germ cells and some having only Sertoli cells. Although sperm was not counted, no litter resulted from the mating of these males with wild-type females (Brown et al., 2010).

In all the models described above, reproductive abnormalities are not limited to impaired spermatogenesis, but extend to lowered sperm counts and/or smaller testis sizes. In the first three models, DNA methylation analyses correlate these phenotypic anomalies with methylation defects in germ cells. Studies in our lab during the perinatal window, using a methylation sensitive qPCR assay (qAMP), found that methylation levels in germ cells of Dnmt3L-deficient males were reduced by roughly 50% at many sites on chromosomes 4 and X (LaSalle et al., 2007), compared to wild-type levels, and similarly reduced to about 30% of wild-type levels at sites on chromosome 9 (Niles et al., 2011). DNA methylation analysis of spermatogonia from P11 testes of Dnmt3L (-/-) and germline-specific Dnmt3a knock-outs revealed that the normally paternally methylated H19 differentially methylated region (DMR) was unmethylated in both mutants, and that the Dlk1-Gtl2 DMR was unmethylated in Dnmt3a (-/-) mutants (Kaneda et al., 2004). In the study on MIWI2 function referred to above, testis DNA from Miwi2-deficient males was found to be hypomethylated in repeat elements compared to that from wild-type and heterozygous males. This demethylation was first identified by Southern blot analysis after digestion with HpaII, a methylation-sensitive enzyme, and then confirmed by bisulfite sequencing. The latter analysis revealed an average methylation level of 95% in heterozygotes in the first 150 base pairs of a specific repeat region, compared to 60% methylation in the homozygous mutants (Carmell et al., 2007). Therefore, the models described above correlate severe reproductive abnormalities with equally severe DNA methylation abnormalities.

In the present study, the large majority of sites that were differentially methylated, whether between transgenic and non-transgenic sperm, or between transgenic and control sperm, only exhibited a difference in average methylation levels between 20 to 30%. This is in contrast to the studies described above, where there is in most cases a large level of DNA demethylation in the germ cells of the respective mutant males. Also, many of the sites interrogated in the studies above displayed abnormal methylation in germ cells of mutant animals, whereas a very small proportion of sites analyzed in present study (ranging from 0.035% to 0.066% of all 100

base-pair tiles interrogated, in all comparisons of transgenic vs non-transgenic or control sperm) displayed abnormal methylation. In other words, the extent and the level of abnormal methylation seen in germ cells of transgenic males in our study is many orders of magnitude lower than in mutant germ cells in the studies above. The relatively subtle effect of overexpression of the Dnmt3L transgene on germ cell DNA methylation, seen in our model, might not be strong enough to cause severe reproductive abnormalities such as reduced testis size and decreased sperm counts, which seem to correlate with much greater methylation abnormalities in other studies. It may instead lead to much more subtle phenotypic effects, such as impaired spermatogenesis in only a fraction of all seminiferous tubules. It may take more than one generation for such subtle methylation defects to accumulate and result in the more severe reproductive phenotypes seen in other transgenic models. This idea is consistent with the worsening of the quality of spermatogenesis from F1 to F2 high copy transgenics.

Another key difference between the models described above and the present study is the respective proportions of seminiferous tubules containing only Sertoli cells. In all of the models above, nearly all seminiferous tubules displayed a Sertoli-cell-only phenotype. In the present study, by contrast, the proportion of seminiferous tubules of an apparent Sertoli-cell only phenotype was 10% or less in all groups in F1, and between 10 and 20% in the high copy transgenics in F2. This means that, unlike those other models, most tubules in testes of males in our model do produce germ cells and, ultimately, mature sperm. This would explain why sperm counts appear normal in our transgenic animals, in contrast to the azoospermia or oligospermia seen in those other models.

Effects of EF1α-Dnmt3L transgene overexpression on mature sperm DNA methylation

My second aim was to assess the effect of overexpressing transgenic Dnmt3L on DNA methylation in the male germline. Some subtle reproductive anomalies were detected in the high copy lineage during the characterization experiments. As I am interested in the correlation between DNA methylation and reproduction/fertility, I decided to examine sperm DNA methylation in transgenic and non-transgenic males from the high copy lineage in F1 and F2.

We analyzed DNA methylation in mature sperm on a genome-wide scale using a technique called Reduced Representation Bisulfite Sequencing (RRBS). This method uses enzymatic digestion to enrich the library in CpG content (Gu et al., 2011; Meissner et al., 2005), thereby making the method very cost-effective. Some limitations of RRBS have to be pointed out, however. Despite being genome-wide, RRBS is not a whole-genome sequencing technique; we can expect about 5 million of the 20 million CpGs in the total genome to be covered by the RRBS analysis (Bock et al., 2010; Gu et al., 2011; Meissner et al., 2005). Our sperm analysis, however, should be an accurate representation of methylation patterns across the genome, as the RRBS data outputs were found to be similar to those generated by other techniques (Bock et al., 2010; Gu et al., 2011; Meissner et al., 2005; Smith et al., 2012). Also, RRBS does not discriminate between 5mC and 5hmC marks, as neither are converted to thymines following bisulfite treatment. 5hmC is an intermediate in the DNA demethylation process, and most DNA methylation is completed by the pachytene spermatocyte stage of spermatogenesis in wild-type male germ cells (LaSalle et al., 2007; Niles et al., 2011; Oakes et al., 2006; Oakes et al., 2007), so most of the DNA methylation picked up by RRBS in mature sperm should be 5mC, not 5hmC. It should be noted, however, that a recent study found 5hmC marks in mature sperm, at the promoter or enhancer of the pluripotency genes Nanog, Lefty, Sox2, and Prdm14, which the authors suggest might facilitate the transition to the active state in the embryo (Hammoud et al., 2014).

The sequencing data was mapped to the mouse reference genome, and analyzed in 100 base-pair tiles to find regions with 20% or more difference in methylation levels between any two groups compared. Such regions were called differentially methylated regions (DMRs). High copy transgenic sperm was remarkably normal when compared to high copy non-transgenic sperm, or to control sperm. Whether F1 or F2 transgenic sperm was compared to F1 or F2 non- transgenic sperm, or to control sperm, the number of differentially methylated tiles was very low, ranging from 73 (out of 208772 total tiles, or 0.035%) to 140 (out of 213033 total tiles, or 0.066%) tiles. This is a very low number considering the millions of CpGs sequenced. Most of those differentially methylated tiles were not greatly hyper- or hypomethylated either, as the difference in methylation for the large majority of them ranged from 20 to 30%. Also, there did

not seem to be a great difference in the methylation patterns of F1 and F2 transgenics, with a total of 99 differentially methylated tiles (out of 211327 total tiles, or 0.047%) between the two groups. Specifically, F2 sperm had 74 hypermethylated and 25 hypomethylated tiles compared to F1 sperm. Again, the large majority of those tiles were differentially methylated by only 20 to 30%. There are limitations to these data, however, including once again the many more millions of CpGs not sequenced, which includes imprinted gene loci. Also, in all the comparisons performed, the Pearson correlation coefficient was r2 = 0.99, making each sample remarkably similar to any other. This raises the question of whether the differences in methylation between these samples is attributable to chance alone, such that any two wild-type samples might be as different from each other as any of the two compared here. This underscores the need to validate the DMRs found in this study using locus-specific techniques, such as pyrosequencing. Other genome-wide DNA methylation sequencing techniques are also available. The Infinium HumanMethylation27 assay is another bisulfite sequencing technique. It is a microarray-based method, and like RRBS, it provides single base-pair resolution and high accuracy of measurements of DNA methylation levels. The trade-off with these two bisulfite sequencing techniques, however, is the reduced genomic coverage compared to other methods based on methylated DNA library enrichment. Methylated DNA immunoprecipitation sequencing (MeDIP-seq), is one such enrichment-based technique, and it uses a 5-methylcytosine-specific antibody to recover methylated DNA fragments from DNA that has been broken up by sonication. Another enrichment based-technique is methylated DNA capture by affinity purification (MethylCap-seq), which utilizes a methyl-binding domain protein to retrieve methylated DNA that was also sonicated. Whereas these two methods achieve higher coverage than the bisulfite-based methods, they do not measure DNA methylation levels as accurately, presumably because they measure relative enrichment of methylated DNA rather than absolute levels of DNA methylation (Bock et al., 2010). When validating the sequencing results obtained in this study with another genome-wide sequencing technique, perhaps it would be best to use an enrichment-based technique rather than another bisulfite-based technique. Using a technique that has different biases than RRBS, and therefore different strengths and weaknesses, might lead to a more comprehensive picture of DNA methylation patterns. Using RRBS and/or one of these other techniques, it would be interesting to monitor methylation in high copy transgenic sperm in

F3 and beyond, to see how it compares to F1 and F2 sperm, and whether there is a trend toward an increase in methylation abnormalities with successive generations of transgene transmission.

Despite F1 and F2 transgenic sperm DNA methylation being remarkably similar, there is a trend toward hypermethylation of F2 transgenic sperm relative to F1 transgenic sperm among the tiles that are differentially methylated, raising the possibility that it is due to transgenerational epigenetic inheritance. Strictly speaking, a true transgenerational effect occurs when a change is initiated in one generation due to some trigger, and the effect is experienced in a successive generation, despite the latter generation not being exposed to the initial trigger (Heard & Martienssen, 2014). In our model, however, the assessment of transgenerational inheritance of DNA methylation abnormalities in F2 sperm, possibly due to transgenic overexpression of Dnmt3L in F1, is confounded by the fact that Dnmt3L is also overexpressed in the germline in F2. However, abnormal epigenetic marks are known to be transmitted from one generation to the next due to failure of germline reprogramming (Heard & Martienssen, 2014). As Dnmt3L overexpression levels should be the same in high-copy F1 and F2 transgenics, sperm DNA methylation levels should also be the same if there was perfect germline reprogramming in F2 transgenics. Instead, we observed relative hypermethylation in F2 sperm, suggesting a possible transgenerational effect. Ultimately, an evaluation of sperm DNA methylation in F3 and successive generations will tell whether this was due to random fluctuation or the transmission of methylation defects.

Despite the fact that most 100 base-pair tiles in all comparisons of sperm DNA methylation were not differentially methylated, some patterns did emerge. Within both the F1 and F2 comparisons of transgenic versus control sperm, the average methylation level of differentially methylated tiles found in exons was higher in transgenic sperm than in controls. This is as expected, given that the presumably much higher number of Dnmt3L copies in transgenic versus control germ cells should lead to hypermethylation in transgenic germ cells. In both the F1 transgenic vs control sperm and F2 transgenic vs control sperm comparisons, exons make up the second most represented genomic region where differentially methylated tiles are found. It might therefore be important that a large proportion of those DMRs are found in

functionally relevant regions. Furthermore, the average methylation level of differentially methylated tiles found in exons, in the comparison of F2 transgenic versus F1 transgenic sperm, is higher in F2 sperm. It would be interesting to look at high copy transgenic sperm from F3 and subsequent generations, to see if differentially methylated tiles found in exons get progressively hypermethylated in later generations, and whether this has functional consequences in time.

Another pattern emerged when comparing control sperm to F1 and F2 sperm, respectively. In both the F1 vs control and F2 vs control comparisons, those DMRs that were found in intergenic regions had a higher average methylation level in control compared to transgenic sperm. Unlike the hypermethylation of transgenic sperm found in exons, this hypomethylation of transgenic sperm is unexpected, and again this is because transgenic males should be overexpressing Dnmt3L, a DNA methylating enzyme, compared to controls. This is also important because the bulk of differentially methylated tiles were found in intergenic regions (in all comparisons).

How does overexpression of Dnmt3L lead to hypomethylation of sperm, rather than hypermethylation, in the majority of DMRs? There are a few potential explanations. The first has to do with the timing of exogenous (transgenic) Dnmt3L expression, which does not coincide with endogenous Dnmt3L expression. The activity of the EF1α promoter, and hence expression of transgenic Dnmt3L, occurs mostly in spermatogonia, and therefore post-natally (Furuchi et al., 1996, Kimmins, S., personal communication). By contrast, endogenous Dnmt3L expression peaks between E15.5-18.5, and the bulk of expression occurs pre-natally (LaSalle et al., 2004). The window of endogenous Dnmt3L expression is also the window of de novo DNA methylation, in which the Dnmt3a expression pattern mirrors that of Dnmt3L. Unless there is a physiological compensation to Dnmt3L upregulation, whereby Dnmt3a is also upregulated, overexpressing Dnmt3L outside of the normal window of de novo methylation would not lead to a corresponding increase in Dnmt3a expression. Therefore, transgenic overexpression of Dnmt3L in spermatogonia would lead to an excess of DNMT3L molecules compared to DNMT3A molecules. However, DNMT3A and DNMT3L associate in a tetramer complex, with 2 molecules of DNMT3A and two molecules of DNMT3L (Jia et al., 2007). If DNMT3L

molecules are saturated, perhaps the excess are recruiting limited DNMT3A molecules to sites that are normally unmethylated, leading to hypermethylation of transgenic sperm in some areas. This recruitment of DNMT3A to ectopic methylation sites might sequester DNMT3A away from sites that are normally methylated, leading to hypomethylation of transgenic sperm in other areas.

A second potential explanation for the observed hypomethylation is the disruption of other epigenetic modulators following Dnmt3L overexpression. DNA methylation and histone modifications influence each other; experimental targeting of one mark leads to changes in the other mark (Cedar & Bergman, 2009). In other DNMT3L dosage experiments, for instance, Dnmt3L haploinsufficiency led not only to hypomethylation of male germ cells (Niles et al., 2011; Niles et al., 2013), but also to chromatin anomalies (non-disjunction, aneuploidy) (Chong et al., 2007; Zamudio et al., 2011). Therefore a potential interaction of DNA and histone modifications resulting from transgenic Dnmt3L overexpression might cause the hypomethylation observed in sperm DNA of EF1α-Dnmt3L males.

Attempt to correct infertility in Dnmt3L (-/-) males using the EF1α-Dnmt3L transgene

The third aim of my project was to attempt a correction of infertility in Dnmt3L-deficient males using the EF1α-Dnmt3L transgene. The testes of these males are much smaller than those of wild type males, and they do not produce any sperm (Bourc’his et al., 2001; LaSalle et al, 2004). Matings were carried out between transgene-positive males and Dnmt3L heterozygous females for two generations, to produce TG +, Dnmt3L (-/-) males, thereby introducing transgenic copies of Dnmt3L on a background endogenously deficient in Dnmt3L. None of the females mated to low copy, TG +, Dnmt3L (-/-) males had a large increase in body weight, nor did they give birth. Their uteri did not show any resorption sites. The testis weights of TG +, Dnmt3L (-/-) males were not significantly different from those of TG -, Dnmt3L (-/-) males, but they were significantly lower than those of Dnmt3L (+/+) males. It therefore appears that TG +, Dnmt3L (-/-) males from the low copy lineage are infertile. Assuming that the Dnmt3L transgene is indeed expressed, the reason for its failure to rescue infertility in Dnmt3L (-/-) males might be

the timing of transgenic versus endogenous expression. Transgenic Dnmt3L is presumably expressed in spermatogonia (Furuchi et al., 1996; Kimmins, S., personal communication), in other words after the window of endogenous Dnmt3L expression, during which de novo methylation occurs. One of the reasons for choosing a transgenic model with a promoter active outside this window was to determine whether Dnmt3L expression in that window is critical to male fertility. The window from E14.5 to 2 dpp is one when gonocytes are mitotically quiescent, and it is thought that this quiescence is critical for proper establishment of DNA methylation patterns in germ cells (Bourc’his & Proudhon, 2008; LaSalle et al., 2004; Ueda et al., 2000). Dnmt3a expression and Dnmt3L expression overlap, peaking between E15.5 and E18.5 (LaSalle et al., 2004). DNMT3L is a cofactor that recruits DNMT3A to histone tails, and DNMT3A has catalytic methyltransferase activity, and is responsible for de novo methylation of germ cells (Hu et al., 2009; Ooi et al., 2007). Overexpressing Dnmt3L outside of the normal window of de novo methylation means that, unless there is a physiological compensation to also upregulate Dnmt3a, DNMT3A levels in germ cells will be much lower than those of DNMT3L. Our Dnmt3L transgene might have failed to rescue fertility due to low levels of DNMT3A when expressed.

Another possibility is that levels of transgenic DNMT3L were not high enough to restore methylation patterns in germ cells. Unfortunately, matings of high copy transgenic males to Dnmt3L heterozygous females did not produce any TG +, Dnmt3L (-/-) males, which would have allowed to test that possibility. It would be interesting to repeat those matings in the future.

Matings between transgenic males and Dnmt3L heterozygous females also produced two TG +, Dnmt3L (-/-) females, one from the low and one from the high copy lineage. Female mice deficient in Dnmt3L are infertile. When mated to wild-type males they get pregnant; however, all embryos die at mid-gestation (Arima et al., 2006). When TG +, Dnmt3L (-/-) females were mated with wild-type males, they did not gain a noticeable amount of weight after copulatory plugs were observed, nor did they give birth. Therefore, the TG +, Dnmt3L (-/-) females from the low and high copy lineages don’t seem fertile. Unlike in the male germline, however, in the female germline, exogenous and endogenous Dnmt3L expression presumably overlaps, so we would expect Dnmt3a expression to be upregulated at the time of transgenic Dnmt3L expression.

However, there was only one female per lineage, and each was only mated twice. More TG +, Dnmt3L (-/-) females should be generated and mated, before this apparent failure of the EF1α- Dnmt3L transgene to restore fertility in Dnmt3L-deficient females is conclusive.

Comparison of outcomes upon EF1α-Dnmt3L transgene transmission through male and female germlines

Work for my thesis focused mostly on the effects of transmission of the EF1α-Dnmt3L transgene through the male germline. However, as part of my first aim, I also characterized some reproductive outcomes of transmitting the transgene through the female germline, namely the rate of transgene transmission and average litter size. Although not a comprehensive assessment of the reproductive impact of transgenic Dnmt3L overexpression, it does allow for a comparison of the effect of EF1α-Dnmt3L transgene transmission through the male and female germlines.

Looking at the average litter sizes at birth versus weaning in F1, and the rate of transgene transmission to F1, in lineages of male versus female transgene transmission revealed some striking differences. Average litter sizes decreased from birth to weaning in most lineages of female germline transmission, whereas they remained stable in most lineages of male germline transmission. In total, 120 pups were born to male founders, and only 2 pups died by weaning age, representing a loss of 1.7%. By contrast, 132 pups were born to female founders, and 38 pups died by weaning age, representing a loss of 28.8% of all pups born. Of the 118 pups born to male founders that survived to weaning age, 53 were transgenic, which is a 44.9% transgene transmission rate, close to the expected rate of 50% transmission. By contrast, only 21 of the 94 pups born to female founders that survived to weaning age were transgenic, which is a low rate of transgene transmission, at 22.3%. This decreased offspring viability upon transgene transmission through the female germline might be understood by comparing the timing of endogenous versus exogenous Dnmt3L expression in the male and female germline. In the male germline, the bulk of endogenous Dnmt3L expression occurs pre-natally, between embryonic day 15.5 (E15.5) to 18.5 (E18.5), after which it tapers off until about 2 dpp, which does not overlap with the presumed timing of exogenous, or transgenic, Dnmt3L expression. Transgenic Dnmt3L

expression is under control of a truncated form of the EF1α promoter, presumed to be active post-natally, mainly in spermatogonia and growing oocytes (Furuchi et al., 1996; Kimmins, S., personal communication). In the female germline, endogenous Dnmt3L expression occurs entirely post-natally, in growing oocytes, which therefore presumably overlaps with exogenous Dnmt3L expression. As previous work has shown, when normal DNMT3L levels are disrupted, normal methylation patterns fail to be acquired during the window of de novo methylation, leading to reproductive abnormalities (Bourc’his & Bestor, 2004; Chong et al., 2007; LaSalle et al., 2007; Niles et al., 2011; Niles et al., 2013; Oakes et al., 2007; Webster et al., 2005). Overlap of endogenous and exogenous Dnmt3L expression during this window in the female germline could therefore lead to hypermethylation of germ cells and the observed phenotypes.

REFERENCES

Aapola, U., Lyle, R., Krohn, K., Antonarakis, S. E., & Peterson, P. (2001). Isolation and initial characterization of the mouse Dnmt3L gene. Cytogenet Cell Genet, 92(1-2), 122-126.

Aoki, A., Suetake, I., Miyagawa, J., Fujio, T., Chijiwa, T., Sasaki, H., & Tajima, S. (2001). Enzymatic properties of de novo-type mouse DNA (cytosine-5) methyltransferases. Nucleic Acids Res, 29(17), 3506-3512.

Arima, T., Hata, Kenichiro, Tanaka, S., Kusumi, M., Li, E., Kato, K., Shiota, K., Sasaki, H., & Wake, N. (2006). Loss of the maternal imprint in Dnmt3Lmat−/− mice leads to a differentiation defect in the extraembryonic tissue. Dev Biol, 297(2), 361-373.

Bartolomei, M. S., Webber, A. L., Brunkow, M. E., & Tilghman, S. M. (1993). Epigenetic mechanisms underlying the imprinting of the mouse H19 gene. Genes Dev, 7(9), 1663-1673.

Bartolomei, M. S., Zemel, S., & Tilghman, S. M. (1991). Parental imprinting of the mouse H19 gene. Nature, 351(6322), 153-155.

Bayne, E. H., & Allshire, R. C. (2005). RNA-directed transcriptional gene silencing in mammals. Trends Genet, 21(7), 370-373.

Benoit, G., & Trasler, J. M. (1994). Developmental expression of DNA methyltransferase messenger ribonucleic acid, protein, and enzyme activity in the mouse testis. Biol Reprod, 50(6), 1312-1319.

Bestor, T. H. (1990). DNA methylation: evolution of a bacterial immune function into a regulator of gene expression and genome structure in higher eukaryotes. Philos Trans R Soc Lond B Biol Sci, 326(1235), 179-187.

Bestor, T. H. (1992). Activation of mammalian DNA methyltransferase by cleavage of a Zn binding regulatory domain. EMBO J, 11(7), 2611-2617.

Bestor, T., Laudano, A., Mattaliano, R., & Ingram, V. (1988). Cloning and sequencing of a cDNA encoding DNA methyltransferase of mouse cells. The carboxyl-terminal domain of the mammalian enzymes is related to bacterial restriction methyltransferases. J Mol Biol, 203(4), 971-983.

Bestor, T. H., & Coxon, A. (1993). Cytosine methylation: the pros and cons of DNA methylation. Curr Biol, 3(6), 384-386.

Bestor, T. H. , & Tycko, B. (1996). Creation of genomic methylation patterns. Nat Genet, 12(4), 363-367.

Bock, C., Tomazou, E. M., Brinkman, A. B., Muller, F., Simmer, F., Gu, H., Jager, N., Gnirke, A., Stunnenberg, H., & Meissner, A. (2010). Quantitative comparison of genome-wide DNA methylation mapping technologies. Nat Biotechnol, 28(10), 1106-1114.

Bourc’his, D., Xu, G. L., Lin C. S., Bollman, B., & Bestor, T. H. (2001). Dnmt3L and the establishment of maternal genomic imprints. Science, 294(5551), 2536-2539.

Bourc’his, D., & Bestor, T. H. (2004). Meiotic catastrophe and retrotransposon reactivation in male germ cells lacking Dnmt3L. Nature, 431(7004), 96-99.

Bourc’his, D. & Proudhon, C. (2008). Sexual dimorphism in parental imprint ontogeny and contribution to embryonic development. Mol Cell Endocrinol, 282(1-2), 87-94.

Brown, J. P., Bullwinkel, J., Baron-Lühr, B., Billur, M., Schneider, P., Winking, H., Singh, P. B. (2010). HP1gamma function is required for male germ cell survival and spermatogenesis. Epigenetics Chromatin, 3(1), 9.

Carmell, M. A., Girard, A., van de Kant, H. J., Bourc'his, D., Bestor, T. H., de Rooij, D. G., Hannon, G. J. (2007). MIWI2 is essential for spermatogenesis and repression of transposons in the mouse male germline. Dev Cell, 12(4), 503-514.

Cedar, H., & Bergman, Y. (2009). Linking DNA methylation and histone modification: patterns and paradigms. Nat Rev Genet, 10(5), 295-304.

Chedin, F., Lieber, M. R., & Hsieh, C. L. (2002). The DNA methyltransferase-like protein DNMT3L stimulates de novo methylation by Dnmt3a. Proc Natl Acad Sci U S A, 99(26), 16916- 16921.

Chen, T., Ueda, Y., Xie, S., & Li, E. (2002). A novel Dnmt3a isoform produced from an alternative promoter localizes to euchromatin and its expression correlates with active de novo methylation. J Biol Chem, 277(41), 38746-38754.

Chong, S., Vickaryous, N., Ashe, A., Zamudio, N., Youngson, N., Hemley, S., Stopka, T., Skoultchi, A., Matthews, J., Scott, H. S., de Kretser, D., O’Bryan, M., Blewitt, M., & Whitelaw, E. (2007). Modifiers of epigenetic reprogramming show paternal effects in the mouse. Nat Genet, 39(5), 614-622.

Davis, T. L., Trasler, J. M., Moss, S. B., Yang, G. J., & Bartolomei, M. S. (1999). Acquisition of the H19 methylation imprint occurs differentially on the parental alleles during spermatogenesis. Genomics, 58(1), 18-28.

Davis, T. L., Yang, G. J., McCarrey, J. R., & Bartolomei, M. S. (2000). The H19 methylation imprint is erased and re-established differentially on the parental alleles during male germ cell development. Hum Mol Genet, 9(19), 2885-2894. de Rooij, D. G., & Russell, L. D. (2000). All you wanted to know about spermatogonia but were afraid to ask. J Androl, 21(6), 776-798.

Deaton, A. M., & Bird, A. (2011). CpG islands and the regulation of transcription. Genes & Dev, 25, 1010-1022.

Deaton, A. M., Webb, S., Kerr, A. R., Illingworth, R. S., Guy, J., Andrews, R., & Bird, A. (2011). Cell type-specific DNA methylation at intragenic CpG islands in the immune system. Genome Res, 21(7), 1074-1086.

Ehrlich, M., Gama-Sosa, M. A., Huang, L. H., Midgett, R. M., Kuo, K. C., McCune, R. A., & Gehrke, C. (1982). Amount and distribution of 5-methylcytosine in human DNA from different types of tissues of cells. Nucleic Acids Res, 10(8), 2709-2721.

Feinberg, A. P., & Tycko, B. (2004). The history of cancer epigenetics. Nat Rev Cancer, 4(2), 143-153.

Ferguson-Smith, A. C., Sasaki, H., Cattanach, B. M., & Surani, M. A. (1993). Parental-origin- specific epigenetic modification of the mouse H19 gene. Nature, 362(6422), 751-755.

Fouse, S. D., Shen, Y., Pellegrini, M., Cole, S., Meissner, A., Van Neste, L., Jaenisch, R., & Fan, G. (2008). Promoter CpG methylation contributes to ES cell gene regulation in parallel with Oct4/Nanog, PcG complex, and histone H3 K4/K27 trimethylation. Cell Stem Cell, 2(2), 160- 169.

Furuchi, T., Masuko, K., Nishimune, Y., Obinata, M., & Matsui, Y. (1996). Inhibition of testicular germ cell apoptosis and differentiation in mice misexpressing Bcl-2 in spermatogonia. Development, 122(6), 1703-1709.

Geiman, T. M., & Muegge, K. (2010). DNA methylation in early development. Mol Reprod Dev, 77(2), 105-113.

Goll, M. G., & Bestor, T. H. (2005). Eukaryotic cytosine methyltransferases. Annu Rev Biochem, 74, 481-514.

Gu, H., Smith, Z. D., Bock, C., Boyle, P., Gnirke, A., & Meissner, A. (2011). Preparation of reduced representation bisulfite sequencing libraries for genome-scale DNA methylation profiling. Nat Protoc, 6(4), 468-481.

Guenatri, M., Duffie, R., Iranzo, J., Fauque, P., & Bourc`his, D. (2013). Plasticity in Dnmt3L- dependent and -independent modes of de novo methylation in the developing mouse embryo. Development, 140(3), 562-572.

Hackett, J. A., Sengupta, R., Zylicz, J. J., Murakami, K., Lee, C., Down, T. A., & Surani, M. A. (2012). Germline DNA Demethylation Dynamics in Imprint Erasure Through 5- Hydroxymethylcytosine. Science, 339(6118), 448-452.

Hajkova, P., Erhardt, S., Lane, N., Haaf, T., El-Maarri, O., Reik, W., Walter, J., & Surani, A. M. (2002). Epigenetic reprogramming in mouse primordial germ cells. Mech Dev, 117(1-2), 15-23.

Hajkova, P., Jeffries, S. J., Lee, C., Miller, N., Jackson, S. P., & Surani, A. M. (2010). Genome- wide reprogramming in the mouse germ line entails the base excision repair pathway. Science, 329(5987), 78-82.

Hammoud, S. S., Low, D. H. P., Yi, C., Carrell, D. T., Guccione, E., & Cairns, B. R. (2014). Chromatin and Transcription Transitions of Mammalian Adult Germline Stem Cells and Spermatogenesis. Cell Stem Cell. Advance Access. doi: 10.1016/j.stem.2014.04.006

Hara, S., Takano, T., Fujikawa, T., Yamada, M., Wakai, T., Kono, T., & Obata, Y. (2014). Forced expression of DNA methyltransferases during oocyte growth accelerates the establishment of methylation imprints but not functional genomic imprinting. Hum. Mol. Genet. Advance Access. doi: 10.1093/hmg/ddu100

Hata, K., Okano, M., Lei, H., & Li, E. (2002). Dnmt3L cooperates with the Dnmt3 family of de novo methyltransferases to establish paternal imprints in mice. Development, 129(8), 1983-1993.

He, Y.-F., Li, B.-Z., Li, Z., Liu, P., Wang, Y., Tang, Q., Ding, J., Jia, Y., Chen, Z., Li, L., et al. (2011). Tet-mediated formation of 5-carboxylcytosine and its excision by TDG in mammalian DNA. Science, 333, 1303-1307.

Heard, E., & Martienssen, R. A. (2014). Transgenerational Epigenetic Inheritance: Myths and Mechanisms. Cell, 157(1), 95-109.

Holliday, R., & Pugh, J. E. (1975). DNA modification mechanisms and gene activity during development. Science, 187(4173), 226-232.

Horsthemke, B. (2014). In Brief: Genomic imprinting and imprinting diseases. J. Pathol., 232, 485–487.

Hu, Y. G., Hirasawa, R., Hu, J. L., Hata, K., Li, C. L., Jin, Y., Chen, T., Li, E., Rigolet, M., Viegas-Pequignot, E., Sasaki, H., & Xu, G. L. (2008). Regulation of DNA methylation activity through Dnmt3L promoter methylation by Dnmt3 enzymes in embryonic development. Hum Mol Genet, 17(17), 2654-2664.

Huckins, C. (1971). The spermatogonial stem cell population in adult rats. 3. Evidence for a long-cycling population. Cell Tissue Kinet, 4(4), 335-349.

Illingworth, R. S., Gruenewald-Schneider, U., Webb, S., Kerr, A. R. W., James, K. D., Turner, D. J., Smith, C., Harrison, D. J., Andrews, R., & Bird, A. P. (2010). Orphan CpG islands identify numerous conserved promoters in the mammalian genome. PLoS Genet, 6: e1001134.

Inoue, A., & Zhang, Y. (2011). Replication-dependent loss of 5-hydroxymethylcytosine in mouse preimplantation embryos. Science, 334(6053), 194.

Ito, S., Shen, L., Dai, Q., Wu, S. C., Collins, L. B., Swenberg, J. A., He, C., & Zhang, Y. (2011). Tet proteins can convert 5-methylcytosine to 5-formylcytosine and 5-carboxylcytosine. Science, 333, 1300-1303.

Jenuwein, T., & Allis, C. D. (2001). Translating the histone code. Science, 293(5532). 1074- 1080.

Jia, D., Jurkowska, R. Z., Zhang, X., Jeltsch, A., & Cheng, X. (2007). Structure of Dnmt3a bound to Dnmt3L suggests a model for de novo DNA methylation. Nature, 449(7159), 248-251.

Jue, K., Bestor, T. H., & Trasler, J. M. (1995). Regulated synthesis and localization of DNA methyltransferase during spermatogenesis. Biol Reprod, 53(3), 561-569.

Kaneda, M., Okano, M., Hata, K., Sado, T., Tsujimoto, N., Li, E. & Sasaki, H. (2004). Essential role for de novo DNA methyltransferase Dnmt3a in paternal and maternal imprinting. Nature, 429(6994), 900-903.

Kato, Y., Rideout, W. M., 3rd, Hilton, K., Barton, S. C., Tsunoda, Y., & Surani, M. A. (1999). Developmental potential of mouse primordial germ cells. Development, 126(9), 1823-1832.

Kelly, T. L., Li, E., & Trasler, J. M. (2003). 5-aza-2'-deoxycytidine induces alterations in murine spermatogenesis and pregnancy outcome. J. Androl., 24(6), 822-830.

Kiani, J., Grandjean, V., Liebers, R., Tuorto, F., Ghanbarian, H., Lyko, F., Cuzin, F., & Rassoulzadegan, M. (2013). RNA–Mediated Epigenetic Heredity Requires the Cytosine Methyltransferase Dnmt2. PLoS Genet 9(5): e1003498.

Lander, E. S., Linton, L. M., Birren, B., Nusbaum, C., Zody, M. C., Baldwin, J., ...., & Raymond, C. (2001). International Human Genome Sequencing, Consortium. (2001). Initial sequencing and analysis of the human genome. Nature, 409(6822), 860-921.

LaSalle, S., Mertineit, C., Taketo, T., Moens, P. B., Bestor, T. H., & Trasler, J. M. (2004). Windows for sex-specific methylation marked by DNA methyltransferase expression profiles in mouse germ cells. Dev Biol, 268(2), 403-415.

LaSalle, S., Oakes, C. C., Neaga, O. R., Bourc’his, D., Bestor, T. H., & Trasler, J. M. (2007). Loss of spermatogonia and wide-spread DNA methylation defects in newborn male mice deficient in DNMT3L. BMC Dev Biol, 7, 104.

LaSalle, S., & Trasler, J. M. (2006). Dynamic expression of DNMT3a and DNMT3b isoforms during male germ cell development in the mouse. Developmental Biology, 296(1), 71-82.

Law, J. A., & Jacobsen, S. E. (2010). Establishing, maintaining and modifying DNA methylation patterns in plants and animals. Nat Rev Genet, 11(3), 204-220.

Lees-Murdock, D. J., Shovlin, T. C., Gardiner, T., De Felici, M., & Walsh, C. P. (2005). DNA methyltransferase expression in the mouse germ line during periods of de novo methylation. Dev Dyn, 232(4), 992-1002.

Li, E. (2002). Chromatin modification and epigenetic reprogramming in mammalian development. Nat Rev Genet, 3(9), 662-673.

Li, J. Y., Lees-Murdock, D., J., Xu, G. L., & Walsh, C. P. (2004). Timing of establishment of paternal methylation imprints in the mouse. Genomics, 84(6), 952-960.

Li, Y., Zhu, J., Tian, G., Li, N., Li, Q., Ye, M., Zheng, H., Yu, J., Wu, H., Sun, J., et al. (2010). The DNA methylome of human peripheral blood mononuclear cells. PLoS Biol, 8(11):e1000533.

Lister, R., Pelizzola, M., Dowen, R. H., Hawkins, R. D., Hon, G., Tonti-Filippini, J., Nery, J. R., Lee, L., Ye, Z., Ngo, Q. M., Edsall, L., Antosiewicz-Bourget, J., Stewart, R., Ruotti, V., Millar,

A. H., Thomson, J. A., Ren, B., Ecker, J. R. (2009). Human DNA methylomes at base resolution show widespread epigenomic differences. Nature, 462(7271), 315-322.

Magnus, N., Garnier,D., Meehan, B., McGraw, S., Lee, T. H., Caron, M., Bourque, G., Milsom, C., Jabado, N., Trasler, J. M., Pawlinski, R., Mackman, N., & Rak, J. (2014). Tissue factor expression provokes escape from tumor dormancy and leads to genomic alterations. PNAS, 111(9), 3544-3549.

Margot, J. B., Ehrenhofer-Murray, A. E., & Leonhardt, H. (2003). Interactions within the mammalian DNA methyltransferase family. BMC Mol Biol, 4, 7.

Maunakea, A. K., Nagarajan, R. P., Bilenky, M., Ballinger, T. J., D'Souza, C., Fouse, S. D., Johnson, B. E., Hong, C., Nielsen, C., Zhao, Y., et al. (2010). Conserved role of intragenic DNA methyaltion in regulating alternative promoters. Nature, 466, 253-257.

Mayer, W., Niveleau, A., Walter, J., Fundele, R., & Haaf, T. (2000). Demethylation of the zygotic paternal genome. Nature, 403(6769), 501-502.

Meissner, A., Gnirke, A., Bell, G. W., Ramsahoye, B., Lander, E. S., & Jaenisch, R. (2005). Reduced representation bisulfite sequencing for comparative high-resolution DNA methylation analysis. Nucleic Acids Res, 33(18), 5868-5877.

Meissner, A., Mikkelsen, T. S., Gu, H., Wernig, M., Hanna, J., Sivachenko, A., Zhang, X., Bernstein, B. E., Nusbaum, C., Jaffe, D. B., Gnirke, A., Jaenisch, R., Lander, E. S. (2008). Genome-scale DNA methylation maps of pluripotent and differentiated cells. Nature, 454(7205), 766-770.

Mertineit, C., Yoder, J. A., Taketo, T., Laird, D. W., Trasler, J. M., & Bestor, T. H. (1998). Sex- specific exons control DNA methyltransferase in mammalian germ cells. Development, 125(5), 889-897.

Messerschmidt, D. M., Knowles, B. B., & Solter, D. (2014). DNA methylation dynamics during epigenetic reprogramming in the germline and preimplantation embryos. Genes Dev, 28, 812- 828.

Mizushima, S., & Nagata, S. (1990). pEF-BOS, a powerful mammalian expression vector. Nucleic Acids Res, 18(17), 5322.

Molaro, A., Hodges, E., Fang, F., Song, Q., McCombie, W. R., Hannon, G. J., & Smith, A. D. (2011). Sperm methylation profiles reveal features of epigenetic inheritance and evolution in primates. Cell, 146(6), 1029-1041.

Niles, K. M., Chan, D., LaSalle, S., Oakes, C. C., & Trasler, J. M. (2011). Critical period of nonpromoter DNA methylation acquisition during prenatal male germ cell development. PLoS One, 6(9), e24156.

Niles, K. M., Yeh, J. R., Chan, D., Landry, M., Nagano, M. C., & Trasler, J. M. (2013). Haploinsufficiency of the paternal-effect gene Dnmt3L results in transient DNA hypomethylation in progenitor cells of the male germline. Hum Reprod, 28(2), 519-530.

Norris, D. P., Patel, D., Kay, G. F., Penny, G. D., Brockdorff, N., Sheardown, S. A., & Rastan, S. (1994). Evidence that random and imprinted Xist expression is controlled by preemptive methylation. Cell, 77(1), 41-51.

Oakes, C. C., LaSalle, S., Robaire, B., & Trasler, J. M. (2006). Evaluation of a quantitative DNA methylation analysis technique using methylation-sensitive/dependent restriction enzymes and real-time PCR. Epigenetics, 1(3), 146-152.

Oakes, C. C., Kelly, T. L., Robaire, B., & Trasler, J. M. (2007). Adverse effects of 5-aza-2’- deoxycytidine on spermatogenesis include reduced sperm function and selective inhibition of de novo DNA methylation. J Pharmacol Exp Ther, 322(3), 1171-1180.

Oatley, J. M., & Brinster, R. L. (2008). Regulation of spermatogonial stem cell self-renewal in mammals. Annu Rev Cell Dev Biol, 24, 263-286.

Okano, M., Xie, S., & Li, E. (1998). Cloning and characterization of a family of novel mammalian DNA (cytosine-5) methyltransferases. Nat Genet, 19(3), 219-220.

Okano, M., Bell, D. W., Haber, D. A., & Li, E. (1999). DNA methyltransferases Dnmt3a and Dnmt3b are essential for de novo methylation and mammalian development. Cell, 99(3), 247- 257.

Ooi, S. K., Qiu, C., Bernstein, E., Li, K., Jia, D., Yang, Z., Erdjument-Bromage, H., Tempst, P., Lin, S. P., Allis, C. D., Cheng, X., Bestor, T. H. (2007). DNMT3L connects unmethylated lysine 4 of histone H3 to de novo methylation of DNA. Nature, 448(7154), 714-717.

Panning, B. & Jaenisch, R. (1996). DNA hypomethylation can activate Xist expression and silence X-linked genes. Genes Dev, 10(16), 1991-2002.

Paulsen, M., & Ferguson-Smith, A. C. (2001). DNA methylation in genomic imprinting, development, and disease. J Pathol, 195(1), 97-110.

Pollex, T., & Heard, E. (2012). Recent advances in X-chromosome inactivation research. Curr Opin Cell Biol, 24, 825-832.

Ratnam, S., Mertineit, C., Ding, F., Howell, C. Y., Clarke, H. J., Bestor, T. H., Chaillet, J. R., & Trasler, J. M. (2002). Dynamics of Dnmt1 methyltransferase expression and intracellular localization during oogenesis and preimplantation development. Dev Biol, 245(2), 304-314.

Reik, W. (2007). Stability and flexibility of epigenetic gene regulation in mammalian development. Nature, 447(7143), 425-432.

Reik, W., Dean, W., & Walter, J. (2001). Epigenetic reprogramming in mammalian development. Science, 293(5532), 1089-1093.

Robb, G.W., Amann, R.P. and Killian, G.J. (1978) Daily sperm production and epididymal sperm reserves of pubertal and adult rats. J. Reprod. Fertil., 54, 103–107.

Rose, N. R., & Klose, R. J. (2014). Understanding the relationship between DNA methylation and histone lysine methylation. Biochim Biophys Acta. Advance Access. doi: 10.1016/j.bbagrm.2014.02.007

Sado, T., & Ferguson-Smith, A. C. (2005). Imprinted X inactivation and reprogramming in the preimplantation mouse embryo. Hum Mol Genet, 14 Spec No 1, R59-64.

Sado, T., Okano, M., Li, E., & Sasaki, H. (2004). De novo DNA methylation is dispensable for the initiation and propagation of X chromosome inactivation. Development, 131(5), 975-982.

Saitou, M., Barton, S. C., & Surani, M. A. (2002). A molecular programme for the specification of germ cell fate in mice. Nature, 418(6895), 293-300.

Sakai, Y., Suetake, I., Shinozaki, F., Yamashima, S., & Tajima, S. (2004). Co-expression of de novo DNA methyltransferases Dnmt3a2 and Dnmt3L in gonocytes of mouse embryos. Gene Expr Patterns, 5(2), 231-237.

Santos, F., Hendrich, B., Reik, W., & Dean, W. (2002). Dynamic reprogramming of DNA methylation in the early mouse embryo. Dev Biol, 241(1), 172-182.

Saxonov, S., Berg, P., & Brutlag, D. L. (2006). A genome-wide analysis of CpG dinucleotides in the human genome distinguishes two distinct classes of promoters. Proc Natl Acad Sci, 103, 1312-1417.

Seki, Y., Hayashi, K., Itoh, K., Mizugaki, M., Saitou, M., & Matsui, Y. (2005). Extensive and orderly reprogramming of genome-wide chromatin modifications associated with specification and early development of germ cells in mice. Dev Biol, 278(2), 440-458.

Sharpe, R. (1994). Regulation of spermatogenesis. The physiology of Reproduction. Raven, New York, 1994.

Shen, L., Wu, H., Diep, D., Yamaguchi, S., D'Alessio, A. C., Fung, H.-L. Zhang, K., & Zhang, Y. (2013). Genome-wide analysis reveals TET- and TDG-dependent 5-methylcytosine oxidation dynamics. Cell, 153, 692-706.

Shovlin, T. C., Bourc’his, D., LaSalle, S., O’Doherty, A., Trasler, J. M., Bestor, T. H., & Walsh, C. P. (2007). Sex-specific promoters regulate Dnmt3L expression in mouse germ cells. Hum Reprod, 22(2), 457-467.

Siegfried, Z., & Simon, I. (2010). DNA methylation and gene expression. Wiley Interdiscip Rev Syst Biol Med, 2(3), 362-371.

Smith, F. M., Garfield, A. S., & Ward, A. (2006). Regulation of growth and metabolism by imprinted genes. Cytogenet Genome Res, 113(1-4), 279-291.

Smith, Z. D., Chan, M. M., Mikkelsen, T. S., Gu, H., Gnirke, A., Regev., A., & Meissner, A. (2012). A unique regulatory phase of DNA methylation in the early mammalian embryo. Nature, 484(7394), 339-344.

Steinberger, E., & Steinberger, A. (1975). Spermatogenic Function of the Testis. Handbook of Physiology. R. O. Greep and E. B. Astwood. Bethesda, MD, Am Physiol Soc, 5, 1-19.

Strausberg, R. L., Feingold, E. A., Grouse, L. H., Derge, J. G. Klausner, R. D., Collins, F. S., ..., & Marra, M. A. Mammalian Gene Collection Program Team. (2002). Generation and initial

analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci U S A, 99(26), 16899-16903.

Suetake, I., Shinozaki, F., Miyagawa, J., Takeshima, H., & Tajima, S. (2004). DNMT3L stimulates the DNA methylation activity of Dnmt3a and Dnmt3b through a direct interaction. J Biol Chem, 279(26), 27816-27823.

Surani, M. A., Ancelin, K., Hajkova, P., Lange, U. C., Payer, B., Western, P., & Saitou, M. (2004). Mechanism of mouse germ cell specification: a genetic program regulating epigenetic reprogramming. Cold Spring Harb Symp Quant Biol, 69, 1-9.

Surani, M. A., Hayashi, K., & Hajkova, P. (2007). Genetic and epigenetic regulators of pluripotency. Cell, 128(4), 747-762.

Suzuki, M. M., & Bird, A. (2008). DNA methylation landscapes: provocative insights from epigenomics. Nat Rev Genet, 9(6), 465-476.

Tahiliani, M., Koh, K. P., Shen, Y., Pastor, W. A., Bandukwala, H., Brudno, Y., Agarwal, S., Iyer, L. M., Liu, D. R., Aravind, L., et al. (2009). Conversion of 5-methylcytosine to 5- hydroxymethylcytosine in mammalian DNA by MLL partner TET1. Science, 324, 930-935.

Takada, S., Paulsen, M., Tevendale, M., Tsai, C. E., Kelsey, G., Cattanach, B. M., & Ferguson- Smith, A. C. (2002). Epigenetic analysis of the Dlk1-Gtl2 imprinted domain on mouse chromosome 12: implications for imprinting control from comparison with Igf2-H19. Hum Mol Genet, 11(1), 77-86.

Takashima, S., Takehashi, M., Lee, J., Chuma, S., Okano, M., Hata, K., Suetake, I., Nakatsuji, N., Miyoshi, H., Tajima, S., Tanaka, Y., Toyokuni, S., Sasaki, H., Kanatsu-Shinohara, M., Shinohara, T. (2009). Abnormal DNA methyltransferase expression in mouse germline stem cells results in spermatogenic defects. Biol Reprod, 81(1):155-64.

Trasler, J. M., Alcivar, A. A., Hake, L. E., Bestor, T. H., & Hecht, N. B. (1992). DNA methyltransferase is developmentally expressed in replicating and non-replicating male germ cells. Nucleic Acids Res, 20(10), 2541-2545.

Tremblay, K. D., Saam, J. R., Ingram, R. S., Tilghman, S. M., & Bartolomei, M. S. (1995). A paternal-specific methylation imprint marks the alleles of the mouse H19 gene. Nat Genet, 9(4), 407-413.

Tycko, B., & Morison, I. M. (2002). Physiological functions of imprinted genes. J Cell Physiol, 192(3), 245-258.

Ueda, T., Abe. K., Miura, A., Yuzuriha, M., Zubair, M., Noguchi, M., Niwa, K., Kawase, Y., Kono, T., Matsuda, Y., Fujimoto, H., Shibata, H., Hayashizaki, Y., & Sasaki, H. (2000). The paternal methylation imprint of the mouse H19 locus is acquired in the gonocyte stage during foetal testis development. Genes Cells, 5(8), 649-659.

Uetsuki, T., Naito, A., Nagata, S., & Kaziro, Y. (1989). Isolation and characterization of the human chromosomal gene for polypeptide chain elongation factor-1 alpha. J. Biol. Chem. 264(10), 5791-5798.

Walsh, C. P., & Bestor, T. H. (1999). Cytosine methylation and mammalian development. Genes Dev, 13(1), 26-34.

Walsh, C. P., Chaillet, J. R., & Bestor, T. H. (1998). Transcription of IAP endogenous retroviruses is constrained by cytosine methylation. Nat Genet, 20(2), 116-117.

Walsh, C., Glaser, A., Fundele, R., Ferguson-Smith, A., Barton, S., Surani, M. A., & Ohlsson, R. (1994). The non-viability of uniparental mouse conceptuses correlates with the loss of the products of imprinted genes. Mech Dev, 46(1), 55-62.

Weber, M., Hellmann, I., Stadler, M. B., Ramos, L., Paabo, S., Rebhan, M., & Schubeler, D. (2007). Distribution, silencing potential and evolutionary impact of promoter DNA methylation in the human genome. Nat Genet, 39(4), 457-466.

Webster, K. E., O’Bryan, M. K., Fletcher, S., Crewther, P. E., Aapola, U., Craig, J., Harrison, D. K., Aung, H., Phutikanit, N., Lyle, R., Meachem, S. J., Antonarakis, S. E., de Kretser, D. M., Hedger, M. P., Peterson, P., Carroll, B. J., Scott, H. S. (2005). Meiotic and epigenetic defects in Dnmt3L-knockout mouse spermatogenesis. Proc Natl Acad Sci U S A, 102(11), 4068-4073.

Weissenberger, D. J., Velicescu, M., Cheng, J. C., Gonzales, F. A., Liang, G., & Jones, P. A. (2004). Role of the DNA methyltransferase variant DNMT3b3 in DNA methylation. Mol Cancer Res, 2(1), 62-72.

Yoder, J.A., & Bestor, T. H. (1998). A candidate mammalian DNA methyltransferase related to pmt1p of fission yeast. Hum Mol Genet, 7(2), 279-284.

Yoon, B. J., Herman, H., Sikora, A., Smith, L. T., Plass, C., & Soloway, P. D. (2002). Regulation of DNA methylation of Rasgrf1. Nat Genet, 30(1), 92-96.

Zamudio, N. M., Scott, H. S., Wolski, K., Lo, C. Y., Law, C., Leong, D., Kinkel, S. A., Chong, S., Jolley, D., Smyth, G. K., de Kretser, D., Whitelaw, E., O'Bryan, M. K. (2011). DNMT3L is a regulator of X chromosome compaction and post-meiotic gene transcription. PLoS ONE, 6(3), e18276.

FIGURES

Figure 1. The DNA methyltransferase (DNMTs) enzymes are responsible for setting down methylation marks on DNA, and are grouped together based on conservation of a cytosine 5- methyltransferase motif in their catalytic domains, located in their C-terminus. DNMT1 is responsible for maintenance methylation upon DNA replication, whereas DNMT3a is involved in de novo methylation. DNMT3L is a germ-cell specific enzyme lacking catalytic methyltransferase activity, but is a DNMT3a co-factor which is critical for the proper establishment of DNA methylation patterns in both germlines and fertility. Adapted from Bourc’his et al. (2001).

Figure 2. DNA methylation dynamics in male and female gametogenesis. Common erasure of DNA methylation patterns in male and female germ cells, followed by sex-specific re-acquisition of methylation patterns via de novo methylation. DNA methylation patterns are mostly re- acquired pre-natally in the male germline, whereas they are entirely re-established post-natally in female germ cells. Adapted from Bourc’his et al. (2008).

Figure 3. Sex-specific patterns of expression of DNA methyltransferases (DNMTs) during male (top panel) and female (bottom panel) germ cell development. DNMT1 expression is shown in black, DNMT3a in blue, DNMT3b in green, and DNMT3L in red. The peaks of DNMT3L expression in each germline coincide with their respective peaks in de novo methylation. Adapted from LaSalle et al. (2004).

Figure 4. EF1α-Dnmt3L transgene construct, with Dnmt3L cDNA under the control of the human elongation factor alpha (EF1-α) promoter. An AcGFP reporter is separated from the EF1-α promoter and Dnmt3L by an internal ribosomal entry sequence (IRES).

Figure 5. Breeding scheme displaying the pattern of EF1α-Dnmt3L transgene transmission from founder animals to subsequent generations through the male and female germline, respectively. Transgene transmission through the male germline is kept separate from the female germline.

Figure 6. Fluorescence microscopy images of cross-sections of cryopreserved testes from a transgenic (TG+) and non-transgenic (TG-) male mouse born to a transgenic founder male, in an EF1α-Dnmt3L transgene male germline transmission experiment. Green = GFP; Blue = DAPI. Testes were dissected from a male from the mid copy lineage, with 67 transgene copies. White dotted lines indicate the edges of seminiferous tubules.

Figure 7. Rate of EF1α-Dnmt3L transgene transmission through the male germline, A. from founder males to F1 (low: n=32; mid: n=31; high: n=55), and B. from F1 transgenic males to F2 (low: n=26;mid: n=57; high: n=35). Displayed per lineage, each with a different transgene copy number, where low = 6, mid = 67, and high = 263 transgene copies.

Figure 8. Average litter sizes A. at birth, and B. at weaning (~21 dpp), compared between F1 (low: n=4; mid: n=5; high, n=7) and F2 (low: n=4; mid: n=7; high: n=5) generations of a male germline EF1α-Dnmt3L transgene transmission experiment. Comparisons are made per lineage of transgene transmission, each with a different transgene copy number, where low = 6, mid = 67, and high = 263 transgene copies.

Figure 9. Average paired testes weights in A. F1 (low, transgenic: n=6; low, non-transgenic: n=4; mid, transgenic: n=3; mid, non-transgenic: n=3; high, transgenic: n=11; high, non- transgenic: n=9), B. F2 (low, transgenic: n=10; low, non-transgenic: n=4; mid, transgenic: n=11; mid, non-transgenic: n=4; high, transgenic: n=4; high, non-transgenic: n=6), and C. F3 (low, transgenic: n=2; low, non-transgenic: n=4; high, transgenic: n=3; high, non-transgenic: n=5) males, from a male germline EF1α-Dnmt3L transgene transmission experiment, between transgenic and non-transgenic males. D. Sperm counts per testis in F2 males (low, transgenic: n=6; low, non-transgenic: n=4; mid, transgenic: n=5; mid, non-transgenic: n=3; high, transgenic: n=4; high, non-transgenic: n=6). Low = 6, mid = 67, and high = 263 transgene copies.

Figure 10. Quantification of normal, abnormal, and Sertoli-cell-only seminiferous tubules in A. F1 transgenic and non-transgenic males from low and high transgene copy lineages, vs controls (n=3 for all groups), and B. F1 and F2 high-copy transgenics (n=3 for all groups), in a male germline EF1α-Dnmt3L transgene transmission experiment. Low copy lineage = 6 transgene copies; high copy lineage = 263 transgene copies. In left image, asterisks (*) indicate significant difference from controls (Ctrl). In right image, asterisks indicate significant difference between groups compared. *p<0.05; **p<0.01

A B

C D

E F

G H

Figure 11. Clustering of sperm samples in a genome-wide methylation analysis by Reduced Representation Bisulfite Sequencing (RRBS), compared between A. F1 non-transgenics (blue) and controls (red), B. F1 transgenics (blue) and controls (red), C. F1 transgenics (blue) and F1 non-transgenics (red), D. F2 non-transgenics (blue) and controls (red), E. F2 transgenics (blue) and controls (red), F. F2 transgenics (blue) and F2 non-transgenics (red), G. F2 transgenics (blue) and F1 transgenics (red), and H. F2 non-transgenics (blue) and F1 non-transgenics (red), in a male germline EF1α-Dnmt3L transgene transmission experiment. Comparisons were performed in 100 base pair tiles, containing at least 5 CpGs per tile.

Figure 12. A. Number of differentially methylated 100 base pair tiles between sperm of F1 transgenic and control males, and distribution by genomic region. B. Average DNA methylation levels (%) of differentially methylated tiles between sperm of F1 transgenic and control males (intergenic regions: n=56; introns: n=26; exons: n=14). C. Number of differentially methylated 100 base pair tiles between sperm of F2 transgenic and control males, and distribution by genomic region. D. Average DNA methylation levels (%) of differentially methylated tiles between sperm of F2 transgenic and control males (intergenic regions: n=54; introns: n=13; exons: n=11). E. Number of differentially methylated 100 base pair tiles between sperm of F1 and F2 transgenic males, and distribution by genomic region. F. Average DNA methylation levels (%) of differentially methylated tiles between sperm of F1 and F2 transgenic males (intergenic regions: n=66; introns: n=19; exons: n=9). Tiles are considered differentially methylated when the difference in their methylation levels is at least 20%.

Figure 13. A. Number of differentially methylated 100 base pair tiles between sperm of F1 non- transgenic and control males, and distribution by genomic region. B. Average DNA methylation levels (%) of differentially methylated tiles between sperm of F1 non-transgenic and control males (intergenic regions: n=124; introns: n=33; exons: n=26). C. Number of differentially methylated 100 base pair tiles between sperm of F2 non-transgenic and control males, and distribution by genomic region. D. Average DNA methylation levels (%) of differentially methylated tiles between sperm of F2 non-transgenic and control males (intergenic regions: n=69; introns: n=26; exons: n=15). E. Number of differentially methylated 100 base pair tiles between sperm of F1 and F2 non-transgenic males, and distribution by genomic region. F. Average DNA methylation levels (%) of differentially methylated tiles between sperm of F1 and F2 non-transgenic males (intergenic regions: n=100; introns: n=35; exons: n=23). Tiles are considered differentially methylated when the difference in their methylation levels is at least 20%.

Figure 14. Breeding scheme displaying the pattern of EF1α-Dnmt3L transgene transmission through the male germline, from an F1 transgenic male to an F2 transgenic male, and finally to

F3 transgenic males and females. In each mating round, a transgenic male is mated to a Dnmt3L

(+/-) female, to produce transgenic animals endogenously Dnmt3L-deficient (Dnmt3L (-/-)).

Figure 15. Body weight of wild-type females for 20 consecutive days after the observation of a copulatory plug, following mating with a A. low copy, TG-, Dnmt3L (-/-) male, a B. low copy,

TG+, Dnmt3L (-/-) male and a C. high copy, TG-, Dnmt3L (-/-) male. Body weight of a D. low copy, TG+, Dnmt3L (-/-) female and a E. high copy, TG+, Dnmt3L (-/-) female for 20 consecutive days after the observation of a copulatory plug, following mating with a wild-type male. TG+: transgene-positive; TG-: transgene-negative, where transgene = EF1α-Dnmt3L transgene. Each line in a graph represents a different female.

100

Figure 16. Average A. paired testes weight B. paired testes/body weight and C. seminal vesicle weight in F3 animals from a male germline EF1α-Dnmt3L transgene transmission experiment, where transgenic positive (n=3) and negative (n=3) males, endogenously Dnmt3L-deficient (Dnmt3L (-/-)), are compared to each other and to Dnmt3L (+/+) (non-transgenic) controls (n=3).

101

Figure 17. Rate of EF1α-Dnmt3L transgene transmission through the female germline from A. founder females to F1 animals (n=25, n=14, n=4, n=24, n=6, n=15, n=21 for lineages with 3, 4, 5, 10, 14, 22, and 33 transgene copies, respectively), and from B. F1 females to F2 animals (n=29 and n=21 for lineages with 10 and 33 transgene copies, respectively), displayed per lineage, each with a different transgene copy number. Average litter size, per lineage, of C. F1 (n=3, n=3, n=2, n=3, n=3, n=2, n=3 for lineages with 3, 4, 5, 10, 14, 22, and 33 transgene copies, respectively) and D. F2 (n=4 and n=5 for lineages with 10 and 33 transgene copies, respectively) animals from the same female germline EF1α-Dnmt3L transgene transmission experiment.

102

Table 1. Average paired testes/body weight (mg/g), seminal vesicle weight (mg), paired epididymides weight (mg), and body weight (g), with standard error of the mean (SEM) for transgenic and non-transgenic males for 3 generations of male germline EF1α-Dnmt3L transgene transmission. Low copy = 6, mid copy = 67, and high copy = 263 transgene copies.

F1 testes/body wt seminal vesicle wt epididymidal wt body weight low copy mean ± SEM mean ± SEM mean ± SEM mean ± SEM TG 6.1 ± 0.3 71.1 ± 3.3 63.5 ± 1.8 30.7 ± 1.3 non-TG 6.2 ± 0.4 72.1 ± 2.5 67.3 ± 2.0 34.4 ± 1.9 N (TG; non-TG) (n=5; n=4) (n=5; n=3) (n=6; n=4) (n=5; n=4) mid copy mean ± SEM mean ± SEM mean ± SEM mean ± SEM TG 5.8 ± 0.4 76.1 ± 5.0 62.1 ± 4.7 30.3 ± 1.0 non-TG 5.4 ± 0.2 78.9 ± 3.9 61.0 ± 4.2 30.6 ± 1.0 N (TG; non-TG) (n=3; n=3) (n=3; n=3) (n=3; n=3) (n=3; n=3) high copy mean ± SEM mean ± SEM mean ± SEM mean ± SEM TG 5.8 ± 0.4 76.6 ± 2.8 60.7 ± 2.1 29.8 ± 1.6 non-TG 5.5 ± 0.4 74.5 ± 2.4 62.5 ± 2.9 31.8 ± 2.0 N (TG; non-TG) (n=10; n=9) (n=10; n=8) (n=10; n=8) (n=10; n=9) F2 testes/body wt seminal vesicle wt epididymidal wt body weight low copy mean ± SEM mean ± SEM mean ± SEM mean ± SEM TG 5.0 ± 0.2 74.4 ± 2.3 70.1 ± 1.3 37.0 ± 1.1 non-TG 4.4 ± 0.5 72.2 ± 4.7 74.3 ± 4.3 38.1 ± 0.8 N (TG; non-TG) (n=9; n=4) (n=8; n=3) (n=10; n=4) (n=9; n=4) mid copy mean ± SEM mean ± SEM mean ± SEM mean ± SEM TG 4.3 ± 0.3 75.4 ± 2.2 69.4 ± 2.1 40.7 ± 2.0 non-TG 4.8 ± 0.3 72.0 ± 2.3 72.7 ± 4.1 39.3 ± 1.4 N (TG; non-TG) (n=11; n=4) (n=8; n=3) (n=11; n=3) (n=11; n=4) high copy mean ± SEM mean ± SEM mean ± SEM mean ± SEM TG 4.0 ± 0.2 73.1 ± 3.2 72.1 ± 2.9 42.5 ± 2.1 non-TG 4.1 ± 0.1 71.7 ± 1.9 73.9 ± 2.1 42.3 ± 1.9 N (TG; non-TG) (n=4; n=6) (n=4; n=6) (n=4; n=6) (n=4; n=6) F3 testes/body wt seminal vesicle wt epididymidal wt body weight low copy mean ± SEM mean ± SEM mean ± SEM mean ± SEM TG 7.6 ± 0.1 73.5 ± 2.2 51.7 ± 1.8 25.3 ± 1.4 non-TG 7.1 ± 0.5 71.6 ± 2.6 55.3 ± 2.8 25.5 ± 0.9 N (TG; non-TG) (n=2; n=4) (n=2; n=4) (n=2; n=4) (n=2; n=4) high copy mean ± SEM mean ± SEM mean ± SEM mean ± SEM TG 7.1 ± 0.8 72.1 ± 1.1 61.0 ± 4.0 25.8 ± 2.2 non-TG 6.8 ± 0.5 72.9 ± 2.5 61.2 ± 3.5 26.7 ± 1.2 N (TG; non-TG) (n=3; n=5) (n=3; n=5) (n=3; n=5) (n=3; n=5) 103

Table 2. Number of hypermethylated and hypomethylated 100 base-pair tiles (at least 20% more (or less) methylated) in 8 different comparisons among control (n=4) as well as transgenic (n=4) and non-transgenic (n=4) sperm from F1 and F2 males in an EF1α- Dnmt3L transgene transmission experiment. Ctrl = controls, C57BL/6 strain; 1-TG = F1 transgenic males; 2-TG = F2 transgenic males; 1-NonTG = F1 non-transgenic males; 2-nonTG = F2 non-transgenic males. comparison (per tile) hyper hypo total 1-nonTG vs Ctrl 79 114 193 1-TG vs Ctrl 37 66 103 1-TG vs 1-nonTG 68 72 140 2-nonTG vs Ctrl 75 41 116 2-TG vs Ctrl 42 44 86 2-TG vs 2-nonTG 24 49 73 2-TG vs 1-TG 74 25 99 2-nonTG vs 2-TG 125 40 165

Table 3. Number of hypermethylated 100 base-pair tiles (at least 20% more methylated) split into hypermethylation ranging from 20 to 30%, and 30 to 50%, respectively, in 8 comparisons among control (n=4) as well as transgenic (n=4) and non-transgenic (n=4) sperm from F1 and F2 males in an EF1α-Dnmt3L transgene transmission experiment. Ctrl = controls, C57BL/6 strain; 1-TG = F1 transgenic males; 2-TG = F2 transgenic males; 1-nonTG = F1 non-transgenic males; 2-nonTG = F2 non-transgenic males. comparison (per tile) total hyper [20-30%) [30-50%) 1-nonTG vs Ctrl 79 73 6 1-TG vs Ctrl 37 36 1 1-TG vs 1-nonTG 68 62 6 2-nonTG vs Ctrl 75 70 5 2-TG vs Ctrl 42 42 0 2-TG vs 2-nonTG 24 24 0 2-TG vs 1-TG 74 63 11 2-nonTG vs 1-nonTG 125 115 10 104

Table 4. Number of hypomethylated 100 base-pair tiles (at least 20% less methylated) split into hypomethylation ranging from 20 and 30%, and from 30 to 50%, respectively, for 8 comparisons among control (n=4) as well as transgenic (n=4) and non-transgenic (n=4) sperm from F1 and F2 males in an EF1α-Dnmt3L transgene transmission experiment. Ctrl = controls, C57BL/6 strain; 1-TG = F1 transgenic males; 2-TG = F2 transgenic males; 1-nonTG = F1 non-transgenic males; 2-nonTG = F2 non-transgenic males. comparison (per tile) total hypo [20-30%) [30-50%) 1-nonTG vs Ctrl 114 97 17 1-TG vs Ctrl 66 60 6 1-TG vs 1-nonTG 72 60 12 2-nonTG vs Ctrl 41 39 2 2-TG vs Ctrl 44 43 1 2-TG vs 2-nonTG 49 47 2 2-TG vs 1-TG 25 22 3 2-nonTG vs 1-nonTG 40 38 2

Table 5. Distribution (%) of hypermethylated 100 base-pair tiles (at least 20% more methylated) split by genomic region, for 8 comparisons among control (n=4) as well as transgenic (n=4) and non-transgenic (n=4) sperm from F1 and F2 males in an EF1α-Dnmt3L transgene transmission experiment. Ctrl = controls, C57BL/6 strain; 1-TG = F1 transgenic males; 2-TG = F2 transgenic males; 1-nonTG = F1 non-transgenic males; 2-nonTG = F2 non-transgenic males. inter- promote non- hypermethylated intron exon 3'UTR 5'UTR TTS genic r-TSS coding 1-nonTG vs Ctrl 58.2 20.3 16.5 1.3 2.5 0.0 1.3 0.0 1-TG vs Ctrl 54.1 16.2 24.3 0.0 0.0 0.0 0.0 5.4 1-TG vs 1-nonTG 70.6 11.8 11.8 4.4 0.0 0.0 1.5 0.0 2-NonTG vs Ctrl 53.3 25.3 14.7 4.0 1.3 0.0 0.0 1.3 2-TG vs Ctrl 47.6 16.7 21.4 7.1 4.8 0.0 2.4 0 2-TG vs 2-nonTG 58.3 20.8 8.3 8.3 0.0 0.0 0.0 4.2 2-TG vs 1-TG 66.2 18.9 10.81 2.7 1.4 0.0 0.0 0.0 2-NonTG vs 1-NonTG 56.8 24.0 15.2 1.6 0.0 0.0 0.8 1.6 105

Table 6. Distribution (%) of hypomethylated 100 base-pair tiles (at least 20% less methylated) split by genomic region, for 8 comparisons among control (n=4) as well as transgenic (n=4) and non-transgenic (n=4) sperm from F1 and F2 males in an EF1α-Dnmt3L transgene transmission experiment. Ctrl = controls, C57BL/6 strain; 1-TG = F1 transgenic males; 2-TG = F2 transgenic males; 1-nonTG = F1 non-transgenic males; 2-nonTG = F2 non-transgenic males. inter- promoter- non- hypomethylated intron exon 3'UTR 5'UTR TTS genic TSS coding 1-NonTG vs Ctrl 68.4 14.9 11.4 3.5 0.9 0.0 0.0 0.9 1-TG vs Ctrl 54.5 30.3 7.6 4.5 0.0 0.0 0.0 3.0 1-TG vs 1-nonTG 68.1 13.9 11.1 1.4 1.4 0.0 2.8 1.4 2-NonTG vs Ctrl 70.7 17.1 9.8 2.4 0.0 0.0 0.0 0.0 2-TG vs Ctrl 77.3 13.6 4.5 2.3 2.3 0.0 0.0 0.0 2-TG vs 2-nonTG 51.0 30.6 12.2 2.0 2.0 2.0 0.0 0.0 2-TG vs 1-TG 68.0 20.0 4.0 4.0 0.0 0.0 0.0 4.0 2-NonTG vs 1-NonTG 72.5 12.5 10.0 0.0 2.5 0.0 0.0 2.5

Table 7. Dnmt3L transgenic (EF1α-Dnmt3L) and Dnmt3L knock-out (KO) PCR primers for mouse colony genotyping in an EF1α-Dnmt3L transgene germline transmission experiment. Forward (5' to 3') Reverse (5' to 3') Dnmt3L KO Wild-type GGTCCTTAGGGGTTCTGGAC TAGCTACCCGTGGCCAATAC Mutant GTTGGAGGATTGGGAAGACA CCATGGCATTGATCCTCTCT Dnmt3L transgene TG (EF1α-Dnmt3L) TTCCATTTCAGGTGTCGTGA CCTAAAACGCGACCAGAGAG

106