The Genetic Transformation of Jatropha Curcas

Total Page:16

File Type:pdf, Size:1020Kb

The Genetic Transformation of Jatropha Curcas The Genetic Transformation of Jatropha curcas Aurellia Whitmore Southern University at New Orleans & The Pennsylvania State University-Harrisburg The Phylogeny and Advantages of Jatropha Curcas Habitat: tropical & subtropical SEEDSAdvantagesare considered: anthelemintic in • GrowsBrazil. on marginal land LATEX(Pennsylvaniacontains has aan number alkaloid of abandonedknown as “Jatrophine” (having anti- mind landscancerous) properties.) BARK•Droughtyields resistance a dark blue dye used in the •Non foodPhilippines crop for coloring cloth, finishing nets and lines. Ranjan Parajuli “Jatropha Curcas and Its •30-40 % oil content in seed Potential Applications; A Compilation Paper on LEAVES are for fumigating houses Plantation and Application of Jatropha Curcas” •USED AS BIODIESEL http://www.environmental-http://gas2.org/2008/10/02/jatropha-from- against bed bugs, in Ghana. expert.com/Files/0/articles/73213/Jatropha.pdfhaitian-voodoo-to-biodiesel-holy-grail/ What is transformation and why is it important and helpful? A desired (single) gene of interest Combines multiple genes Introduce foreign genes simultaneously Rapidly generate plants with improved Mendelian Genetics (same species) varieties Enhance market value of the plant Challenge: Jatropha is susceptible to cold. Transformation with CBF3 can make it cold resistant. 1 Proof of concept for cold and drought tolerance induced by CBF3 demonstrated in Petunia and corn (Sairam et al, 2008) Plant 1: After exposure to -6° C ( 22°F) Plant 2: 2 Watered to saturation No watering for 15 days 24 hours after watering CBF NT Sairam R.V., Al-Abed, D., Johnson, J., Muzynski, M., Raab, M., Reddy, T.V. and Goldman, S.L. Maize. (2008) In: Kole, C., Hall, T.C. (eds) A Compendium of Transgenic Crop Plants 49-82. What are GUS, GFP, & CBF3 genes? CBF3 CBF3 A176 A. Agrobacterium Cell Rd29 CBF3-A354 CBF3-350 B. Agrobacterium DNA CBF3A478 C. Ti Plasmid CBF3 A-648 CBF3 A779 D. Plant Cell CBF3 Second Exon CBF3A-952 E. Plant Mitochondria CBF3 A1099 F. Plant Chloroplast CBF3A-1256 CBF3 A1403 G. Plant Nucleus CBF3 A-1400 a. T-DNA CBF3 A-1551 CBF3 A-1701 b. Vir genes c. Replication origin http://en.wikipedia.org/wiki/File:Transf ection_by_Agrobacterium.svg Procedures for Transformation In vitro germinated Embryos leaves Biolistic Agrobacterium-mediated transformation transformation Immerse in GUS, GFP and Coat gold with Plasmid DNA CBF3 cultures 20 mins. Load explants on Transfer explants to co- regeneration media. cultivation media. http://www.ag.ndsu.edu/pu Prepare gene gun. bs/plantsci/crops/a1219w.ht m Dark, 25° C, 72 hrs. FIRE! Procedure for GUS staining solution Transformation with GUS gene • Explants: Embryo & Leaf Explants from JAT: 1st picture- 6/17 Jat Embryo. 2nd picture- 7/22 Jat leaf invitro. Transformation with GFP EXPLANT: Leaf 7/22 Transformation with CBF3 Explant: Embryo Explants from 6/17/11 JPB exp. PCR Results Jatropha Jatropha Agrobacterium- Particle mediated BombardmentTransformation (GUS) (GFP) • Gradient PCR with different concentrations into different wells. Summary & Future Research SUMMARY .GUS and GFP expression was positive in PCR results. FUTURE RESEARCH .To perform molecular analysis for CBF3 .Develop Jatropha to be resistant to other abiotic and biotic stress. Industrial use of Jatropha Oil On January 7, 2009 Continental Airlines successfully completed a test flight from Houston, Texas using a 50/50 mixture of algae/Jatropha oil-derived biofuel & http://phx.corporate-ir.net/phoenix.zhtml? traditional Jet fuel in one of the 2 engines. c=85779&p=irol-newsArticle&ID=1241576 Acknowledgements • National Science Foundation (NSF) for their fellowship • The Pennsylvania State- Harrisburg • Ben Tabatabai (Mentor, tissue culture, transformation and procedures), Deepkamal Karelia(Biolistic Transformation)Mathew Ritzel (Molecular Analysis) • Dr. Puthiyaparambil Josekutty, Dr. Sairam Rudrabhatla • NSF-REU staff and colleagues Work Cited Continental Airlines Flight Demonstrates Use of Sustainable Biofuels as Energy Source for Jet Travelhttp://phx.corporate-ir.net/phoenix.zhtml?c=85779&p=irol-newsArticle&ID=1241576 Plant Transformation: Problems and strategies for Practical Application. R.G. Birch Department of Botany. The University of Queensland, Brisbane,4072, Australia Sairam R.V., Al-Abed, D., Johnson, J., Muzynski, M., Raab, M., Reddy, T.V. and Goldman, S.L. Maize. (2008) In: Kole, C., Hall, T.C. (eds) A Compendium of Transgenic Crop Plants 49-82. Agrobacterium-mediated transformation diagramhttp://en.wikipedia.org/wiki/File:Transfection_by_Agrobacterium.svg(Image) Bayer Crop Science, Jatropha: From Hatain vodoo biodiesal holy grain. http://gas2.org/2008/10/02/jatropha-from-haitian-voodoo-to-biodiesel-holy- grail/ (Images) http://www.biodiesel.org/pdf_files/fuelfactsheets/emissions.pdf http://www.environmental-expert.com/Files/0/articles/73213/Jatropha.pdf.
Recommended publications
  • Genetic Transformation Via Biolistic Gene Gun Method and Regeneration of Common Bean
    GENETIC TRANSFORMATION VIA BIOLISTIC GENE GUN METHOD AND REGENERATION OF COMMON BEAN E. A. Eissa Genetics Department, Faculty of Agriculture, Fayoum University, Fayoum, Egypt. ABSTRACT The objective of the present research was to utilize biotechnology to improve agronomical traits such as drought stress tolerance in common bean (Phaseolus vulgaris L.) as important recalcitrant crop species via a particle gun “GeneboosterTM” for the bombardment of plant tissues with DNA. The process involves the high velocity acceleration of microprojectiles carrying foreign DNA, penetration of the cell wall and membrane by microprojectiles, and delivery of the DNA into plant cells. The initial phase of the two common bean varieties “Fönix” and “Maxidor” focused on the development of a highly regenerable tissue culture procedure amenable to the particle gun physical method. The results showed that MS medium supplemented with 1 mg/l BA and 0.1 mg/l NAA were the optimal for shoot induction from meristematic ring of cotyledonary node explants in the both bean varieties. The author has developed a tissue culture protocol that enables the “meristematic ring” that develops below axillary shoots on nodal bean explants to produce shoot buds, and developed an electric-discharge particle acceleration procedure to produce transgenic plants in the two common bean varieties. The plasmid pFF19K, harboring the kanamycin resistance gene nptII as a selectable marker and pFF19-mtlD harboring the mtlD gene which confers mannitol (drought stress) tolerance were used for adapting transformation in the two common bean varieties. The results indicated that the successful delivery of plasmids DNA and efficient gene transfer into common bean meristematic tissues included 20 bar nitrogen pressure, 135 mm shooting distance, 1.1 µm diameter size of microprojectiles, and twice bombarding of the target tissues.
    [Show full text]
  • Direct Gene Transfer
    PLNT2530 Plant Biotechnology 2021 Unit 8b Direct Transformation with DNA Unless otherwise cited or referenced, all content of this presenataion is licensed under the Creative Commons License Attribution Share-Alike 2.5 Canada 1 Transformation by direct transfection of DNA into plants •It has long been observed that cells have mechanisms for incorporating free DNA into their chromosomes. •This seems to be an effect of the naturally-occurring DNA repair mechanisms. •Foreign DNA will often be integrated at random chromosomal sites •Therefore, if you can find a way to get DNA into the cell, you can probably transform the cell. 2 Gene Gun • Known as The "Gene Gun" method. • Also referred to as micro-projectile bombardment or biolistics (ballistics using biological components). • This technique is used for in vivo transformation and has been especially useful in transforming monocot species like corn and rice. 3 A Gene Gun shoots genes into plant cells. DNA is coated onto small particles of gold or tungsten approximately two microns in diameter. The particles are placed in a vacuum chamber and the plant tissue is placed below the chamber. The particles are propelled at high velocity using a short pulse of high pressure Helium gas into any target cell or tissue. 4 Two types of Gene Guns Fixed gun for cell culture Handheld gun for in-planta transformation 5 The real trick is to fire pellets with enough force to break into cell, but not so much as to go right through tissue. Must optimize distance, placement of tissue, dispersal of charge (don't want charge to all go in one place).
    [Show full text]
  • Inside the Biotech Lab: How to Genetically Engineer a Plant? Biotechnology Is One of the Most Controversial Fields of Science and Technology
    Inside the Biotech Lab: How to Genetically Engineer a Plant? Biotechnology is one of the most controversial fields of science and technology. Some people think that it is a highly complicated field of science, with questions raised against how things are done by scientists in the lab and what their real intentions are in developing genetically modified organisms (GMOs).The fear of the unknown sometimes becomes an excuse to exercise the precautionary principle, which could block the progress of biotech innovations. This booklet seeks to dispel fears about biotechnology by showing images of what actually happens inside the biotech laboratory. The process of developing a genetically engineered (GE) plant is explained using simple terms and images. The images in this booklet with ISAAA icon are available in a photo database for public use. Journalists and other media practitioners are encouraged to use the photos to better represent biotechnology in their articles and replace fear- mongering images that are widespread in the media, especially online. Genetic engineering enables direct transfer of gene/s between closely or distantly related organisms. Though How to modifications may also be done by removing DNA sequences to switch on/off of genes, this booklet focuses genetically on gene insertion. The two most common processes used in plant genetic transformation are particle bombardment and Agrobacterium tumefaciens-mediated transformation. engineer These methods require a gene of interest that codes for a specific favorable trait (such as insect resistance, herbicide tolerance, and drought tolerance, to name a few) and a a plant? target plant that needs the trait. 1 Gene cloning Cutting out the gene of interest from the DNA would have been easy if we’re dealing with something made of paper, but we’re not.
    [Show full text]
  • Chapter 7 Heliosr Gene Gun–Mediated Transfection of the Inner
    Chapter 7 HeliosR Gene Gun–Mediated Transfection of the Inner Ear Sensory Epithelium Inna A. Belyantseva Abstract Helios R Gene Gun–mediated transfection is a biolistic method for mechanical delivery of exogenous DNA into cells in vitro or in vivo. The technique is based on bombardment of a targeted cellular surface by micron- or submicron-sized DNA-coated gold particles that are accelerated by a pressure pulse of compressed helium gas. The main advantage of Helios R Gene Gun–mediated transfections is that it functions well on various cell types, including terminally differentiated cells that are difficult to transfect, such as neurons or inner ear sensory hair cells, and cells in internal cellular layers, such as neurons in organotypic brain slices. The successful delivery of mRNA, siRNA, or DNA of practically any size can be achieved using biolistic transfection. This chapter provides a detailed description and critical evaluation of the methodology used to transfect cDNA expression constructs, including green fluorescent protein (GFP) tagged full-length cDNAs of myosin XVa, whirlin, and β-actin, into cultured inner ear sensory epithelia using the Bio-Rad Helios R Gene Gun. Key words: Biolistic, transfection, Gene Gun, culture, ear, hair cell, stereocilia, myosin, whirlin, actin, immunofluorescence, GFP. 1. Introduction Mammalian inner ear sensory epithelia of hearing and balance end-organs (organ of Corti and vestibular epithelia, respectively) are tiny delicate tissues embedded in a bony labyrinth of the tem- poral bone and are not readily accessible for non-traumatic, non- surgical interventions. Using explanted (cultured) rodent inner ear neurosensory epithelium, one can study the development and function of these sensory cells (1, 2) as well as investigate the effects of epitope-tagged cDNA constructs that are trans- fected into particular cell types of the inner ear of mice and Bernd Sokolowski (ed.), Auditory and Vestibular Research: Methods and Protocols, vol.
    [Show full text]
  • Genetic Engineering and Sustainable Crop Disease Management: Opportunities for Case-By-Case Decision-Making
    sustainability Review Genetic Engineering and Sustainable Crop Disease Management: Opportunities for Case-by-Case Decision-Making Paul Vincelli Department of Plant Pathology, 207 Plant Science Building, College of Agriculture, Food and Environment, University of Kentucky, Lexington, KY 40546, USA; [email protected] Academic Editor: Sean Clark Received: 22 March 2016; Accepted: 13 May 2016; Published: 20 May 2016 Abstract: Genetic engineering (GE) offers an expanding array of strategies for enhancing disease resistance of crop plants in sustainable ways, including the potential for reduced pesticide usage. Certain GE applications involve transgenesis, in some cases creating a metabolic pathway novel to the GE crop. In other cases, only cisgenessis is employed. In yet other cases, engineered genetic changes can be so minimal as to be indistinguishable from natural mutations. Thus, GE crops vary substantially and should be evaluated for risks, benefits, and social considerations on a case-by-case basis. Deployment of GE traits should be with an eye towards long-term sustainability; several options are discussed. Selected risks and concerns of GE are also considered, along with genome editing, a technology that greatly expands the capacity of molecular biologists to make more precise and targeted genetic edits. While GE is merely a suite of tools to supplement other breeding techniques, if wisely used, certain GE tools and applications can contribute to sustainability goals. Keywords: biotechnology; GMO (genetically modified organism) 1. Introduction and Background Disease management practices can contribute to sustainability by protecting crop yields, maintaining and improving profitability for crop producers, reducing losses along the distribution chain, and reducing the negative environmental impacts of diseases and their management.
    [Show full text]
  • Genetic Transformation of Metroxylon Sagu (Rottb.) Cultures Via Agrobacterium-Mediated and Particle Bombardment
    Hindawi Publishing Corporation BioMed Research International Volume 2014, Article ID 348140, 9 pages http://dx.doi.org/10.1155/2014/348140 Research Article Genetic Transformation of Metroxylon sagu (Rottb.) Cultures via Agrobacterium-Mediated and Particle Bombardment Evra Raunie Ibrahim,1 Md. Anowar Hossain,2,3 and Hairul Azman Roslan2 1 CRAUNResearchSdn.Bhd.,93055Kuching,Sarawak,Malaysia 2 Genetic Engineering Laboratory, Department of Molecular Biology, Faculty of Resource Science and Technology, Universiti Malaysia Sarawak, 94300 Kota Samarahan, Sarawak, Malaysia 3 Department of Biochemistry and Molecular Biology, University of Rajshahi, Rajshahi 6205, Bangladesh Correspondence should be addressed to Hairul Azman Roslan; [email protected] Received 14 July 2014; Revised 27 August 2014; Accepted 27 August 2014; Published 11 September 2014 Academic Editor: Rodomiro Ortiz Copyright © 2014 Evra Raunie Ibrahim et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Sago palm (Metroxylon sagu) is a perennial plant native to Southeast Asia and exploited mainly for the starch content in its trunk. Genetic improvement of sago palm is extremely slow when compared to other annual starch crops. Urgent attention is needed to improve the sago palm planting material and can be achieved through nonconventional methods. We have previously developed a tissue culture method for sago palm, which is used to provide the planting materials and to develop a genetic transformation procedure. Here, we report the genetic transformation of sago embryonic callus derived from suspension culture using Agrobacterium tumefaciens and gene gun systems.
    [Show full text]
  • Bayer Cropscience Contaminates Our Rice
    Bayer e CropScience contaminates our rice greenpeace.org Campaigning for Sustainable Agricultur Greenpeace is an independent global campaigning organisation that acts to change attitudes and behaviour, to protect and conserve the environment and to promote peace. Contents A Contamination Nightmare 3 US Export markets impacted by GE contamination 4 Key dates in the LL rice scandals 5 The situation now 6 LL601 and other Bayer GE rice varieties 7 Should consumers be worried about eating LL rice? 7 Contamination threats 8 Bayer CropScience 9 Rice facts 9 Securing a Healthy Industry - Conclusion and Demands 10 End Notes 11 For more information contact: [email protected] JN 085 Published in October 2007 by Greenpeace International Ottho Heldringstraat 5 1066 AZ Amsterdam The Netherlands Tel: +31 20 7182000 Fax: +31 20 5148151 greenpeace.org Cover image: ©Greenpeace/Novis Bayer CropScience contaminates our rice The following is a summary of events Japan and Korea imposed equally strict testing requirements, surrounding one of the worst cases of genetic followed some months later by the Philippines when engineering contamination of food in history Greenpeace revealed contamination there. Russia and Bulgaria imposed bans on US rice and Mexico, Iraq and and one of the most damaging events in the Canada imposed test and certification requirements on history of the US rice industry. imports. The United Arab Emirates required a GE free guarantee. (5) The devastation has been caused by the multinational company Bayer CropScience - which maintains that the contamination As of July 2007, Greenpeace has identified 30 countries wasn't their fault - it was an 'act of God'.
    [Show full text]
  • (Genetically Modified Organisms (Plants) Genetically Engineered Plants)) Why Create Transgenic Plants?
    Transgenic Plants (Genetically modified organisms (plants) Genetically engineered plants)) Why create transgenic plants? When there is no naturally occurring genetic variation for the target trait. Examples: 1. Glyphosate herbicide resistance in soybean, corn 2.Vitamin A in rice 3.Blue roses What genes to transfer? 1. One gene to a few genes - the CP4 ESPS example 2. Multiple genes - Golden Rice and Applause rose 3. In principle, any gene (or genes) ORIGIN 1 cctttcctac tcactctgga caggaacagc tgtctgcagc cacgccgcgc ctgagtgagg 61 agaggcgtag gcaccagccg aggccaccca gcaaacatct atgctgactc tgaatgggcc 121 cagtcctccg gaacagctcc ggtagaagca gccaaagcct gtctgtccat ggcgggatgc 181 cgggagctgg agttgaccaa cggctccaat ggcggcttgg agttcaaccc tatgaaggag 241 tacatgatct tgagtgatgc gcagcagatc gctgtggcgg tgctgtgtac cctgatgggg 301 ctgctgagtg ccctggagaa cgtggctgtg ctctatctca tcctgtcctc gcagcggctc CP4 EPSPS: The gene conferring resistance to the herbicide Roundup The gene was found in Agrobacterium tumefaciens and transferred to various plants Coincidentally, this organism is also used for creating transgenic plants TGGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTGCGATAAAGGAAAGGCCATCGTTGAAGATGCCTCTGCCGACAGTGGTCCCAAAG ATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGATATCTCCACTGA CGTAAGGGATGACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGACACGCTGACAAG CTGACTCTAGCAGATCTTTCAAGAATGGCACAAATTAACAACATGGCACAAGGGATACAAACCCTTAATCCCAATTCCAATTTCCATAAACC CCAAGTTCCTAAATCTTCAAGTTTTCTTGTTTTTGGATCTAAAAAACTGAAAAATTCAGCAAATTCTATGTTGGTTTTGAAAAAAGATTCAATT
    [Show full text]
  • Optimizing the Particle Bombardment Method for Efficient Genetic Transformation
    JARQ 32, 239-247 (1998) Optimizing the Particle Bombardment Method for Efficient Genetic Transformation Takashi HAGIO Department of biotechnology, National Institure of Agrobiological Resources (Tsukuba, Ibaraki, 305-8602 Japan) Abstract Particle bombardment method has evolved into a useful tool for biotechnologists, allowing direct gene transfer to a broad range of cells and tissues over the past several years. Some of the important applications of the process include the production of fertile transgenic crops including maize, soybean, rice, wheat, barley, sorghum, etc. Recent results have extended the range of gene transfer to animal and bacterial cells. In this article the method of particle bombardment is reviewed and discussed, and practical suggestions for improving transforma- tion efficiency are presented. Discipline: Biotechnology Additional key words: biolistic, particle gun, direct gene transfer now marketed by BIO RAD Laboratories, represents Introduction to particle bombardment method a significant technical improvement over the gun­ powder device. The basic design was developed by Particle bombardment method which is one of Sanford et al.37l. The PDS-1000/He™ device is the technologies for introducing foreign genes into powered by a burst of helium gas that accelerates cells was developed by John Sanford and co­ a macrocarrier, upon which millions of DNA-coated workers23·37l at Cornell University in the United microcarriers have been dried (Figs. 2 and 3). Com­ States. This technique involves accelerating DNA­ pared to the gunpowder device, it is cleaner and safer, coated particles (microprojectiles) directly into intact allows better control over bombardment parameter, tissues or cells. The research was conducted with distributes microcarriers more uniformly over target a view to avoiding the host-range restrictions of cells, is more gentle to target cells, is more consistent Agrobacterium tumefaciens, and the regeneration from bombardment to bombardment, and yields problems of protoplast transformation.
    [Show full text]
  • An Improved and Efficient Method of Agrobacterium Syringe Infiltration
    Zheng et al. BMC Plant Biology (2021) 21:54 https://doi.org/10.1186/s12870-021-02833-w METHODOLOGY ARTICLE Open Access An improved and efficient method of Agrobacterium syringe infiltration for transient transformation and its application in the elucidation of gene function in poplar Lin Zheng1, Jixiu Yang1,2, Yajuan Chen1, Liping Ding1, Jianhua Wei1* and Hongzhi Wang1* Abstract Background: Forest trees have important economic and ecological value. As a model tree, poplar has played a significant role in elucidating the molecular mechanisms underlying tree biology. However, a lack of mutant libraries and time-consuming stable genetic transformation processes severely limit progress into the functional characterization of poplar genes. A convenient and fast transient transformation method is therefore needed to enhance progress on functional genomics in poplar. Methods: A total of 11 poplar clones were screened for amenability to syringe infiltration. Syringe infiltration was performed on the lower side of the leaves of young soil-grown plants. Transient expression was evaluated by visualizing the reporters β-glucuronidase (GUS) and green fluorescent protein (GFP). The experimental parameters of the syringe agroinfiltration were optimized based on the expression levels of the reporter luciferase (LUC). Stably transformed plants were regenerated from transiently transformed leaf explants through callus-induced organogenesis. The functions of Populus genes in secondary cell wall-thickening were characterized by visualizing lignin deposition therein after staining with basic fuchsin. Results: We greatly improved the transient transformation efficiency of syringe Agrobacterium infiltration in poplar through screening for a suitable poplar clone from a variety of clones and optimizing the syringe infiltration procedure.
    [Show full text]
  • Genetically Modified Organisms Vocabulary Deoxyribonucleic Acid (DNA) Gene - a Section of DNA That - the Long, Double-Stranded Codes for a Specific Product
    A Quick Look at Genetically Modified Organisms Vocabulary Deoxyribonucleic acid (DNA) Gene - a section of DNA that - the long, double-stranded codes for a specific product. helical molecule that contains Genes (and environmental fac- an organism’s genes. tors) determine traits exhibited The “blueprint” or “recipe” for by an organism. an organism. Genetically Modified Transgenic Organism - an Organism (GMO) - an organism organism that has had genes whose DNA has been changed from another species, or syn- in some way. Includes alteration thetic genes, introduced into its by genetic engineering and DNA by genetic engineering. non-genetic engineering meth- Sometimes found in nature, ods. Frequently occur in nature. most created in laboratories. Genetic Engineering - the Mutation - a spontaneous or in- introduction or change of DNA, duced change in an organism’s RNA, or proteins by human DNA. Plant “sports”, like blood manipulation. oranges, are common examples of mutation. Methods Used in Plant Breeding Conventional Breeding Genetic Engineering Cross Pollination Agrobacterium-mediated The natural or artificial Transformation transfer of pollen from one The use of the naturally sexually compatible part- occurring, soil-dwelling ner to another. The oldest bacterium Agrobacterium technique used in plant tumefaciens to transfer breeding. genes into a target plant. Chromosome Doubling Gene Editing Inhibiting proper cell divi- The use of sequence-specific sion to produce cells with enzymes to alter targeted, twice the amount of DNA. non-random sites in the Can be induced by radia- DNA. Allows for precision tion, chemical treatment, or genetic engineering. natural errors in cell division. Mutation Breeding Particle Bombardment The process of exposing “Gene gun” method.
    [Show full text]
  • Biolistic Delivery Systems
    Gene Transfer Biolistic Delivery Systems Get Right on Target With Precise Gene Delivery Systems Biolistic Particle Delivery Systems Helios® Gene Gun System n Transfection of mammalian cells in vivo n Easy-to-use, portable handheld device n Simple, rapid, versatile technique Helios Gene Gun System Biolistic Applications of the Helios Gene Gun System Transformation Factors Experimental conditions In situ, in vitro, in vivo, ex vivo Sample location External and exposed internal aspects of target organism Target area Small (2 cm2) Target membrane structure In vivo Pressure range 100–600 psi Targets Animals: Any material exposed to gun barrel — intact tissue (skin, organs); cell, explant, or organ culture Plants: Field and greenhouse use, plant cell culture, explants Microbes: Yeast, bacteria, other Biolistic technology, also called particle bombardment, is a direct physical method of introducing nucleic acids into cells. Nucleic acids or other biological molecules are coated onto high-density gold or tungsten microparticles (microcarriers), which are then accelerated to high velocity by a helium pulse and driven through cell walls and membranes into the target. The physical nature of this technology makes it extremely versatile and easy to use. It can be applied to a wide range of targets, including cell cultures, tissues, organs, plants, animals, and bacteria, as well as organelles. Bio-Rad offers two types of biolistic instruments, the Helios gene gun and PDS-1000/He systems. For more information, visit us on the Web at www.bio-rad.com/genetransfer/
    [Show full text]