dsRNA SIGNALING IN INNATE IMMUNITY AND VIRAL INHIBITION
by
LENETTE LIN LU
Submitted in partial fulfillment of the requirements
for the degree of Doctor of Philosophy
Thesis Advisor: Dr. Ganes C. Sen
Medical Scientist Training Program / Department of Molecular Biology and
Microbiology- Molecular Virology Program
CASE WESTERN RESERVE UNIVERSITY
January, 2009 CASE WESTERN RESERVE UNIVERSITY
SCHOOL OF GRADUATE STUDIES
We hereby approve the thesis/dissertation of
______Lenette Lu______
candidate for the ____PhD______degree *.
(signed)___Robert Silverman______
(chair of the committee)
____Jonathon Karn______
____Ganes C Sen______
____Clifford V Harding III______
____George R Stark______
______
(date) ____June 6 2008______
We also certify that written approval has been obtained for any proprietary material contained therein.
TABLE OF CONTENTS
LIST OF TABLES……………………………………………………………. ………….7
LIST OF FIGURES…………………………………………………………... ………….8
ACKNOWLEDGEMENTS…………………………………………………….………..10
LIST OF ABBREVIATIONS…………………………………………………. ………..13
ABSTRACT………………………………………………………………………….…..16
CHAPTER 1. INTRODUCTION………………………………………………………..18
Innate and Adaptive Immunity…………………………………………………..18
Pathogen Associated Molecular Patterns and their Receptors
in Innate Immunity……………………………………………………………….19
Receptors that respond to dsRNA………………………………………………..23
Extracellular dsRNA and TLR3………………………………………….24
Intracellular dsRNA and RNA helicases………………………………...30
The IFN Regulatory Factor (IRF) family of transcription factors……………….32
IFN stimulated response element (ISRE) mediated signaling…………...33
The ISG56 family of proteins……………………………………………34
Negative Regulation of Innate Immunity………………………………………..42
Host Mechanisms………………………………………………………...42
Virus Mechanisms……………………………………………………….44
CHAPTER 2. MATERIALS AND METHODS…………………………….…………. 46
Construction of ISG56 knockout targeting vector……………………………….46
Screening of ES cells for recombination of the targeting vector………………...48
Southern Blot hybridization……………………………………………………..49
1
Cell Survival Assay………………………………………………………………50
Viruses…………………………………………………………………………...50
TLR3 antiviral activity…………………………………………………………...51
Hemagglutination assay………………………………………………………….51
PIV5 plaque assay………………………………………………………………..51
Cells……………………………………………………………………………..51
Plasmids…………………………………………………………………………52
Reagents…………………………………………………………………………53
Quantitative PCR………………………………………………………………...54
IRF3 dimerization assay…………………………………………………………54
IRF3 apoptosis assays……………………………………………………………55
IRF3 phosphorylation and nuclear localization assays…………………………..55
Immunoblotting and Immunoprecipitation………………………………………55
In vitro Kinase Assay…………………………………………………………….57
VM degradation…………………………………………………………………..57
IKKe ubiquitination……………………………………………………………...58
IL8 ELISA……………………………………………………………………….58
CHAPTER 3. A KNOCKOUT MOUSE MODEL TO ADDRESS THE
PHYSIOLOGICAL SIGNIFICANCE OF INTERFERON STIMULATED GENE 56/
INTERFERON-INDUCED PROTEIN WITH TETRACOPEPTIDE REPEATS 1
(IFIT1)……………………………………………………………………………………59
Summary…………………………………………………………………………59
Introduction………………………………………………………………………59
2
Results……………………………………………………………………………62
Targeting Strategy………………………………………………………..62
Embryonic stem (ES) cell screening……………………………………..66
Discussion………………………………………………………………………..67
Improving chances for targeting success………………………………...67
Mouse vs human ISG56…………………………………………………69
Multiple members of the ISG56 family of genes………………………...70
Predicted phenotypes of a P56 knockout mouse…………………………71
CHAPTER 4. A CELL SURVIVAL ASSAY THAT IDENTIFIES VIRAL INHIBITORS
OF dsRNA MEDIATED SIGNALING………………………………………………….73
Summary…………………………………………………………………………73
Introduction………………………………………………………………………73
Results……………………………………………………………………………76
A cell line that dies in response to
dsRNA-TLR3-ISRE mediated signaling………………………………...76
TLR3 293 561-TK validation in dsRNA induced cell death assays……..79
Discussion……………………………………………………………………….82
Unique assay characteristics……………………………………………..82
Advantages of TK negative selection……………………………………83
High throughput assays and screens……………………………………..84
IRF3 and ISRE as a convergence points
for multiple signaling pathways…………………………………………85
3
CHAPTER 5. SELECT PARAMYXOVIRAL V PROTEINS INHIBIT IRF3
ACTIVATION BY ACTING AS ALTERNATIVE SUBSTRATES
FOR IKKe/TBK1………………………………………………………………………...87
Summary…………………………………………………………………………87
Background………………………………………………………………………88
The family Paramyxoviridae…………………………………………….88
Genera within Paramyxovirinae…………………………………………96
Paramyxoviruses and innate immunity…………………………………..98
V proteins in innate immunity…………………………………………...98
Introduction……………………………………………………………………..100
Results…………………………………………………………………………..102
Some but not al Paramyxoviral V proteins inhibit TLR3 signaling……102
V proteins block IRF3 activation……………………………………….105
Interaction of V with IKKe is essential for inhibiting TLR3 signaling...109
V proteins are substrates for IKKe and TBK1………………………….113
V protein determines the efficacy of virus replication in TLR3
activated cells…………………………………………………………...116
Discussion………………………………………………………………………121
The virus-host equilibrium……………………………………………...121
The complex process of IRF3 activation……………………………….127
The role of V mediated innate immune inhibition in Rubulaviruses…...128
CHAPTER 6. HERPESVIRAL PROTEINS INHIBIT IRF3 ACTIVATION….……...130
Summary………………………………………………………………………..130
4
Background……………………………………………………………………..131
The family Herpesviridae………………………………………………131
The β-herpesvirus Cytomegalovirus (CMV): Disease and Treatment…137
Cytomegalovirus Host interactions: Natural Killer Cells………………138
Cytomegalovirus Host interactions: T cells…………………………….139
Cytomegalovirus regulation of host innate immunity………………….140
Murine γ-herpesvirus 68 (MHV68),
a model for γ-herpesvirus infections……………………………………142
Innate and adaptive immune responses that control MHV68…………..144
Introduction…………………………………………………………………….146
Results………………………………………………………………………….151
CMV ORFs that inhibit signaling………………………………………151
MHV68 ORFs that inhibit signaling……………………………………154
Confirmation of MHV68 ORF35 and 58
inhibition of dsRNA signaling………………………………………….154
MHV68 ORF35 and 58 activation of P38 and AKT…………………...157
ORF58 inhibits NFkB activation……………………………………….162
ORF35 enhances NFkB activation……………………………………..165
ORF58 inhibits IRF3 activation………………………………………..165
ORF35 inhibits IRF3 activation………………………………………...170
ORF58 inhibits RIG-I and IRF3 mediated apoptosis…………………..173
Discussion………………………………………………………………………176
A cell death assay that identifies inhibitors and activators of IRF3……176
5
Viral assays that identify inhibitors of signaling………………….……176
Members of the US22 mCMV gene family inhibit IRF3 activation…...182
mCMV M36 inhibits IRF3 activation…………………………………..183
hCMV ORFs inhibit IRF3 activation………………………...…………184
hCMV UL122 inhibits signaling potentially via the IRF3 autoinhibitory
domain……………………………………………………….………….184
MHV68 ORFs inhibit IRF3 activation…………………………………185
Putative exonuclease activity of MHV68 ORF37 may repress global gene
expression………………………………………………………………186
MHV68 ORF58 inhibits IRF3 and NFkB activation…………………...186
MHV68 ORF35 inhibits IRF3 but augments NFkB activation……...…189
CHAPTER 7. DISCUSSION AND PERSPECTIVE……………………………….….193
Summary…………………………………………………………………….….193
A cell survival assay…………………………………………………………....193
IRF3: Complex regulation by phosphorylation……….…………………….…194
TBK1/IKKe represents an important point of convergence and divergence…...195
Viral activation and inhibition of host signaling pathways…………………….197
A single point of viral host interaction can be both inhibitory
and activating………………………….………………………………………..198
Viral evasion at multiple points within the viral replication cycle...... 199
Practical applications…………………………………………………………...201
Evolution of the virus host relationship………………………………………...201
BIBLIOGRAPHY…………………………………………………………………….. 204
6
LIST OF TABLES
Table 1.1:Pathogen/Danger Associated Molecular Patterns and their Pattern Recognition Receptors
Table 6.1: Mouse and human cytomegalovirus ORFs assayed for inhibition of IRF3 activation
Table 6.2: Murine γ-herpesvirus 68 ORFs assayed for inhibition of IRF3 activation
7
LIST OF FIGURES
Figure 1.1: Signaling induced by the RNA pattern recognition receptors.
Figure 1.2: Phylogenetic relationships between members of the P56 family of proteins.
Figure 1.3: Members of the P56 family of proteins are structurally homologous with tetracopeptide repeat motifs.
Figure 1.4: The P56 family of proteins binds to elongation initiation factor subunits to inhibit translation.
Figure 3.1: Targeting strategy of the P56-/- mouse.
Figure 4.1: A cell death assay that identifies inhibitors and activators of dsRNA-TLR3-
IRF3 signaling.
Figure 4.2: Authentication of TLR3 293 561-TK cells.
Figure 5.1: International Committee on Taxonomy of Viruses classification of negative sense ssRNA viruses.
Figure 5.2: RNA editing during transcription of the P ORF in different genera of the
Paramyxovirinae subfamily generates a variety of accessory proteins.
Figure 5.3: A Paramyxovirinae virion not drawn to scale.
Figure 5.4: Select Paramyxoviral V proteins inhibit TLR3-mediated gene induction.
Figure 5.5: V proteins from hPIV2, MuV and PIV5 inhibit IRF3 activation.
Figure 5.6: Interaction of V with IKKe is essential for inhibition of TLR3 signaling.
Figure 5.7: MuV and PIV5 V proteins are phosphorylated by IKKe and TBK1.
Figure 5.8: Phosphorylated MuV V protein is degraded.
Figure 5.9: Effects of dsRNA signaling on WT and mutant PIV5 replication.
Figure 5.10: A negative feed-back loop between Rubulaviral V proteins and IKKe/TBK1.
8
Figure 6.1: Herpesvirus virion structure.
Figure 6.2: International Committee on Taxonomy of Viruses classification of the order
Herpesvirales.
Figure 6.3: MHV68 ORFs 35, 37 and 58 inhibit p56 induction.
Figure 6.4: MHV68 ORFs 35 and 58 do not inhibit activation of p38 and AKT.
Figure 6.5: ORF58 inhibits NFkB activation.
Figure 6.6: ORF35 augments NFkB activation.
Figure 6.7: ORF58 inhibits IRF3 activation.
Figure 6.8: ORF35 inhibits IRF3 activation.
Figure 6.9: ORF58 inhibits IRF3 mediated apoptosis.
9
ACKNOWLEDGEMENTS
Parts of this work were presented at the CWRU MSTP winter and summer retreats, the Cleveland Clinic Research Day Retreats, the 2006 ASV meeting in Madison,
Wisconsin, the 2008 Innate immune signaling mechanisms Keystone meeting in
Keystone, Colerado, 2008 Lepow Day at CWRU and 2008 Research ShowCASE at
CWRU.
Veronique Lefebvre at the Cleveland Clinic provided advice for the ISG56 knockout mouse targeting construct and Southern strategy. The ISG56 knockout mouse targeting vector was injected into ES cells at the Embryonic Stem Cell Core in collaboration with Herbert Virgin IV at Washington University in St. Louis. Mamta Puri under Curt Horvath at Northwestern University cloned V protein wildtype and mutant expression vectors. Sun Qiang under John Hiscott at McGill University provided purified
IRF3 and IRF3 constructs for the in vitro kinase assays. Minghao Sun under Biao He at
Pennsylvania State University provided wildtype and mutant PIV5 viruses and guidance in their use. Ulrich Siebenlist at NIAID provided TBK1 and IKKe expression vectors.
Xiaoxia Li at Cleveland Clinic provided TRIF expression vector. Serge Fuchs at the
University of Pennsylvania provided HA tagged ubiquitin expression vector. Adam
Geballe at University of Washington in Seattle provided mCMV and hCMV ORF expression vectors. Jae Jung at University of Southern California provided MHV68 ORF expression vectors and also related reagents for which data have not been presented here: wildtype MHV68 virus, GFP tagged MHV68 virus and ORF27 and 58 deficient MHV68
(originally constructed by Ren Sun at University of California at Los Angeles).
10
In the Sen lab, Kevin Smith provided invaluable technical support in the projects
involved with viral proteins. Kristi Peters cloned the 561-TK construct and was
instrumental in the construction of the cell line itself. Sauman Sarkar, Theresa Rowe and
Heather Smith constructed and kindly provided the parental cells TLR3-293. Srabani Pal
provided technical support in the cloning and Southerns for the ISG56 (and ISG69)
knockout mouse project and Theresa Rowe and Tina Gaughan provided much expertise
in the design of the knockout and Southern strategies. In work not presented here, Avanti
Desai contributed by conducting MHV68 plaque assays. Christine White provided mice
for making macrophages and Difernando Vanegas and Michi Yamashita provided
technical assistance with mice. Finally, Neil Halmagyi provided technical support for
cloning in the V protein project.
In addition, other past and present members of the Sen lab provided invaluable
assistance. In the Signaling group, Kristi Peters, Saumen Sarkar, Chris Elco, Neil
Halmagyi, Theresa Rowe, Heather Smith, Michi Yamashita, Boni Pal, Kevin Smith,
Mitali Pandey, Pritha Majumder, Jazz Singh, Tammy Guo and Andy the rotating CCF
med student whose last name I can’t remember. Chris in particular was helpful in writing
and editing this thesis. In the PACT/PKR group, Christine White, Greg Peters, Ben
Dickerman, Avanti Desai, Shoudong Li, Mark Rizzi and Joao Marques. In the P56 group,
Fulvia Terenzi, Parama Saikia, Danny Hui, Wen Li and Volker Fensterl. In the ACE
group, Saurabh Chattopadhyay, Jeff Chang, Difernando Vanegas, Sean Kessler and Tina
Gaughan.
11
Lastly, I thank my committee members George Stark, Clifford Harding, Phil
Pellet, Robert Silverman and Jon Karn for guiding me through my studies, and my advisor Ganes Sen for his mentorship.
12
LIST OF ABBREVIATIONS
EBV Epstein Barr virus
CARD caspase activated recruitment domain
CMV cytomegalovirus
CPG Cytosine Guanine
DAI DNA-dependent activator of IRFs
DAMP damage associated molecular pattern
DExD H box RNA helicases motif
Dpi days post infection dsRNA double-stranded RNA eIF elongation initiation factor
ELISA Enzyme-Linked ImmunoSorbent Assay
EMCV encephalomyocarditis virus
GAS gamma-activated site
GCV ganciclovir
HCV Hepatitis C virus
HeV Hendra virus
HHV8 human herpesvirus 8 hPIV2 human Parainfluenza virus 2
IFN interferon
IFIT1 interferon induced tetracopeptide 1
IKKe Inhibitor of κB kinase ε
13
IL interleukin
IPS-I IFNβ promoter stimulator 1
IRF interferon regulatory factor
ISG interferon stimulate gene
ISRE interferon stimulated response element
JAK Janus kinase
KSHV Kaposi Sarcoma Herpesvirus
LMB leptomycin B
LPS lipopolysaccharide
LRR leucine-rich repeat mda-5 melanoma differentiation-associated gene 5
MHV68 murine γ-herpesvirus 68 moi multiplicity of infection
MeV Measles virus
MuV Mumps virus
NFκB nuclear factor κ B
ORF open reading frame
PAMP pathogen-associated molecular pattern pfu plaque forming unit
PI3K phosphatidylinositol 3-kinase pIC Polyinosinic-polycytidylic acid
PIV5 Parainfluenxa virus 5
PKR protein kinase RNA regulated
14
PRR pattern recognition receptor
RIG-I retinoic acid inducible gene
SeV Sendai virus
siRNA small interfering RNA
ssRNA single-stranded RNA
STAT signal transducer and activator of transcription
TBK1 TANK-binding kinase 1
TIR toll/IL-1R homology domain
TK thymidine kinase
TLR toll-like receptor
TNF tumor necrosis factor alpha
TPR tetracopeptide repeat
TRIF Toll-IL1R domain containing adaptor inducing IFNβ
VH V protein from hPIV2
VM V protein from MuV
VP V protein from PIV5
VDC V delta C
WT wild-type
15
dsRNA Signaling in Innate Immunity and Viral Inhibition
Abstract
by
LENETTE LIN LU
The innate immune system helps determine the outcome of pathogen invasion of a host because it mediates recognition of and initiates the host response against the pathogen. The balance of the system is delicate. Too little signaling is ineffective in clearing the pathogen and too much is pathological for the host. Therefore, regulation is important for both parties.
dsRNA is a molecular pattern associated with viral infections which stimulates the innate immune response. Host recognition of dsRNA include Toll like receptor 3
(TLR3) and the RNA helicases retinoic acid inducible gene (RIG-I) and melanoma differentiation associated gene (mda-5). These receptors signal to activate many transcription factors including Interferon (IFN) Regulatory Factor 3 (IRF3) which mediates the expression of IFN stimulated genes (ISGs). Of the hundreds of ISGs, ISG56 is consistently one of, if not the most, highly induced, indicating an importance in antiviral immunity. Indeed, p56, the protein product of ISG56, inhibits host translation and in doing so prevents viral replication.
To determine the physiological significance of p56, we sought to conditionally disrupt the mouse ISG56 gene. (Chapter 3) Unfortunately, problems were encountered in generating an embryonic stem cell containing a correctly integrated targeting construct.
16
To discover novel and to distinguish previously characterized regulatory mechanisms of IRF3, we established a cell survival assay that can identify both activators and inhibitors of IRF3 via TLR3 signaling. (Chapter 4) Using this system, we found that
V proteins encoded by select RNA Paramyxoviridae viruses could inhibit IRF3
activation by acting as alternative substrates for the IRF3 kinases inhibitor of κ B kinase
epsilon (IKKe) and TANK binding kinase (TBK1). (Chapter 5) In addition, we identified
novel open reading frames from the DNA viruses cytomegalovirus and murine
γ−herpesvirus 68 that could inhibit IRF3 activation. (Chapter 6) Mechanistic studies of
these inhibitors revealed complexities in IRF3 activation, distinguished TBK1 and IKKe as points of convergence and divergence for many pathways and indicated the disparate needs of viruses to both activate and inhibit immune signaling. (Chapter 7) These investigations have implications not only in antiviral therapy development but also in understanding host virus coevolution.
17
CHAPTER 1
INTRODUCTION
Innate and Adaptive Immunity
The immune system consists of both innate and adaptive responses to infections.1
The innate branch presents the first line of defense against pathogens such as viruses, bacteria, fungi and parasites in the form of passive physical barriers like the skin and mucosa. If the pathogen penetrates this defense, the innate immune system is also responsible for the initial recognition of an infection and the subsequent generation of an active anti-microbial response which begins immediately and can persist hours to days.
This is accomplished at the cellular level by monocytes such as macrophages and dendritic cells which produce interferons (IFNs) and cytokines, granulocytes such as neutrophils which phagocytose and kill bacteria and, finally, lymphocytes such as natural killer (NK) cells that kill infected host cells with aberrant major histocompatibility complex (MHC) Class I expression. Although effective, the innate immune response does not improve with repeat exposures to the same pathogens. This is because surveillance is limited to a set of pattern recognition receptors (PRR) that recognize only general constituents of either foreign origin or the stressed host.2
Innate immunity also serves to initiate the adaptive branch of the immune system, which is necessary if the pathogen persists beyond the initial neutralization steps. This occurs in part through T and B lymphocytes following activation by antigen presenting cells (APC) such as monocytes. Lymphocyte activation leads to the generation of a diverse repertoire of T cell receptors and antibodies via gene rearrangement that provides more specific responses. In addition, the gene rearrangement also provides
18
immunological B and T cell memory and, as a result, more rapid and enhanced recall
responses upon re-infection when compared to the innate response.
Innate immunity alone is sufficient for simple organisms like single cell
eukaryotes such as the social amoeba3 which evolved 1-2 billion years ago. However as
organisms have evolved, immunity too has become more complex with the development
of adaptive immunity in jawed (but not jawless) fishes and higher vertebrates over the
past 500 million years.4 During that time co-evolution of adaptive and innate immune systems under the constant selection pressure for host fitness applied by pathogens has led to the generation of a highly complex system of relationships.
Pathogen Associated Molecular Patterns and their Receptors in Innate Immunity
One of the most critical aspects of the innate immune system is recognition of pathogen associated molecular patterns (PAMPs), originally defined as molecules unique to invading microorganisms.5 These include but are not limited to lipopolysaccharide
(LPS), lipotechoic acids (LTA), peptidoglycan (PGN), flagellin, lipoproteins/peptides, β- glucan and nucleic acids from bacteria and fungi (Table 1.1).6 Virus specific PAMPs
include double (ds) and single stranded (ss) RNA and DNA as well as virion proteins
such as glycoprotein B from human cytomegalovirus (hCMV),7 the envelope protein
from mouse mammary tumor virus (MMTV) 8 and Measles virus hemmaglutinin (HA)
protein.9 In addition, endogenous proteins and nucleic acids present in a stressed host in either abnormal compartments or concentrations are also capable of initiating innate immune responses.10 These ligands are known as danger associated molecular patterns
(DAMPs).
19
The PRRs are host proteins responsible for recognizing and inducing a cytokine
response to PAMPs and DAMPs. They can be organized into toll like receptors (TLRs), nucleotide binding oligomerization domain (NOD) like receptors (NLR), the RNA
helicases, lectins and the DNA binding protein DNA-dependent activator of IFN-
regulatory factors (DAI) (Table 1.1).
Vertebrate TLRs were originally discovered as homologues of the Drosophila
Toll gene which is involved in embryonic development and antifungal immunity.11, 12 To date, 11 TLRs have been identified in humans and 12 in mice. As type I transmembrane proteins, they span the plasma membrane once and have extracellular N termini and cytoplasmic C termini. TLRs can further be identified by a leucine rich repeats (LRR) in their extracellular domains responsible for ligand recognition and a Toll-interleukin 1 receptor (TIR) domain in their cytoplasmic segment responsible for protein-protein interactions necessary for downstream signaling. TLR2, 4 and 5 are expressed on the plasma membrane and classically recognize lipoprotein and peptidoglycan, LPS and flagellin respectively. TLR3, 7 and 9 are localized to endolysosomes and classically recognize dsRNA, ssRNA and CPG DNA respectively (Table 1.1).13 For the identified 11
members of the family, two adaptor proteins serve as scaffolding to mediate interactions
for gene induction: TIR domain containing adaptor inducing IFNb (TRIF), used by TLR3 and 4, and myeloid differentiation primary response gene 88 (MyD88), used by the other
TLRs.
The remaining PRRs are structurally distinct from TLRs in a number of ways.
NLRs also contain LRRs for recognition of their ligands which are bacterial peptidoglycans and even viral DNA.13, 14 However, they are not transmembrane proteins
20
Table 1.1: Pathogen/Danger Associated Molecular Patterns and their Pattern Recognition
Receptors.
Adapted from “Toll-like receptor signaling”6 and “How dying cells alert the immune system to danger.”10
Microbial components Organisms Pattern Recognition Receptor Bacteria LPS Gram negative bacteria TLR4 Diacyl lipopeptides Mycoplasma TLR6/TLR2 Triacyl lipopeptides bacteria and mycobacteria TLR1/TLR2 LTA Group B Streptococcus TLR6/TLR2 PGN Gram positive bacteria TLR2 diaminopimelic acid Gram negative bacteria NOD1 muramyl dipeptide Gram negative and positive bacte NOD2 and NALP3 Porins Neisseria TLR2 Lipoarabinomanna Mycobacteria TLR2 Flagellin Flagellated bacteria (Legionella) TLR5, NAIP and Ipaf lethal toxin Bacillus anthracis NALP1b CpG DNA bacteria and mycobacteria TLR9 RNA bacteria NALP3 and TLR3 ND Uropathogenic bacteria TLR11 Fungus Zymosan Saccharomyces cerevisiae TLR6/TLR2 and Dectin 1 Phospholipomannan Candida albicans TLR2 Mannan Candida albicans TLR4 Glucuronoxylomannan Cryotococcus neoformans TLR2 and TLR4 beta glucan Fungi and some plants Dectin 1 Parasites tGPI-mutin Trypanosoma TLR2 Glycoinositolphospholipids Trypanosoma TLR4 Hemozoin Plasmodium TLR9 Profilin-like molecule Toxoplasma gondii TLR11 Viruses DNA Viruses TLR9, DAI-I, NLR and possibly RIG-I and mda-5 dsRNA Viruses such as Reovirus, HSV TLR3 ssRNA RNA viruses TLR7 and TLR8 Envelope proteins RSV, MMTV TLR4 Hemagglutinin protein Measles virus TLR2 glycoprotein B hCMV TLR2 RNA latent EBV RIG-I RNA HCV RIG-I and LGP2 Host Heat shock protein 60, 70 TLR2? and TLR4? Fibrinogen TLR4 mitochondrial mRNA TLR3 uric acid crystals NALP3, TLR2? and TLR4? HMGB1 TLR2? and TLR4 chromatin, nucleosomes and DNA TLR9 Defensins TLR4 Heparan sulphate TLR4 Hyaluronic acid TLR2 and TLR4 Synthetic pIC TLR3 and mda-5
Ampligen (pIC12U) TLR3 pI TLR7, TLR8 and TLR3 Imidazoquinoline compounds (R837, R848) TLR7, TLR8 and NALP3 in vitro transcribed RNA RIG-I
21
nor do they contain a TIR domain. Instead, downstream signaling through NLRs is
mediated by either a pyrin, baculoviral inhibitor of apoptosis repeat (BIR), or caspase-
recruitment domain (CARD). The RNA DExD/H box helicases retinoic acid-inducible
gene (RIG-I), melanoma differentiation associated gene (mda-5) and LGP2 also contain
CARD domains for protein-protein interactions in downstream signaling,15-17 but their helicase domain is responsible for the recognition of nucleic acids in place of LRRs. The lectin Dectin 1 binds to β-glucan in fungal walls via its C-type lectin like domain18 and is a type II transmembrane protein. Like type I transmembrane proteins, type II span the plasma membrane only once, however they utilize an immunoreceptor tyrosine based activation motif (ITAM) on their cytoplasmic N-terminus for downstream signaling.
Finally, DAI (also known as tumor stroma and activated macrophages protein, DLM-I, and Z DNA binding protein 1, ZBP-I) is a cytoplasmic protein which binds and responds to dsDNA via its N terminal DNA binding domain and signals to downstream components via its C terminus.19
PRRs mediate all their important effects via the downstream signaling events they
initiate. In general, signaling initiated by NLRs activates the transcription factor nuclear
factor κ B (NFkB). TLRs, RNA helicases, Dectin 1 and DAI activate the transcription
factors interferon regulatory factors (IRFs) and general activator protein 1 (AP1) in
addition to NFkB. The repertoire of genes and also microRNAs induced through these
transcription factors includes many with diverse functions which can be both directly and
indirectly anti-microbial.20 A majority of the genes induced through IRFs are classified as
interferon-stimulated genes (ISGs) based on their historic characterization in the context
22
of type I IFN signaling and despite the fact that their induction through PAMP-signaling
can be IFN-independent.
Signaling is not limited to direct gene induction either. Proinflammatory
cytokines are produced to regulate extracellular signaling such as interleukins (ILs),
tumor necrosis factor (TNF) and IFNs. Through paracrine and autocrine signaling this
heightens the antiviral state by IFN-dependent augmentation of ISG expression, and
initiates the adaptive immune response by promoting dendritic cell maturation, memory T
cell proliferation and B cell differentiation.21 Finally, independent of transcription PRR signaling can also induce Bax and caspase mediated apoptosis.22, 23 Thus, the antiviral
state is established by cell death in certain circumstances as well as by direct and indirect
(via cytokine amplification) gene induction from PAMPs activating their receptors.24, 25
Receptors that respond to dsRNA
During virus infection, dsRNA capable of acting as a PAMP/DAMP can be
produced from several sources: dsRNA virus genomes, replication intermediates of ssRNA viruses, convergent DNA virus transcription products, defective viral particles
and debris from necrotic cells.26-28 In addition to the TLR3 and RNA helicases, several
IFN inducible proteins bind and respond to dsRNA with direct antiviral activity: dsRNA
dependent protein kinase (PKR), protein activator of the IFN-induced PKR (PACT), 2-5
oligoadenylate synthetase (2-5OAS) and adenosine deaminase (ADAR). These proteins
respectively function to phosphorylate eukaryotic initiation factor 2a (eIF2a) leading to inhibition of mRNA translation, bind to dsRNA as well as bind and activate PKR, synthesize oligoadenylates that activate RNaseL causing RNA degradation, and deaminate adenosines thereby destabilizing mRNA.29, 30
23
While PKR31 and 2-5OAS32 have been implicated in IFN induction in response to
RNA, the TLRs and RNA helicases are thought to be the main effecter molecules for this
function. TLRs 7 and 9 have been shown to be essential for plasmacytoid dendritic cell
production of IFN in response to viruses. TLR3 through its recognition of extracellular dsRNA has been shown to be important for IFN induction in conventional dendritic cells
and macrophages. Lastly, for both these cell types and also fibroblasts, RIG-I and mda-5
have been shown to be essential for IFN induction in response to intracellular dsRNA.33,
34
Extracellular dsRNA and TLR3
Extracellular RNA is endocytosed in a clathrin dependent manner35 and binds
directly and reversibly to the LRRs in the TLR3 ectodomain.36 This interaction is thought
to take place in endolysosomes which is where TLR3 is translocated from the plasma
membrane and endoplasmic reticulum (ER) upon dsRNA stimulation. This is
accomplished with the help of the C. elegans homologue of B1 (UNC93B1).37-39
Consistent with this location of interaction, the binding affinity between RNA and receptor increases with acidic pH. This affinity also increases with length of RNA, up to
62bp.40 Many dsRNA ligands have been shown for TLR3. These include the synthetic
mimic Polyinosinic-polycytidylic acid (pIC),41 siRNA (sequence and target
independent),42 ssRNA (secondary structure dependent),43 total bacterial mRNA and
mitochondrial mRNA released from necrotic and not apoptotic cells.28 Interaction
between receptor and ligand induces the multimerization of TLR3 with or without the
myeloid specific leucine rich glycoprotein CD14 which is thought to function more in the
recognition of LPS by TLR4.44 Multimerized TLR3 associates with c-Src in endosomes
24
where signaling35 occurs through an interaction with TRIF45 via the TIR domains on each
protein. This interaction is transient as the two proteins colocalize only initially after
stimulation. During this process TRIF distribution changes from diffusely cytoplasmic
to punctuate or “speckled”46 as it acts as a scaffolding protein for further signaling to
activate NFkB and IRFs (Fig 1.1A).
For NFkB, TRIF recruits receptor interacting protein (RIP1) into these cytoplasmic speckles where they interact via the RIP homotypic interaction motif
(RHIM) of RIP1.47 RIP1 is then phosphorylated and ubiquitinated at non-degradative
K63 sites by the E3 ubiquitin ligase TNFR associated factor (TRAF6). Ubiquitinated
RIP1 is then able to recruit and activate TAK1 and TAK1 binding proteins (TAB) 1, 2
and 348 via the scaffolding proteins ubiquitin conjugating enzyme (Ubc13), Ubc E2
variant (Uev1A) and evolutionarily-conserved signaling intermediate in Toll pathway
(ECSIT). Activated TAK1 then phosphorylates IkB kinase (IKK) complex of the kinases
IKKa and IKKb and their scaffolding protein IKKg/NEMO. Finally, phosphorylated
IKKa and b phosphorylate IkB, leading to its proteosomal degradation and release of
NFkB subunits p50 and p65/RelA. P65/RelA has also been implicated as a substrate for
IKKa and b kinase activity. However the mechanistic significance is less clear.49 TAK1 also phosphorylates the mitogen activated protein kinase (MAPK) pathway of Jun kinases (JNK), p38 and extracellular signal regulated kinase (ERK) to activate the AP1 transcription factor complex of ATF2 and c-Jun.50
For IRF activation, TRIF recruits the scaffolding protein TRAF351 which interacts
with the non canonical IKK kinases: TRAF family member-associated NFkB activator
(TANK) binding kinase (TBK1) (also known as T2K and NFkB activating kinase, NAK)
25
and IKKe/IKKi. TBK1 and IKKe then oligomerize52 and are able to bind via their ubiquitin like domain (ULD)53 to and directly phosphorylate IRF3 with the aid of three
other adaptors that contain TANK binding domains (TBD) essential for interaction with
TBK1: TANK54, Nck associated protein (NAP1)55 and similar to NAP1 TBK1 adaptor
(SINTBAD).56 IRF3 phosphorylation is also aided by cyclophilin B57 which is thought to
relieve autoinhibition between the N and C termini and promote homo and hetero
dimerization with IRF7 via the C terminal IRF association domain (IAD).58 IRF3 dimers
then localize to the nucleus, however for transcription activation further signals are
necessary from phosphatidylinositol 3-kinase (PI3K) originating at the receptor level59 and histone deactylases (HDACs).60 Finally, via its IAD, IRF3 in its dimerized state binds
to CREB binding protein (CBP) with the help of PKCa,61 as well as p300, and then to
DNA via its N terminal DNA binding domain. ISRE mediated transcription may be further enhanced by other coactivators such as glucocorticoid receptor interacting protein
(GRIP1) which also interacts with IRF3 via its IAD.62
TLR3 is basally expressed in the lung, brain and kidney as well as the placenta
and pancreas.12, 63 Immune cells that express TLR3 include dendritic cells,64 macrophages, natural killer cells, mast cells and T cells as well as microglia, the macrophages of the central nervous system (CNS).65 Furthermore, TLR3 is itself an ISG.
Therefore, its expression is upregulated by IRF activation through virus. Influenza A,66, 67
Respiratory Syncytial Virus (RSV),68 Simian immunodeficiency virus (SIV),69 Measles,70
Rhinovirus (RV)71 and Hepatitis C virus (HCV)72 all increase TLR3 expression upon
infection, and therefore at least theoretically heighten responsiveness to dsRNA.
26
Fig 1.1: Signaling induced by the RNA pattern recognition receptors.
A.) Toll like receptor 3 (TLR3) recognizes extracellular dsRNA endocytosed into the cell, represented by the synthetic analogue pIC, and the RNA helicases B.) retinoic acid inducible gene (RIG-I) and melanoma differentiation associated gene 5 (mda-5) recognize intracellular dsRNA in the cytoplasm. While both use different adaptors, the signaling pathways converge upon the IRF3/7 activation complex which includes IKKe and TBK1 and NFkB activation complex which includes IKKa, b, and g/NEMO.
Together with activating protein 1 (AP1), these factors transcribe the interferons (IFN) and cytokines essential to an innate immune response. Adapted from “Snapshot: Pattern- recognition receptors.”73
27
28
The role of TLR3 in immunity and pathology is complex. Reovirus dsRNA,63
Theiler’s murine emcephalomyocarditis virus (EMCV),74 Herpes simplex virus (HSV)
produced dsRNA75 and HCV RNA-dependent RNA polymerase NS5B76 all induce genes
through TLR3. However, the effects of TLR3-mediated gene induction are varied. Some
experiments show no difference in immune response or survival during viral infection in
mouse models,77 others paradoxically show protective as well as detrimental effects for
TLR3.
Protective roles for TLR3 have been identified in infections with RV, RSV,
EMCV, mouse cytomegalovirus (mCMV), HSV and, in the CNS, influenza A. TLR3 is
also required for the host immune response against RV.71 For RSV, TLR3 is not only
induced but also required for protection against the virus in the lung.78 For EMCV,
dsRNA released from virus infected cells primes dendritic cells and induces cross
presentation and activation of cytotoxic cells for an efficient antiviral response.79 This
may be how TLR3 prevents higher EMCV titres in the heart.80 In the case of mCMV,
TLR3 along with TLR9 but not TLR7 are essential components for the immune response
and critical to survival of infection.81 Finally, within the CNS, TLR3 expression is
protective for human astrocytes,82 further TLR3-dependent pIC stimulation suppresses relapsing demyelination in a murine experimental autoimmune encephalomyelitis
model.83 An autosomal dominant negative mutation in TLR3 has been linked to HSV-1
encephalitis in otherwise healthy children.84 This, aside from autosomal recessive
UNC93B deficiency,85 is the most common genetic etiology of isolated herpes simplex
encephalitis (HSE), the most common form of sporadic encephalitis in western countries.
29
Finally, a loss of function missense mutation in TLR3 is linked with influenza A induced
encephalopathy in patients.86
However, not all TLR3 induced signaling is protective and excessive signaling, or
more specifically the resulting immune/inflammatory response may cause pathology. In contrast to the previous example where TLR3 in the CNS appears protective for the host
in influenza A infections, upregulation of TLR3 in the lung with the same virus causes
acute pneumonia and is actually detrimental for the host.66, 87 TLR3 expression also correlates with the development of autoimmune diabetes in a mouse model88 and in the
infiltrating antigen presenting cells and glomerular mesangial cells involved in lupus
nephritis.89 Finally, TLR3 null mice have increased resistance to infection with hepatotropic phlebovirus Punta Toro virus90 and are more resistant to lethal encephalitis
caused by West Nile Virus.91 This indicates that there is an optimal level of TLR3
signaling that benefits the host and therapeutic potential in the development of both
TLR3 antagonists and agonists.
Indeed in animal models, dsRNA treatment appears to protect against genital
herpes infection,92 is beneficial as a vaccine adjuvant for influenza93 and, when complexed with cationic liposomes, is even able to control the growth of melanomas.94 In human studies, Ampligen, a synthetic nontoxic pIC analog, pI:C12U, is in a Phase III trial
to treat chronic fatigue syndrome and Phase II trial to treat HIV.95
Intracellular dsRNA and RNA helicases
Intracellular dsRNA, including that from many viruses is recognized by the
cytosolic RNA DExD/H box helicases RIG-I and mda-5. For RIG-I, it is thought that in
the inactive state, the C terminal repression domain (RD) and linker helicase domain
30
interact with and prevent function of the N terminal CARD domain. Signaling begins
when interaction between ligand and the C terminal domain relieves this inhibition.96 The
now exposed CARD domain is then K63 ubiquitinated by tripartite motif containing
protein (TRIM25)97 thereby enabling it to bind to the adaptor, mitochondrial antiviral
signaling protein (MAVS; also known as virus induced signaling adaptor, VISA; IFNb
promoter stimulator 1, IPS1; and CARD adaptor inducing IFNb, Cardif) via an
interaction between the CARD domains of the two proteins. Interestingly, MAVS
appears to reside in the mitochondria and this localization is apparently essential for
function.98 MAVS once itself is ubiquitinated by an as yet unidentified mechanism99 can
recruit IKKe.100 The activation of the IRF3/7 kinases IKKe and TBK1 is, like TLR3,
dependent on the scaffolding proteins TRAF3, TANK, SINTBAD and NAP1, which
appears to localize in areas around the mitochondria.101 TANK also mediates interaction
between TBK1/IKKe and IKKg/NEMO.102 These interactions then lead to activation of
IRF3 as previously described for TLR3 mediated transcription. NFkB activation is also mediated by MAVS, but through interaction with FAS associated via death domain
(FADD). This MAVS interaction with FADD leads to cleavage of Caspase 8/10 which then activates the canonical IKKa, b, g to phosphorylate and degrade IKB for p65 and p50 release and nuclear localization (Fig 1.1B).
While RIG-I is generally expressed at low levels it is highly induced by retinoic acid and IRF activators such as LPS and IFN.103 mda-5 is inducible in the same manner
but is also basally expressed in the spleen, pancreas and placenta.15, 104 RIG-I is essential
for the antiviral response to what is most likely the short dsRNAs from Flaviviruses,
Paramyxoviruses, Orthomyxoviruses, and Rhabdoviruses, in vitro transcribed RNA
31
without host modifications such as capping and base modification and ssRNA with 5’
triphosphates. Conversely, mda-5 is essential for the signaling response to Picornoviruses
and longer dsRNA, pIC.105-107 This specificity in response corresponds to increased
vulnerability to the Flavivirus Japanese encephalitis virus (JEV) and the Picornovirus
EMCV in RIG-I and mda-5 null mice respectively.108, 109 In addition RNA from the DNA virus EBV as well as dsDNA itself have been shown to be able to activate pathways that signal using the RNA helicases.110, 111
The IFN Regulatory Factor (IRF) family of transcription factors
IRF3 and 7 which are involved in the initial response to dsRNA recognition are
two of nine mammalian members of the Interferon Regulatory Factor (IRF) family of
transcription factors: IRF1, IRF2, IRF3, IRF4 (also known as LSIRF, PIP and ICSAT),
IRF5, IRF6, IRF7, IRF8 (also known as ICSBP) and IRF9 (also known as p48). These
proteins share in common an amino terminus DNA binding domain of the helix-turn-
helix motif which mediates the recognition of their DNA binding site, the IFN-stimulated
response element (ISRE). At the carboxy terminus is an IRF association domain (IAD)
which is responsible for homo- and hetero- dimeric interactions between members of the
family and is homologous to the C terminal domains of the mothers against
decapentaplegic homologue (SMAD) family of transcription factors.112 Nuclear localization (NLS) and export signals (NES) help guide the nuclear-cytoplasmic shuttling of the protein. In IRF3 specifically, the transactivation domain (aa 134-394) which contains the NES, a proline rich segment, and the IAD is alone sufficient to drive transcription. Finally, two inhibitory domains, one at the amino terminus (aa 134-197)
32
and the other at the carboxy terminus (aa 407-414), are thought to mediate intramolecular
interactions to mask the IAD, DBD and NLS.113, 114
At least six of the nine IRF members are positive regulators of type I IFN genes:
IRF1, 3, 5, 7, 8 and 9. IRF3 as described previously is mainly involved in the cellular
response to dsRNA and LPS via TLR 3, TLR4, RIG-I and mda-5. IRF7 is involved in the
dsRNA response but in addition plays a role in TLR7 and 9 signaling. IRF5 is also
involved in TLR4, 7 and 9 signaling. Via MyD88, IRF8 is a positive regulator of TLR4
and 9 responses. IRF9 is part of the ISGF3 complex with STAT1 and STAT2 and
mediates signaling induced by type I IFN. Similarly, IRF1 can mediate transcription of
type I IFN and also interacts with the adaptor MyD88. Finally, while IRF6 has not been
extensively studied, it apparently interacts with MyD88 like IRF1. However the
regulatory implications of this interaction are not yet known.112
Negative regulation of IRFs is in part accomplished by other family members.
IRF2 attenuates the type I IFN response mediated by IRF1. IRF4 competitively inhibits
IRF3 binding to the adaptor Myd88. In addition, non-IRF transcription factors such as B lymphocyte induced maturation protein (Blimp-1) competes with IRF1, 2 and 3 in binding to ISREs and serves as negative regulators of IRF signaling.115 Thus, the IRF
family of proteins represents an important group of transcription factors essential for the
host immune response against pathogens with multiple levels of control within and
between members.
Interferon stimulated response element (ISRE) mediated signaling
IRFs bind to ISRE sites to mediate the transcription of ISGs. While ISREs in
general confer positive responsiveness to IFN with the common motif of
33
GAAANNGAAA, the actual sequences of specific ISREs can vary. These variances may
account for the variations in ISG expression upon different stimuli which activate
different transcription factor complexes, dsRNA as compared to IFN. In addition, ISRE
variation may explain differences in induction even with the same stimulus. IFN for
instance requires IKKe phosphorylation of STAT1 to mediate the induction of a specific
subset of genes which may be identified by subtle differences in their ISREs. The
relevance of these differences is apparent is apparent in an influenza mouse model.116
The ISG56 family of proteins
The ISG56 family of genes is characterized by their promoter in that they all contain ISREs that are necessary and sufficient for induction.117-120 Thus, IRFs are the
primary transcription factors that mediate expression. ISG56 family members are not
basally expressed. However, as discussed in more detail in Chapter 4, ISG56 mRNA is
one of the most if not the most highly upregulated messages by ISRE-mediated
transcription24, 25. Although ISG56 was originally cloned from human fibroblasts as an
interferon inducible gene,121, 122 it is also strongly upon activation of TLR3, RIG-I/mda-
5,123-126 TLR4.127 As mentioned previously, in the context of dsRNA signaling ISG56
induction can be both direct via IRF3 and indirect via IFN feedback through ISGF3.123, 124
ISG56 has a prodigious number of aliases. They include G10P1, GARG-16, IFI-
56, IFNAI1 and RNM561. The ISG56 family of genes include human ISG56, 54, 60 and
58 and mouse ISG56, 54, 49 as well as homologues in goldfish, the chinese hamster, rat and sheep.118, 120, 121, 128-130 (Fig 1.2) Intriguingly, all the genes of the family members lie
next to each other on chromosome 10 in humans131 and 19 in mouse.117 This tandem gene
arrangement suggests the common use of regulatory mechanisms, functional redundancy
34
and gene duplication events underlying the evolution of the family. The genetic structure
is similar overall as well, with a short first exon comprising just the start codon, an
intervening intron and the second exon which comprises the remaining coding region.117
However, the actual redundancy within this family is still not known because knockdown attempts have not been completely successful.
The members of the P56 family of proteins (Fig 1.2) contain multiple 34 amino acid tetratricopeptide repeat (TPR) motifs and a proteosome-COP9-signalosome-and- initiation-factor (PCI) domain responsible for protein-protein interactions. (Fig 1.3)
These TPR motifs mediate interaction with the eukaryotic translation initiation factor subunits (eIF3) to inhibit translation. The first two TPR motifs in the protein product of mouse ISG56 (mp56) and the first TPR of mp54 are sufficient to bind to eIF3c.126 This prevents the formation of the 48S preinitiation complex between 40S ribosomal subunit and 20S complex.132 In comparison, the last two motifs, TPRs 5 and 6, of human p56
(hp56) binds to the e instead of c subunit of eIF3.123 This prevents the formation of the ternary complex which is also essential for translation.132, 133 Finally, the protein product
of human ISG54 (hp54) binds to both the e and c subunits of eIF3, inhibiting both steps
(Fig 1.4).125 In summary, the ISG56 family of genes and the proteins for which they
encode represent part of a vast repertoire of genes upregulated upon activation of IRFs.
To be sure, these genes mediate antiviral/antipathogen activities. However the
mechanisms by which they function do not limit them to such processes and the function
of ISGs in other biological processes is an important area to address.
35
Figure 1.2 Phylogenetic relationships between members of P56 family of proteins.
Multiple sequnce alignments and phylogenetic tree for the P56 family of proteins were obtained from HOVERGEN database. (http://pbil.univ-lyon1.fr/databases/hovergen.html)
Hu: human; Mu: mouse; Ra: rat; CI: chimpanzee; GF: goldfish. Adapted from “Novel functions of proteins encoded by viral-stress inducible genes.”134
36
37
Figure 1.3: Members of the P56 family of proteins are structurally homologous with tetracopeptide repeat (TPR) motifs.
Both human P56 (hp56) (GenBank accession P09914) and mouse P56 (mp56) (GenBank accession Q64282) contain six TPR motifs represented by grey bars. TPR2 is expanded to show conserved amino acid residues shaded in grey, similar amino acids shaded in black and nonconserved residues in white. Key consensus residues that define a TPR motif are indicated by large open traingles indicating large hydrophobic residues and dark small triangles indicating small hydrophobic residues. Adapted from “Mouse p56 blocks a distinct function of eukaryotic initiation factor 3 in translation initiation.”132
38
39
Figure 1.4: The P56 family of proteins binds to elongation initiation factor (eIF) subunits to inhibit translation. hp56 and hp54 bind to the e subunit of eIF3 to prevent the formation of the eIF-ternary complex. hp54 and mp56 and mp54 bind to the c subunit of eIF3 to prevent the formation of the 48S preinitiation complex which comprises of the 40S ribosomal subunit, eIF3 ternary complex, mRNA and eIF4F. Adapted from “Distinct induction patterns and functions of two closely related interferon-inducible human genes, ISG54 and ISG56.”125
40
41
Negative Regulation of Innate Immunity
Host Mechanisms
To protect against excessive innate immune responses that is in part mediated by
PRRs, multiple methods of downregulation have evolved. As important as this may be to
pathogen fitness, this is also necessary to prevent the immune system from becoming
pathologic to the host, as seen with autoimmunity, as well as infections such as West Nile
virus encephalitis,91 1918 influenza lethality135 or the more classic example of LPS induced sepsis.136
For receptor level regulation, the third member of the RNA helicase family, LGP2
inhibits both RIG-I and mda-5 by sequestering dsRNA through its helicase domain in the
absence of a CARD domain for signaling.16 Like many negative regulators, LGP2 is induced by signaling and serves as part of a negative feedback mechanism. In contrast, dihydroxyacetone kinase (DAK) inhibits mda-5 but not RIG-I basally by binding to its
CARD domain. This inhibition is released upon mda-5 activation mediated by dsRNA binding to its helicase domain.137
More examples of regulatory mechanism exist at the adaptor level. Sterile alpha
and heat/armadillo motifs (SAM) containing protein (SARM), one of the five members of
the TIR family of adaptors, is thought to inhibit TRIF signaling by either itself competing
for the TIR domain of TRIF or recruiting another protein with its SAM domain to do
so.ff138 Similarly for RNA helicase signaling, the mitochondrial-localized protein
NLRX1 competes with the RNA helicases to bind to the CARD domain of MAVS.139 For both receptors and their adaptor, the Ring finger protein (RNF125) K48 ubiquitinates and degrades RIG-I, mda-5 and MAVS.140 In terms of secondary scaffolding proteins in the
42
signaling cascade, deubiquitinating enzyme A (DUBA) via its ubiquitin interacting motif
(UIM) degrades K63 ubiquitin on TRAF3 and prevents its interaction with TBK1.141
Tripartite motif protein (TRIM30a) through its RING domain interacts with and mediates degradation of TAB2 and 3 to inhibit NFkB activation.96
At the level of the IRF3/7 kinases, suppressor of IKKe (SIKE) via its coiled
coiled domains binds to TBK1 and IKKe and prevents their basal interaction with TRIF,
RIG-I and TLR3 but not TRAF6 and RIP1. Like DAK, this inhibition is released upon signaling.142 The tyrosine phosphatase SHP2 also negatively regulates TBK1 in a
phosphatase independent manner by binding to the kinase domain.143 Ret Finger Protein
(RFP) interacts with and is a substrate for TBK1 and IKKe as well as IKKa and b upon
signaling. It also interacts with IRF3, allowing for its dimerization but not nuclear
localization.144 The NFkB induced gene, A20 inhibits both IRF3 and NFkB signaling. To prevent the IRF3 dimerization, A20 interacts with TBK1 and IKKe.145 To prevent NFkB
activation, it deubiquitinates TRAF6146 and mediates degradative K48 ubiquitination of
RIP1.147
Finally, at the level of the transcription factors, peptidyl-prolyl cist/trans
isomerase, NIMA-interacting (Pin1) mediates signal dependent ubiquitination and
degradation of IRF3.148 Glucocorticoid receptor (GR) inhibits ISRE transcription by
competing for the co-activator GRIP1.62 For NFkB, TNF-related apoptosis inducing
ligand receptor (TRAILR) stabilizes the inhibitory IKBa.149 In addition, IKBa is itself
induced by NFkB to shut down signaling.150
43
Viral Mechanisms
For pathogens such as viruses, host mechanisms of PRR signaling downregulation
may be easily manipulated. The human immunodeficiency virus (HIV) accessory protein
Vpu151 and several strains of vaccinia viruses interfere with IKBa degradation152 to
prevent NFkB activation. Herpes simplex virus 1 (HSV-1) and Hepatitis C virus (HCV)
induce SOCS to negatively regulate IFN signaling.153, 154
Another mechanism of signaling inhibition commonly employed by many viruses is the development of viral homologues of host proteins or their important regulatory domains. Kaposi’s sarcoma-associated herpesvirus (KSHV)/Human herpesvirus (HHV8) encodes vIRFs that prevent (but in some instances activate) the proper function of host
IRF.155 Vaccinia virus A52R acts as a dominant negative for MYD88 signaling156 while
A46R inhibits both MYD88 and TRIF157 because they, like the host adaptors, contain
TIR domains. Finally, vaccinia virus IFNR and Myxoma virus TNFR homologues inhibit signaling of these respective host cytokine signaling pathways.158
Cytokine and IFN receptor and function are popular targets for viral evasion,
especially when their induction is not completely prevented. Human CMV (hCMV)
encodes a decoy for the chemokine RANTES, chemokine receptor analogues and also a
vIL10 which serves to downregulate the immune response.159, 160 KSHV, too, encodes a
variety of chemokine and chemokine receptors.155 Lastly, Poxviruses secrete IFN binding
proteins that neutralize the actions of IFN once it is produced.161
For signal induced gene expression, Rift Valley fever virus NS proteins and M protein of vesicular stomatitis virus (VSV) inhibits components of the host machinery to prevent transcription. VSV M1 interacts with Rae1 and Nup98 to inhibit selective mRNA
44
export. Finally, even though mRNA is still exported in cells infected with Poliovirus and
EMCV, protein translation is inhibited.161
One interesting characteristic of viral evasion is that points of convergence within
the host signaling pathways represent common areas of inhibition for a variety of viruses.
These include members of the IKK family of kinases that activate transcription factors or the factors themselves. Vaccinia virus N1L interacts with almost all the IKKs: TBK1,
IKKe, IKKa and IKKb.162 P proteins of Rabies163, Ebola164 and Borna disease165 viruses
and Severe acute respiratory syndrome coronavirus (SARS-CoV) papain-like propease
PLpro166 interfere with IRF3 activation, most likely its phosphorylation. Likewise, KSHV
open reading frame (ORF45) interferes with IRF7 phosphorylation.167 In addition, human
papillomavirus 16 (HPV16) E6 oncoprotein binds to IRF3 and inhibits its transactivation168 and Epstein Barr virus (EBV) BZLF1 inhibits IRF7 function.169 To
decrease IRF levels in general, classic swine fever virus Npro inhibits IRF3 synthesis170 and rotavirus NSP1 promotes IRF3 degradation171 while KSHV RTA does the same for
IRF7.172 Finally, for NFkB, the Picornovirus Foot and mouth disease virus (FMDV) LPro
degrades p65173 while the African swine fever virus uses its IkB homologue A238L protein to bind to NFkB, preventing its nuclear translocation.174
Lastly, as implicated by some of the examples above, multiple mechanisms of
immune evasions are often times attributed to one pathogen protein as, especially in the
case of viruses, their genomes are small and contain only a few ORFs.175 One example is influenza NS1 which binds to and sequesters dsRNA to prevent activation of PKR, binds
to and inhibits PKR itself,176 activates P58IPK a PKR inhibitor,177 interacts with the
receptor RIG-I to prevent its activation and inhibits selective mRNA nuclear export.176,
45
178, 179 Another is HCV NS34A protease, which cleaves the adaptors for both TLR3 and
RNA helicases TRIF and MAVS.180, 181 To finish, Ebola Virus VP35 inhibits signaling by both binding to dsRNA in addition to a yet to be elucidated mechanism downstream of
TBK1 and IKKe.182 Thus, while the immune system has developed a complex response
against invading pathogens to protect the host, pathogens themselves have been forced to
evolve and adapt in equally diverse ways.
46
CHAPTER 2
MATERIALS AND METHODS
Construction of ISG56 knockout targeting vector
All PCRs were conducted using the Expand Hi Fidelity PCR System (Roche) per the manufacturer’s instructions. Restriction enzymes (NEB) and calf intestinal phosphatase (Roche) were used according to manufacturer’s instructions. All ligations were conducted using T4 DNA ligase (5u/ul) (Roche) with glycogen (Roche). All transformations were conducted using chemically competent DH5a prepared with rubidium chloride.
The targeting vector (mISG56LOXP) was constructed in three steps. The first step involved the cloning of two fragments to form together the 5’ homologous recombination arm and ISG56 coding region (5’ ARM-EXON2). The first fragment (5’ ARM) contained the 5’ homologous arm and Exon 1 (approximately 3kb in size). This was generated by
PCR using template from 129Sv DNA obtained from University of Washington ES Core and primers that introduced a loxP site in the 5’ UTR before the ATG and an Apa I site at the 5’ end for cloning purposes. The second fragment (EXON2) contained Exon 2 and was generated from the 129Sv DNA by PCR with the 5’ primer containing the loxP and
Exon 1 from the first fragment and the 3’ primer introducing a SalI site for cloning purposes. These two PCR fragments were cloned into TOPO TA vectors per the manufacturer’s suggestions (Invitrogen). The EXON2 fragment was then cloned into the
TOPO TA vector containing 5’ ARM using BstEII and SacI. The resulting fragment (5’
ARM-EXON2) was then cloned into the targeting vector, pBluescript based plasmid containing a PGK-NEO cassette, pK11, gift of V. Lefebvre, using ApaI and SalI.
47
The second step involved the cloning of two fragments to form together the LacZ reporter gene linked to the 3’ homologous recombination arm (LACZ-3’ ARM). The first fragment (LACZ) was generated by PCR using the plasmid pNTRlacZ, gift of V.
Lefebvre, as template and using primers that introduced at the 5’ end a SacII site for cloning and a loxP site. The second fragment (3’ ARM) was generated by PCR using the
129Sv DNA as template and primers introducing a NotI site at the 3’ end for cloning purposes. These two PCR fragments were cloned into TOPO TA vectors. The 3’ ARM was cloned into the vector containing LACZ using XmaI and NotI. The resulting
fragment (LACZ-3’ARM) was then cloned using SacII and NotI into the pK11 vector
already containing the first fragment, 5’ARM-EXON2, to form mISG56LOXP.
While restriction digest analysis of mISG56LOXP indicated that the insertion and
orientations of our fragments were correct, sequencing of important regions within the
vector such as the 5’ UTR and coding regions for ISG56 and LacZ indicated that the
second of the two essential ISREs in the 5’ UTR was mutated. This was not a result of
the genomic DNA used as the template. Therefore, a third cloning step was required to
replace this mutated sequence with a correct ISRE. A region with the 5’ UTR was
amplified by PCR again, the ISRE sequence confirmed to be correct and then cloned
using SexAI and BstEII into the original mISG56LOXP to replace the mutated sequence.
Screening of ES cells for recombination of the targeting vector
The targeting vector mISG56LOXP was linearized with NotI, gel purified with
QiaexII (Qiagen) and sent for electroporation into ES cells at the University of
Washington at St. Louis in collaboration with Herbert Virgin III. ES cell clones were
selected in G418. DNA was extracted using a standard phenol chloroform protocol.
48
Briefly, cell pellets were digested overnight at 55C with proteinase K (200ug/mL)
(Sigma) in 0.5M Tris-HCl pH8.5, 25mM EDTA, 1% SDS, 1M NaCl. DNA was extracted
with phenol, washed with chloroform:isoamyl alcohol (49:1), precipitated with NaOAc
and ethanol and resuspended in Tris for further analytical digests.
Southern Blot Hybridization
The probes for Southern hybridization were amplified by PCR from 129Sv DNA using the appropriate primers and TOPO TA cloned for use. The probe fragments BGLII, targeting the 5’ non coding region of ISG56 outside the area of recombination, and
ECORI, targeting the 3’ non coding region of ISG56 outside the area of recombination,
were released from their vectors by EcoRI digestion, gel purified Qiaquick (Qiagen) and
resuspended in TE. The purified fragments were then labeled with 32P dCTP in
RediPrime II Random Primer labeling system (Amerscham) per manufacturer’s
instructions, denatured at 100C 10min before use in hybridization.
10ug of ES cell DNA samples was digested overnight with the appropriate
restriction enzyme (BglII or EcoRI) with 1mM Spermadine. Digested DNA fragments
were precipitated with ethanol and 300mM NaOAc and resuspended in water to be
separated on a 0.8% Tris Borate EDTA agarose gel. Gels were washed 4 times for 15
minutes each in water to rinse off ethidium bromide. DNA was depurinated by soaking
the gel in 0.2N HCl for 15 min. Gels were washed again and then soaked in 0.4N NaOH
for 15 min to denature and dehydrolyze the DNA. Capillary transfers of the DNA were
performed overnight with 0.4N NaOH onto nylon transfer membranes Hybond N+
(Amersham), rinsed briefly in 2X SSC 0.2M Tris-HCl pH 8.0 and DNA crosslinked onto
membrane in the UV Stratalinker 2400 (Stratagene). Membranes were prehybridzed at
49
65C for more than 2 hrs in Hybridization buffer (0.3M NaPO4 pH7.2, 6.7% SDS), then
hybridized overnight with a minimum of 21 million cpm of radiolabeled probe per blot in
Hybridization Buffer. Membranes were washed briefly in 2XSSC 0.1%SDS at room
temperature and 30 min at 65C, then two more times 15 min each with 0.2XSSC
0.1%SDS. Membranes were sealed and exposed overnight to visualize by Molecular
Dynamics PhosphorImager. Membranes were then exposed at -80C to visualize by film.
Cell Survival Assay
1x10^5 TLR3 293 561-TK cells were seeded in 35mm wells overnight,
transfected with 2ug total of plasmids expressing viral ORFs and 6 uL of Fugene for 16 hrs, media changed to complete for 24 hrs and treated with dsRNA and GCV. Cells were maintained under selection 4 days to assay survival as determined by visualization with
media containing selective pressures changed every 2 days. Pools of these cells
expressing V proteins were passaged without dsRNA before further experiments.
Viruses
W3A strain wildtype and VDC PIV5 virus, gifts of B. He, were propagated in
Vero cells as described previously.183, 184 Briefly, 5x10^6 cells were seeded in 100mm plates overnight, washed with PBS with divalent cations, inoculated with virus diluted in
1% BSA in MEM with Earle’s Salts at an moi of 0.2 to infect for 1.5 hr at 37C, 2% FBS
media added and virus allowed to grow for 4 days before collection. When growth
stopped increasing as monitored by hemagluttination assay, virus was harvested, cells
spun down and supernatant collected to be aliquoted and quick frozen in 1% w/v BSA.
50
TLR3 antiviral activity
1x10^6 293 or TLR3 293 cells were seeded in 35mm wells overnight, treated with
dsRNA for 16hrs, then infected with WT or VDC PIV5 at an moi of 0.1. Final media
volume per well was 2mLs. Viral replication was monitored via henagglutination assays
daily. Supernatants were collected 6dpi.
PIV5 Plaque Assay
Virus yields were determined by plaque assay on Vero as described previously.184
Briefly, approximately 2x10^6 Vero cells were plated to 100% confluency and washed with PBS with divalent cations before infection as described above. After the infection period of 1.5 hr, virus inoculum was removed, cells washed with PBS again and overlaid with 0.8% carboxy methyl cellulose (CMC) in 2%FBS 10mM HEPES DMEM. Plaques were allowed to develop for 4-7 days before fixation with 10% formaldehyde and visualization with 1% crystal violet in 10% methanol in PBS.
Hemagglutination assay
Hemagglutination assays were conducted as previously described.184 Briefly, virus samples were serially diluted 2 fold in cold PBS in U bottom 96 well plates. Equal volume of 0.5% suspension of guinea pig red blood cells (Colerado Serum Company) in
PBS was mixed into samples and the reactions were allowed to proceed at 4C 1-2hrs.
Cells
HT1080 derived 2fTGH wildtype V protein expressing cells, 293 and TLR3 293
have been described.185, 186 To make HT1080 derived 2fTGH cell lines permanently
expressing mutant viral proteins, 2fTGH cells were co-transfected with respective pEF-V
protein expression vectors and a puromycin expressing vector for selection or, for
51
MHV68 ORFs, 2fTGH cells were transfected with just the ORF expression vector and
selected by G418 resistance carried by the plasmid. To make TLR3 293 561-TK cells,
TLR3 293 was transfected with 561-TK plasmid. This contains the ISG56 promoter (-
654-+3) 124 driving the herpesvirus thymidine kinase (TK) 187 which was cloned via
Sst1/SalI into pGL3B (Promega) to replace luciferase.
Plasmids
Wildtype pEF-V protein expression vectors have been described.188, 189 MuV V
mutants were constructed with QuikChange® II XL (Stratagene). PCR products from
primers targeting residues were cloned with DpnI. PIV5 VDC mutant was constructed
with Expand Hi Fidelity PCR System (Roche) using wildtype pEF-V protein as template
and BamHI/BglII and NotI for cloning. The following primers were used for cloning: for
C189A, 5’ GTCCGGGTCTTTGAGTGGGCCAACCCTATATGCTCACC 3’ and 5’
GGTGAGCATATAGGGTTGGCCCACTCAAAGACCCGGAC 3’, for C214A 5’
CCCGCAAAGGCCGATCAGTGC 3’ and 5’ GCACTGATCGGCCTTTGCGGG 3’,
for C217A, 5’ CCCGCAAAGTGCGATCAGGCCGAACGAGATTATGGACC 3’ and
5’ GGTCCATAATCTCGTTCGGCCTGATCGCACTTTGCGGG 3’, for M-AAA (a
combination of three W to A mutations) W174A 5’
GGAGGGCATAGACGGGAAGCGAGCCTCAGCTGGGTCC 3’ and
5’GGACCCAGCTGAGGCTCGCTTCCCGTCTATGCCCTCC 3’, W178A 5’
CGGGAATGGAGCCTCAGCGCGGTCCAAGGAGAGGTC 3’ and
5’GACCTCTCCTTGGACCGCGCTGAGGCTCCATTCCCG 3’, W188A 5’
GAGGTCCGGGTCTTTGAGGCGTGCAACCCTATATGCTCA 3’ and 5’
TGAGCATATAGGGTTGCACGCCTCAAAGACCCGGACCTC 3’, for E95D 5'
52
GGAGGGACTCAGATTCCTGACCCCCTTTTTGCACAAAC 3' and 5'
GTTTGTGCAAAAAGGGGGTCAGGAATCTGAGTCCCTCC 3', for E95R 5'
GGAGGGACTCAGATTCCTAGGCCCCTTTTTGCACAAAC 3' and 5'
GTTTGTGCAAAAAGGGGCCTAGGAATCTGAGTCCCTCC 3', for V47P 5’
ATCCCTGGCGTTGCACCTCCACTCATTGGCAATCCAGAG 3’ and 5’
CTCTGGATTGCCAATGAGTGGAGGTGCAACGCCAGGGAT 3’ and for L97P 5’
ACTCAGATTCCTGAGCCCCCTTTTGCACAAACAGGACAG 3’ and 5’
CTGTCCTGTTTGTGCAAAAGGGGGCTCAGGAATCTGAGT 3’. pEF plasmids
expressing MHV68 ORFs were a gift from J. Jung and plasmids expressing mCMV and
hCMV ORFs were a gift of A. Geballe. pEF-Trif-Flag190 (gift of K. Fitzgerald), wildtype
and kinase inactive (K38A) IKKe (pCDNA3.1-Myc)191 (gifts of U. Siebenlist), Flag-
IRF3 and IRF3 5D 192 (gifts of J. Hiscott), MyD88 dominant negative, TLR3 dominant
negative without a TIR domain in plasmid and lentiviral forms,193 IRF3 siRNA,23 HCV
NS34A180 (gift of M. Gale) and HA-Ubiquitin (gift of S. Fuchs) 194 vectors have been
described.
Reagents
All transfections were carried out with Fugene6 (Roche) with 3uL of Fugene per ug of DNA and 3uL of Fugene per 2ug pIC. Ganciclovir (GCV) (Invivogen), Leptomycin
B (LMB) (Sigma), MG132 (Sigma) in DMSO (Sigma), dsRNA (Amersham Pharmacia)
in the media, 124 transfected dsRNA and IFNb (Calbiochem) were used in treatments at
10ug/mL, 10ng/mL, 10uM, 100ug/mL, 8ug/mL and 1U/mL respectively unless otherwise
specified.
53
Quantitative PCR
HT1080 V protein and MHV68 ORF expressing cells were treated with dsRNA for 6hrs. Total RNA was isolated with RNA-Bee (Tel-Test) and DNase treated with
DNA-free (Ambion). cDNA was synthesized with Superscript III (Invitrogen). The Q-
PCR reaction amplified bp 6-354 of ISG56, control RPL32 (ribosomal protein L32) and
MHV68 ORF58 bp 338-460 with SYBR Green (Applied Biosystems). ISG56 primers: 5’
TCT CAG AGG AGC CTG GCT AAG 3’ and 5’ GTC ACC AGA CTC CTC ACA TTT
GC 3’. RPL32 primers: 5’ GCC AGA TCT TAT GCC CCA AC 3’ and 5’ CGT GCA
CAT GAG CTG CCT AC 3’. ORF58 primers: 5’ GGG TTC CCA TGG CAC TTA TTT
CAA C 3’ and 5’ GGG AAT CCA GAA GGC AGG AGA 3’.
IRF3 Dimerization assay
IRF3 dimerization was analyzed by native PAGE and immunoblotting with IRF3 antibody. Briefly, cells were lysed in buffer containing 75mM NaCl, 50mM Tris-Cl, pH
7.5, 1mM EDTA, 1% (w/v) NP40, 10mM NaF, 0.4mM PMSF, 1mM Na3VO4, 1X protease inhibitor (complete protease inhibitor tablets, Roche), protein samples loaded in
0.125m Tris-Cl, pH 6.8 20% (w/v) glycerol and 0.1mg bromophenol blue, and electrophoresed by native PAGE with 1% deoxycholate (Sigma) in the inner chamber.
Electrophoresis was conducted on ice and gels were prerun for 2hrs before loading of samples. After electrophoresis, gels were soaked in running buffer containing SDS
(0.25M Tris, 1.92M Glycine, 1% SDS) for 30 minutes at room temperature before transfer onto PVDF membrane.
54
IRF3 apoptosis assays
HT1080 derived cells stably expressing MHV68 ORF58 were plated overnight,
transfected with 8ug/mL dsRNA and 12uL Fugene6 for 16hrs before collection and
analysis of PARP cleavage by immunoblotting. For visualization, the transfection was
allowed to proceed for 20 hrs and viewed under the microscope.
IRF3 phosphorylation and nuclear localization assays
To assess S396 phosphorylation and IRF3 nuclear localization, HT1080 cells
expressing viral proteins were treated with dsRNA for 3hrs before collection of whole
cell or nuclear lysates respectively described previously.124 For nuclear extracts, cells
were washed in PBS and resuspended first in Hypotonic Buffer (20mM Tris pH8.0, 4mM
MgCl2, 6mM CaCl2, 0.5mM DTT), incubated on ice for 5 minutes and then mixed with
equal volume of Lysis Buffer (0.6M Sucrose, 0.2% NP-40, 0.5mM DTT) before
douncing. Nuclei were pelleted by centrifugation (1000g 5 minutes) washed with
Glycerol Wash Buffer (50mM Tris pH8.3, 5mM MgCl2, 0.1mM EDTA, 40% glycerol) and PBS before further lysis. To look at localization by immunoflourescence, the same cells were plated on coverslips, treated with dsRNA for 1hr and then LMB for 2hrs before fixation with 4% formaldehyde and permeablization with 0.2% Triton X-100
(Sigma). Cells were stained for IRF3 (1:10,000) and DAPI.124 To determine IRF3
transcriptional activity, the same cells were treated with dsRNA for 1hr, and then LMB
for 6hrs. Whole cell extracts were prepared for immunoblotting.
Immunoblotting and Immunoprecipitation
Unless otherwise specified, protein extracts were made by lysing cell pellets in
50mM Tris pH 7.4, 150mM NaCl, 0.1mM EDTA, 10% glycerol, 1% Triton X-100,
55
50mM NaF, 10mM β glycerophosphate, 1mM PMSF, 1mM Na3VO4 and 1X protease inhibitor (complete protease inhibitor tablets, Roche) on ice, brief sonication followed by
clarification by centrifugation.
Immunoblotting was performed with antibodies HA Y-11 (1:1000) (Santa Cruz
Biotechnology), actin (1:500) (Sigma), p56 (1:5000),123 c-Myc 9E10 (1:1000) (Santa
Cruz Biotechnology), P396 IRF3 (1:1000) (Cell Signaling), total IRF3 (1:10,000) (gift of
M. David),195 histone H1 AE4 (1:1000) (Santa Cruz Biotechnology), STAT2 C-20
(2:15,000) (Santa Cruz Biotechnology), Flag M2 (1:5000) (Sigma), PARP 9541 (1:1000)
(Cell Signaling), AKT 9272 (1:1000) (Cell Signaling), phospho serine 473 AKT 4051
(1:1000) (Cell Signaling), P38 9212 (1:1000) (Cell Signaling), phospho threonine
180/tyrosine 182 P38 9211 (1:1000) (Cell Signaling), p65 4764 (1:1000) (Cell
Signaling), DRBP76/p90 (1:1000) raised in the Cleveland Clinic Hybridoma core against
purified protein196, 197 and V5 (1:1000), a polyclonal antibody raised against a full length
PIV5 V-GST fusion protein at Cocalico Biologicals Inc (gift of C. Horvath).
To assay V interaction with IKKe, TLR3 293 cells were transfected with relevant
expression plasmids. Immunoprecipitations (IP) were performed as described previously
189 with agarose conjugated HA F7 (Santa Cruz Biotechnology), Flag M2 (Sigma) or
Protein A/G PLUS-Agarose (Santa Cruz Biotechnology) with c-Myc 9E10 at 4C. To
assay for in vivo V phosphorylation, the same procedure was used to isolate V. The
resulting samples were then treated with 100U calf intestine phosphatase (CIP) (USB)
37C 3hr where indicated.
56
In vitro Kinase Assay
To purify Flag- IRF3 and VM, the respective vectors were transfected for 24hrs
into TLR3 293 cells and lysates prepared as described.198 Briefly, cells were lysed on ice
for 30 minutes in 50mM HEPES pH 7.4, 150mM NaCl, 2mM EDTA, 5mM NAF,
0.1mM NaVO4, 1% NP-40, 10% glycerol, 5ug/mL PMSF, 5 ug/mL Leupeptide and
5ug/mL Pepstatin A. Flag-tagged proteins were immunoprecipitated from centrifuged
clarified lysates (approximately 3mg) with 50uL of Flag M2 agarose (Sigma) for 2 hrs at
4C, washed 6 times with PBS, eluted with Flag peptide (Sigma) 0.2ug/uL in 10mM TRIS
pH7.5 in 10% glycerol and concentrated with Microcon Filter Devices YM-3 (Millipore).
Myc-TBK1 was purified similarly with c-Myc 9E10 and Trueblot IP beads (eBioscience).
Quantitation of purified substrates was performed by Flag immunoblotting with Odyssey.
For in vitro kinase assays, purified Flag-IRF3 or VM (100ng each) were incubated with
GST-IKKe (Cell Signaling) (70ng) or Myc-TBK1 in 20uCi γ32PATP and 20mM HEPES
pH7.4, 10mM MgCl2, 100uMNa3V04, 20mM β glycerophosphate, 10mM p-Nitrophenyl
Phosphate , 1mM DTT, 50mM NaCl for 30 minutes at 30C.198 Samples were analyzed by
SDS gel electrophoresis and quantitation for autoradiograph was performed by Molecular
Dynamics PhosphorImager and for immunoblotting by Odyssey (Licor).
VM degradation
To follow VM degradation by IKKe, 1ug control empty or IKKe expressing
vectors were cotransfected with 1ug V expressing vectors into TLR3 293 cells for 8hrs,
media changed and whole cell lysates prepared 48hrs later. To follow VM degradation by
dsRNA, the same cells were simultaneously transfected with pEF-V and dsRNA-treated
with either MG132 or control DMSO for 16hrs.
57
IKKe ubiquitination
To assay for ubiquitination of IKKe, 2ug empty or VM expressing vectors were co
transfected with 1ug of HA tagged ubiquitin and 2ug of IKKe vector into 4 x 10^6 293
cells seeded in 100mM plate for 8 hrs. Cells were collected 24 hrs after transfection,
lysed and 1mg of whole cell extract pre cleared with 20uL protein A/G agarose beads
(Santa Cruz Biotechnology) for 2 hr at 4C. Pre cleared lysates were then mixed with 1ug
of Myc 9E10 (Santa Cruz Biotechnology) for 3 hrs 4C and then 20uL of protein A/G
agarose beads were added for another 2 hr at 4C. Immunoprecipitations were washed five
times before eluction and analysis by SDS gel electrophoresis.
IL8 ELISA
1x10^6 HT1080 derived cells stably expressing MHV68 ORF58 were plated in
35mm dishes overnight and treated as indicated. Media was collected and frozen -20C to store for further analysis. IL8 ELISA (BD Pharmingen) was performed in triplicate and confirmed by at least 2 independent experiments according to manufacturers’ instructions.
58
CHAPTER 3
A KNOCKOUT MOUSE MODEL TO ADDRESS THE PHYSIOLOGICAL
SIGNIFICANCE OF INTERFERON STIMULATED GENE 56 (ISG56)/
INTERFERON-INDUCED PROTEIN WITH TETRACOPEPTIDE REPEATS 1
(IFIT1)
Summary
Interferon stimulated genes (ISGs) are induced in diverse situations. These include
infection by virus, bacteria and parasites as well as other biological processes involved in autoimmunity, cancer and even the female menstrual cycle. Of the hundreds of genes that are upregulated, ISG56 is consistently one of the, if not the, strongest induced gene. The protein which it encodes, p56, has been shown to mediate antiviral activity against human papillomavirus and hepatitis C virus by inhibiting translation. To determine the physiological functions of this antiviral activity as well as other processes in which
ISG56 has been implicated we sought to disrupt the mouse ISG56 gene by making a conditional knockout. Unfortunately, problems were encountered in the generation of an embryonic stem cell containing a correctly integrated targeting construct. Possible reasons for this failure, methods to improve the chances for targeting success and the predicted phenotype of the ISG56 knockout are discussed.
Introduction
ISG56 is a member of a family of genes induced by interferons (IFNs) that
include human ISG54, 60 and 58, mouse ISG56, 54, 49 as well as others in goldfish, the
chinese hamster, rat and sheep.118, 120-122, 128-130, 134 The members of the protein products
59
of these genes, P56 family of proteins contain multiple 34 amino acid tetratricopeptide
repeat (TPR) motifs responsible for protein-protein interactions.
For the P56 family of proteins, TPR motifs mediate interaction with the
eukaryotic translation initiation factor (eIF3) subunits to inhibit translation. The first two
TPR motifs of mouse p56 (mp56) and the first TPR of mp54 bind to eIF3c,126 preventing the formation of the 48S preinitiation complex between the 40S ribosomal subunit and
20S complex.132 The last two motifs, TPRs 5 and 6, of human p56 (hp56) bind to the e
instead of c subunit of eIF3,123 preventing the formation of the ternary complex which is
also essential for translation.132, 133 Finally, hp54 binds to both the e and c subunits of
eIF3, inhibiting formation of both complexes.125 The translational inhibition then occurs
when the p56 family of proteins is expressed.
Induction of the ISG56 family of genes is mediated by interferon stimulated regulatory elements (ISREs) in their promoters which are both necessary and sufficient.117-120 Thus, interferon regulatory factors (IRFs) which bind to ISREs are the primary transcription factors responsible for expression. Although originally identified as
an IFN stimulated gene (ISG), the members of the ISG56 family can also be induced in
an IFN independent manner- directly from the activation of pattern recognition receptors
(PRRs). These PRRs include Toll like receptor 3 (TLR3), the RNA helicases RIG-I/mda-
5124-126 and TLR4.127 Induction then is both direct and mediated by IRF3 which is
activated by all the above mentioned PRRs, as well as indirect through IFN amplification
and mediated by the IFN stimulated gene factor 3 (ISGF3) complex of STAT1, 2 and
IRF9/p48.123-126, 199-201 Of the vast array of such genes that are induced by these pathways,
ISG56 mRNA is one of, if not the most, highly upregulated.24, 25
60
The fact that ISG56 in particular is so highly expressed upon infection by viruses that activate IRF3 is one indication that the p56 protein may play an important role in immunity. In situ hybridization show that mRNA of the ISG56 gene family are upregulated during infection with the Arenavirus lymphocytic choriomeningitis virus
(LCMV) particularly in microglia, a CNS specific immune cell, and other infiltrating immune cells within the brain.201 In addition, expression of the ISG56 family of genes overlaps with and extends beyond the area of LCMV infection. This pattern also occurs during infection of the brain by the Flavivirus West Nile virus.202 This indicates that
ISG56 expression may help to contain virus replication in these two instances.
Furthermore, in response to infection by the Rhabdovirus Vesicular stomatitis virus
(VSV), almost every single other organ except the heart and kidney display increased mp56.203 Finally the Polyomavirus John Cunninghan virus (JCV),204 Paramyvxovirus
Sendai virus,123, 125 Adenovirus 12205 and Coronavirus severe acute respiratory syndrome
(SARS)206 also induce the ISG56 family of genes.
Once induced, human p56 (hp56) appears to have an antiviral role against viruses such as the Flavivirus Hepatitis C virus (HCV). Virus infection induces p56 expression in whole chimpanzee207 as well as human208 and mouse209 tissue culture models. hp56 is associated with the initiator ribosome HCV RNA complex in IFN treated cells and suppresses HCV internal ribosome entry site (IRES) mediated translation both in vitro and in vivo through eIF3 binding.210 This antiviral mechanism is important in determining viral fitness as in a cell culture model a poorly replicating HCV replicon with a mutation that induced IFN and p56 evolved to replicate better and include point mutations that decreased the association of hp56 with RNA.211 Indeed, the HCV NS34A protease
61
mediates cleavage of the TLR3 and RIG-I/mda 5 adaptors TRIF and IPS1 respectively,
which are essential in IRF3 activation and hp56 induction and sequence diversity in the
NS3 coding region is associated with differential IRF3 activation.180, 212 These findings
indicate that the antiviral activity of P56 is a selective pressure.
Together, these lines of evidence support that the ISG56 family of genes is
important in the innate immune response against virus infection. Its low basal expression
and high inducibility in different tissues from a wide variety of stimuli suggest that its
actions are potent, have global implications and must be tightly regulated. No mouse models of any of the ISG56 family members currently exist currently. Of the family members, ISG56 and its protein product has been the most extensively studied and has
been shown to be able to directly mediate antiviral effects. Attempts at knocking down
ISG56 expression in tissue culture models via siRNA have never achieved 100% efficiency.213 This indicates that there may be a potentially unknown and essential role of
ISG56 for the host itself. To assess this and other as yet to be identified functions of P56
in a more physiologically relevant model, we sought to develop a conditional P56
knockout mouse.
Results
Targeting Strategy
To assess the function and expression of the mouse ISG56 gene, a conditional
knockout was designed. ISG56 is encoded by only two exons separated by one intron,
with the first exon comprising only of the start codon.117 Conditional expression in the
targeting vector was achieved by removing the intron, joining the two exons together to
create a continuous ORF and flanking this ORF with the cre recombination sites loxP.214
62
(Fig 3.1) The widely accepted purpose of an intron is for use in alternative splicing. This
process was not felt to be important for the ISG56 gene since there are no indications that
splicing occurs: there is only one intron within the gene and two are necessary for actual
alternative splicing and we have not observed protein products by immunoblotting that
may result from an alternatively spliced version. While the removal of the intron may
affect the stability of the ISG56 mRNA, we did not believe this possibility outweighed
the ability of being able to completely remove the ISG56 allele in the null situation.
ISG56 and the homologous recombination arms were cloned from 129/Sv embryonic
stem (ES) cell DNA derived from the genotype of ES cells in which transfection and
recombination would take place.
For selection, the antibiotic Neomycin (Neo) under the control of the
phosphoglycerate kinase (PGK) promoter was inserted after the poly adenylation signal
of ISG56. To ensure that the PGK promoter and Neo did not affect the transcription of
the ISG56 present on the targeting vector, PGK Neo was inserted in the antisense
direction of the ISG56 gene. In addition, frt recombination sites were placed on either
side of the PGK Neo cassette for its removal after use as a selection marker. This could
be accomplished either during the embryonic stem (ES) cell stage or by crossing with
transgenic mice expressing the recombinase flp.215
For conditional ISG56 expression, loxP sites were placed immediately 5’ of the
ISG56 ATG and 3’ of the outer flp site. The creation of a null allele could be
accomplished again either in the ES cell stage or by crossing with transgenic mice
expressing the recombinase cre. As many transgenic mice exist that express cre from promoters which are inducible, tissue specific or developmental stage specific, the use of
63
Figure 3.1: Targeting strategy of the P56-/- mouse.
The white boxes detail the genomic structure of the ISG56 gene with its two exons and and an intervening intron as labeled. The targeting vector is highlighted in grey and so represented in the recombination possibilities outlined. Complete recombination of targeting vector with the resident ISG56 allele are denoted with crossing black lines and
partial recombination in exon 3 denoted with dashed lines. PGK NEO denotes the
phosphoglycerate kinase-neomycin resistance cassette inserted in reverse orientation.
LacZ denotes the promoter-less β galactosidase gene. Target sequences for frt and cre
recombinases are labeled as flp and loxP, respectively. Bgl II and Eco RI restriction sites
used for genotype determination by Southern blot analysis are as labeled with indicated
probes and expected DNA fragments. Representative Southern blot analysis of an ES
clone picked after transfection of targeting vector into cells and antibiotic selection shows
a band at 12.1 kb with the BglII probe and 10.9 kb band with the EcoRI probe, indicating
the complete integration of the targeting vector into the genome at some place other than
the ISG56 allele.
64
65
the cre/loxP recombination system would allow for a great number of conditions in
which the ISG56 allele could be removed.
Finally, to assess the expression pattern of ISG56, the reporter gene lacZ encoding
β galactosidase was inserted immediately after the 3’ loxP site. In this way, reporter gene
expression would be controlled by the ISG56 promoter once cre recombination took place.216
Embryonic Stem (ES) cell screening
Homologous recombination of this targeting vector with the resident gene would delete the intron, 6.6 kb, from the start of the resident gene. (Fig 3.1) Restriction
enzyme digestion of the inserted intronless ISG56 construct with Bgl II would produce a
5.5 kb instead of the 12.1 kb DNA fragment when hybridizing to a specific probe
targeting the 5’ non-coding region of ISG56 outside of the region of recombination.
Partial homologous recombination could also potentially occur with an incorrect
5’ homologous arm containing exon 2 of ISG56 instead of the 5’ region upstream.
Digestion of such a partially recombined allele with Bgl II would produce a 12.1 kb DNA
fragment identical to the wildtype ISG56 allele because of the presence of the intron.
Therefore, a second screening strategy was devised to detect this partial recombination
using the presence of an Eco RI restriction site in the lacZ gene of the targeting vector.
Eco RI digestion of DNA containing a partial (or complete) recombination of the
targeting vector would produce a 5.7 kb DNA fragment hybridizing to a specific probe
targeting the 3’ non coding region of ISG56 outside of the region of recombination. The
same restriction enzyme would generate a 10.9 kb DNA fragment from the resident
66
ISG56 allele. Using both of these strategies, we could distinguish between clones in
which only partial and clones in which complete recombination took place.
Proper construction of the targeting vector was confirmed by restriction digest
and sequencing. It was linearized by Not1, purified and transfected into ES cells three
different times. A total of 364 clones overall were picked. None were shown to contain
the targeting vector integrated appropriately by Southern hybridization of genomic DNA
digested with Bgl II. Further analysis of clones from the first transfection group
confirmed that while the vector integrated into the genome, it was in multiple sites
outside of the ISG56 locus. Unfortunately, the sites themselves were never identified.
Discussion
ISRE mediated signaling is activated in diverse situations, not just viral infection. These
include infection with bacteria and parasites, some autoimmune diseases and cancers, and
even as part of the female menstrual cycle. Although ISREs mediate the induction of hundreds of genes, ISG56 is consistently one of the, if not the strongest, induced genes.
This begs the question whether ISG56 plays important and phenotypically evident roles in the diverse situations in which it is induced. Development of a knockout mouse will be critical to answering this mystery.
Improving chances for targeting success
It is disconcerting that out of the 364 clones we tested, none showed correct homologous recombination of the targeting vector with the resident ISG56 allele. Equally
surprising was that not even partial recombination via the exon 2 homology occurred.
Instead, integration of the targeting vector occurred at unknown sites. One possible
explanation may be that the lengths of the arms built into the vector for homologous
67
recombination were too short. The 5’ arm was 3 kb and the 3’ arm was 2.9 kb. While
these lengths were certainly not the shortest successfully used for recombination by
others, the fact that the intervening sequences were about 9.1 kb in length, more than
three times the length of either, may have decreased the overall efficiency as the
frequency of recombination is inversely proportional to the length of the nonhomologous
DNA insert. A second possible problem may be that the homologous arms are similar enough to other areas of the genome for recombination. While both the 5’ and 3’ arms
were specifically homologous to the respective areas around the resident ISG56 allele,
BLAST analysis of did indicate approximately 80% nucleotide sequence identity in 1 kb
of the 2.9 kb 3’ arm to an area on chromosome 9. In addition, the 0.5 kb PGK promoter
and 0.5 kb 3’ UTR for Neo are 99% homologous to areas on chromosome X within the
mouse genome. While we have not specifically assessed if recombination did indeed
occur at these locations, the fact that there were more than two different banding patterns
shown by Southern indicate the targeting vector integrated into many and not just these
two areas.
In light of these possibilities, longer arms for homologous recombination may be
necessary for larger pieces of DNA to be integrated. Thus, decreasing the length of the non-homologous insert (i.e. removing the LacZ reporter gene and/or shortening the
ISG56 targeting vector allele) may help improve the chances for targeting success.
Another option is to use a negative selection marker such as the herpesvirus thymidine
kinase (TK) at the end of the targeting vector to screen out random integration by
ganciclovir antibiotic selection. This is based on the notion that random integration will
incorporate TK into the genome and its subsequent expression in the presence of GCV is
68
lethal to the cells. However, correct homologous recombination will not incorporate TK
into the genome and its lack of expression in the presence of GCV will allow survival.
Finally, changing the areas used for homologous recombination to try to minimize the
homology between sequences within the targeting vector and non-specific areas in the
genome, particularly in the 3’ end, may be helpful in targeting success. This last option,
however, cannot be utilized unless a completely new knockout strategy is devised.
Mouse vs human ISG56
The development of a knockout mouse would be essential in addressing many
questions as to the physiological importance of mp56. However, extrapolations to its
human protein must be made cautiously. While human and mouse p56 have homology in
terms of tertiary structure in the location and number of TPR motifs, actual amino acid
sequence homology is 53% between mouse and human ISG56 and 63% for ISG54.126
The induction patterns of human and mouse p56 are also slightly different when dsRNA in the media is the treatment, with much less efficient IFN independent induction of
ISG56 in mouse macrophages compared to human tissue culture cell lines.217
Furthermore, while mouse and human p56 have similar potencies at inhibiting translation as measured by in vitro assays, they are different in that mp56 binds to the c subunit of eIF3 while the hp56 binds to the e subunit.126 These different mechanisms mediated by
the different subunits, (preventing the formation of the preinitiation complex compared to
the ternary complex respectively) may be more important in a whole mouse model context.
69
Multiple members of the ISG56 family of genes
Another inherent issue with an ISG56 knockout mouse lies in its family members.
All are homologous to each other and utilize TPR motifs to interact with eIF subunits to
inhibit translation. We choose ISG56 to knockout first because it is one of highest
induced and also best characterized member of its family. In addition, only hp56 has been
shown to have antiviral functions against such viruses as HPV and HCV. Therefore, a
mouse lacking ISG56 is more likely to have a phenotype such as increased susceptibility
to viral infections as compared to other family members who either have not been shown
to be antiviral in this capacity or have not been characterized. However, no phenotype
may be observed if the functional conservation between family members is sufficient to
compensate for the loss of one.
It is our hope though that the mouse model will indicate physiological reasons for
the subtle differences between the ISG56 family members. Even though mp49 has yet to
have a function associated with it, it appears to be as strongly induced as mp56 in LCMV
and WNV infections. In contrast, mp54 is consistently induced to lower extents in these
experiments.201 Similarly, in response to IFNα and VSV treatments in the mouse, mp54
appears to be less induced as compared to mp56203 and in response to IFNβ but not pIC
in the media or transfected into cells, human ISG54 mRNA is induced less than ISG56.125
However, there are instances in which ISG56 is induced less than ISG54. This is seen most notably in B cells upon stimulation with dsRNA, VSV and IFNa at both the protein and mRNA expression levels.203 Thus, while the ISG56 family appears to be functionally
similar, these differences in induction indicate that the roles of each protein may be
unique.
70
Predicted phenotypes for a P56 knockout mouse
Members of the ISG56 family are induced by a variety of stimuli including viral
infections. While induction alone cannot be equated to importance, expression is
sufficient to indicate the possibility that ISG56 may play a role in infection. In this
capacity, a knockout mouse will help to more definitively establish or debunk this
characterization. Of course the most attractive pathogens to test for phenotypic changes
in the knockout mouse are those viruses which have already been shown to be affected by
P56 in tissue culture models: HCV and HPV. Unfortunately, the lack of a good mouse model for either of these viruses makes testing them difficult. A second group of viruses worthy of examination are those which induce p56 during infection but where an antiviral function has not been elucidated. As mentioned above, these viruses include Sendai,123,
125 SARS,206 WNV,202 LCMV201 and herpesviruses such as CMV.218 Interestingly, the
upregulation of ISG56 in LCMV infections is correlated with impaired spatial and
temporal learning (the inability to learn how to run a maze by being shocked in the foot).
This indicates a possible behavioral function or phenotype related to ISG56.219
Furthermore, ISG56 in the rat appears to be upregulated in developed oligodendrocytes which are responsible for producing the myelin necessary for nerve conduction.220 These patterns of expression indicate a possible neurological as well as antiviral role in the expression of ISGs. For non-viral pathogens, bacterial PAMPS such as LPS from
Neisseria127 and CPG DNA have been shown to induce ISG56.221 Based on these
findings, it is not unreasonable to hypothesize that the ISG56 knockout mouse will have defects in the host immune response to bacteria and parasites in addition to viruses.
71
Not surprisingly, ISG56 being an ISG is also upregulated in some autoimmune
diseases where the immune system is upregulated. Plasma from patients with systemic
lupus erythematosus but not rheumatoid arthritis appear to induce ISG56.222 Therefore, a
knockout mouse in this context may exhibit altered immune pathogenesis of some
autoimmune diseases.
In addition, ISG56 is linked to lymphomas. Both ISG56 and ISG60 are
upregulated in myodysplastic syndromes in the cells which are precursors to lymphocytic
and myelomonocytic leukemias.223 Furthermore, patients treated with imiquimoid, a
TLR7 ligand, for superficial basal cell carcinomas and cutaneous T cell lymphomas also
have elevated levels of ISG56.224 Thus a knockout mouse model of ISG56 may have
altered susceptibilities to some lymphomas and also respond differently to treatments.
Finally, ISG56 is regulated by the menstrual cycle and pregnancy in ewes.130 In
addition, ISG56 levels cycle in the uterus in response to menstrual hormones in both mice
(GDS2208)225 and humans.226 This suggests a possible role for P56 in reproduction and,
in a very round about manner, is one justification for using an inducible knockout model to account for the possibility of reproductive defects.
In summary, the ISG56 family of proteins is unique in its high expression, regulation and possible redundancy. The various members have been shown to be important in the context of the pathogen and host relationship. However, there are numerous indications that the ISG56 family may be important for other physiological processes. The only possible way to really ascertain their role is to systematically knockdown one by one and in combination the different members. Making an ISG56 knockout will only be the first of many to come.
72
CHAPTER 4
A CELL SURVIVAL ASSAY THAT IDENTIFIES VIRAL INHIBITORS OF
dsRNA MEDIATED SIGNALING
Summary dsRNA is an important pathogen associated molecular pattern whether its source is the
pathogen itself or the host as cells necrose during infection. Extracellular dsRNA is
recognized through TLR3 and activates IRF3 to mediate the transcription of interferon
(IFN) stimulated genes (ISGs) via IFN stimulated regulatory elements (ISREs) in their
promoter. This pathway is important in establishing the antiviral environment as many
viruses activate IRF3 and many of the genes that are induced have been shown to have
direct antiviral activity. Viruses in turn have developed a variety of mechanisms to evade
this part of the immune system. To identify inhibitors of IRF3 transcriptional activity, we
therefore developed a cell death assay in which IRF3 is activated by dsRNA signaling
through TLR3. When dsRNA TLR3 IRF3 signaling was induced cells died. When
signaling was inhibited cells survived. In this capacity, this assay can be used to identify
not only inhibitors but also activators of IRF3 mediated gene transcription from a variety
of different sources including viruses.
Introduction
dsRNA is an important pathogen associated molecular pattern present during viral
infections either as the viral genome, as replication intermediates or as part of cellular
debris released in necrosis.26 This is underscored by the phenotypes of the dsRNA
receptor knockout mice in virus infections. Mice lacking RIG-I and mda-5, which
recognize cytoplasmic or intracellular RNA, have increased susceptibility to vesicular
73
stomatitis virus (VSV) and Japanese encephalitis virus (JEV) for the former and EMCV
for the latter.108, 109 The mouse model for TLR3, which recognizes extracellular dsRNA, appears to be protective for DNA and RNA viruses such as rhinovirus (RV), respiratory
syncytial virus (RSV), encephalomyocarditis virus (EMCV), mouse cytomegalovirus
(mCMV), herpes simplex virus (HSV) and influenza in the central nervous system
(CNS).45, 71, 78, 79, 81, 82 Paradoxically, TLR3 also appears to be detrimental in influenza
infections in the lung, Punta Toro virus, West Nile virus (WNV) and autoimmune diseases.66, 87, 90, 91
Signaling induced through these dsRNA receptors is predominantly through the
IFN regulatory factor (IRF3). Constitutively expressed IRF3 is activated directly by
dsRNA. Activated IRF3 homodimerizes,113, 227 localizes to the nucleus and induces the
expression of IRF7 and other ISGs. Subsequent heterodimerization between IRF3 and
IRF7 serves to amplify the antiviral response.228
These same steps of IRF3 activation provide multiple the levels of regulation for
the host and virus. Full phosphorylation and nuclear localization is essential for activity
and even partial inhibition of these steps is sufficient to inhibit transcription.59, 229 Host mechanisms of negative regulation as mentioned in Chapter 1 include suppressor of IKKe
(SIKE) which prevents phosphorylation,142 A20 which prevents dimerization145 and Ret finger protein (RFP) which allows for dimerization but not nuclear translocation.144 In addition, IRF3 after being activated via phosphorylation can be simply degraded via a proteosome dependent pathway.148, 192 Finally, IRF3 activation is a target for many RNA
and DNA viruses to inhibit as detailed in Chapter 1. The complexity of IRF3 regulation
74
here indicates that the transcription factor plays key roles in immune and possibly non-
immune functions.
IRF3 was first identified as an important part of the host response to viral
infection as part of the dsRNA-activator factor 1 (DRAF1) complex230 and subsequent
studies have shown that a variety of other pathogens activate the same transcription
factor. IRF3 null mice produce less IFN in response to virus infection and are
correspondingly more susceptible to EMCV induced lethality.228 WNV is also able to
replicate better in an IRF3 deficient situation but only in certain cell types.202 RNA viruses that induce IRF3 nuclear localization include Sendai via the RNA helicase RIG-
I,192, 231 New Castle Disease Virus (NDV),232 vesicular stomatitis virus (VSV),198
Reovirus233 and Measles virus nucleocapsid.234 DNA viruses that induce IRF3 nuclear
localization include Epstein Barr Virus (EBV) small RNAs,111, 235 human
cytomegalovirus (hCMV) glycoprotein B,7, 236 herpes simplex virus (HSV1)237, Kaposi’s
sarcoma virus (KSHV) vIRF3238 and murine γ−herpesvirus 68 (MHV68) genome fragments.239 Finally non-viral pathogens that activate IRF3 include bacterial components
such as LPS which signals through TLR4,240 Mycobacteria,241 Chlamydia muridarum,242
Listeria monocytogenes DNA and Legionella pneumophila.19, 243 Many of these
pathogens activate IRF3 through the receptors TLR3, RIG-I and mda-5. For this reason,
these receptors play an important role in inducing the antiviral environment which IRF3
helps establish.
The IRF3 mediated antiviral activity is via transcription of interferon stimulated
genes (ISGs). IRF3 binds to interferon stimulated regulatory elements (ISREs) within the
promoters of these genes for expression. The array of genes overlaps with those induced
75
by IFN231 and include genes of the ISG56 family, genes involved in signaling such as
TLR3 itself, apoptosis such as the oncogene pleiomorphic adenoma gene 1, RNA
synthesis, protein synthesis and processing, cell metabolism, transport, and structure such
as microfibril associated glycoprotein 2 are induced. This wide array of functions
indicates that IRF3 may have functional implications beyond the host immune system.25,
244
The importance of IRF3 in the host response to virus indicates that viruses may
have developed a variety of mechanisms to cope with IRF3 activation. Inhibition of
activation is one such mechanism. To identify inhibitors of IRF3 transcriptional activity,
we developed a cell death assay in which IRF3 is activated by dsRNA signaling through
TLR3. When signaling was induced by dsRNA or specific activating mediators of signaling, cells died. When signaling was inhibited by a known viral inhibitor, dominant
negative mutant of or siRNA targeting a signaling protein cells survived. Thus, in
addition to identifying inhibitors of IRF3 mediated gene transcription, this cell death
assay is also capable of identifying activators.
Results
A cell line that dies in response to dsRNA-TLR3-ISRE mediated signaling
To identify inhibitors of TLR3-ISRE mediated signaling, a cell line was developed to respond specifically to dsRNA in the media. Selection with this line was conferred by the expression of the Herpesvirus thymidine kinase (TK) gene, which when
in the presence of ganciclovir (GCV) is lethal.245 To construct the plasmid (561-TK) in
which TK is induced in the presence of TLR3 signaling, the ISG56 promoter (-654 to +3)
was cloned immediately upstream of the TK gene. (Fig 4.1) This promoter contains two
76
Figure 4.1: A cell death assay that identifies inhibitors and activators of dsRNA-TLR3-
IRF3 signaling.
A. A depiction of the reporter gene construct using in our assay. This construct contains
the HSV-1 thymidine kinase under the control of the ISG56 also known as 561 promoter
(-654-3). This promoter contains two interferon stimulated regulatory elements (ISREs)
(underlined) that are sufficient and essential for induction via the transcription factor
Interferon Regulatory Factor 3 (IRF3). B. A depiction of the cell line used in our death assay: TLR3 293 561-TK. Proteins or siRNA are expressed by transient transfection or lentiviral infection and the selection pressure of ganciclovir (GCV) (grey) alone or dsRNA (dotted) and GCV is added. Thus, cells die in the presence and live in the absence of signaling.
77
78
ISREs which alone are essential and sufficient for IRF mediated induction by dsRNA,
virus and IFN. Induction is also independent of NFkB and AP-1. Therefore, gene
expression is solely mediated by IRF3 or ISGF3.119, 120, 123, 124 The cells used for this line
were 293 cells stably overexpressing exogenous TLR3 (TLR3 293).186 293 cells do not
signal in response to dsRNA or IFN in the media. However, overexpression of TLR3 in
this cell lines confers dsRNA responsiveness. Therefore, IRF3 but not ISGF3 is activated
in response to dsRNA in the media. In addition, 293 and TLR3 293 cells do not die in
response to dsRNA in the media. As a result, TLR3 293 cells expressing 561-TK die as a
result of TK and GCV lethality. Thus, the dsRNA induced cell death phenotype is TLR3
signaling specific.
561-TK was co-transfected with a puromycin antibiotic selection plasmid into
TLR3-293 cells. Transfected TLR3 293 cells were selected for clones that survived
without and died with dsRNA in the media. Cells were subcloned three rounds to
generate the cell line used in our cell survival assays TLR3 293 561-TK. In these cells,
less than 20 from an original population of 10^5 cells survived dsRNA GCV selection.
TLR3 293 561-TK validation in dsRNA induced cell death assays
A variety of inhibitors as well as an activator of TLR3 signaling were used to
authenticate the resulting cell line (TLR3 293 561-TK). (Fig 4.2) Exogenous expression
of signaling proteins downstream of TLR3, such as the adaptor TRIF, is known to
activate IRF3 and induce ISG56 transcription independent of the inducer dsRNA. As expected, transient overexpression of wildtype TRIF in TLR 293 561-TK cells induced signaling and cell death even without dsRNA. Cells survive in the absence of the inducer dsRNA or when the dsRNA signal is blocked by an inhibitor. HCV NS34A protease
79
Figure 4.2: Authentication of TLR3 293 561-TK cells.
Authentication was performed by challenging with activators (dsRNA and wildtype TRIF
(TRIF WT)) and inhibitors (dominant negative TLR3 (TLR3DTIR) expressed by plasmid
or lentivirus (LV), siRNA to IRF3, and Hepatitis C virus NS3/4A (HCV NS3/4A)).
Dominant negative form of MyD88 (MyD88DN) and empty vector (-) were used as negative controls. Cells were transiently transfected or infected, media changed, and treated with or without dsRNA (100ug/mL) in the presence of GCV (5ug/mL).
Percentage of surviving cells as determined by eye is shown as the mean of two independent experiments except when *, where only one experiment was conducted.
Error bars, when applied, represent standard error.
80
81
inhibits TLR3 signaling by cleaving TRIF.180 Transient expression of NS34A inhibited
dsRNA TLR3 signaling induced cell death. Similarly, an siRNA construct targeting IRF3 as well as a dominant negative mutant of TLR3 lacking the TIR domain inhibited TLR3 mediated dsRNA signaling induced cell death. This inhibition was effective when both plasmid transfection and lentiviral infection were used for expression. Finally, cell
survival results from a specific inhibition of TLR3 signaling and not general signaling
pathways. Overexpression of a dominant negative mutant of MyD88, which is able to
inhibit TLR4, 7 and 9 but not TLR3,45 did not inhibit signaling induced cell death. These
results indicate that cell death was an accurate reflection of signaling in TLR3 293 561-
TK cells and that a variety of methods of delivery and inhibition could be measured in
this cell line.
Discussion
Unique assay characteristics
Several characteristics of the 293 cells and ISG56 promoter allowed for the
development of the cell death assay. These characteristics involve the specificity of the
response to dsRNA for both the 293 cells and the ISG56 promoter.
For the TLR3 293 cells, constitutive TLR3 signaling is not lethal in contrast to
RIG-I signaling which leads to cell death. This property allowed for cell death to specifically reflect TK mediated cell death driven by IRF3. In addition, 293 cells do not respond well to IFN. Therefore, dsRNA TLR3 signaling is not amplified and transcription at the ISG56 promoter is driven by IRF3 and not ISGF3. Finally, 293 cells are highly transfectable and infectable with plasmid or lentiviral expression vectors.
Exogenous expression either transiently or in stable lines does not induce ISG56 in 293
82
as compared to other cell types. 293 cells, then, provide a system in which exogenous
proteins can be expressed efficiently to assay for inhibition of signaling.
For the ISG56 promoter, transcription is regulated by ISREs.119, 120, 124 Several
characteristics help distinguish the expression pattern of ISG56 from other ISGs. First,
ISG56 is induced by dsRNA both directly by IRF3 and also indirectly through IFN and
ISGF3. This is in contrast to other promoters such as the 6-16, 9-27 and Mx which are
upregulated not by IRF3 but only by ISGF3. 199, 244 Second, ISG56 mRNA expression is
tightly regulated. It is not expressed basally.123 However, it is one of the most highly
induced ISGs in cells stimulated with dsRNA or IFN.24, 25 Third, the ISG56 promoter has two ISREs which are essential and sufficient for induction.119, 120, 124 This is in contrast to the complex promoter of the type I IFNs where NFkB and AP-1 binding sites are required for induction. Put together, these characteristics embody a tightly regulated promoter that when driving a strong reporter gene creates a simple assay for signaling.
Advantages of TK negative selection
The use of TK in negative selection has been used to identify regulators of NFkB activation by interleukin 1 and other signals.246-248 The TK GCV selection system has
several advantages over other selection genes such as the E. coli 6 thioguanine (gpt)
Hypoxanthine Aminopterin Thymidine (HAT) system and also other reporter genes such
as luciferase or green fluorescent protein (GFP). First, only the Herpesvirus and not
cellular TK sufficiently phosphorylates GCV to induce lethality. This is in contrast to the
gpt system where the cellular hypoxanthine-guanine phosphoryibosyltransferase
(HPGRT) functions sufficiently in the salvage pathway so that the E. coli gpt is
unnecessary. Thus for the gpt selection system to work, cells must be deficient of
83
endogenous HPGRT. This is unnecessary for the TK system. Second, unlike the gpt
system the stringency of selection can be manipulated by GCV concentration. In this
context, it appears that the selection conditions used in our assays were very stringent
because the best host inhibitor, the dominant negative mutant of TLR3, could only
protect 25% of cells from lethality in the presence of dsRNA as compared to cells
without any treatment at all. (Fig 4.2) Using this stringency, our assay would identify
only the most robust inhibitors of signaling. Third, TK selection system is much easier to
use than other reporter genes such as luciferase or GFP in that the cell death phenotype is
much simpler to see and does not require fluorescence measurements. Furthermore, TK
or GCV alone are not toxic to the cells. In contrast, GFP for example can be toxic when
expressed at high levels and or probably for an extended period of time. In fact,
preliminary attempts at constructing a stable cell line using GFP as a reporter gene under
the ISG56 promoter resulted in gradual loss of inducible fluorescence over time, giving
credence to this possibility. (Data not shown.)
High throughput assays and screens
The use of a cell death phenotype in our assays here also builds the basis for
future experiments with this cell line in more high through put assays where, again, the
phenotype is much easier to measure as compared to fluorescence or β galactosidase
assays. It is possible to extend our assays into a 96 well format or microarray slide with
plasmids pre-fixed onto the plate for transfection and expression. An overlay of the cells,
addition of selection pressure with GCV and dsRNA and finally observation of the cell
survival or death would all be performed by a robot.249 In this way, many proteins and molecules can be assayed for inhibition of signaling at once.
84
Transforming the assay into a screen would be another approach to extending our
system towards a more high through put format. Forward genetic screens have identified
many proteins important in a variety of processes.247 Advancements in transposon
mediated mutagenesis248 and siRNA screens250 have greatly improved the process of
identification of the mutation lending to selection when compared to the
complementation assays necessary for chemical mutagenesis in the past. In this instance,
the addition of a positive selection marker such as the antibiotic resistance gene zeocin
(R)187 under the control of the ISG56 promoter would allow for easy distinction between
actual inhibitors of signaling and inhibitors of TK GCV mediated cell death which would
at the moment be indistinguishable in the initial assay using TK and GCV selection
presented here.
IRF3 and ISRE as a convergence point for multiple signaling pathways
As mentioned previously, IRF3 is activated by a variety of different signals which
include cytoplasmic dsDNA through DAI and other unknown receptors,19, 110, 239, 243, 251
LPS through TLR4,240 hCMV glycoprotein B through TLR2236 and Listeria
monocytogenes through an unidentified mechanism.243 Furthermore, IRF3 is involved in
processes such as the induction of inflammation from ischemia252 and the responses to
DNA damaging agents such as doxorubicin, UV253and DMXAA.254 The use of this cell
line in screens with these inducers would allow for further elucidation of these pathways.
In addition to IRF3, ISREs represent a point of convergence for all IRFs, both
positive and negative.112 Like IRF3, other IRF family members are involved in immune
regulation and also a number of processes such as regulation of cell cycle, apoptosis and
85
tumor suppression. The use of the ISG56 promoter and the TK reporter gene would be
helpful in the further examination of these pathways as well.
Finally, for known inhibitors or activators of ISRE activation (whether they be
host or pathogen associated) this cell line can be used to further screen for chemical
inhibitors for potential pharmaceutical development. The influenza virus NS1, for
example, is an inhibitor of IRF3 activation. Subsequent screening for inhibitors of NS1 mediated IRF3 inhibition resulted in the identification of several potentially therapeutic
chemicals able to reduce influenza A replication.255 Ideally, viral proteins identified here
in 293 TLR3 561-TK cells would be stably expressed if survival were the selection
criteria as in TK and GCV. Further chemical screening of these stable lines would then
provide a foray into the development of possible treatments as in the case of influenza
NS1.
86
CHAPTER 5
SELECT PARAMYXOVIRAL V PROTEINS INHIBIT IRF3 ACTIVATION BY
ACTING AS ALTERNATIVE SUBSTRATES FOR IKKe/TBK1
Summary
V accessory proteins from Paramyxoviruses are important in viral evasion of the innate
immune response. Here, using a cell survival assay that identifies both inhibitors and
activators of IFN Regulatory Factor 3 (IRF3) mediated gene induction, we identified
select Paramyxoviral V proteins that inhibited double-stranded (ds) RNA-mediated
signaling; these are encoded by Mumps virus (MuV), human Parainfluenza virus 2
(hPIV2) and Parainfluenza virus 5 (PIV5), all members of the genus Rubulavirus. We
showed that interaction between V and the IRF3/7 kinases, TANK-binding kinase 1
(TBK1)/ Inhibitor of κB kinase ε (IKKe), was essential for this inhibition. Indeed, V
proteins were phosphorylated directly by TBK1/IKKe, and this, intriguingly, resulted in
lowering of the cellular level of V. Thus, it appears that V mimics IRF3 in both its
phosphorylation by TBK1/IKKe and subsequent degradation. Finally, a PIV5 mutant
encoding a V protein which could not inhibit IKKe was much more susceptible to the
antiviral effects of dsRNA than the wildtype virus. Because many innate immune
response signaling pathways, including those initiated by TLR3, TLR4, RIG-I, MDA5
and DAI-I, use TBK1/IKKe as the terminal kinases to activate IRFs, Rubulaviral V
proteins have the potential to inhibit all of them.
87
Background
The family Paramyxoviridae
The family Paramyxoviridae of the order Mononegavirales, the nonsegmented negative single stranded RNA viruses, is defined by its F protein, which fuses virus and cell membranes at neutral pH.256 In relation to the Orthomyxoviridae family, the
Paramyxoviridae family shares the characteristic of envelope glycoproteins and with the
Rhabdoviridae family the characteristic of a nonsegmented genome and its gene
expression. Two subfamilies represent the divisions of the Paramyxoviridae family and
are classified based on morphology, biological activities of the proteins, genome
organization and sequence relationships: Paramyxovirinae (with genera Respirovirus,
Rubulavirus, Avulavirus, Morbillivirus and Henipavirus) and Pneumovirinae (with
genera Pneumovirus and Metapneumovirus) (Fig 5.1). The Paramyxovirinae subfamily is
distinguished by the size and shape of the nucleocapsids (diameter 18nm, length 1um,
pitch 5.5nm) which is wider than Pneumovirinae members and its left handed helical
symmetry. All within the subfamily can cross react antigenically. However, the genera
differ in neuraminidase activity of the hemagglutinin neuraminidase (HN/H/G) open
reading frame (ORF) product (Respiroviruses and Rubulaviruses are positive and
Morbiliviruses and Henipaviruses are negative) and the coding potential of the P ORF
(Fig 5.2, discussed in more detail below).
The Paramyxovirinae virions possess an envelope derived from the plasma membrane of host cells (Fig 5.3). This contains two surface glycoproteins, the HN/H/G for cell attachment and F involved in fusion. In addition, some members of the genera
Rubulavirus and Pneumovirus express a third integral membrane protein SH thought to
88
Figure 5.1: International Committee on Taxonomy of Viruses classification of negative sense ssRNA viruses.
The only order established within this group is that of the non-segmented
Mononegavirales. Additionally, the segmented families Orthomyxoviridae, Bunyaviridae
(not shown) and Arenaviridae (not shown) without an official order are also negative
sense ssRNA viruses.
89
90
Figure 5.2: RNA editing during transcription of the P ORF in different genera of the
Paramyxovirinae subfamily generates a variety of accessory proteins.
The antigenome ORFs are at the top while the correlate edited transcripts are below. The white box represents common amino termini. The RNA editing site is represented by the vertical line where the indicated number of guanines (G) are inserted to generate the different accessory proteins. The shaded boxes represent unique carboxy termini fused to the common amino termini as a result of this editing. This includes the cysteine rich domain of V proteins. Transcript abundance corresponds to number of nucleotide additions with the unedited version produced the most. For Respiro, Morbilli, Avula and
Henipaviruses, the unedited transcript is the P protein. For Rubulaviruses, the unedited transcript is the V protein. Adapted from “Paramyxoviridae: The Viruses and Their
Replication.”256
91
92
Figure 5.3: A Paramyxovirinae virion not drawn to scale.
Two glycoproteins, fusion (F) and hmaggltinin neuraminidase (HN), lie within the envelope or lipid bilayer derived from the host cell. While HN mediates attachment, F
promotes fusion with the host membrane to deliver the nucleocapsid (N) bound to the (-)
ssRNA nonsegmented genome and also syncytia formation. The small integral membrane
protein, SH, is found only in specific Rubulaviruses such as PIV5 and MuV and is
thought to be able to inhibit apoptosis of the host cell. Associated with the nucleocapsid
are the large (L) and phospho (P) proteins which together has RNA dependent RNA
transcriptase activity. For Rubulaviruses but not other members of the Paramyxovirinae
subfmily, the accessory protein V is also found as an internal component of the virion.
Adapted from “Paramyxoviridae: The Viruses and Their Replication.”256
93
94
block virus induced apoptosis. Inside the membrane lies the viral matrix (M) which
determines the architecture. Finally, the core is a 15-19 kb RNA genome encapsidated by the nucleocapsid (N) proteins. N is also associated here with phospho- (P) and large (L) proteins. Together, P and L are responsible for RNA dependent RNA transcriptase activity. For the genus Rubulavirus, the accessory protein V is also found within the virion while for other genera it is found only in virus-infected cells.
As described above, virus adsorption and entry begins with binding of HN to sialic acid containing cell surface receptors and then fusion with the F protein at neutral pH. While the F protein remains in the host membrane and facilitates fusion with other infected cells to form syncytia, the M layer disassembles and the nucleocapsid enters the cytoplasm. It is here in the cytoplasm that all aspects of the replication cycle are thought to take place as viral mRNA synthesis is insensitive to DNA-intercalating drugs such as actinomycin D and replication can occur in enucleated cells.
The RNA wound around the helical nucleocapsid serves as the template for all
RNA synthesis by the viral RNA polymerase (vRNAP), formed by the complex of L which possesses all enzymatic activities and P, an essential cofactor. Synthesis early in infection by this complex yields (+) leader RNAs for the generation of viral genomes and mRNAs for protein expression. Because of imperfect re-initiation in the “stop-start” mechanism for transcription, mRNA for the 6-10 ORFs is produced in a gradient, decreasing in abundance from the 3’ end of the genome which contains the promoter region. This results in N followed by P or V being expressed the most and L the least. In addition, RNA editing or pseudotemplated addition of guanine (G) occurs in the coding region of the P ORF, yielding a faithful unedited mRNA transcript as well as several
95
more edited versions that code for the accessory proteins V, W/I and D (Fig 2). These, too, are expressed in a gradient, decreasing in abundance with increased editing. Once sufficient levels of viral proteins are achieved, the (-) genome is replicated to produce a full length encapsidated complementary copy, the antigenome. This intermediate is used as a template to generate the genome itself. The nucleocapsid is then assembled in the cytoplasm and the envelope at the membrane. The M protein positioned beneath the envelope contact both the RNP core as well as the enveloped glycoproteins, facilitating the incorporation of the genome into progeny virions during budding.
Genera within Paramyxovirinae
Viruses representing different genera within Paramyxovirinae are important pathogens. For humans these include members of the genus Morbillivirus Measles virus
(MeV) and Rubulavirus Mumps virus (MuV) and human Parainfluenza virus 2 (hPIV2).
Indeed, Measles virus represents not only one of the most infectious but also, along with
Mumps and Parainfluenza viruses, some of the most prevalent. For animals, examples include Hendra virus (HeV), a Henipavirus which infects flying foxes, Sendai virus
(SeV), a Respirovirus which infects rodents, Parainfluenza virus 5 (PIV5) (also known as
Simian virus 5 or SV5), a Rubulavirus which infects dogs and Newcastle disease virus
(NDV), a highly infectious Avulavirus with 100% morbidity and 90% mortality in chickens.256
Parainfluenza viruses are represented by members of three different genera within the subfamily Paramyovirinae: Respirovirus (hPIV1 and its mouse equivalent Sendai virus and human and bovine PIV3), Rubulavirus (hPIV2 and its canine and simian equivalents PIV5 and SV41 as well as hPIV4) and Avulavirus (NDV) (Fig 5.1).257 While
96
NDV as described above has important economic impacts in the poultry industry, hPIV1-
3 account for at least one third of the five million lower respiratory infections each year
in the US in children younger than five and has an estimated cost of over $186 million.
Seen annually or biennially, long term resistance is incomplete and re-infections are
frequent. Spread by droplets, the virus replicates in the epithelial cells that line the
respiratory tract and causes rhinitis, pharyngitis, laryngitis, trachiobronchitis, bronchiolitis and pneumonia, with more severe disease in children or the immunocompromised. In addition to CD8 cytotoxic responses against HN, P and N, neutralizing antibodies have been identified against HN and F with a specific serotype
response in the primary infection that can cross react in subsequent infections with
booster responses.
Although Mumps virus is also a Rubulavirus like PIV2 and 4, the associated
symptoms and disease are not as limited to the respiratory tract. Hippocrates in the 5th century BC first described the classically associated swelling near the ears (the parotid or submaxillary glands) and, variably, of one or both testes (orchitis). Also transmitted by droplets, MuV is most commonly seen in children 5-9 years old although the incidence has dropped almost 99% since the advent of the attenuated Jeryl Ly vaccine strain.
Routine MuV vaccination, however, does not prevent outbreaks and two recent epidemics in the UK and US in 2005 and 2006 are such examples.258 The natural host of
MuV is the human and initially, like PIV, infects the upper respiratory mucosa. However,
MuV can then spread to the lymph nodes and dessiminate via T cells to the parotid glands
as described above, CNS, gonads, kidneys, pancreas, heart and joints. Although one third
of infections are thought to occur without symptoms, MuV is the most common cause of
97
unilateral acquired sensorineural hearing loss in children and, before the vaccine, encephalitis in the US.
Paramyxoviruses and innate immunity
Approximately 30% of children infected with PIV produce IFN in the respiratory tract.259 Experiments indicated that this IFN is initially inhibitory but quickly overcome
by the virus.260 Indeed, V from Sendai and PIV5 were isolated as the protein with this
function, stimulating the degradation of STAT1 which is involved in IFNa/b signaling.261
Finally, V mutant or knockout virus showed that V not only inhibits IFN signaling but also IFN induction.183, 262
V proteins in innate immunity
V proteins were first defined as accessory proteins because the Respirovirus
Sendai lacking V could replicate just as effectively as wildtype in various cell lines,
indicating that V is almost completely dispensable for replication in vitro and in vivo.263
However, repeated failed attempts at making a complete V knockout in members of the
Rubulavirus genus gave reason to believe that V and also probably the other proteins encoded by the same ORF are more essential than initially believed.183
The P ORF of Paramyxoviruses encodes an assortment of accessory proteins. Via
RNA editing as described previously, the P ORF encodes for V, W, D and I (depending
on the species) (Fig 5.2). A second mechanism to express P ORF proteins is the use of
alternative translation initiation codons, which yields C and Y proteins for Respiro-,
Henipa- and Morbilliviruses.256 A third mechanism involves ribosomal frame shifting
during translation which yields an R protein for MeV. Finally, use of a presumed internal
ribosome entry site yields the X protein for Sendai.263
98
While the functions of R and X have not been fully elucidated, V, W, D, I and
even P in some instances have been shown to affect the host cell cycle and downregulate
viral genome replication in addition to inhibit induction and or signaling of IFN. Through
unclear mechanisms, PIV5 V and Sendai C and Y proteins inhibit cellular apoptosis.264,
265 V proteins of Sendai, MeV, hPIV2 and PIV5 also inhibit viral RNA transcription.266-
269 This is thought to occur by way of competition between the V or C accessory protein
with the binding of P to L and N proteins for RNA polymerase activity. V and P have a
common amino terminus which is able to bind to RNA, L protein and P protein. In
addition, the unique carboxy terminus of V can bind to N.270 Finally, V can also bind to
kinases such as Akt, which is involved in phosphorylating and activating P.265
Finally, a variety of accessory proteins, V, W and C have been shown to be able to inhibit IFN signaling.263, 271 For Respiroviruses, Sendai V and C inhibit IRF3
activation. C also binds to and prevents STAT1 phosphorylation and Y inhibits IFN
signaling through an as yet to be determined mechanism.263, 272 For Henipaviruses, HeV
V sequesters STAT1 and 2 in the cytoplasm.188 Nipah V, W and C are able to do the same thing273 and W also inhibits TLR3 mediated IRF3 activation.274 For Morbilliviruses,
MeV C275 and V can inhibit IFN signaling. V binds to IFNAR2 and also STAT1, 2, 3 and
IRF9/p48 to prevent nuclear localization.276, 277 For Avulaviruses, NDV V can inhibit IFN
signaling.273 For Rubulaviruses, V proteins from PIV5, MuV and hPIV2 act as E3
ubiquitin ligases to degrade STAT1, STAT1 and 3 and STAT2 respectively.189, 260, 278-280
In addition, V proteins bind to mda-5 (and not RIG-I) and also to dsRNA itself to inhibit intracellular dsRNA signaling and PKR activation.281-283 These functions highlight the
99
importance of immune signaling in the viral life cycle and indicate that V may inhibit
dsRNA activation of IRF3 via TLR3.
Introduction
Innate immunity is stimulated by viruses in part via RNA. dsRNA specifically is present in several forms: viral genomes, ssRNA virus replication intermediates, DNA
virus symmetric transcription products, defective viral particles and debris from lysed
cells.105 While extracellular dsRNA is sensed by Toll-like receptor 3 (TLR3),
intracellular dsRNA is detected in part by the RNA helicases retinoic acid inducible gene
1 (RIG-I) and melanoma differentiation associated gene 5 (mda-5). These receptors
signal through Toll-IL1R (TIR) domain containing adaptor inducing IFNβ (TRIF) and
IFNβ promoter stimulator 1 (IPS1) respectively to activate the kinases TANK-binding kinase 1 (TBK1) and Inhibitor of κB kinase ε (IKKe). They, in turn, phosphorylate IFN
Regulatory Factor 3 (IRF3), promoting its nuclear translocation and subsequent IFN stimulated regulatory element (ISRE) mediated transcription of IFN stimulated genes
(ISG), such as ISG56, as well as IFN and other cytokines. IFN then, through JAK/STAT activation of IRF9, modulates miRNAs in addition to upregulating itself and more ISGs to heighten the antiviral state and also to initiate the adaptive immune response by
promoting dendritic cell maturation, memory T cell proliferation, and B cell
differentiation.5
To control this immune response, pathogens and hosts have developed methods of
downregulation and evasion at a variety of different points.136, 161 At the level of sensing
infection, NS1 from Influenza virus binds to and sequesters dsRNA and also interacts
with RIG-I.161, 178 At the level of signal transduction, the NS3/4A protease from Hepatitis
100
C virus cleaves TRIF and IPSI 180, 181, 284 and vaccinia virus A46R, which contains a TIR
domain, inhibits TRIF dependent activation of IRF3 156, 157. At the level of IRF mediated
transcription, P proteins from Ebola285 and Borna Disease 165 viruses and HPV E16 168 interfere with IRF3 activation. For a more global effect, M protein from vesicular stomatitis virus inhibits host machinery to prevent gene transcription.161 Finally, at the level of IFN and cytokines binding to their receptors, human cytomegalovirus encodes a decoy for the chemokine RANTES to prevent further signaling.159
The family Paramyxoviridae encompasses two subfamilies- Paramyxovirinae and
Pneumovirinae. Viruses representing different genera within the Paramyxoviral
subfamily are important pathogens for humans such as Measles virus (MeV), a
Morbillivirus, and Mumps virus (MuV) and human Parainfluenza virus 2 (hPIV2), both
Rubulaviruses. For animals, examples include Hendra virus (HeV), a Henipavirus which
infects flying foxes, Sendai virus (SeV), a Respirovirus which infects rodents, and
Parainfluenza virus 5 (PIV5), a Rubulavirus which infects dogs.256 Paramyxoviral V
accessory proteins have been shown to be important in viral evasion of innate immunity.
At the level of IFN signaling, V proteins act as E3 ubiquitin ligases that target STATs for
degradation or sequester them, preventing their nuclear translocation and subsequent
transcriptional functions.271 At the level of sensing infection, V proteins bind to mda-5
and also to dsRNA itself to inhibit intracellular dsRNA signaling and PKR activation,
respectively.281-283 These functions highlight the importance of immune signaling in the
viral life cycle. Indeed, VDC PIV5, a mutant PIV5 virus lacking the unique C terminus of
V, is no longer able to inhibit IRF3 activation and causes a greater cytopathic effect in a
101
variety of different cells.183, 286 Taken together, these lines of evidence indicate that V
may inhibit dsRNA activation of IRF3 via TLR3.
Here we show that V proteins from hPIV2 (VH), MuV (VM) and PIV5 (VP), but
not HeV and MeV, inhibit TLR3 signaling. Analysis of the underlying mechanism
revealed that the inhibitory V proteins interacted with the signaling kinases TBK1/IKKe
and served as their substrates, thus preventing IRF3 phosphorylation. Our results
indicated that the above interaction led to modifications of both partners and their
degradation. Therefore, the V proteins from Rubulaviruses and the IRF3 activating
kinases TBK1/IKKe are connected by a negative feedback loop.
Results
Some, but not all, Paramyxoviral V proteins inhibit TLR3 signaling
We used a cell survival assay to examine the potentials of V proteins from
different Paramyxoviral subfamilies to inhibit TLR3 signaling. This assay uses a TLR3-
expressing 293 cell line (TLR3 293) in which a selection gene has been introduced; this
gene is driven by the promoter of ISG56124 and encodes the herpesvirus thymidine kinase
(TK) protein.187 Any signaling that activates transcription factors containing IRF proteins,
such as TLR3 signaling or type I IFN signaling, induces TK production and causes cell
death in the presence of ganciclovir (GCV). If in a cell an inhibitor of signaling blocks
TK production, that cell survives and proliferates even in the presence of GCV. Using this assay, we determined that V proteins from the Rubulaviruses hPIV2 (VH), MuV (VM)
and PIV5 (VP) inhibited TLR3 signaling (Fig 5.4A, top panel, lanes 4 - 6). In contrast, V
proteins from HeV and MeV were ineffective (Fig 5.4A, top panel, lanes 2 and 3),
although the different V proteins were expressed at similar levels in the transfected cells
102
Figure 5.4: Select Paramyxoviral V proteins inhibit TLR3-mediated gene induction. A,
Paramyxoviral V proteins were transiently expressed in TLR3 293 561-TK cells, which were then treated with dsRNA and ganciclovir (GCV) for 4 days (top panel) or GCV alone (bottom panel). Estimated cell survival is shown. Lane 1: no V protein, lane 2:
Hendra V protein (HeV), lane 3: Measles V protein (MeV), lane 4: hPIV2 V protein/ VH
(H), lane 5: MuV V protein/ VM (M), lane 6: PIV5 V protein/VP (P) B, HA
immunoblotting of extracts from the above cells was performed to determine the levels of
HA-tagged V proteins. Lanes are as described above. Approximate molecular weights are
marked. C, P56 mRNA levels were measured by Q RT-PCR in untreated (lanes 1-4) or
dsRNA-treated (lanes 5-8) HT1080 cells stably expressing V proteins. D, P56 protein
levels were measured by immunoblotting in untreated (lanes 1-4) or dsRNA treated
(lanes 5-8) cells described in C. Immunoblotting for actin and Flag-V served as controls.
103
104
(Fig 5.4B). Expression of the V proteins themselves, without any dsRNA-treatment did
not affect cell survival at all (Fig 5.4A, bottom panel). The above observations suggested that Rubulaviral V proteins could block induction of cellular dsRNA-inducible genes as well, a conclusion that was confirmed by measuring the levels of ISG56 mRNA, using a quantitative RTPCR assay in HT1080 cells permanently expressing different V proteins.
The mRNA was induced strongly upon dsRNA-treatment of cells (Fig 5.4C, lane 5) and
the induction was almost completely blocked by VH, VM and VP (Fig 5.4C, lanes 6-8).
Similar inhibitions were observed for CIG5/viperin287, 288 mRNA another ISG whose
transcription is mediated by IRF3 (Data not shown).231 Finally, inhibition of the induction
of p56 protein was also observed (Fig 5.4D).
V proteins block IRF3 activation
Once we established that the three V proteins blocked TLR3 signaling, we
investigated the underlying mechanism. Exogenous expression of signaling proteins
downstream of TLR3 is known to activate IRF3 and induce synthesis of p56, as shown in
Fig 5.5A. Expression of TRIF, IKKe and TBK1 induced p56 (lane 1) and the induction was blocked by all three V proteins. In contrast, p56 induction from expression of a constitutively active IRF3 5D mutant was not blocked (Fig 5.5A, lanes 2-4). These results indicated that the V proteins blocked a step in signaling downstream of TLR3, TRIF and the IRF3 kinases and upstream of events following activation of IRF3. Inactive IRF3 shuttles in and out of the nucleus while activated IRF3 translocates to the nucleus and induces transcription of target genes, such as ISG56.289 IRF3 was not localized to the
nucleus in cells expressing VM (Fig 5.5B, lane 4), VH and VP (data not shown). We then
asked whether the observed block of IRF3 activation was due to a block in its
105
Figure 5.5: V proteins from hPIV2, MuV and PIV5 inhibit IRF3 activation.
A, Pools of TLR3 293 561-TK cells expressing V proteins were transfected with
expression vectors for different components of the TLR3 pathway; the specific signaling
protein expressed is shown on the left. Induced p56 levels were determined by
immunoblotting. Actin served as a loading control. Lane 1: no V; lane 2: VH (H); lane 3:
VM (M); lane 4: VP (P). B, Nuclear extracts from control cells (lanes 1, 2) or cells stably
expressing VM (lanes 3, 4), that were untreated (lanes 1, 3) or treated with dsRNA (lanes
2, 4), were immunoblotted for IRF3, with histone as loading control. C, IRF3
phosphorylation at serine 396 (P396) was detected by immunoblotting cell extracts with a phospho-IRF3-specific antiserum, with total IRF3 as a control. Whole cell extracts were prepared from control cells (lanes 1, 3) or cells stably expressing VM (lanes 2, 4), that
were untreated (lanes 1, 2) or treated with dsRNA (lanes 3, 4). D, Control and cells stably
expressing V proteins indicated were treated with dsRNA (rows 5-8). IRF3 dimerization
was assayed by native gel electrophoresis followed by immunoblotting. E, Control and
VM-expressing HT1080 cells were treated with dsRNA (rows 2, 4) and Leptomycin B
(LMB) (rows 3, 4). Subcellular location of IRF3 was determined by immunofluorescence. F, Cell extracts from samples, as described in E, rows 3 and 4, were used for immunoblotting to detect p56, Flag-V and actin.
106
107
phosphorylation, which is known to activate it. Indeed, phosphorylation of Ser396, a
hallmark of IRF3 activation, was inhibited in the presence of VM. (Fig 5.5C, lane 4)
Unexpectedly, IRF3 was still able to dimerize in these cells as shown by native gel electrophoresis. (Fig 5.5D) These results suggested that V prevents IRF3 mediated
transcription of genes in one of three ways: 1.) V prevents shuttling of IRF3 into the
nucleus independent of its phosphorylation or dimerization state, 2.) V deactivates
dimerized IRF3 before it can perform its function as a transcription factor, possibly be
enhancing its nuclear export and or its dephosphorylation, 3.) V allows partial activation
of IRF3 for dimerization but not full activation in its phosphorylation and nuclear
localization.
To address these hypotheses, we first asked if IRF3 could enter the nucleus at all
in the presence of V protein. By using leptomycin B (LMB), a drug that blocks nuclear
229 export of proteins, we examined whether VM blocked nuclear import of IRF3 or
enhanced its export. As expected, in untreated cells, IRF3 was in the cytoplasm of both control and V expressing cells (Fig 5.5E, row 1). DsRNA treatment alone caused nuclear accumulation of IRF3 only in the absence of V protein (Fig 5.5E, row 2). In both untreated and dsRNA-treated cells, LMB caused similar nuclear accumulation of IRF3 in the absence and the presence of V protein (Fig 5.5E, rows 3 and 4). These results suggested that either VM inhibited nuclear import of only activated IRF3 or VM enhanced export of activated IRF3 through exportin 1, which is blocked by LMB.229 To distinguish
between these two possibilities, we examined if the IRF3 sequestered within the nucleus
by LMB was transcriptionally active in the presence of dsRNA. Nuclear IRF3 in LMB-
108
treated cells could not induce p56 in control cells unless they were dsRNA-treated as well
(Fig 5.5F, lanes 1 and 3). In dsRNA-treated V-expressing cells, although LMB-treatment caused nuclear translocation of IRF3, p56 was not induced (Fig 5.5F, lanes 2 and 4).
These results indicated that V inhibits import of activated IRF3 to the nucleus and did not
enhance its nuclear export. Furthermore, these results indicated that 1.) IRF3 dimerization
was independent of Ser396 phosphorylation, 2.) IRF3 dimerization was not sufficient for
nuclear translocation and 3.) nuclear localization, although necessary, was insufficient for
IRF3 to induce genes; additional activation was required by post-translational
modifications of the protein. Taken together, these results indicated that VM did not enhance IRF3 deactivation but instead allowed only partial and not full phosphorylation and activation of IRF3 by dsRNA.
Interaction of V with IKKe is essential for inhibiting TLR3 signaling
To further analyze the mechanism of V-mediated blocking of TLR3 signaling, we examined possible interactions of the viral proteins with known components of the signaling pathways. VH, VM and VP did not interact with TLR3, TRIF, IRF3, Src, PI3K
and IKK α, β and as revealed by co-immunoprecipitation assays, although the same assay demonstrated their known interactions with STAT2 (Fig 5.6A and B). In contrast, all three viral proteins interacted with both IKKe (Fig 5.6C) and TBK1 (data not shown).
IKKe co-immunoprecipitated with VH (lane 3), VM (lane 5) and VP (lane 7) (Fig 5.6C, top
panel). Note that the mobility of co-immunoprecipitated IKKe was slower than that of the
protein in cell extracts. This was also the case for co-immunoprecipitated STAT2 (Fig
5.6C, middle panel, lanes 3, 5 and 7). Since the V proteins have E3 ubiquitin ligase
activity,271 the observed mobility differences could be due to V-mediated
109
Figure 5.6: Interaction of V with IKKe is essential for inhibition of TLR3 signaling.
A, TRIF and V proteins were transiently expressed in TLR3 293 cells. V proteins were
immunoprecipitated (IP) and co-immunoprecipitated proteins were immunoblotted to detect TRIF (indicated by arrow), HA-tagged V, stably expressed Flag-tagged TLR3 and endogenous STAT2, PI3K p85, c-Src (indicated by arrow) and IRF3 (indicated by arrow); cell extracts (W) served as controls for expression levels. B, It is the same as (A) except that immunoblotting to detect endogenous IKK , and was used in place of other
TLR3 signaling mediators. C, IKKe and V proteins were transiently expressed in TLR3
293 cells. V proteins were immunoprecipitated (IP) and co-immunoprecipitated proteins were immunoblotted to detect Myc-tagged IKKe, STAT2, and HA-tagged V; whole cell extracts (W) served as controls for expression levels. Lanes 1, 2: no V; lanes 3, 4: VH (H);
lanes 5, 6: VM (M); lanes 7, 8: VP (P). D, IKKe, transiently expressed with tagged
ubiquitin and VM or empty vector control, was immunoprecipitated. Samples were
immunoblotted to detect HA-tagged ubiquitin (top panel: IKKeUb). Membranes were
stripped and reprobed to detect Myc-tagged IKKe (bottom panel: IKKe) at the same
molecular weight. E, Flag-tagged WT and VM mutants M-AAA
(W174A/W178A/W188A), E95D, E95R, C189A, C214A and C217A were
immunoprecipitated (IP) (top two panels) and co-immunoprecipitated proteins were
immunoblotted to detect Myc-tagged IKKe and Flag-tagged V. The bottom two panels
show corresponding analyses of whole cell extracts (W). F, Flag-tagged WT and VM
C189A mutant were immunoprecipitated (IP) (lanes 2, 4) as in (D). Samples were then
electrophoresed along side whole cell extracts (W) to show shifted compared to unshifted
mobilities of Myc-tagged IKKe. G, P56 protein levels were measured by immunoblotting
110
in untreated (lanes 1, 3, 5, 7) or dsRNA treated (lanes 2, 4, 6, 8) HT1080 cells stably expressing WT or VM mutants C189A or M-AAA. Immunoblotting for actin and Flag-V
served as controls.
111
112
polyubiquitination of the co-immunoprecipitated proteins. Indeed, exogenously
introduced ubiquitin was covalently bound to IKKe purified by immunoprecipitation and
this ubiquitination was VM dependent (Fig 5.6D). The functional significance of the V-
IKKe interaction was determined by testing mutant VM. Among six mutant proteins
tested (Fig 5.6E), only the VM mutant W174A/W178A/W188A (VM-AAA) failed to bind to
IKKe (lane 3, left top panel). This mutant protein could not block TLR3 signaling as
revealed by the cell survival assay (data not shown) and in HT1080 cells permanently
expressing mutant VM-AAA (Fig 5.6G, lane 8). In contrast, WT VM and mutant VC189A
could inhibit signaling (Fig 5.6G, lanes 4 and 6). Both bound to IKKe (Fig 5.6E, lanes 7
and 8) and, as shown when electrophoresed longer, both shifted the mobility of co- immunoprecipitated IKKe, indicating its ubiquitination (Fig 5.6F lanes 2 and 4 compared
to lanes 1 and 3). These results strongly indicated that the V proteins blocked TLR3 signaling by blocking the action of the signaling kinases.
V proteins are substrates for IKKe and TBK1
Because the V proteins bound to the kinases, in the next experiments we tested whether they were phosphorylated as a consequence. Indeed, both VM (Fig 5.7A) and VP
(Fig 5.7B) were phosphorylated by IKKe in vivo. As expected, the phosphorylated V
proteins migrated more slowly (Fig 5.7A and B, lane 2) and upon phosphatase treatment,
they co-migrated with the unphosphorylated proteins (Fig 5.7A and B, lane 3). Similar
results were seen for TBK1 (data not shown). Expression of enzymatically inactive IKKe
did not cause phosphorylation of the V proteins (Fig 5.7A and B, lane 4) suggesting that
IKKe directly phosphorylated V. To test this suggestion, purified VM and IKKe were
added to an in vitro protein kinase reaction in the presence of γ32PATP, and
113
Figure 5.7: MuV and PIV5 V proteins are phosphorylated by IKKe and TBK1.
A, MuV V protein (VM) was expressed by itself (lane 1) or co-expressed with kinase
active (lanes 2-3) or inactive (lanes 4-5) IKKe, immunoprecipitated, and treated with
phosphatase (lanes 3, 5). HA immunoblotting was used to detect V. B, It is the same as
(A) except that PIV5 V protein (VP) was used in place of VM. C, In vitro γ32PATP
kinase assays were conducted with GST IKKe and V protein or IRF3. Radiolabeled
proteins were visualized by autoradiography (top two panels) and immunoblotted (bottom
two panels) to determine total amounts of IRF3 or V in the loaded samples. Lane 1: VM
+ IKKe; lane 2: IRF3 + IKKe; lane 3: IKKe ; lane 4: VM. D, In vitro γ32PATP kinase
assays were performed using purified Myc-TBK1. The top two panels are autoradiographs and bottom two panels are immunoblots. Lane 1: TBK1; lane 2: VM; lane 3: TBK1 + VM; lane 4: IRF3; lane 5: TBK1 + IRF3.
114
115
radiolabeling of VM was measured. As a positive control, purified IRF3, a known
substrate of IKKe, was used. Both IRF3 and VM were phosphorylated by IKKe (Fig 5.7C,
lanes 1, 2). Control reactions showed that the addition of both IKKe and VM were needed to observe the radiolabeled protein (Fig 5.7C, lanes 3, 4). Quantification of the incorporated phosphates demonstrated that, on a molar basis, VM was a slightly better
substrate than IRF3 (114 vs 100). Similar in vitro reactions demonstrated the ability of
purified TBK1 to phosphorylate VM (130 vs 100) (Fig 5.7D, lane 3). These results
established the V proteins as authentic substrates for IKKe/TBK1.
As a consequence of phosphorylation, V appeared to be destined for faster
degradation (Fig 5.8A). Co-expression of V with kinase active (lane 2), but not kinase
inactive (lane 3) IKKe caused major diminution of the cellular level of V, as compared to
control (lane 1). Furthermore, this was not caused just by over-expression of IKKe,
because dsRNA-mediated activation of the endogenous kinase caused a dramatic
lowering of the level of V as well (Fig 5.8B, lane 2) and this diminution could be
inhibited by the proteasome inhibitor MG132 (Fig 5.8B, lane 3). Finally, interaction
between V and IKKe was required for degradation; VM-AAA, a mutant that did not co-
immunoprecipitate with IKKe (Fig 5.6E, lane 3), was not degraded (Fig 5.8C).
V protein determines the efficacy of virus replication in TLR3-activated cells
To evaluate the biological significance of our observations, we chose to use the
PIV5 mutant virus VDC, which encodes a C-terminally truncated V protein.183 VDC was
not phosphorylated in vivo by IKKe as seen in WT PIV5 V protein (Fig 5.9A).
Furthermore, we determined that the truncated V protein could not block signaling induced by exogenous expression of IKKe (data not shown). Results showed that WT
116
Figure 5.8: Phosphorylated MuV V protein is degraded.
A, VM was expressed alone (lane 1), or along with wildtype kinase active (WT) (lane 2)
or kinase inactive (KI) (lane 3) IKKe. Levels of HA-tagged V and Myc-tagged IKKe
were determined by immunoblotting of cell extracts. B, TLR3 293 cells transiently
expressing VM were treated with DMSO as a control (lane 1), dsRNA and DMSO (lane
2) or dsRNA and MG132 (lane 3). Flag immunoblotting was used to detect Flag-tagged
V, with actin as control. C, VM WT (lanes 1 and 2) and mutant M-AAA (lanes 3 and 4)
were expressed with wildtype kinase active (WT) (lanes 1 and 3) or kinase inactive (KI)
(lanes 2 and 4) IKKe. Levels of Flag-tagged V and Myc-tagged IKKe were determined
by immunoblotting of cell extracts.
117
118
Figure 5.9: Effects of dsRNA signaling on WT and mutant PIV5 replication. A, PIV5
WT (lane 1) or mutant C-terminally truncated (VDC) (lane 2) V proteins were co- expressed with IKKe and immunoprecipitated. V5 immunoblotting was used to detect V and Myc to detect IKKe. B, Virus yields 6 dpi were measured for WT or VDC PIV5 replication in 293 cells with and without TLR3 and pre- or mock treated with dsRNA.
Bars represent standard error derived from 2 independent experiments.
119
120
virus replicated better compared to the mutant virus in both TLR3-expressing and non-
expressing cells (Fig 5.9B). Since the mda-5/RIG-I pathway is still intact in these cells,
this difference may be due to the lack of ability of the truncated V protein to inhibit that
signaling pathway.281 In cells not expressing TLR3, treatment with dsRNA did not have
any effect on the replication of either virus. In contrast, in TLR3-expressing cells,
dsRNA-treatment strongly inhibited the replication of the mutant virus (5 logs), whereas
the effect on WT virus was minor. These results demonstrated that inhibition of TLR3
signaling by V protein was relevant for effective virus replication.
Discussion
The virus-host equilibrium
The results presented above revealed several new features of the equilibrium
established in an infected cell between the virus and the host (Fig 5.10). Induction of viral stress-inducible genes, including IFNs, is blocked by Rubulaviral V proteins by inhibiting
IRF3 phosphorylation, which is required for its activation because the V proteins can themselves be phosphorylated by TBK1/IKKe. A similar observation has been made by
Unterstab et al for Borna disease virus P protein.165 It is not yet clear exactly how V
proteins can inhibit IRF3 phosphorylation by TBK1/IKKe. Because they themselves are
substrates of the same kinases, one possibility is that V simply competes out IRF3 as a
substrate. In the in vitro kinase assays, quantitation of phosphorylation showed that IRF3 and VM were equally phosphorylated by IKKe, when present in equimolar amounts either singly or in combination (data not shown), indicating that the two proteins are equally competent substrates of the kinases. Hence, to compete out IRF3, V has to be present at a high molar excess, a possibility not unlikely because V proteins are produced in large
121
Figure 5.10: A negative feed-back loop between Rubulaviral V proteins and IKKe/TBK1.
While Rubulaviral V proteins block TBK1/IKKe kinase activity by acting as an alternative substrate to IRF3/7, the resulting phosphorylated V protein (VPO4) is degraded. V proteins also mediate ubiquitination of TBK1/IKKe (Ub), leading to their degradation.
122
123
quantities in Paramyxovirus-infected cells.256 Alternatively, V proteins can have stronger
affinity for TBK1/IKKe, thus not allowing access to IRF3. The fact that V and IKKe
were co-immunoprecipitated efficiently indicated that the two proteins could interact
strongly, thus providing credence to the second scenario. Although our study was
designed to determine whether different Paramyxoviral V proteins could inhibit TLR3
signaling, our observations are equally relevant for other signaling pathways that
converge on TBK1/IKKe. Thus, we can expect Rubulaviral V proteins to block signaling
initiated by the cytoplasmic receptors RIG-I, mda-5, and DAI or the membrane receptor
TLR4, that are known to be triggered by RNA, DNA or LPS.5 Indeed, we observed that
RIG-I/mda-5 signaling to IRF3 triggered by transfected dsRNA was inhibited by VH, VM and VP (data not shown).
Wildtype and VDC mutant PIV5 replication assays showed that in addition to
dsRNA inhibiting the VDC mutant to a greater extent than wildtype, the expression of
TLR3 alone increased VDC viral titres two log fold. This occurred only in the absence of
dsRNA. (Fig 5.9) The role of P protein as an essential polymerase subunit may be one
explanation for this observation. P protein phosphorylation by host factors such as Akt is
important for RNA synthesis and, consequently, viral replication.265 In wildtype PIV5, V
protein is able to regulate RNA synthesis by acting as either an alternative or competitive
substrate against P for Akt kinase activity and interaction with the other RNA polymerase
subunits N, L and even the viral RNA itself.267, 270 For the VDC mutant PIV5, the
expression of TLR3 can increase the activity of Akt and other host kinases. Without the
inhibitory function of V, P polymerase activity then increases and viral replication is
enhanced. However, in the presence of dsRNA, these titres are not observed because host
124
expression of antiviral genes is able to inhibit the virus replication. Taken together, these results show the complex factors in host virus interactions that affect the outcome of viral replication.
An additional consequence of the action of V proteins as alternative substrates of
IKKe could be inhibition of phosphorylation of STAT1. Because STAT1 phosphorylation by IKKe is essential for its ability to induce a subset of ISGs,116 in
addition to causing STAT1 degradation,271 Rubulaviral V proteins may block actions of
IFN using this mechanism.
The interaction with V caused ubiquitination of IKKe as indicated by the
observed slower mobility of co-immunoprecipitated IKKe and its V dependent
ubiquitination when co-transfected with tagged ubiquitin. A similar change in the
mobility of IKKe was observed when C189A mutant of VM was used; this was
unexpected because the mutant cannot bind DDB1 (data not shown), a component of the
ubiquitin ligase complex.271 This indicates the existence of alternative pathways for the ubiquitin ligase activity of VM. Here, polyubiquitination of IKKe leads to its proteasome-
mediated degradation. Thus, V not only blocks IRF3 phosphorylation but destroys the
activating kinase as well.
What was clear from our results was that the host could fight back by degrading V
proteins. Just as phosphorylation of IRF3 leads to its degradation, phosphorylation of V
protein was accompanied by its destruction (Fig 5.8). This is consistent with the
290 degradation of VM observed over the course of a viral infection. Because V was needed
for the optimum replication of viruses, even in the absence of dsRNA-signaling (Fig 5.9),
its destruction should be a potent antiviral mechanism in that context as well.
125
Phosphorylation and degradation of V provide an opportunity for temporal regulation of
IRF3 activation; when the level of V is high, IRF3 phosphorylation is blocked by
competition. As more and more V is phosphorylated and degraded, the relative
concentration of IRF3 will increase, leading to its phosphorylation, activation and
degradation. Thus, two negative feedback loops, one between V and IRF3 and the other
between IKKe/TBK1 and V, regulate the equilibrium between the virus and the cell.
It is known that IKKe interacts with STAT1 and STAT1 can interact with V.116,
189 However the interaction between IKKe and V reported here is not mediated by
291 STAT1, because VM could block TLR3 signaling in U3B cells which lack functional
STAT1 (Fig 5.6G). In addition, VM C terminal mutants in the conserved cysteine residues
(C189A, C214A, C217A) within the zinc finger binding domain292, 293 and N terminal
mutations V47P and L97P corresponding to mutations forming a canine parainfluenza
virus minus (CPI-) PIV5 strain262 involved in binding and degrading STAT1 were used to
look at the IKKe and V interaction. Co immunoprecipitation assays indicated that all of
these mutants could bind to IKKe (Fig 5.6E lanes 7-10 and data not shown). Furthermore,
STAT2 is not involved in the interaction between IKKe and V. Two N terminal mutants
E95D and R have reduced binding to STAT2 but still interact with IKKe (Fig 5.6E lanes
4 and 5).294, 295 The tryptophan residues of V that were required for IKKe binding are
located in the C-terminal region of the protein.293 Because this region is not shared
between viral V and P proteins, whose mRNAs are produced by alternative transcription
of the same open reading frame (ORF), P proteins are not expected to bind to IKKe. This
prediction is consistent with previous findings that V, but not P, blocks dsRNA-mediated
IRF3 activation.183
126
While the conserved triple tryptophan residues are important for the interaction
between V and IKKe, other yet to be identified motifs may also be involved. One such
area is the TBK1 binding region of SINTBAD, NAP1, and TANK which is essential for
all these adaptors to bind to TBK1 and IKKe.56 Alignment with V protein however did
not show areas with significant homology. V proteins also do not have the ubiquitin like
domain (ULD) which TBK1 and IKKe use to bind to IRF3.53 In addition, V proteins are not homologous to any of the signaling mediators such as these scaffolding proteins for the IRF3 kinases, TRAF6 or PKCα. Finally, V is not homologous to any of the host negative regulators such as SIKE, SHP and RFP. Therefore, it does not appear that V inhibits TLR3 signaling by mimicking a host protein.
The complex process of IRF3 activation
The experiments with LMB (Fig 5.5E and F) illuminated subtle, but important, aspects concerning IRF3 activation. According to the current paradigm of the activation process, IRF3 is phosphorylated at multiple serine residues and this leads to its nuclear translocation, a process that is necessary for its action as a transcription factor289 We
found that forcing nuclear localization of IRF3 by LMB treatment of cells was not
sufficient for its ability to induce genes. Therefore, there are consequences to IRF3 phosphorylation in addition to nuclear translocation that are necessary for activation.
Furthermore, while IRF3 appeared to be less activated by Ser396 phosphorylation and nuclear localization, dimerization still occurred. This was unexpected because IRF3 dimerization has been shown to be an important step for activation and in fact correlated with its association with the CBP/p300 coactivators and subsequent transcription.296 For
dimerization to occur, it has been thought that phosphorylation at sites such as Ser396
127
and Ser386 are the rate limiting steps.58, 289 Indeed, a S396A mutant, incapable of being
phosphorylated at that residue, is unable to drive ISRE mediated transcription192, 296 and cannot associate with CBP/p300.297 However, native gel electrophoresis shows that this same mutant is still able to dimerize and be phosphorylated at ser386.298 This dissociation
between phosphorylation and dimerization seen also with the V protein indicates that
while ser386 may be important for dimerization it is insufficient for nuclear localization.
Consistent with this hypothesis, IRF3, even when artificially retained in the nucleus by
LMB, was not transcriptionally active in the presence of V and dsRNA. (Fig 5.5F) One
example of such a situation may already exist with the IKKe interacting protein Ret
finger protein (RFP).144 Like V, RFP is a substrate for IKKe and TBK1 and allows for
IRF3 dimerization but not nuclear localization. Thus, for V and RFP, we would predict
that residue ser386 but not ser396 is phosphorylated on IRF3 and that only when both
sites are phosphorylated can full activation occur.
The role of V mediated innate immune inhibition in Rubulaviruses
It is interesting to note that among the V proteins from Paramyxoviral subfamilies
tested, all inhibit IFN signaling, but only members of the genus Rubulavirus were able to
inhibit dsRNA-TLR3 mediated IRF3 activation.256 These observations seem to correlate
with what seems to be a more important role for V in the life cycle of Rubulaviruses
compared to others. Rubulaviral V proteins, in contrast to P in other Paramyxoviruses,
represent the default ORF transcribed at the P/V locus, resulting in higher levels of basal
expression. Indeed, some Respiroviruses such as hPIV1 and 3 may not even make V
protein. Instead, C seems to play a more important role.272 Correspondingly, virions from
Rubulaviruses contain a much higher level of V compared to others and are conveniently
128
present during the initial stages of infection and signaling.256 This importance of
Rubulaviral V proteins may be in part compensation for the lack of W, C and Y accessory proteins which Respiro-, Morbilli- and Henipaviruses encode to counteract host defense.161, 256, 274
129
CHAPTER 6
HERPESVIRAL PROTEINS INHIBIT IRF3 ACTIVATION
Summary
Members of the family Herpesviridae encompass a variety of dsDNA viruses of
which the most relevant human pathogens include human cytomegalovirus (HCMV),
Epstein Barr virus (EBV) and Human herpesviruses 8 (also known as Kaposi’s Sarcoma
herpesvirus) (HHV8/KSHV). One of the defining characteristics of this virus family is that all members go through latent life cycles with life long viral persistence. In this capacity, the success of viral persistence is largely due to the many mechanisms which
Herpesviruses employ to regulate the host response. dsRNA signaling through TLR3 is one of many pathways shown to activate IRF3. IRF3 in turn mediates a variety of antiviral and apoptotic effects. For this reason, many viruses encode molecules that inhibit IRF3. More specifically, Herpesvirus infections do induce the transcriptional activity of IRF3. However, this activity is greatly increased when virus is inactivated by
UV or protein synthesis is blocked. Thus, Herpesviruses encode inhibitors of IRF3 activation. To identify these inhibitors, we developed a cell survival assay to systematically assay the known and predicted open reading frames from the
βherpesviruses mouse and human cytomegalovirus and the γ−herpesvirus murine
γ−herpesvirus 68. We found that none of the ORFs activated IRF3 on their own and 18 out of 135 ORFs potentially inhibited IRF3. Of these 18, four were followed to confirm the inhibition of signaling. Two of these four- MHV68 ORFs 35 and 58- were examined in more depth to determine the possible mechanism. Results from these experiments revealed the complex nature by which these viral molecules can inhibit signaling and the
130
disparate needs of the virus to replicate and persist in the host.
Background
The family Herpesviridae
The Herpesviridae family members are characterized by the architecture of the
virion.299 This consists of a core containing the linear dsDNA genome, an icosohedral
capsid surrounding the core, a tegument and finally the envelope.300, 301 (Fig 6.1) The
genome ranges from 124-241kb and contains terminal signals for packaging into the
capsids. Its coding capacity lies within unique long (UL) and short (US) sequences that
are separated by tandem reiterated sequences (IR) and are also flanked by the same sequences at both termini (TR). These reiterated sequences vary in copy number within
the same species and promote isomerization of the genome. The capsid is mainly
structural in purpose and consists of capsid and portal proteins. Around that is an
amorphous and sometimes asymmetric tegument that connects the capsid with the
envelope. This layer matures as the virion egresses through the endoplasmic reticulum
and Golgi and is where viral proteins including some glycoproteins are added to inhibit
host protein synthesis, cell defense and help stimulate viral gene expression. Finally, the
envelope is derived from patches of altered cellular membranes spiked with viral
glycoproteins. These glycoproteins are important in attachment and entry into the host
cell and also stimulate the major antibody responses during an infection.
Four significant biological properties characterize the Herpesviridae family.299
First, they encode a variety of proteins involved in nucleic acid metabolism such as thymidine kinase, DNA synthesis and protein processing. Second, synthesis of viral DNA and capsid assembly occurs in the nucleus and the virion matures as it egresses through
131
Figure 6.1: Herpesvirus virion structure.
A.) A three dimensional model of the cytomegalovirus virion301 and B.) a murine
γ−herpesvirus 68 virion as visualized by cryo-electron tomography300 show common structural characteristics of members of the Herpesviridae family. Both virions contain the linear dsDNA genome in their cores. This is surrounded by an icosohedral capsid
(depicted as nucleocapsid in A and colored yellow in B) which provides structure. The core is covered by an amorphous tegument layer which is developed as the virion egresses using the cellular endoplasmic reticulum and Golgi systems. The tegument layer itself can consist of layers as reflected in B by the green and blue which are acquired sequentially during virion maturation. In addition to host proteins, the tegument consists of glycoproteins such as glycoprotein B and H (gB and gH in A) which are involved in entry into a host cell and also immune evasion. Finally, the envelope (membrane in A and so labeled in B) is derived from patches of altered cellular membranes spiked with viral glycoproteins.
132
133
the cytoplasm to the plasma membrane. Third, the production of progeny eventual
involves cell lysis. Fourth and finally, all Herpesviruses go through latency, replicating
their genome in the form of covalently enclosed circles and expressing a subset of viral
genes. This differs however from chronic infection because no infectious progeny is
being produced.
ORF expression occurs in three phases: α, β and γ. The α or immediate early
genes are expressed with no prior viral protein synthesis. The β or early genes is totally independent of viral DNA synthesis but somewhat dependent on protein synthesis. The
γ1 or leaky late genes are augmented by the onset of viral DNA synthesis and the γ2 or true late genes are totally dependent on viral DNA synthesis.
The family Herpesviridiae is divided into three subfamilies based on biological properties, DNA sequence, predicted coding regions, genomic structural arrangement and immunological recognition of viral proteins. (Fig 6.2) Α herpesviruses have a variable host range, short reproductive cycle, spread rapidly in culture, efficiently destroy infected cells and establish latency in sensory ganglia. Β herpesviruses have a restricted host range, long reproductive cycle, spread slowly in culture, cause cytomegaly and establish latency in secretory glands, lymphoreticular cells and kidneys. Γ− herpesviruses have an even more limited host range, a long reproductive cycle in lymphoblastoid, epitheliod and fibroblastic cells and establish latency in mainly lymphoid tissues. Of the more than 130 members within the family, the main human herpesviruses are the αherpesviruses varicella zoster virus (VZV), herpes simplex 1 (HSV) and 2, the βherpesviruses human herpesvirus HHV6, 7 and human
134
Figure 6.2: International Committee on Taxonomy of Viruses classification of the order
Herpesvirales.
The order Herpesvirales comprises Herpesviruses that infect a variety of different species. The Families are determined based on sequence based comparisons which indicate common ancestry within each group. The Family Herpesviridae can be further subdivided into α, β and γ− Herpesviruses based on biological properties, DNA sequence, predicted coding regions, genomic structural arrangement and immunological recognition of viral proteins as discussed in the text. The most relevant human pathogens include human cytomegalovirus (hCMV), Epstein Barr virus (EBV), Kaposi’s Sarcoma herpesvirus (KSHV), Herpes simplex virus 1 (HSV1), vaicella zoster virus (VZV) and human herpesvirus 6 (HHV6).
135
136
cytomegalovirus (hCMV) and the γ−herpesviruses Epstein Barr virus (EBV) and
KSHV/HHV 8.
The β−herpesvirus Cytomegalovirus: Disease and Treatment
Cytomegalovirus (CMV) is ubiquitous with seroprevalence ranging from 30-70% in varying countries and the US at 59%.301 In the healthy, infection and latency are established without significant pathology. However in the immunocompromised, human
CMV (hCMV) can replicate in almost any tissue, causing disease. Experimental models for CMV include tissue culture adapted hCMV strains and also the mouse CMV
(mCMV) which shares significant amino acid homology in 78 of its predicted 170 ORFs with hCMV. While human and mouse strains are species specific, their replication characteristics and associated diseases are similar.301, 302 Transmission of is horizontal via shedding in the saliva, urine and other secretions or vertical via transplacental, intrapartum or breast milk routes. hCMV and mCMV initially infect mucosal epithelium.301 This is followed by dissemination and latency in myeloid lineage cells.
Persistence of the primary infection can last months to years and latent infection is life long. Disease usually occurs with reactivation from latency in immunocompromised situations such as when the recipient is in utero or when the immune system is suppressed. For neonates who have acquired the virus from their mother, periventricular calcification and other clinical CNS symptoms are the hallmarks of infection. For transplant and HIV positive patients, hCMV infection can be life threatening, causing pathology first in the transplanted organ and then spreading to many different systems.
Diagnosis for hCMV is usually made by testing for pp65 one of the most highly expressed glycoproteins in the virion which also is in part responsible for immune
137
evasion. The most common drugs for hCMV are nucleoside analogues such as
ganciclovir and cidofovir which are phosphorylated by the herpesvirus thymidine kinase
and subsequently incorporated into replicating DNA strands, inhibiting replication and
causing cell death.
Cytomegalovirus-Host interactions: Natural Killer cells
The most well studied host responses to CMV infection involve natural killer
(NK) cells, T cells and IFN. NK cells play an important early role in controlling CMV
infections.303 The inbred BALB/c strain of mice is more susceptible to mCMV infection
when compared to other strains because it expresses an inhibitory NK receptor which is
activated by mCMV and thus prevents NK cell mediated cytotoxicity.304 Similarly, there
are several reports of patients (the majority of which were offspring of consanguineous
parents) with NK cell deficiencies for various reasons experiencing severe hCMV as well
as other Herpesviral infections.305, 306
In BALB/c mice, the LY49I receptor on NK cells binds to the mCMV protein
m157, inhibiting NK mediated lysis of the infected cell.307 However, m157 also binds to
the activating LY49H receptor which is expressed preferentially over the inhibitory
LY49I in the majority of mouse strains including wild mice. Thus, it is thought that the evolutionary advantage afforded by the inhibitory function of m157 in the majority of mice outweighs its detrimental effects in the minority.308 In addition, certain host cell
proteins when presented by the infected cell can act as ligands for NK receptors that
trigger lysis of the infected cell. To inhibit the presentation of these ligands, mCMV
encodes for the proteins m152, m145 and m155 and hCMV the proteins UL16, UL141,
UL142 and microRNA miR-UL112.308-310
138
Cytomegaloviurs-Host interactions: T cells
In contrast to the effects of NK cells early in the infection, T cells play more
important roles in the termination of lytic infection and establishment of latency.
Adoptive transfer experiments in mouse and humans of CMV specific CD8 T cells into
immunodeficient bone marrow recipients restore viral immunity.311, 312 However, mice
lacking functional CD8 responses are still able to control virus replication with CD4 T
cells and macrophages.313 Furthermore, CD4 T cells seem to be essential for inhibiting
horizontal transmission by limiting viral replication specifically in the salivary glands.314
Thus, both arms to the T cell response are necessary for control of viral infection and its spread.
The cytolytic responses of CD8 T cells are mediated by recognition of the CMV immediate early gene products or glycoproteins from the virions. These viral ligands include pp89, or IE1, in the mouse or its functional homologue pp72 in humans and the glycoprotein pp65, the product of UL83 in hCMV mentioned earlier to be important in viral binding and entry into the host cell.311, 315, 316 These viral ligands are presented to T
cells by MHC Class I and II molecules.
To evade the cytolytic T cell response, CMV must prevent MHC Class I and II
presentation. However, this inhibition must not be complete because the absence of MHC
Class I on the host cell surface will also induce NK cell mediated killing. CMV
downregulates host MHC Class I and II presentation by retaining the complexes in the
ER-Golgi or redirecting the complexes for proteolytic degradation. The viral proteins responsible for these functions include mCMV m152 encoding gp40, mCMV m06
encoding gp48, hCMV US2, 3, 6 and 11.317 Simultaneously, CMV encodes for viral
139
homologues of MHC Class I, mCMV m144318 and hCMV UL18, to prevent NK cell mediated cytotoxicity. Finally, some host MHC Class I is allowed to interact with the T cell receptor by the virus. However, this is facilitated by mCMV m04 encoding for gp34
which manipulates the interaction to block the actual antigen presentation and prevent
NK cell mediated cytotoxicity.319 Thus, all these mechanisms cooperatively hide infected
host cells from cytotoxic immune surveillance.
Finally, both type I and II IFNs are important in the regulation of CMV. Antibody
depletion experiments show that IFN γ and TNF α help stimulate the effecter CD8 and
CD4 T cell responses described above and hence are essential for the control of viral
replication.320 In addition, IFN γ receptor null and, to an even larger extent, IFN α
receptor null mice are much more susceptible to mCMV lethality compared to wildtype controls.321, 322 Thus CMV induces IFN in infection and this is essential in establishing downstream host immune responses in part mediated by T and NK cells. As a result, just
as CMV encodes molecules to manipulate the functions of T and NK cells, the virus also
establishes a complex relationship with the host during the initial stages of infection.
Cytomegalovirus regulation of host innate immunity
Previous analysis of the CMV genome has identified many ORFs which are able
to inhibit host innate immunity. At the receptor level, hCMV IRS1 and TRS1 as well as
mCMV m142 and m143 bind to the PAMP dsRNA. As a result they inhibit PKR and
RNAse L, both of which are host IFN stimulated genes (IFN) which are activated by
RNA and inhibit host translation in response to viral infection.323-326 To prevent the TLR3
and TNFα activation of the transcription factor NFkB, mCMV M45 binds to RIP1 and inhibits its ubiquitination. This also inhibits TNFα activation of p38 which is involved in
140
AP1 transcription and induction of caspase dependent cell death.327 hCMV pp65 too participates through an unknown mechanism in inhibiting NFkB.328 In addition, it is able
to inhibit IRF3 activation.329 At the cytokine level, hCMV encodes homologues of host negative regulatory signals such as IL10 and also induces these negative signals such as
CCL22.330 Finally, once IFN is induced and signals through its own receptor, MHV68
M2 downregulates STAT1 and STAT2331 and hCMV immediate early gene 1 (IE1/p72)
coimmunoprecipitates with the components of the ISGF3 complex to block binding to
DNA and further amplification of the innate immune response.332 With the exception of
the latently expressed MHV68 M2 protein, all these immune evasion proteins are
expressed during the initial stages of viral infection. All are found within the virion except vIL10 which is secreted along with the virions. Thus, these Herpesvirus viral immune evasion proteins are present to inhibit the early induction of signaling. In
addition, the majority of these proteins are non essential (IRS1, TRS1, pp65, vIL10 and
M2) which indicates that as in many immune evasion molecules, existence is not
essential for viral replication. Therefore, the known Herpesvirus evasion molecules for the most part embody the characteristics of a viral inhibitor of signaling- expressed early
in the infection cycle and non-essential for actual viral replication.
Ironically, in some instances, immune signaling actually benefits the virus. Both
hCMV and mCMV encode homologues of proinflammatory cytokines and chemokines as
well as their receptors to recruit immune cells to aid in viral dissemination. These include
mCMV m131-129 and hCMV UL146 which are chemokine homologues333, 334 and mCMV M33, 78 and hCMV US28 which are chemokine receptor homologues.335, 336
141
Thus, Herpesviruses must delicately balance immune activation and inhibition for
successful survival.
Murine γ−herpesvirus 68 (MHV68), a model for γ−herpesvirus infections
Murine γ−herpesvirus 68 (MHV68) (also known as murid herpesvirus 4) is the first small animal model for γ−herpesvirus infections with similar pathogenesis to Epstein
Barr virus (EBV) and structure to Kaposi Sarcoma herpesvirus/Human herpesvirus 8
(KSHV/HHV8). Since γ−herpesviruses such as EBV and KSHV are difficult to work with even in tissue culture systems, MHV68 and other murine herpesviruses such as
MHV70 and Herpesvirus samurai serve as experimental models.
MHV68 is a natural pathogen of rodents such as mice, voles and shrews.337
Approximately 70% of bank voles in the UK harbor the virus in the respiratory tract.
While the natural route of infection is unknown, it is thought that MHV68 infection, like
EBV, begins with an oral exposure. Experimentally, intranasal inoculations are the most popular route of administration. This route leads to lytic replication in the lungs and epithelial cells of the oropharynx, thereby reproducing the mucosal characteristics of natural herpesvirus transmission. This also parallels some nasopharyngeal EBV infections which eventually lead to cancer.
The host response to viral infection begins with an initial wave of macrophages followed by CD8 T cells. By the time the inflammation resolves, the virus has already spread to the local lymph nodes. There it infects dendritic cells, macrophages and B cells.
Latency can be established as early as three days after infection mainly in B lymphocytes, like EBV, but also in dendritic cells, macrophages as well as lung epithelial cells.
Eventually, MHV68 infection leads to disease states which have been associated
142
with but not necessarily proven to be caused by EBV or KSHV. The original infection
can spread into the spleen leading to splenomegaly. This increases the number of
circulating lymphocytes, causing a mononucleosis-like syndrome reminiscent to that seen
in EBV infections. About 10% of mice with MHV68 develop lymphoproliferative disease
originating from B cells, another characteristic of EBV infections. Finally, like EBV and
KSHV, MHV68 infection can also aggravate autoimmune arthritis338 and cause lethal
vasculitis in immune compromised mice.339
The 118 kb genome from MHV68 strain g2.4 and the laboratory passaged derivative WUMS340 have been sequenced and extensively analyzed. The unique region
of the genome is flanked by terminal repeat regions (TR) of approximately 1.2 kb in
length. The 5’ left hand TR is significant because it is similar to the EBV small early
RNA (EBER) genes most abundantly expressed during viral latency. Downstream of this
region, a variety of microRNAs have been predicted to be encoded by the genome.341, 342
While their targets have not yet been identified, the functional importance of microRNAs is implicated by the altered latency and reactivation observed in a mutant lacking this area.343 Therefore many regions in addition to the protein coding areas are important in the MHV68 genome.
In addition, the majority of the 80 genes predicted to be encoded by MHV68 is collinear and homologous to other γ−herpesviruses. Approximately 90% of MHV68 genes have homologues in KSHV and 80% have homologues in EBV. In this capacity, key similarities between MHV68 and the human γ−herpesviruses lie in the genes involved in the infection process as well as the lytic and latent cycles. MHV68 ORF52 encoding gp150 is akin to the glycoprotein B encoded by other Herpesviruses that is
143
important in binding and entry into the cell.344 ORF50 is the MHV68 version of the
replication and transcriptional activator (RTA) which initiates the lytic cycle of gene
expression both during the initial infection and in reactivation from latency.345 MHV68
ORF21 encodes the viral thymidine kinase present in all other Herpesviruses that renders infected cells more sensitive to the antibiotic ganciclovir.346 Like EBV and KSHV,
MHV68 uses bcl-2 and a latent associated nuclear antigen (LANA) to enter into and maintain latency: ORF73 and M11.347-350 Finally, to reactivate from latency, ORF74 is
used as a G protein coupled receptor that binds to chemokines such as KC and
macrophage inflammatory protein 2 (MIP2) which are essential for this process.347
Innate and adaptive immune responses that control MHV68
The host immune response to MHV68 infection is not as well studied as that for
CMV. Ironically, while B cells are a major target for MHV68 latent infection, the cells
themselves and also their antibody producing capability do not appear to be important for
lytic viral replication because deficient mice clear replicating virus from the lungs with
normal kinetics.351 In addition, NK cells while activated do not appear to play a
significant role in pathogenesis or viral clearance in MHV68 infections.352 CD8 T cells,
however, are important in the recovery from primary infection and regulation of latently
infected cells. Depletion of CD8 T cells during the primary infection results in systemic
infection and higher viral titres while activation of CD8 T cells by priming reduces
them.353 CD4 T cells are also important in the host response against MHV68. Through
IFN γ CD4 T cells control the proliferation of latently infected B cells that contribute to splenomegaly. Removal of both CD4 and CD8 T cells is lethal.
144
Similarly, innate immune responses through IFN are important in protecting the
host from MHV68 pathogenesis. The lack of IFN signaling in IFNAR and IRF1 null mice
is lethal, with rapid dissemination of MHV68 into the lymph nodes, blood stream and
central nervous system.354 STAT1 null mice also readily succumb to infection355 and mice lacking protein inhibitor of activated stat (PIAS1) which inhibits STAT1 have decreased viral titres compared to wildtype.356 IFN γ is important not only in CD4 T cell function as described above but also for viral clearance from smooth muscle cells in the
arterial walls to prevent vasculitis.339 However, the phenotype of IFNγR null mice is not
as severe when compared to the IFNAR null mice. IFNγR null mice do not exhibit any
differences in MHV68 replication early on in the course of infection but do show
increased lymphoid tissue atrophy with more persistent virus later.355, 357 IL6, IL12p40
and C3 complement protein deficient mice however appear to experience a completely
normal course of infection.358 Thus, though the field is just beginning to be investigated, it is clear that while not all cytokines are essential type I and II IFNs are important in the host immune response to MHV68 infection.
The knowledge concerning MHV68 evasion of both innate and adaptive immune responses to date consists of a handful of proteins which perform a hodgepodge of functions previously ascribed to other Herpesvirus proteins. This includes the K3 protein which is a ubiquitin ligase, and like hCMV encoded US2 and US11, can independently degrade MHC class I heavy chains and also TAP.359 ORF73, like EBV EBNA-1, inhibits
T cell epitope presentation, allowing for viral amplification in latency.360 M2
downregulates both STAT1 and STAT2 during the latent replication cycle of MHV68.331
M3 is a chemokine binding protein that inhibits signaling through G protein coupled
145
receptors and subsequent chemotaxis of lymphocytes.361 ORF45, like its KSHV counterpart, is important for viral replication because it is phosphorylated and this presumably leads to the inhibition of IRF7 activation.167, 362 Finally, MHV68 ORF4, like its homologues in KSHV and EBV, regulates complement activation.363 These immune
evasion examples indicate that the MHV68 genome encodes a variety of proteins capable
of many different functions that have yet to be elucidated.
Introduction
Herpesviruses are prolific enveloped dsDNA viruses that cause a variety of
diseases.299 Of the over 130 members within the family, the most relevant human
pathogens include herpes simplex virus 1 (HSV-1), herpes simplex virus 2 (HSV-2),
human cytomegalovirus (HCMV), varicella zoster virus (VZV) and Epstein Barr virus
(EBV), and Human herpesviruses 6A, 6B, 7, and 8 (also known as Kaposi’s Sarcoma
herpesvirus) (HHV6A, HHV6B, HHV7, and HHV8/KSHV). Model systems used to
study these viruses include tissue culture passaged strains of hCMV, mouse CMV
(mCMV) and murine γ−herpesvirus 68 (MHV68) which resembles EBV in pathogenesis
and KSHV in structure. One of the defining characteristics of this virus family is that all
members go through both lytic and latent life cycles. Thus, viral persistence is life long
and only in an immunocompromised situation does disease occur. In this capacity, while
a virus infection activates the innate and adaptive immune systems, the success of viral
persistence is largely due to the many mechanisms which Herpesviruses employ to
regulate the host response.
The innate branch of the host immune response is induced by the recognition of
pathogen associated molecular patterns (PAMPs)5 such as dsRNA and DNA present
146
either in the genome or as replication intermediates during viral infection.26 These
PAMPs through pattern recognition receptors (PRRs) then activate transcription factors such as Interferon (IFN) Regulatory Factor 3 (IRF3) and 7, nuclear factor κ B (NFkB)
and Activate protein 1 (AP1) to mediate the expression of IFN stimulated genes (ISGs) as
well as IFN and cytokines. IFN then signals in autocrine and paracrine manners to induce
more ISGs and amplify the antiviral environment.
Herpesviruses present a variety of PAMPs which may stimulate this innate
immune response. RNA, for what is hypothesized to be structural, transcriptional or
replication purposes, is present within CMV and HSV virions in the forms of host and
viral mRNA364, 365 and also RNA-DNA hybrids linked to the essential lytic region, oriLyt.366 In the case of EBV, RNA is also present during the latent replication cycle in the form of EBV encoded small RNAs (EBERs) which can induce type I IFN.111 Finally,
DNA is present in the form of the genome. In the case of MHV68 and KSHV, the repetitive regions of their genomes have been shown to be able to induce IFN.239
In addition, Herpesviruses present other molecules which have been shown to induce signaling. These include hCMV glycoproteins B and H which are expressed in the virion and necessary for viral entry.7, 236
These PRRs that recognize these Herpesvirus PAMPs include members of the
Toll like receptor family such as TLR2, 3 and 9, RNA helicase family such as RIG-I and
also the recently identified cytoplasmic DNA receptor DAI. TLR2 is implicated in the
recognition of and IRF3 activation in response to hCMV glycoproteins.7, 236 367 However, additional receptors may be in play for glycoproteins in particular as a dominant negative
TLR2 cannot block induction.368 Using null mice, TLR3 and TLR9 have been shown to
147
be important for the induction of cytokines in response to and subsequent control of
mCMV infection.81 In addition, mice lacking MyD88, an adaptor for TLR9 but not TLR3
show a similar lethal phenotype upon mCMV infection.369 Mice lacking TRIF, the
adaptor for TLR3 but not TLR9, show increased susceptibility and produce less type I
IFN in response to infection.45 Finally, KSHV appears to not only upregulate expression
of but also induce IFNb and activate NFkB through TLR3.370As shown by
immunoprecipitation, RIG-I binds directly to EBV EBERs and this activates NFkB and
IRF3.111 Paradoxically, EBV EBERs are also able to bind to the ISG protein kinase R
(PKR) and actually inhibit its function.371 Thus these viral molecules have opposing
functions dependent on the host cell context. Finally, a DNA activated pathway signaling
through RIG-I is implicated in the production of IFN in response to HSV-1.110 It is possible that this pathway is initiated by the more recently described DNA receptor DAI which has also shown to be important for the IFN induction in response to HSV-1 infection.19
The induction of IFNs and ISGs in response to Herpesviral PAMPS is antiviral in
nature. Treatment of wildtype macrophages with dsRNA inhibits MHV68 replication.
This inhibition is not observed in the presence of IFN blocking antibody or when IFNα
receptor null cells are used.372, 373 IFNα, IRF1 and STAT1 null mice experience lethal
MHV68 infections with rapid system wide dissemination.354, 355 IFNγ receptor knockout
mice have increased pathology in the lymphoid tissues.357 For hCMV, infection activates
IRF37, 374, 375 and induces not only IFN but also ISGs such as ISG56, 54 and cig5/viperin.
This last ISG in particular has been shown to be able to inhibit specifically hCMV replication.288 Like MHV68, treatment of astrocytes and brain cells in culture with
148
dsRNA inhibits hCMV replication from infections at a low multiplicity of infection,
presumably when not enough viral evasion proteins are available to block signaling.374
IFNα and γ receptor knockout mice are also more susceptible to mCMV lethality compared to wildtype.321, 322 These observations indicate that the host immune system is
able to mount a response against the virus. That the virus persists in the face of this
response indicates that it is able to inhibit some of this response.
Indeed, there are many indications that Herpesviruses are able to inhibit the initial induction of IFN. While ISG56 and other IRF3 transcribed genes are upregulated upon
hCMV infection, these levels are accentuated when inhibitory viral proteins are not
expressed such as in the case of UV inactivated virus or in the presence of cycloheximide
which presumably blocks the translation of viral proteins.218 Furthermore, hCMV is able
to complement the vaccinia virus mutant lacking E3L which is responsible for inhibition
of IRF3, protein kinase R (PKR) and RNaseL activation. This complementation occurs
even in the presence of the antibiotic ganciclovir which inhibits viral DNA synthesis
early in the replication cycle. This indicates that even without significant viral protein
production, hCMV can inhibit innate immune signaling.376 Finally, our preliminary
studies indicate that MHV68 infection does not appear to activate IRF3 at all. Thus, many
virally encoded molecules present at the time of infection and also expressed later in the
replication cycle are responsible for this inhibition.
While not much is known about molecular determinants of MHV68 immune
evasion, previous analysis of the CMV genome has identified many ORFs which possess this function. These include hCMV IRS1 and TRS1 and mCMV m142 and m143 which
inhibit PKR and another dsRNA binding ISG RNAse L323-326 In addition, mCMV M45
149
binds to RIP1, inhibiting its ubiquitination and thus TLR3 activation of NFkB.327 Finally, hCMV pp65 has also been reported to inhibit NFkB and also IRF3 although the mechanisms have yet to be elucidated.328 329
Ironically, in some instances, immune signaling actually benefits the virus. Both
hCMV and mCMV encode homologues of proinflammatory cytokines and chemokines as
well as their receptors to recruit immune cells to aid in viral dissemination. 333, 334 335, 336
For MHV68, KSHV and EBV, NFkB signaling mediated by overexpression of the p65 subunit of the transcription factor has been shown to inhibit lytic viral replication but is apparently essential for entry into the latent phase.377 Thus, Herpesviruses must delicately
balance immune activation and inhibition for successful survival.
The viral molecules responsible for immune regulation are both protein products
as well as microRNAs encoded by the large genome of Herpesviruses ranging from 124-
241 kb. As mentioned previously, the capacity for MHV68 to regulate immune signaling
has not been extensively studied. For CMV, while many ORFs and even microRNAs
have an identified function, much of the genome has yet to be characterized.
Furthermore, many viral ORFs have multiple functions that are not necessarily related.
Thus, even if an ORF has an assigned function, they may still have the ability to inhibit
signaling. To undertake a more systematic approach to identify viral regulators of
signaling, we developed a cell death assay which specifically addressed IRF3 activation
by TLR3. We assessed a limited number of uncharacterized ORFs within the US22
mCMV gene family, approximately 50% of the hCMV and 50% of the MHV68 predicted
ORFs. Our results indicated that no ORFs appeared to activate IRF3 on their own.
However, of the 135 total ORFs assayed, 18 appeared to be able to inhibit IRF3
150
activation by TLR3. We confirmed this inhibition for 4 of these 18 ORFs experimentally
and continued further in addressing the mechanism of inhibition for MHV68 ORFs 35
and 58, both of which are not attributed with immune regulatory functions.
Our experiments indicated that both MHV68 ORF35 and 58 inhibit the activation
of IRF3 at the level of its activating kinases, TBK1 and IKKe. In addition, ORF35
appeared to be able to augment NFkB- while still inhibiting IRF3- mediated transcription.
In these capacities, MHV68 ORFs 35 and 58 reflect the complexity involved in the
regulation of IRF3 activation and MHV68 ORF35 exemplifies a viral protein that is
capable of manipulating the host immune system in multiple ways.
Results
CMV ORFs that inhibit signaling
To identify mCMV and hCMV inhibitors of TLR3-ISRE mediated signaling, we
used the cell survival assay described in Chapter 4. Briefly, a TLR3 expressing 293 cell
line (TLR3 293)186 in which the selection gene Herpesvirus thymidine kinase (TK)187 driven by the promoter of ISG56 was used to determine the presence (cell death) or absence (cell survival) of dsRNA signaling. 12 putative ORFs from the US22 gene family of mCMV and 78 putative ORFs from the hCMV genome were tested individually and also in groups according to published reports indicating interactions: 1.) m142 and m143324 and 2.) m139, m140 and m141.378 (Table 6.1) Plasmid expression vectors for
each ORF or groups of ORFs were individually transfected into cells. The cells were then
either treated with dsRNA and the antibiotic ganciclovir (GCV) or GCV alone. We
expected inhibitors of signaling to allow cells to survive even in the presence of dsRNA
151
Table 6.1: Mouse and human cytomegalovirus (mCMV and hCMV) open reading frames
(ORFs) assayed for inhibition of IRF3 activation.
Grey shaded cells indicate an inhibitor of dsRNA-TLR3 activation of IRF3 as determined
by the cell death assay described in the text. Bolded ORF names indicate that the mutant
virus grows poorly in tissue culture compared to widltype virus. Italicized and bolded
ORF names indicate that the mutant virus grows slightly poorly in tissue culture
compared to wildtype virus. Non bolded italicized ORF names indicate that the mutant
virus grows better in tissue culture compared to wildtype virus. ORFs were a gift of A.
Geballe. Sources of information include personal communication (A. Geballe), “The
Herpesviridae Family: A Brief Introduction,”299 “Virus-encoded microRNAs: novel
regulators of gene expression,”341 “Mouse cytomegalovirus microRNAs dominate the cellular small RNA profile during lytic infection and show features of posttranscriptional regulation,”379 “Functional map of human cytomegalovirus AD169 defined by global
mutational analysis,”380 “Identification of microRNAs of the herpesvirus family”342 and
notes from the 29th International Herpesvirus Workshop 2004.
152
ORFs Description mCMV m128 m139 in protein complex m139-141 important in induction of cytokines m140 in protein complex m139-141 important in induction of cytokines m141 in protein complex m139-141 important in induction of cytokines M23 encodes 2 putative microRNAs similar to hCMV microRNA miR-UL22A-1; binds dsRNA M24 binds dsRNA m25.1 m25.2 M36 antiapoptotic function in macrophages; inhibits gamma IFN signaling; hCMV UL36 has micro RNA in intron M43 involved in T helper response m142 IE transcription; no transactivating activity m143 IE transcription; no transactivating activity m139, m140 and m141 m142 and m143 hCMV TRL1 identical to IRL1 TRL2 identical to IRL2 TRL3 identical to IRL3; possible glycoprotein TRL5 identical to IRL5 TRL6 identical to IRL6 TRL7 identical to IRL7 TRL8 identical to IRL8 TRL9 identical to IRL9 TRL10 identical to IRL10 TRL13 identical to IRL13; possible glycoprotein TRL14 RL11 gene family; virion glycoprotein; N terminal identical to IRL14 UL3 UL6 RL11 gene family; possible glycoprotein UL8 RL11 gene family; possible glycoprotein UL11 RL11 gene family; possible membrane glycoprotein UL12 possible glycoprotein UL13 possible secreted protein UL15 putative membrane protein UL17 seven transmembrane glycoprotein UL18 homologue to MHC Class I UL21 CC chemokine binding protein (aka UL20A and UL21.5) UL24 US22 gene family; virion tegument protein UL25 UL25 gene family; virion and dense body tegument phosphoprotein UL27 confers Maribavir resistance UL29 US22 gene family; U8 in HHV6/7 UL30 positional homologue to HHV6 U9 UL41 Virion envelope protein (aka UL41.5) UL45 RR1 tegument protein; enzymatically inactive homolog of large subunit of ribonucleotide reductase UL46 (TRI1) component of capsid triplex (minor capsid binding protein) UL49 dense body capsid; possible virion matrix or tegument protein; US33 in HHV6 UL51 (TER3) DNA packaging terminase component UL59 uncharacterized virion protein UL62 UL64 UL65 pp67; possible matrix or tegument protein UL66 UL68 UL70 DNA helicase primase subunit involved in viral replication or metabolism; HHV6 U43; encodes for microRNA miR UL71 uncharacterized virion tegument protein UL74 envelope glylcoprotein gO; complexed w/ gH + gL (UL75+115) UL75 envelope glycoprotein; gH; complex w/ gL + gO (UL74+115) UL76 virion associate regulatory protein; HHV6/7 U49 UL77 portal capping protein involved in DNA packaging UL78 GPCR family; putative chemokine receptor, envelope glycoprotein UL79 uncharacterized virion protein and dense body tegument protein; HHV6/7 U52 UL84 UL82 family; dUTPase family; role in organizing DNA replication; shuttles between nucleus and cytoplasm; binds UL85 (TRI2) minor capsid component of capsid triplex UL94 tegument protein; binds ssDNA; HHV6/7 U68 UL96 tegument protein UL97 ppUL97; ganciclovir kinase; matrix or tegument protein; mimics cdc2/CDK1 UL98 deoxyribonuclease UL105 DNA helicase primase subuni; viral replication or metabolism UL106 UL107 UL108 UL109 UL110 UL111 vIL10 UL112 early pp family; viral DNA replication or metabolism; spliced to UL113 UL115 envelope glycoprotein gL; complex w/ gH + gO (UL74+75) UL118 possible glycoprotein UL121 UL120 family; possible glycoprotein UL122 pp80 IE2; spliced; transactivator UL125 UL132 virion glycoprotein UL133 IRS1 US22 gene family; 490 aa identical to TRS1; transactivator; matrix or tegument protein; blocks PKR response; US5 US6 US6 gene family; membrane glycoprotein; inhibits TAP mediated ER peptide transport US10 US6 gene family; membrane glycoprotein; delays trafficking of MHC class I US12 US12 gene family; putative multiple transmembrane protein US14 US12 gene family; putative multiple transmembrane protein US15 US12 gene family; putative multiple transmembrane protein US19 US12 gene family; putative multiple transmembrane protein US21 US12 gene family; putative multiple transmembrane protein US31 US1 gene family US33 US35 153
and activators to cause cells to die even without dsRNA. An empty vector was used as a
negative control and a plasmid expressing the V protein of Parainfluenza virus 5 was
used as a positive control for inhibition of dsRNA signaling. The degree of inhibition was
determined by cell survival which was estimated based on confluency after 4 days.
Survival varied from 10% to 90% in cells expressing the viral ORFs and scored as a
positive in terms of inhibition compared to 0% in the negative control. From the mCMV
ORFs tested, 1 individual and both combinations inhibited signaling. From the hCMV
ORFs, 5 inhibited signaling. Expression of the viral proteins themselves did not affect
cell survival.
MHV68 ORFs that inhibit signaling
Using the assay described above, we also assayed 45 putative ORFs from the
MHV68 genome individually and also a group of two (ORF27 and 58) according to
published reports indicating interactions for their ability to inhibit dsRNA-TLR3
signaling. (Table 6.2) From the MHV68 ORFs tested, 6 individual and 1 combination
inhibited signaling. Expression of the viral proteins themselves did not affect cell survival
except the protein encoded by ORF21 which caused cell death even in the absence of
dsRNA. This protein was later identified via literature search to be the MHV68
homologue of TK.346
Confirmation of MHV68 ORF35 and 58 inhibition of dsRNA signaling
Several of the more potent inhibitors of dsRNA signaling as determined by cell confluency were further analyzed to confirm their ability to inhibit signaling: mCMV
M36, MHV68 ORFs 35, 37 and 58. This was achieved by creating stably expressing lines
in HT1080 derived cells (2fTGH)381 and measuring P56 induction after treatment with
154
Table 6.2: Murine γ−herpesvirus 68 (MHV68) open reading frames (ORFs) assayed for inhibition of IRF3 activation.
Grey shaded cells indicate an inhibitor of dsRNA-TLR3 activation of IRF3 as determined by the cell death assay described in the text. Bolded ORF names indicate that the mutant virus grows poorly in tissue culture compared to widltype virus. Italicized and bolded
ORF names indicate that the mutant virus grows slightly poorly in tissue culture compared to wildtype virus. Non bolded italicized ORF names indicate that the mutant virus grows better in tissue culture compared to wildtype virus. Epstein Barr virus (EBV)
ORF names are homologues of MHV68 ORFs. HVS: Herpesvirus Samurai, KSHV:
Kaposi's Sarcoma herpesvirus. ORFs were a gift of J. Jung. Sources of information include “Complete sequence and genomic analysis of murine γ−herpesvirus 68.”340
155
MHV68 ORFs Description 9 DNA polymerase; EBV BALF5 (interacts with BBLF2/3, BMRF1, BSLF1, BBLF4) putative homologue to BXRF1 in EBV (possible interaction with BILF1); induces cell 20 cycle arrest G2 inhibiting Cdc2-cyclinB 21 thymidine kinase 23 EBV BTRF1 (interacts with BZLF2 and host protein phosphatase 1) 24 EBV BcRF1 capsid protein; EBV BDLF1 (interacts with BNLF2b and host MAP kinase 7, cathepsin c, 26 coiled coiled domain containing 14 )
encodes gp48, a type 2 transmembrane glycoprotein; putative homologue to BDLF2 in EBV (homologous to cyclin B1) (interacts with EBNA2 and host proteosome subunits), 27 interacts with ORF45 involved in immune evasion via inhibit IRF7 phosphorylation 30 Possible KSHV + HVS but not EBV homologues 31 EBV BDLF4 32 EBV BGLF1 33 EBV BGLF2 (interacts with BSLF1) 34 EBV BGLF3 35 putative homologue to BGLF3.5 in EBV 36 kinase; EBV BGLF4 (interacts with BGLF1) putative homologue to BGLF5 in EBV, an alkaline exonuclease; putative homologue to 37 SOX of KSHV, which degrades host RNA 39 Glycoprotein M; EBV BBRF3 42 EBV BBRF2 (interacts with host protein kinase c) 43 EBV BBRF1 putative homologue to BBLF4 in EBV, a helicase primase; conserved essential gene in 44 alpha, beta, and gamma herpesviruses phosphoprotein; possibly blocking IRF7 phosphorylation like its KSHV homologue; EBV 45 BKRF4 46 putative homologue to BKRF3 in EBV, a uracil DNA glycosylase 48 EBV BKRF2 49 EBV BRRF1 (interacts with BSRF1) 52 glycoprotein B; EBV BRLF2 54 EBV BLLF3; dUTPase 55 EBV BSRF1 (interacts with BBRF1) 56 EBV BSLF1 (interacts with BGLF2); DNA replication protein 58 form protein complex in ER, ORF58 is putative homologue to BMRF2 in EBV 59 EBV BMRF1 (interacts with EBNA3B); DNA replication protein 60 EBV BaRF1 (interacts with itself); Ribonucleotide reductase, small 67 EBV BFRF1 (interacts with BFLF2); tegument protein 68 EBV BFLF1; glycoprotein 69 EBV BFLF2 (interacts with BFLF1) 73 Like EBV EBNA-1 inhibits T cell epitope presentation 29A EBV BGRF1; packaging protein 29B KSHV and HVS but no EBV homologue K3 BHV4 IE1 homolog; ubiquitin ligase; inhibits MHC Class I presentation M3 chemokine binding protein that inhibits signaling through GPCRs M9 UL1 UL22 27 and 58
156
dsRNA added to the media to activate the TLR3 signaling pathway. P56 is also induced
by the RIG-I and IFNb pathways. We also assayed for the inhibition of these two pathways by transfecting dsRNA into cells and adding IFNb into the media respectively.
P56 was strongly induced upon dsRNA addition to the media, dsRNA transfection and
IFNb treatment (Lane 1 Fig 6.3 A and B and Lanes 1 and 2 Fig 6.3C). All viral ORFs
showed varying degrees of inhibition of TLR3 and RIG-I signaling (Data not shown and
Lane 2 Fig 6.3B, Lane 4 Fig 6.3C). Only MHV68 ORF37 was also able to inhibit P56
induced by IFN, indicating global repression (Fig 6.3A Lanes 2 and 3). We further
confirmed the inhibition of dsRNA signaling by measuring mRNA levels of ISG56 and
MHV68 ORF58 via quantitative PCR. Two independently isolated clones for ORF58
were tested. Consistent with the protein analysis, dsRNA induced ISG56 mRNA and p56
protein levels were decreased in a dose dependent manner correlating to increasing levels
of ORF58 mRNA (Data not shown and Fig 6.3D). These results indicated that while
MHV68 ORFs 35 and 58 can block IRF3 activation by dsRNA, they cannot block ISGF3
activation by IFNb. MHV68 ORFs 35 and 58 were chosen for further analysis because
they were less well characterized in the literature.
MHV68 ORF35 and 58 activation of P38 and AKT
The AP1 transcription factor complex of ATF2 and c-Jun is activated in the TLR3
pathway via a phosphorylation cascade of mitogen activated protein kinases (MAPK) Jun
kinases (JNK), p38 and extracellular signal regulated kinase (ERK).63 To assay the effects of ORF35 and ORF58 on the activation of this pathway we measured phosphorylation of P38 by phosphospecific antibody. In cells stably expressing ORF35 or
ORF58 (Fig 6.4B and C), p38 was phosphorylated to the same extent as control cells
157
Figure 6.3: MHV68 ORFs 35, 37 and 58 inhibit p56 induction.
A. 2fTGH cells stably expressing ORF37 (Lane 2) or empty vector control (Lane 1) were left untreated, treated with dsRNA in the media, transfected dsRNA, or IFNb. p56 protein levels were measured by immunoblotting. B. 2fTGH cells stably expressing ORF35
(Lane 2) or empty vector (Lane 1) were left untreated, treated with dsRNA in the media, transfected dsRNA or IFNb. p56 protein levels were measured by immunoblotting. C.
2fTGH cells stably expressing ORF58 (Lanes 1 and 2) or empty vector control (Lanes 3 and 4) were untreated (Lanes 1 and 3) or teated with dsRNA in the media, transfected dsRNA or IFNb (Lanes 2 and 4). p56 levels were measured by immunoblotting. D. Two independently isolated 2fTGH clones expressing ORF58 (58.2 and 58.3) or control cells
(-) were treated with dsRNA in the media or transfected dsRNA. p56 protein levels were measured by immunoblotting (top). ISG56 and ORF58 mRNA levels were measured by
Q RT-PCR (bottom) in independently isolated clones expressing ORF58 (58.2 and 58.3) or empty vector control (-) treated with dsRNA in the media. mRNA levels are shown relative to the highest expressing sample. Bars represent standard error.
158
159
Figure 6.4: MHV68 ORFs 35 and 58 do not inhibit activation of p38 and AKT.
Empty vector control (A) or 2fTGH cells stably expressing ORF58 (B) or ORF35 (C) were treated with dsRNA in the media for the time indicated and collected for immunoblot analysis. P38 phosphorylation at threonine 180 and tyrosine 182 (p-P38) was detected by immunoblotting cell extracts with phospho-p38 specific antiserum with total
P38 as a control. AKT phosphorylation at serine 473 (p-AKT) was detected by immunoblotting cell extracts with phospho-AKT specific antiserum with total AKT as a control.
160
161
without viral protein (Fig 6.4A). These results indicated that while ORF35 and ORF58
can block IRF3 activation by dsRNA, they cannot block AP1 activation.
PI3K plays an important role in the full phosphorylation of IRF3 via AKT.59 To assay the effects of ORF35 and 58 on the activation of this part of the pathway we measured phosphorylation of AKT by phosphospecific antibody. The amount of phosphorylated AKT was slightly decreased compared to control cells without viral protein initially at 15 minutes (Lanes 2 Fig 6.4A-C). However, phosphorylated AKT levels were comparable to control cells after 30 minutes. (Lanes 3 Fig 6.4A-C) These results indicated that ORFs 35 and 58 do not block phosphorylation of IRF3 via the
PI3K/AKT pathway.
ORF58 inhibits NFkB activation
NFkB is also activated in the TLR3 pathway and this can in part by assayed by the nuclear localization of the p65/RelA subunit (Lane 2 Fig 6.5A). In cells expressing
ORF58, dsRNA-induced p65 nuclear localization was inhibited (Lane 4 Fig 6.5A). This was not an effect of decreased basal p65 expression because total cell extracts showed equivalent amounts of the protein in cells with and without ORF58 (Bottom Fig 6.5A). In addition, gene induction by NFkB was assayed by IL8 ELISA as the promoter of IL8 contains NFkB sites.382 The amount of IL8 produced from dsRNA treatment was
decreased by approximately 50% in cells expressing ORF58 (Lane 4 versus Lane 2
Fig6.5B). The IL8 promoter contains NFkB as well as AP1 and other transcription factor binding sites.383, 384 These results are therefore consistent with the interpretation that
ORF58 can inhibit NFkB but not AP1 mediated transcription.
162
Figure 6.5: ORF58 inhibits NFkB activation.
A. Nuclear fractions from empty vector control cells (Lanes 1 and 2) or 2fTGH stably
expressing ORF58 (Lanes 3 and 4) that were untreated (Lanes 1 and 3) or treated with
dsRNA in the media (Lanes 2 and 4) were immnoblotted for p65 with the nuclear protein
DRBP76 as a loading control. For comparison, total cell extracts were immunoblotted for
p65 with actin as a loading control. B. Empty vector control cells (Lanes 1 and 2) or
2fTGH stably expressing ORF58 (Lanes 3 and 4) were untreated (Lanes 1 and 3) or
treated with dsRNA in the media (Lanes 2 and 4). Media from these samples were
collected to assay for IL8 by ELISA. Bars represent standard error. Data is representative of two independent experiments.
163
164
ORF35 enhances NFkB activation
In contrast to ORF58, NFkB activity in cells expressing ORF35 was actually increased in unstimulated and also dsRNA treated cells activating TLR3 (Fig 6.6). Basal
IL8 expression without any stimulation as assayed by ELISA was approximately 10 fold more in cells expressing ORF35 (Lane 3 Fig 6.6) compared to control cells without the viral ORF (Lane 1 Fig 6.6). When dsRNA was used as an inducer, ORF35 expressing cells produced more than twice as much IL8 compared to control cells (Lane 4 versus
Lane 2 Fig 6.6). Since ORF35 appears to not affect P38 or AKT phosphorylation, these
results most likely suggest that NFkB and not AP1 mediated transcription is being
augmented.
ORF58 inhibits IRF3 activation
We hypothesized that the point of inhibition for ORF58 was at the level of the
IKK family of kinases TBK1 and IKKe because ORF58 could inhibit both TLR3 and
RIG-I mediated signaling which converge at this point. Furthermore, the IKK family
members IKKα, β and γ are in part responsible for p65 nuclear localization in NFkB
activation and this was also inhibited by ORF58. Exogenous expression of the IKK
family member TBK1, activated by both TLR3 and RIG-I, can by itself phosphorylate
IRF3 and induce P56. Consistent with our hypothesis, this induction was inhibited in the presence of ORF58 (Fig 6.7A).
Inactive IRF3 is predominantly cytoplasmic while activated IRF3 is predominantly nuclear.289 Nuclear localization of IRF3 induced by both TLR3 and RIG-I
signaling was inhibited in cells expressing ORF58. (Lane 4 versus Lane 2 Fig 6.7 B and
C) We then asked whether the observed block of IRF3 translocation was due to a block in
165
Figure 6.6: ORF35 augments NFkB activation.
Empty vector control cells (Lanes 1 and 2) or 2fTGH stably expressing ORF35 (Lanes 3 and 4) were untreated (Lanes 1 and 3) or treated with dsRNA in the media (Lanes 2 and
4). Media from these samples were collected to assay for IL8 by ELISA. Bars represent standard error. Data is representative of two independent experiments.
166
167
Figure 6.7: ORF58 inhibits IRF3 activation.
A. 293 cells were co-transfected with expression vectors for TBK1 and ORF58 (Lane 2) or empty vector control (Lane 1). Immunoblotting was used to detect p56 levels and
Myc-tagged TBK1. B. Nuclear fractions and total cell extracts from empty vector control cells (Lanes 1 and 2) and 2fTGH stably expressing ORF58 (Lanes 3 and 4) were untreated (Lanes 1 and 3) or treated with dsRNA (Lanes 2 and 4) and immunoblotted to determine the levels of IRF3. The nuclear protein DRBP76 and actin served as controls.
C. Nuclear fractions from empty vector control cells (Lanes 1 and 2) and 2fTGH stably expressing ORF58 (Lanes 3 and 4) were untreated (Lanes 1 and 3) or treated with transfected dsRNA (tdsRNA) (Lanes 2 and 4) and immunoblotted to determine the levels of IRF3. The nuclear protein DRBP76 served as a control. D. Empty vector control (left) or 2fTGH cells stably expressing ORF58 (right) were treated with dsRNA in the media for the time indicated and collected for immunoblot analysis. IRF3 phosphorylation at serine 396 was detected immunoblotting cell extracts with phospho-IRF specific antiserum with total IRF3 as a control. E. Empty vector control (Lanes 1 and 2) or 2fTGH cells stably expressing ORF58 (Lanes 3 and 4) were transfected with dsRNA and samples were collected for immunoblot analysis. IRF3 phosphorylation at serine 396 was detected immunoblotting cell extracts with phospho-IRF specific antiserum with total IRF3 as a control. F. Empty vector control cells (Lanes 1 and 2) and 2fTGH cells stably expressing
ORF58 (Lanes 3 and 4) were treated with dsRNA (Lanes 2 and 4). IRF3 dimerization was assayed by native gel electrophoresis followed by immunoblotting. G. It is the same as in F except cells were transfected with dsRNA.
168
169
its phosphorylation, which is known to activate it. Phosphorylation of Ser396, a hallmark
of IRF3 activation in both the TLR3 and RIG-I pathways, was inhibited in the presence
of ORF58. (Fig 6.7D and E) Consistent with these results, IRF3 dimerization as measured by native gel electrophoresis was reduced in cells expressing ORF58 when TLR3 was
activated. (Fig 6.7F) However, the relative inhibition of dimerization was not as great as
the inhibition of IRF3 nuclear localization or P56 induction. Furthermore, there was no
difference in IRF3 dimerization between ORF58 expressing and control cells when
dsRNA was transfected to activate RIG-I (Fig 6.7G). These results indicated that ORF58
inhibits certain aspects of IRF3 activation such as nuclear localization and Ser396
phosphorylation but not all as reflected by dimerization.
ORF35 inhibits IRF3 activation
Like ORF58, ORF35 was also able to inhibit p56 induction from both the TLR3
and RIG-I/mda-5 pathways. Thus, for this protein too, the point of inhibition is likely
downstream of where the two pathways converge at TBK1 and IKKe. IRF3 was not
localized into the nucleus in cells expressing ORF35 when treated with dsRNA floating
in the media as compared to empty vector control cells (Fig 6.8A), indicating that the
transcription factor was not active. However, IRF3 dimerization as assayed by native gel
electrophoresis and Ser396 phosphorylation as assayed by a phosphospecific antibody,
were not decreased and in fact was the same as in control cells. (Fig 6.8B and C) These
results indicated that ORF35 mediated inhibition is not at the step of TBK1/IKKe
phosphorylating Ser396. However, an additional level of regulation after this step is
being inhibited since nuclear translocation and transcriptional activity are absent.
170
Figure 6.8: ORF35 inhibits IRF3 activation.
A. Nuclear fractions from empty vector control cells (Lanes 1 and 2) and 2fTGH stably expressing ORF35 (Lanes 3 and 4) were untreated (Lanes 1 and 3) or treated with transfected dsRNA (tdsRNA) (Lanes 2 and 4) and immunoblotted to determine the levels of IRF3. B. Empty vector control cells (Lanes 1 and 2) and 2fTGH cells stably expressing
ORF35 (Lanes 3 and 4) were treated with dsRNA (Lanes 2 and 4). IRF3 dimerization was assayed by native gel electrophoresis followed by immunoblotting. C. Empty vector control (left) or 2fTGH cells stably expressing ORF35 (right) were treated with dsRNA
in the media for the time indicated and collected for immunoblot analysis. IRF3
phosphoyaltion at serine 396 was detected immunoblotting cell extracts with phospho-
IRF3 specific antiserum with total IRF3 as a control.
171
172
ORF58 inhibits RIG-I and IRF3 mediated apoptosis
IRF3 mediates apoptosis induced by transfected dsRNA activating RIG-I.23 TBK1 kinase activity in this process is essential. Since ORF58 could inhibit TBK1 mediated transcriptional activation of IRF3, we asked if ORF58 could also inhibit the apoptotic pathway going through the same kinase. Controls cells when transfected with dsRNA cleaved PARP (Lane 2 Fig 6.9A) and died after 18 hrs. Both cell death estimated by visualization (data not shown) and PARP cleavage were inhibited in cells expressing
ORF58. (Lane 4 Fig 6.9A) These results indicated the ORF58 could inhibit the apoptotic as well as trancriptional activity of IRF3.
173
Figure 6.9: ORF58 inhibits IRF3 mediated apoptosis.
Empty vector control (Lanes 1 and 2) or 2fTGH cells stably expressing ORF58 (Lanes 3 and 4) were untreated (Lanes 1 and 3) or transfected with dsRNA (Lanes 2 and 4). Total cell extracts were collected for cleaved PARP immunoblot analysis.
174
175
Discussion
A cell death assay that identifies inhibitors and activators of IRF3
We employed a cell death assay to identify inhibitors of dsRNA-TLR3 mediated
signaling. We assayed a total of 135 ORFs encoded by members of the Herpesviridae
family that are either putative or have been previously characterized. None of the ORFs
were previously described in the literature to affect IRF3 activation specifically. Our
results indicated that 18 ORFs are able to inhibit IRF3 activation by TLR3 (6 of 12
mCMV, 5 of 78 hCMV and 7 of 45 MHV68) (Table). Of these 18, 4 were chosen to
follow up by making cell lines stably expressing the ORFs to confirm the inhibition of signaling. P56 protein induction from dsRNA activation of TLR3 was significantly decreased in cell lines expressing all four ORFs: mCMV M36, MHV6 ORF35, 37 and
58. Finally, two of these four ORFs, MHV68 ORF 35 and 58, were examined in depth to elucidate the mechanism of signaling. In the following discussion, I will discuss first the advantages and disadvantages of our assay in the context of identifying viral inhibitors and activators of signaling. Next, the focus will turn towards the results of the assay discussing in general and then taking on more specific examples from each virus, mCMV, hCMV and MHV68. Finally, I will discuss the results from experiments conducted to address the mechanisms of inhibition specifically for MHV68 ORF35 and
58.
Viral assays that identify inhibitors of signaling
Several types of systems have been used to identify viral inhibitors of innate immune signaling documented in the literature. As an example, Martinez-Sobrido et al
identified the NP protein of lymphocytic choriomeningitis virus (LCMV) from
176
systematically assaying all the ORFs for inhibitors of IFN induction using reporter gene
assays with plasmid constructs containing CAT, GFP or luciferase under the control of
the IFN promoter.385 Similarly, Park et al systematically assayed ORFs from NDV and
Nipah viruses and identified V accessory proteins as inhibitors of signaling.273 However,
instead of the reporter gene under the control of the IFN promoter, they genetically
engineered NDV to express GFP as a marker for signaling- if virus grew and GFP was
expressed then IFN signaling was inhibited; if virus did not grow and no GFP was
expressed then IFN was effectively signaling. These two examples were feasible because
of the genomes for these RNA viruses were small.
For hCMV which is approximately ten times larger in its genome compared to
these RNA viruses, Child et al used a system based on the vaccinia virus E3L (VV delta
E3L) mutant which is unable to inhibit IRF3,386, 387 PKR388 and 2, 5A synthetase389 activation.323 While the situation is more complex in whole mice experiments,386 in tissue culture, PKR appears to be main host protein that inhibits VV delta E3L.390 Thus, knockdown of expression or function of PKR rescues the virus and allows for replication.
The authors assembled a library of CMV genomic fragments into a vaccinia virus vector, homologously recombined this library into vaccinia virus delta E3L and selected for virus growth in tissue culture cells. This screen was performed with two different libraries created with different restriction enzymes and from this, only one positive hit was obtained. This contained a 10kb hCMV region which was narrowed down to TRS1 and
IRS1, both shown to be able to inhibit PKR activation by binding to dsRNA.323 In our system, we assayed for inhibition of signaling by expressing cloned putative ORFs in transfected plasmids. For hCMV specifically, our screen of 78 ORFs resulted in 5
177
positives, approximately 3% of the genome. This rate of recovery is within the range to
that performed by Child et al who scored 2 out of approximately 200 ORFS theoretically
represented by the library, 1%. Incidentally, while TRS1 was not tested in our assays,
IRS1 was. Results indicated that IRS1 did not block dsRNA TLR3 induced signaling,
signifying that the ability of IRS1 to rescue VV delta E3L replication was in its inhibition
of PKR or 2, 5 A synthetase as described in the paper and not IRF3 activation.
One issue taken into consideration when scoring positives was that our selection system used a herpesvirus protein, the HSV-1 thymidine kinase. Since thymidine kinase is conserved throughout the three subfamilies, it would be reasonable to expect that the majority of Herpesvirus genomes would also encode for proteins that regulate this
function. If the ORFs in our assay affected the function of TK or the metabolism of GCV,
false positives could arise. Indeed, the inclusion of the MHV68 TK homologue was an
example of a false positive whose identity was not uncovered until after the assays were
completed. Unexpectedly, our assay did not show a similar phenotype for the hCMV TK
homologue, UL97.391 This could be due to issues with expression of the protein itself as
this was not confirmed in our assay, a possible mutation in UL97 affording resistance to
the antibiotic or the relative activity of the hCMV TK as compared to the TK from
MHV68 from our ORF collection and HSV-1 used in our cell line TK. It may be that hCMV TK is much less efficient at phosphorylating GCV as compared to the TK of the other two subfamilies and therefore its activity would not be reflected at the concentration of antibiotic used.
The second important issue was that since we assayed each ORF expressed from a plasmid, the inhibition would not necessarily be relevant in the context of a viral
178
infection. This increased the importance in confirming the inhibition and addressing its
role in virus replication.
A third important issue was that we did not confirm the protein expression of the
ORF plasmids in our assay. Therefore, our assay was limited to the correct cloning and
expression level afforded by a transient transfection from plasmids.
Finally, our screen was limited to the extent of our plasmids particularly in the prediction of putative ORFs. If any ORFs did not fall within these predictions, they would be misrepresented. In addition, these ORFs were not constructed specifically to express microRNAs even though they are predicted to be encoded by the genome. While microRNAs could still be expressed from a cloned ORF, this cannot be guaranteed.
Despite these issues, the method we used did afford us several advantages.
First, because we were assaying ORFs individually and not conducting a large screen, we could identify both inhibitors and activators of signaling. Just as cells survive in the presence of an inhibitor independent of dsRNA, cells die in the presence of an
activator independent of inducer. There are numerous examples of viral homologues
encoded by Herpesviruses which stimulate the immune system for dissemination
purposes exist (for instance vIL10 and viral homologues to the TNFR and chemokines).
Consequently, ORFs inducing signaling would not be an unexpected finding in our
assays. None of the ORFs we assayed were previously described in the literature to affect
IRF3 activation specifically. In our assay, with the exception of the thymidine kinase
homologues, no ORF induced cell death on its own. One reason that may explain this
result is the possibility that viral proteins activating IRF3 as an effect of viral binding or
entry may not be properly folded and secreted out into the medium when they are
179
expressed alone from a plasmid as opposed to when they are part of a virion in an actual
virus infection. In addition, viruses may not utilize IRF3 to purposefully stimulate the
immune system for dissemination perhaps because IRF3 mediates too potent an antiviral
response. Other less potent signaling molecules then would then allow for easier viral
manipulation.
Second, using plasmids to express ORFs allowed us to control the representation
of the genome. Alternatives to systematic ORF expression include random library
construction into vectors such as that performed by Child et al or mutagenesis of the
virus itself and then assaying for inhibition of signaling during viral infection instead of
using plasmids to express genes.323 Both of these methods are subject to biases within the construction of the library dependent on the restriction enzymes used or mutagenic technique, whether it be mediated by transposons or chemicals. Here, we are able to cover genomic ends and repetitive regions which are more difficult to assess with alternatives mentioned above. Our assay covered a limited number of ORFs for mCMV, approximately 50% of putative ORFs for hCMV and 50% for MHV68 but can be potentially extended to cover all the ORFs (and microRNA encoding areas) from these viruses.
Third, control of individual ORFs allowed us to test specific combinations easily.
In instances where viral proteins work together as indicated by protein protein interactions in the literature, we were able to express all proteins in a complex together.
We did find that several combinations for mCMV (the complex of m139, m140 and m141 and the complex of m142 and m143) and MHV68 (ORF27 and 58) were able to inhibit signaling. Using the cell death assay, we assessed whether each could
180
independently inhibit signaling or if co-expression was necessary. In all cases, each
individual ORF was as equally efficient in inhibiting signaling as the combination. We
did not, however, observe a cooperative effect. This may be in part due to varying
expression levels- when combinations of plasmids were transfected into cells for the
assay, the total DNA was kept equal so the individual amounts of plasmids per ORF were
decreased by one half to one third when tested in combination as compared to alone.
While controlling for the levels of expression would be important before drawing
conclusions about cooperatively, we could conclude from the data we collected that the
individual ORFs within the combinations were sufficient to inhibit signaling.
Fourth, ORF expression was independent of viral life cycle. The plasmid based expression gave us the potential to easily assay for late lytic and even latent genes. If these were expressed from a virus itself, the experimental procedure and results would have been complicated by the presence of all the immediate early and early genes (or other viral genes) as well as conducting the assay in cells capable of supporting latency.
While early expressing genes are thought to be important in inhibiting the initial
induction, the inhibition of amplification of signaling is just as important later on in the
life cycle. M2 which is expressed in latency and inhibits IFN signaling is such one
example.331 No known latent ORFs were assayed here, but we were able to address
several late expressing ORFs in the lytic cycle. The results indicated that 3 out of 6
mCMV, 4 out of 5 hCMV and 3 out of 7 MHV68 ORFs thought to inhibit signaling were
in fact expressed late in the viral life cycles.
Fifth and finally, ORFs essential or playing an important role in the virus
replication cycle could be assayed. These ORFs constitute a significant part of the
181
genome: 45 of 162 (28%) of hCMV and 41 of 80 (51%) MHV68 ORFs are thought to be
essential and 35 of 162 (22%) hCMV and 6 of 80 (8%) MHV68 ORFs when mutated
have attenuated viral replication abilities.392, 393 In our assay, 29% of hCMV ORFs and
69% of MHV68 ORFs fell into these two categories. (Table 6.1 and 6.2) It is interesting
that the CMV ORFs which appeared by cell survival to be the strongest inhibitors of
signaling were also essential: m142 and m143 for mCMV and UL122 for hCMV. From
this, we may hypothesize that inhibition of signaling is an important enough selection
criteria to engender these ORFs essential. Indeed, in the case of the Paramyxovirus
Sendai, IRF3 alone appears to control the fate of the cells by promoting apoptosis to
prevent viral persistence.23 This indicates that IRF3 is able to determine the outcome of
infections and viral action against IRF3 may in fact be essential for survival. However, only two of the six inhibitory γ−herpesvirus MHV68 ORFs (ORFs 35 and 44) were essential to viral replication and they did not appear to inhibit significantly more than the
others. Ultimately, a more complete analysis of all the ORFs from the genome would be
necessary to conclude if IRF3 activation and its inhibition is actually essential in
replication of β and not γ−herpesviruses.
Members of the US22 mCMV gene family inhibit IRF3 activation
We assayed only 12 ORFs for mCMV. Because analyses of smaller RNA viruses
showed that only some but not the majority of viral proteins are involved in immune
evasion,285 we expected the same for the larger DNA viruses such as here. Therefore, it
was surprising that half of the ORFs we tested for mCMV inhibited cell death, indicating
that they could prevent IRF3 activation. This however is not completely unreasonable
because the US22 gene family as a whole have two properties thought to be important for
182
viral proteins to inhibit the initial induction of signaling from viral infection: they are either found or hypothesized to be part of the tegument378, 394 and are expressed as
immediate early genes.395 Thus they are all present at the time of infection and
accumulate immediate after viral penetration of the cell to potentially block initial
signaling. Furthermore, the conservation of the US22 gene family across βherpesviruses
suggests that their function(s), though many are yet to be elucidated, is essential to
maintain through evolution and divergence. It is interesting that of the members of the
US22 gene family identified to inhibit IRF3 activation, the growth of the corresponding
viral ORF mutants is either severely attenuated or non existent. In comparison, viruses
mutated in the six ORFs that did not inhibit signaling in this assay have much less severe
viral growth defects.396 This strongly suggests the importance of inhibition of IRF3 on the
fitness of viral replication.
mCMV M36 inhibits IRF3 activation
For M36 specifically, the mCMV ORF is a homologue of the hCMV UL36.397
While the mCMV ORF has not been very well characterized, the hCMV UL36 is also known as the viral inhibitor of caspase 8 induced apoptosis (vICA).398 Caspase 8 is
involved in TK/GCV mediated cell death and chemical inhibitors of caspase 8 such as
zIETD-fmk and zVAD-fmk can partially inhibit apoptosis.399 Thus, M36 could
potentially be inhibiting caspase 8 in the apoptosis mediated by TK/GCV instead of the
signaling that induces TK.
We tested this possibility by constructing cell lines stably expressing M36. These
cells did not induce p56 after treatment with transfected dsRNA or dsRNA in the media
compared to controls, confirming that M36 does indeed inhibit IRF3 activation. This
183
inhibition was seen in a dose dependent manner with decreased ISG56 mRNA
corresponding to increasing M36 expression. (Data not shown.) Furthermore, M36 could
not block IFN induction of p56, indicating that the inhibition is not global. (Data not
shown.) Since M36 is one of the few ORFs in mCMV that is predicted to be spliced, this
inhibition of signaling could be due to the default protein, the alternatively spliced version or both.400
hCMV ORFs inhibit IRF3 activation
The five hCMV ORFs identified to inhibit IRF3 activation share many
characteristics with the inhibitory mCMV ORFs found in our assay. With the exception
of TRL3 which has yet to be directly examined, all are present in the virion so again the
proteins are present at the time of infection to prevent signaling.65, 401 In fact, UL25 and
UL122 are contained at high enough levels to elicit a significant antibody response in humans.402 Of the five, two are conserved across β herpesviruses, UL24 and UL122,
indicating that like the mCMV US22 gene family, the functions of UL24 and UL122 are
essential enough to be maintained through evolution and divergence. The actual function
of UL24 is unknown. For UL122 (also known as IE2 and IE86), it has immediate early
transactivation activity which is necessary for viral gene expression. In addition, many
other functions have already been described for this protein: negative autoregulation of
the major immediate early promoter, induction of cell cycle from G0 to G1 and arrest at
the G1/S transition, inhibiting cellular DNA synthesis.403
hCMV UL122 inhibits signaling potentially via the IRF3 autoinhibitory domain
In innate immunity, IE2 has also been shown to block the induction of not only
IFN but also RANTES, MIG, MCP-2, MIP1a and IL8 by UV inactivated hCMV or
184
Sendai virus.404, 405 Since IRF3 is one transcription factor important in the induction of
IFN, its inhibition by UL122 detected here may help explain how the inhibition of IFN is
occurring. Like the mCMV scenario, UL122 was the highest scoring inhibitor of TLR3
signaling and also the only one essential for viral replication.380 Interestingly, searches
using protein protein BLAST and GCG Wisconsin looking for hCMV areas similar to
IRF3 showed that UL122 was homologous to the N terminus of IRF3. (Data not shown.)
This was specifically in the N terminal inhibitory domain which is thought to bind to its
C terminal equivalent to keep IRF3 in an inactive state by masking the transactivation
domain consisting of the IRF association domain (IAD), nuclear export signal (NES) and
a subset of residues that are phosphorylated in response to an inducer.113, 114 From this, we can hypothesize that UL122 inhibits IRF3 activation by encoding an IRF3-like inhibitory domain that binds to the actual IRF3 C terminal inhibitory domain. This masks
IRF3 domains necessary for activity and thus prevents function.
MHV68 ORFs inhibit IRF3 activation
The MHV68 set of ORFs identified to inhibit IRF3 activation are the most diverse
set of proteins in comparison to the mCMV and hCMV results. Three of seven have been reported in the literature to be found in the virion.406 For those not reported to be found in
the virion, three of the four are expressed with early kinetics. Thus, with the exception of
ORF35, the MHV68 ORFs identified in our screen appear to be present either by being delivered with the virion or expressed at early times to prevent the early steps of signal
induction. Despite this, ORF35 does appear to be important somehow because when
mutated, it along with ORF44, have shown to be essential to virus replication.392, 407
185
Putative exonuclease activity of MHV68 ORF37 may repress global gene expression
Though not necessarily characterized, all the MHV68 inhibitory ORFs have
orthologues in other γ−herpesviruses such as EBV and KSHV. MHV68 ORF37 for
example is homologous to EBV BGLF5 and the SOX protein of KSHV.340 The published
literature indicates that EBV BGLF5 and KSHV SOX are DNases involved in processing and packaging of the viral genome and, more importantly, exonucleases which globally inhibit gene expression from the host at early times in the lytic replication cycle.408, 409
Consistent with this description, cell lines stably expressing ORF37 showed a reduction in p56 expression in response to all inducers used, including intracellular dsRNA activating RIG-I/mda-5, extracellular dsRNA activating TLR3 and IFN. (Data not shown.) Thus, MHV68 ORF37 may behave like its EBV and KSHV orthologues and globally inhibit mRNA expression such as that of ISG56.
A more in depth analysis of the mechanism of inhibition for MHV68 ORFs 35 and 58 revealed new features of MHV68 evasion of the dsRNA mediated signaling.
Similar to mCMV M36, induction of viral stress-inducible genes by dsRNA activating
TLR3 and RIG-I but not IFN is blocked by ORFs 35 and 58. (Fig) Thus, ISG56 gene induction by IRF3 and not ISGF3 is inhibited. The point of inhibition is most likely at the step of IRF3 activation because that is where the RIG-I/mda-5 and TLR3 pathways converge. Similar observations have been made here in Chapter 5 and by others, for example Unterstab et al for Borna disease virus P protein.165
MHV68 ORF58 inhibits IRF3 and NFkB activation
MHV68 ORF58 inhibits IRF3 and NFkB mediated transcription induced by TLR3
and RIG-I/mda-5 as well as IRF3 mediated apoptosis induced by RIG-I/mda-5. Several
186
scenarios are possible that explain the mechanism of inhibition. One possibility is that
like BDV P protein and probably Rubulavirus V proteins, ORF58 competes out IRF3 as
substrates for IKKe/TBK1. Similarly, they may compete out IkB as substrate for IKKa/b.
A second possibility is that ORF58 may have stronger affinity for the IKK family
members involved, thus preventing physical interaction between kinase and substrate. A
third possibility is that ORF58 is acting indirectly through a host negative regulators such
as the Ret Finger Protein which interacts with not only the IKK family of kinases
including IKKe, TBK1, IKKa and IKKb but also IRF3 itself, allowing for dimerization
but not nuclear localization.144 This scenario would explain the relatively normal amount
of IRF3 dimerization seen in ORF58 expression cells but inhibition of IRF3 as well as
p65 nuclear localization. (Figs 6.5 and 6.7) In addition, pathway leading to AP1 transcription as assayed by P38 or AKT phosphorylation is likely unaffected because
IKKs are not involved in its activation as the divergence of the pathways is earlier at
TAK1. IKKe kinase activity has been reported to affect a certain subset of genes stimulated by IFNb.116 However, there is no experimental evidence indicating that ISG56
is a member of this subset. Thus, it is possible that ORF58 may inhibit a subset of IFN
induced ISGs by inhibiting IKKe but that this inhibition may not be reflected by ISG56
specifically. Finally, we cannot rule out the possibility that the inhibitory activity of
ORF58 may be the result of a non-protein product such as a microRNA. The protein
product of ORF58 is membrane bound and expressed in low abundance so is difficult to
detect.410 In our hands, we can detect RNA by Q PCR but not protein expression via an epitope tag. Our assay is capable of detecting siRNA mediated effects directed against
IRF3 (Chapter 4). While the coding region of ORF58 does not have any areas predicted
187
to encode a microRNA, if ORF58 did encode a micoRNA that inhibited signaling, its
target would most likely not be IRF3 as protein levels are comparable to control cells but
rather other molecules such as TBK1 or IKKe.
Whether it be by a RNA silencing mechanism or protein protein interactions
ORF58 inhibits not only the transcriptional activity of IRF3 but also its proapoptotic
activity. Sendai virus infection induces cellular apoptosis through IRF323 and this cell
death may be a host mechanism for preventing persistent infection. In addition, inhibition
of apoptosis prevents the possible dissemination of danger associated molecular patterns
(DAMPs) that could be released to potentially prime other cells. Therefore, it would
behoove the virus to inhibit the IRF3 mediated apoptotic pathway to prolong the life of the host cell to generate more virus, prevent cross priming of uninfected cells and block
IRF3 mediated antiviral gene expression in the infected cell.
ORF58 is non essential and encodes for a protein predicted to have multiple
transmembrane spanning domains. Immunoflourescence detecting protein expressed from
a plasmid indicated that it localizes to the ER, Golgi and plasma membrane.392, 410
Intriguingly, localization predictions using PSORT indicated that TBK1 (but not IKKa, b, e) may also be found in the ER.411 More importantly, TBK1 coimmunoprecipitates with
Sec proteins of the exocyst, which is involved in vesicle trafficking to the plasma
membrane via the Golgi and ER.412 Thus, an interaction between ORF58 and TBK1 may
occur transiently at the ER leading to inhibition of the kinase whose activity is essential for both transcription and apoptosis. Co- localization and immunoprecipitation studies assaying for interactions between TBK1 and ORF58 would help to determine if this is indeed occurring.
188
ORF58 is expressed in low abundance.410, 413 However, its expression is present at
the time of infection because the protein is thought to be incorporated into the virion414 and it is transcribed with early kinetics.407 ORF58 is essential for the localization of
ORF27 to the Golgi and eventually the plasma membrane which is thought to be important for cell to cell spread of the virus.415 However, the effect of ORF27 on the localization of ORF58 is not yet clear.410 Our data showed that ORF58 inhibits IRF3
activation independent of ORF27. However, expression of ORF27 may change the
functional amount of ORF58 available for inhibition. Thus, it is important to address the
effect of ORF27 on the ability of ORF58 to inhibit IRF3 activation either in transient
assays or in the more relevant viral context with ORF58 deficient virus that still expresses
ORF27.
ORF58 deficient virus is only slightly attenuated in the tissue culture system when
compared to wildtype- the difference in titres is approximately one log.410 More significant effects on viral replication may be observed however in the presence of IRF3 activation such as in an animal model when dsRNA and other components that activate the immune system are present.
MHV68 ORF35 inhibits IRF3 but augments NFkB activity
Like ORF58, MHV68 ORF35 inhibits IRF3 activation by TLR3 and RIG-I/mda-
5. However NFkB basal and induced activation is augmented by its presence. This inhibition can be either through the inhibition of IRF3 as there is a precedent for IRF3 negatively regulating a subset of NFkB genes or completely independent of IRF3 inhibition for which of course there are also precedents.
189
Situations in which IRF3 negatively regulate NFkB and vice versa have been
previously described. The NFkB induced A20 for instance interacts with TBK1 and IKKe
to inhibit IRF3 activation.145 It also deubiquitinates Traf6 and degrades RIP1 to inhibit
NFkB activity.146, 147 Elco et al described how increasing levels of IRF3 inhibited a subset of NFkB induced genes.217 This phenomenon is independent of the transcriptional
activity of IRF3 since induction is not necessary and deficient IRF3 mutants are also
capable of inhibition. In addition, IkB release and p65 phosphorylation appears similar to wildtype. A similar but not identical situation could be occurring here. Production of IL8 as assayed by ELISA was the endpoint to measure NFkB activation for ORF35. (Fig)
However, it is unclear in microarray analysis if IL8 is suppressed by IRF3 overepression.217 Thus, analysis of other NFkB induced genes especially those which are
more clearly repressed by IRF3, such as A20, is needed. One possible mechanism of
IRF3 inhibition and NFkB augmentation is via the glucocorticoid receptor interacting
protein GRIP1. GRIP1 augments ISRE mediated gene induction by interacting with IRF3
and through its receptor simultaneously represses NFkB mediated transcription.62, 416 If
ORF35 somehow decreases the amount of functional GRIP1, then its IRF3 inducing and
NFkB repressing effects would be alleviated.
Many examples exist in the literature involving an IRF3 independent scenario for
ORF35 mediated augmentation of NFkB activity. EBV LMP1 in latency for instance
activates NFkB by being a TNFR homologue.417 KSHV K15-P through an unknown
mechanism activates NFkB and AP1.418 HTLV Tax oncoprotein associates with the IkB
kinase,419 Cocksackie virus cleaves IkBa,420 HSV1 ICP27 induces loss of IkBa and
IkBb421 and Hepatitis C NS5A phosphorylates IkB.422
190
One possible rationale for viral activation of NFkB and specifically IL8 may be
that in certain circumstances, IL8 inhibits the interferon induced antiviral response. This
is what has been suggested for the last example, HCV NS5A.422 Therefore, ORF35
mediated induction of IL8 may be another way to inhibit the host antiviral activity.
A second possible rationale for viral activation of NFkB and IL8 may be that it is
necessary for the purposes of dissemination as discussed earlier. IL8 is traditionally a
proinflammatory cytokine that induces the chemotaxis of neutrophils, lymphocytes and
basophils.423 Viruses such as herpesviruses have been documented to activate the immune system using viral homologues of proinflammatory cytokines and chemokines as well as their receptors such as mCMV m131-129 and hCMV UL146 which are chemokine homologues333, 334 and mCMV M33, 78 and hCMV US28 which are chemokine receptor
homologues.335, 336 ORF35 mediated induction of IL8 may just be a part of this effort to recruit host cells to the site of infection and facilitate viral spread.
Finally, a third possible rationale for ORF35 mediated activation of NFkB may be
that it is necessary for the establishment of the latent replication cycle and or the
promotion of oncogenesis during this latency. Inhibition of IRF3 and augmentation of
NFkB are activities that have attributed to the HPV16 E6 oncoprotein.168, 424 The two behaviors are thought to be independent- inhibition of IRF3 to suppress the immune response and activation of NFkB to promote the tumorogenesis involved in HPV induced cervical cancers. Like HPV, MHV68 is also associated with oncogenesis such as that in the lymphomas that arise from latently infected B cells. NFkB activity inhibits lytic replication but is absolutely required for viral latency.377 In this particular instance, the
timing of ORF35 expression may be important. Early in the infection, ORF35 is not
191
present in the virion and not expressed. Thus, NFkB and IRF3 are not active and lytic replication can take place. Late in the cycle, however, ORF35 is expressed. While ORF35 continues repression of IRF3, it augments NFkB activity to facilitate the transition into latency and perhaps promote oncogenesis. ORF35 is essential for viral replication. It would be interesting to determine which if not both of these functions is related to viral fitness.
Clearly any or all of these rationales may account for the different effects seen with expression of MHV68 ORF35. As with all viral ORFs, function and purpose is dependent on host and virus in terms of the time or stage of infection and the stage of replication for the virus. Thus, viral protein functions just like the viruses themselves are ever changing.
192
CHAPTER 7
DISCUSSION AND PERSPECTIVE
Summary
The previous chapters have presented in detail work regarding the use of a cell
survival assay to identify viral inhibitors of dsRNA TLR3 mediated IRF3 activation and
then the mechanisms by which these viral inhibitors function. The discussion here begins with some of the unique strengths of the cell survival assay introduced in chapter 4 and used in chapters 5 and 6. The discussion continues with interesting aspects concerning the virus host relationship reflected by the viral inhibitors of signaling and their mechanisms of evasion presented in chapters 5 and 6: the complexity in IRF3 activation and regulation, viral inhibition of TBK1 and IKKe which represent an important point in convergence and divergence of pathways, viral manipulation of the host that is both inhibitory and activating, the bidirectional relationship of the host virus interaction that allows for virus inhibition of the host and vice versa and, lastly, the characteristics of a viral inhibitor of signaling. The discussion ends with practical applications and
implications for virus host evolution derived from the work here.
A cell survival assay
Here, we have presented work involving the use and development of cell assays,
to study the nature of viral inhibitors of the immune response as well as the nature of the
host response to viruses and viral evasion. Our cell line featuring cell death as an
inducible phenotype represents one of the easiest methods to systematically assay for
inhibition of ISRE mediated signaling. Its strengths lie in 1.) the phenotype which is
easily detected in an assay or a screen, 2.) the 293 parental cell line is highly
193
transfectable, infectable and do not respond apoptotically to many stimuli, thus allowing the cell death phenotype to be specifically reflect signaling; and finally 3.) the promoter driving the reporter gene is not basally active but is induced highly by many different signals that converge onto the IRF family of transcription factors. Using this assay system, we were able to assess the inhibitory (and activating) potential of a variety of
ORFs on dsRNA TLR3 signaling. While none of the ORFs we tested were previously described in the literature to inhibit IRF3 activation specifically, there were indications the some could inhibit signaling. We went on to further characterize the nature of inhibition for several of these ORFs and discovered surprising aspects regarding the host virus relationship.
IRF3: complex regulation by phosphorylation
First, IRF3 activation is complex. Unlike other transcription factors such as the
p65 subunit of NFkB or the Fos or Jun subunits of AP1,377, 425 simply overexpressing
IRF3 is insufficient for activation. Thus, many post translational mechanisms of control
exist which have yet to be fully elucidated. The lack of congruence between Ser396
phosphorylation and IRF3 dimerization seen in the cases of the Paramyxoviral V proteins
or MHV68 ORFs 35 and 58 expression indicate that the currently accepted model of
IRF3 activation: phosphorylation, followed by dimerization and then nuclear localization-
is inaccurate.289 Our data indicate that 396 phosphorylation is not required for
dimerization. This is supported in part by other observations within the literature.144, 298 It is likely that phosphorylation or other modifications such as acetylation or methylation at this or other residues is instead required.
194
TBK1/KKe represents an important point of convergence and divergence
Second, TBK1 and IKKe appear to be popular targets for viral inhibition of
signaling. Both the interaction shown by coimmunoprecipitation between V proteins and
IKKe or TBK1 as well as the preliminary studies examining signaling pathway inhibition
by MHV68 ORFs 35 and 58 indicate that they inhibit at this level of the signaling
cascade. This point of regulation is also popular with other viruses. As noted previously,
the P proteins from Borna disease virus, Rabies, Ebola, and the PLpro of Severe acute
respiratory syndrome coronavirus all appear to inhibit at this step within the pathway.163-
166 TBK1/IKKe also represents a key point in the host regulation of signaling via multiple
proteins including SIKE, SHP2, RFP and A20.142-145 The manipulation of this checkpoint
by both host and virus may be due to either the fact that many pathways both converge as
well as diverge from TBK1 and IKKe. TBK1 and IKKe are known to act in the TLR3,
RIG-I, mda-5, TLR4, DAI and IFN signaling pathways. Thus, they have functional
implications in a variety of immune regulatory responses. In addition, both proteins have
been shown to be involved in the promotion of solid cancers and lymphomas. 412, 426
Finally, mice lacking IKKe are hypersusceptible to influenza infection and mice lacking
TBK1 die in utero from massive liver degeneration.116, 427, 428 Therefore, TBK1 and IKKe,
the non canonical members of the IKK family, are responsible for a wide variety of
functions which are reflected phenotypically.
Although TBK1 and IKKe are considered almost synonymous in the literature, it
is clear that they are not functionally identical. TBK1 is basally expressed while IKKe
expression is more induced. Furthermore, basal expressions of TBK1 and IKKe seem to
complement each other. IKKe is expressed more in immune cells and organs such as the
195
spleen, thymus and peripheral blood leukocytes while TBK1 is expressed in other
tissues.429, 430 Finally, deleting TBK1 in mice is lethal while the same for IKKe gives a much more subtle phenotype with influenza infection.427, 428 It is clear from these
phenotypes that the two kinases are not completely functionally redundant. It is curious
then how these two kinases are so different when structurally they both contain similar domains (ubiquitin like domains, kinase domains, coiled coiled domains) and functionally in terms of their kinase abilities, they appear to be able to act on common substrates. Identifying interacting partners and other possible functions would help in discriminating between these two non-canonical IKKs.
Intriguingly, the IKK family is well conserved throughout all eukaryotes from vertebrates such as Homo sapiens to plants such as Arabadopsis thaliana to amphibians such as Xenopus laevis to pathogenic protozoa such as Trichomonas vaginalis.431, 432
Drosophila encodes two members of the IKK family: Dmikkb/ird5 and ik2. Dmikkb/ird5 phosphorylates a Drosophila homologue to NFkB, relish, the host response to bacterial infection.433 ik2 is most closely related to TBK1 and IKKe and its kinase domain is
essential for viability. It is characterized with in NFkB independent role in mRNA
localization for dorsal ventral patterning during oogenesis. This is based on regulation of microtubules in the oocyte cortex involved in actin assembly and cell structure.434 Thus,
in addition to their more documented functions in immunity and cancer, human TBK1
and IKKe activation may potentially have additional undocumented impacts. We do not
know if viral proteins that can inhibit the kinase activity of TBK1 and IKKe directed
towards IRF3 can inhibit other functions of TBK1 and IKKe. We do not even know if
TBK1 or IKKe may have non-kinase related activities, although a function within the
196
ubiquitin utilization pathways is implicated by their ubiquitin like domains53 and their
role in K63 Ub of TANK.435 Again, identifying more interacting partners with these
kinases as well as the modifications which they undergo would then be an important step
in elucidating regulation of TBK1/IKKe and potential novel non-kinase functions. How
viruses would interact in these capacities would then shed more light on the importance
of TBK1/IKKe as a convergence point.
There are numerous examples of viral proteins inhibiting at levels of signaling
that are not TBK1 and IKKe such as HCV NS34A cleaving TRIF.180 Interestingly,
however, NS34A appeared to inhibit signaling only weakly in our cell death assay
compared to V proteins and MHV68 ORFs. Therefore, by selecting for the strongest
inhibitors to further characterize, we may have biased our group of proteins towards
inhibitors of TBK1 and IKKe. Nevertheless, these inhibitors still represent an important
aspect of pathogen control and immune evasion.
Viral activation and inhibition of host signaling pathways
Third, viral manipulation of the host is both inhibitory and activating. Numerous
examples from the literature describe viral homologues of host proteins that act to
stimulate the immune system for the proposed purposes of dissemination or viral
replication that requires host genes. Here, ORF35 represents an MHV68 gene that both inhibits IRF3 and augments NFkB activation. There are several rationales for this which are not mutually exclusive. One conjecture that they can have different functions- inhibition of IRF3 evade the host immune system and stimulation of NFkB to aid in the entry of MHV68 into latency and/or to promote tumorogenesis. A similar situation is documented with the HPV16 E6 oncoprotein which inhibits IRF3 signaling but activates
197
NFkB to promote tumorogenesis.168, 424 Another explanation is that activation of NFkB
and inhibition of IRF3 induces some but not all proinflammatory cytokines and this is
necessary to recruit host cells to aid the dissemination of the virus. Finally, activation of
IL8, an NFkB driven gene, may inhibit IFN mediated antiviral environment.436 Thus,
ORF35 within MHV68 may in part reflect the disparate needs of the virus to survive in
the host and how it may go about meeting them with a single protein.
The need to be able to activate specific pathways for viral persistence may be one
reason why viral or host inhibition of the other is never really complete. In the evolution
between host and virus, room for adaptation is necessary. In some circumstances, the
benefits from activation of signaling by viruses may outweigh the negative effects
resulting from stimulation of the host immune response. Similarly the disadvantages of
mounting too strong an immune response that may eventually kill the host may outweigh
the advantages of complete viral clearance. Therefore viral and host regulation of each
other reflects the homeostasis of a relationship which is ever evolving.
A single point of viral host interaction can be both inhibitory and activating
An alternative explanation for incomplete inhibition may be that the host and
virus uses the same point of interaction to oppose the other. Therefore, virus host
interactions are not necessarily completely in favor of either the virus or the host. We
showed that V protein interaction with TBK1 and IKKe results in inhibition of IRF3
activation by ubiquitination of the kinases or acting as alternative substrates for them. We
also showed that TBK1 and IKKe mediated phosphorylation of V, just as in IRF3, results in its degradation. Therefore, V protein inhibition of signaling may be an active viral mechanism of host evasion and TBK1/IKKe phosphorylation of V may be an active host
198
mechanism to suppress the virus. The literature describes a similar relationship between the host antiviral protein PKR and Hepatitis C virus (HCV). PKR can inhibit HCV IRES mediated translation by phosphorylating the host eukaryotic initiation factor (eiF2).287
HCV via its own internal ribosomal entry site (IRES) can inhibit dsRNA activation of
PKR by competing for the activation site itself 437 and or mediating interaction between
viral non structural protein NS5A and PKR that also inhibits the ability of PKR to be
activated by dsRNA.438 Thus, while it is difficult to prove, the relationship between PKR
and the HCV genome, just like that between TBK1/IKKe and V, may be one which is
exploited by both virus and host to fight the other. Since the protein product of human
ISG56, P56, also interacts with the HCV ribosome RNA complex to inhibit IRES
mediated translation like PKR, a similar relationship between P56 and HCV is possible.
Finally, it would be interesting to see if the yet to be elucidated molecular mechanisms by
which MHV68 ORFs 35 and 58 inhibit signaling are also exploited by the host to inhibit
the virus.
Viral evasion at multiple points within the viral replication cycle
Fifth and finally, the results presented here in part address the nature of a viral
inhibitor of signaling. Paramyxoviral V proteins described here have characteristics which are thought to be important to all viral inhibitors of signaling. They are expressed in large amounts at the beginning of the viral infection cycle. Rubulavirus V proteins are expressed highly as part of the virion. In addition, most but not all V proteins are considered accessory proteins whose functions are not required in viral replication per se but are necessary to interact with a potentially negative environment. However, as exemplified by the MHV68 ORFs, these characteristics do not necessarily apply to all
199
viral inhibitors of signaling. Unlike V proteins, MHV68 ORF58 is expressed at extremely
low levels. However, it is present in the virion. Perhaps this small amount is sufficient for the inhibition of signaling at the initial stage of infection. In contrast, MHV68 ORF35 is neither within the virion nor expressed with early kinetics. Thus, it is not present when signaling is initiated. However, it may still play an important role later in the infection
when possibly the initial viral inhibitors of signaling such as ORF58 are degraded,
occupied with other functions such as manipulation of the host cytoskeleton to aid in cell
to cell viral spread or when the amount of signaling simply becomes overwhelming.
Finally, viral evasion molecules are not just accessory proteins that are
dispensable when the virus is grown in a permissive environment. Like mCMV US22
genes m139-m143 and M36, hCMV UL122 and MHV68 ORF44 identified in our assay,
MHV68 ORF35 is essential for virus replication. Indeed, V proteins specifically for
Rubulaviruses also appear to be essential as a complete knockout has not been
successfully achieved. The reason for this has been speculated to be that Rubulavirus V
proteins may also function in viral replication. However, the nature of this function is
unknown. Alternatively, Rubulavirus V proteins may be essential because inhibition of
innate immune signaling is much more important than one may first imagine. Indeed, it is
clearer now that like many host signaling proteins, a single viral evasion molecule
encodes for many different functions. The Paramyxoviral V proteins inhibits IFN, mda-5
and TLR3 signaling with at least four different targets, STAT1, mda-5, TBK1 and IKKe.
MHV68 ORF35 may be functioning in two different mechanisms to inhibit IRF3 and
augment NFkB activation. Finally, MHV68 ORF58 blocks not only IRF3 activation but
also apoptosis. Thus, the nature of a viral inhibitor of signaling is as diverse as the
200
mechanisms by which they function and in this way viruses may encode for magnitudes
more of host inhibition then previously imagined.
Practical applications
The identification of viral inhibitors of signaling and their mechanisms of action
have many practical as well as theoretical implications. Work on the influenza NS1
protein is an excellent example of how understanding the molecular basis for viral
pathogenesis may have therapeutic impacts. NS1 has been shown to be able to inhibit
both innate and adaptive immunity via a variety of different mechanisms.439 This has been shown to be in part responsible for the extensive pathology seen in the 1918 variant of influenza.440 An understanding of the mechanisms of inhibition and relative
importance to viral replication has thus lead to the identification of inhibitory drugs
which may be used for treatment255 and also the establishment of attenuated viral strains
for vaccine purposes.441 Such strategies may be applied to other viruses and pathogens as
well for which we do not yet have effective therapy or means of prevention.
Evolution of the virus host relationship
Furthermore, the study of virus host interactions serves to help us better
understand the evolution of both organisms. It is interesting that the immune system has
not evolved to completely extinguish pathogens and that the successful pathogens have not evolved to completely exterminate their hosts. Indeed, it is thought that viruses such
as human immunodeficiency virus (HIV) with more persistent infection courses, able to
evade and/or downregulate the immune response, are more adapted for survival as
compared to those viruses such as Ebola which replicate prolifically resulting in a strong
enough immune response to kill the host. In fact, these highly pathogenic viruses only
201
survive because of a reservoir of host species which do not react as strongly and thus can
support persistent infection.
This viral persistence can be in certain circumstances beneficial to the host.
Infection with MHV68 and CMV, two DNA viruses which have co evolved with their
hosts for over 40 million years, appears to protect the host against other bacterial
infections by constitutively stimulating a low level of IFN expression.442 Extending one
step beyond this, polydnaviruses exhibit an obligate symbiotic relationship with their
Hymenoptera hosts, the wasps. These viruses are transmitted vertically in a Mendelian
fashion from mother to progeny instead of horizontally and their genomes exist in both integrated and episomal forms. The wasp host is itself parasitic during part of its life cycle in Lepidoptera, caterpillars. For the wasp, polydnaviruses play an essential role in development because they produce factors necessary to inhibit the caterpillar immune response to the invading parasite. Thus, in this example, not only is the host absolutely essential for viral replication and persistence but the virus is essential for the propagation of the host.443 Finally, the mitochondria represents the most classic example of the co-
evolution of pathogen and host. From the invasion of a proteobacterium-like ancestor
with oxidative capabilities followed by the genome reduction of the bacterium and its
subsequent dependence on the host arise the mitochondria and chloroplast organelles that
define eukaryotes today.444 Perhaps 40 million years from now we will see that CMV and
MHV68 are no longer considered pathogens but rather virus like genetic elements that
aid in the regulation of the immune system.
Eukaryotic life is thought to have originated about 2.5 billion years ago (2.5 bya).
Components of the innate immune system are thought to have arisen approximately 1.5
202
bya with protists and single celled organisms and that of the adaptive 500 million years
ago (mya) with the diversification of jawless fishes. One of the events that is hypothesized to be essential for the rise of the adaptive immune system is the invasion of
an immunoglobulin like gene by a transposable element.445 This then facilitates
recombination which generates the diversity that today characterizes the antibody and T
cell receptor genes. The recombination activating genes (RAG) which are responsible for
recombination have functional and genetic similarities to transposons, retroviruses and
recombinases from bacteria and phages.446, 447 It would be ironic if viral or bacterial
elements 500 mya somehow evolved within the host to become the essential
recombination component of the adaptive immune system that fights off infections today.
203
BIBLIOGRAPHY
1. Janeway, C. A., Jr. & Medzhitov, R. Innate immune recognition. Annu Rev Immunol 20, 197-216 (2002). 2. Biron, C. A. & Sen, G. in Fields' virology (eds. Knipe, D. M. & Howley, P. M.) 249-278 (Wolters Kluwer Health/Lippincott Williams & Wilkins, Philadelphia, 2007). 3. Chen, G., Zhuchenko, O. & Kuspa, A. Immune-like phagocyte activity in the social amoeba. Science 317, 678-81 (2007). 4. Doherty, P. C. & Turner, S. J. The challenge of viral immunity. Immunity 27, 363-5 (2007). 5. Medzhitov, R. Recognition of microorganisms and activation of the immune response. Nature 449, 819-26 (2007). 6. Akira, S. & Takeda, K. Toll-like receptor signalling. Nat Rev Immunol 4, 499- 511 (2004). 7. Boehme, K. W., Singh, J., Perry, S. T. & Compton, T. Human cytomegalovirus elicits a coordinated cellular antiviral response via envelope glycoprotein B. J Virol 78, 1202-11 (2004). 8. Rassa, J. C., Meyers, J. L., Zhang, Y., Kudaravalli, R. & Ross, S. R. Murine retroviruses activate B cells via interaction with toll-like receptor 4. Proc Natl Acad Sci U S A 99, 2281-6 (2002). 9. Bieback, K. et al. Hemagglutinin protein of wild-type measles virus activates toll- like receptor 2 signaling. J Virol 76, 8729-36 (2002). 10. Kono, H. & Rock, K. L. How dying cells alert the immune system to danger. Nat Rev Immunol 8, 279-89 (2008). 11. Medzhitov, R., Preston-Hurlburt, P. & Janeway, C. A., Jr. A human homologue of the Drosophila Toll protein signals activation of adaptive immunity. Nature 388, 394-7 (1997). 12. Rock, F. L., Hardiman, G., Timans, J. C., Kastelein, R. A. & Bazan, J. F. A family of human receptors structurally related to Drosophila Toll. Proc Natl Acad Sci U S A 95, 588-93 (1998). 13. Akira, S., Uematsu, S. & Takeuchi, O. Pathogen recognition and innate immunity. Cell 124, 783-801 (2006). 14. Muruve, D. A. et al. The inflammasome recognizes cytosolic microbial and host DNA and triggers an innate immune response. Nature 452, 103-7 (2008). 15. Kang, D. C. et al. mda-5: An interferon-inducible putative RNA helicase with double-stranded RNA-dependent ATPase activity and melanoma growth- suppressive properties. Proc Natl Acad Sci U S A 99, 637-42 (2002). 16. Yoneyama, M. et al. Shared and unique functions of the DExD/H-box helicases RIG-I, MDA5, and LGP2 in antiviral innate immunity. J Immunol 175, 2851-8 (2005). 17. Yoneyama, M. et al. The RNA helicase RIG-I has an essential function in double- stranded RNA-induced innate antiviral responses. Nat Immunol 5, 730-7 (2004). 18. Brown, G. D. & Gordon, S. Immune recognition. A new receptor for beta- glucans. Nature 413, 36-7 (2001). 19. Takaoka, A. et al. DAI (DLM-1/ZBP1) is a cytosolic DNA sensor and an activator of innate immune response. Nature 448, 501-5 (2007). 204
20. O'Neill, L. A. in Innate Immunity: Signaling Mechanisms (eds. O'Neill, L. A., Tschopp, J. & Akira, S.) (Keystone, Colerado, 2008). 21. Iwasaki, A. & Medzhitov, R. Toll-like receptor control of the adaptive immune responses. Nat Immunol 5, 987-95 (2004). 22. Sharif-Askari, E. et al. Bax-dependent mitochondrial membrane permeabilization enhances IRF3-mediated innate immune response during VSV infection. Virology 365, 20-33 (2007). 23. Peters, K., Chattopadhyay, S. & Sen, G. C. IRF-3 activation by Sendai virus infection is required for cellular apoptosis and avoidance of persistence. J Virol 82, 3500-8 (2008). 24. Geiss, G. et al. A comprehensive view of regulation of gene expression by double-stranded RNA-mediated cell signaling. J Biol Chem 276, 30178-82 (2001). 25. Der, S. D., Zhou, A., Williams, B. R. & Silverman, R. H. Identification of genes differentially regulated by interferon alpha, beta, or gamma using oligonucleotide arrays. Proc Natl Acad Sci U S A 95, 15623-8 (1998). 26. Jacobs, B. L. & Langland, J. O. When two strands are better than one: the mediators and modulators of the cellular responses to double-stranded RNA. Virology 219, 339-49 (1996). 27. Kariko, K., Buckstein, M., Ni, H. & Weissman, D. Suppression of RNA recognition by Toll-like receptors: the impact of nucleoside modification and the evolutionary origin of RNA. Immunity 23, 165-75 (2005). 28. Kariko, K., Ni, H., Capodici, J., Lamphier, M. & Weissman, D. mRNA is an endogenous ligand for Toll-like receptor 3. J Biol Chem 279, 12542-50 (2004). 29. Patel, R. C. & Sen, G. C. PACT, a protein activator of the interferon-induced protein kinase, PKR. Embo J 17, 4379-90 (1998). 30. Samuel, C. E. Antiviral actions of interferons. Clin Microbiol Rev 14, 778-809, table of contents (2001). 31. Kumar, A., Haque, J., Lacoste, J., Hiscott, J. & Williams, B. R. Double-stranded RNA-dependent protein kinase activates transcription factor NF-kappa B by phosphorylating I kappa B. Proc Natl Acad Sci U S A 91, 6288-92 (1994). 32. Malathi, K., Dong, B., Gale, M., Jr. & Silverman, R. H. Small self-RNA generated by RNase L amplifies antiviral innate immunity. Nature 448, 816-9 (2007). 33. Baccala, R., Hoebe, K., Kono, D. H., Beutler, B. & Theofilopoulos, A. N. TLR- dependent and TLR-independent pathways of type I interferon induction in systemic autoimmunity. Nat Med 13, 543-51 (2007). 34. Matsumoto, M., Funami, K., Oshiumi, H. & Seya, T. Toll-like receptor 3: a link between toll-like receptor, interferon and viruses. Microbiol Immunol 48, 147-54 (2004). 35. Johnsen, I. B. et al. Toll-like receptor 3 associates with c-Src tyrosine kinase on endosomes to initiate antiviral signaling. Embo J 25, 3335-46 (2006). 36. Choe, J., Kelker, M. S. & Wilson, I. A. Crystal structure of human toll-like receptor 3 (TLR3) ectodomain. Science 309, 581-5 (2005).
205
37. Kim, Y. M., Brinkmann, M. M., Paquet, M. E. & Ploegh, H. L. UNC93B1 delivers nucleotide-sensing toll-like receptors to endolysosomes. Nature 452, 234- 8 (2008). 38. Matsumoto, M. et al. Subcellular localization of Toll-like receptor 3 in human dendritic cells. J Immunol 171, 3154-62 (2003). 39. Tabeta, K. et al. The Unc93b1 mutation 3d disrupts exogenous antigen presentation and signaling via Toll-like receptors 3, 7 and 9. Nat Immunol 7, 156- 64 (2006). 40. Leonard, J. N. et al. The TLR3 signaling complex forms by cooperative receptor dimerization. Proc Natl Acad Sci U S A 105, 258-63 (2008). 41. Huang, Q. et al. The plasticity of dendritic cell responses to pathogens and their components. Science 294, 870-5 (2001). 42. Kleinman, M. E. et al. Sequence- and target-independent angiogenesis suppression by siRNA via TLR3. Nature (2008). 43. Marshall-Clarke, S. et al. Polyinosinic acid is a ligand for toll-like receptor 3. J Biol Chem 282, 24759-66 (2007). 44. Lee, H. K., Dunzendorfer, S., Soldau, K. & Tobias, P. S. Double-stranded RNA- mediated TLR3 activation is enhanced by CD14. Immunity 24, 153-63 (2006). 45. Hoebe, K. et al. Identification of Lps2 as a key transducer of MyD88-independent TIR signalling. Nature 424, 743-8 (2003). 46. Funami, K. et al. Spatiotemporal mobilization of Toll/IL-1 receptor domain- containing adaptor molecule-1 in response to dsRNA. J Immunol 179, 6867-72 (2007). 47. Meylan, E. et al. RIP1 is an essential mediator of Toll-like receptor 3-induced NF- kappa B activation. Nat Immunol 5, 503-7 (2004). 48. Cusson-Hermance, N., Khurana, S., Lee, T. H., Fitzgerald, K. A. & Kelliher, M. A. Rip1 mediates the Trif-dependent toll-like receptor 3- and 4-induced NF- {kappa}B activation but does not contribute to interferon regulatory factor 3 activation. J Biol Chem 280, 36560-6 (2005). 49. Hayden, M. S. & Ghosh, S. Shared principles in NF-kappaB signaling. Cell 132, 344-62 (2008). 50. Carmody, R. J. & Chen, Y. H. Nuclear factor-kappaB: activation and regulation during toll-like receptor signaling. Cell Mol Immunol 4, 31-41 (2007). 51. Oganesyan, G. et al. Critical role of TRAF3 in the Toll-like receptor-dependent and -independent antiviral response. Nature 439, 208-11 (2006). 52. Fujita, F. et al. Identification of NAP1, a regulatory subunit of IkappaB kinase- related kinases that potentiates NF-kappaB signaling. Mol Cell Biol 23, 7780-93 (2003). 53. Ikeda, F. et al. Involvement of the ubiquitin-like domain of TBK1/IKK-i kinases in regulation of IFN-inducible genes. Embo J 26, 3451-62 (2007). 54. Guo, B. & Cheng, G. Modulation of the interferon antiviral response by the TBK1/IKKi adaptor protein TANK. J Biol Chem 282, 11817-26 (2007). 55. Sasai, M. et al. Cutting Edge: NF-kappaB-activating kinase-associated protein 1 participates in TLR3/Toll-IL-1 homology domain-containing adapter molecule-1- mediated IFN regulatory factor 3 activation. J Immunol 174, 27-30 (2005).
206
56. Ryzhakov, G. & Randow, F. SINTBAD, a novel component of innate antiviral immunity, shares a TBK1-binding domain with NAP1 and TANK. Embo J 26, 3180-90 (2007). 57. Obata, Y. et al. Role of cyclophilin B in activation of interferon regulatory factor- 3. J Biol Chem 280, 18355-60 (2005). 58. Panne, D., McWhirter, S. M., Maniatis, T. & Harrison, S. C. Interferon regulatory factor 3 is regulated by a dual phosphorylation-dependent switch. J Biol Chem 282, 22816-22 (2007). 59. Sarkar, S. N. et al. Novel roles of TLR3 tyrosine phosphorylation and PI3 kinase in double-stranded RNA signaling. Nat Struct Mol Biol 11, 1060-7 (2004). 60. Nusinzon, I. & Horvath, C. M. Positive and negative regulation of the innate antiviral response and beta interferon gene expression by deacetylation. Mol Cell Biol 26, 3106-13 (2006). 61. Johnson, J. et al. Protein kinase Calpha is involved in interferon regulatory factor 3 activation and type I interferon-beta synthesis. J Biol Chem 282, 15022-32 (2007). 62. Reily, M. M., Pantoja, C., Hu, X., Chinenov, Y. & Rogatsky, I. The GRIP1:IRF3 interaction as a target for glucocorticoid receptor-mediated immunosuppression. Embo J 25, 108-17 (2006). 63. Alexopoulou, L., Holt, A. C., Medzhitov, R. & Flavell, R. A. Recognition of double-stranded RNA and activation of NF-kappaB by Toll-like receptor 3. Nature 413, 732-8 (2001). 64. Muzio, M. et al. Differential expression and regulation of toll-like receptors (TLR) in human leukocytes: selective expression of TLR3 in dendritic cells. J Immunol 164, 5998-6004 (2000). 65. Vercammen, E., Staal, J. & Beyaert, R. Sensing of viral infection and activation of innate immunity by toll-like receptor 3. Clin Microbiol Rev 21, 13-25 (2008). 66. Guillot, L. et al. Involvement of toll-like receptor 3 in the immune response of lung epithelial cells to double-stranded RNA and influenza A virus. J Biol Chem 280, 5571-80 (2005). 67. Le Goffic, R. et al. Cutting Edge: Influenza A virus activates TLR3-dependent inflammatory and RIG-I-dependent antiviral responses in human lung epithelial cells. J Immunol 178, 3368-72 (2007). 68. Groskreutz, D. J. et al. Respiratory syncytial virus induces TLR3 protein and protein kinase R, leading to increased double-stranded RNA responsiveness in airway epithelial cells. J Immunol 176, 1733-40 (2006). 69. Sanghavi, S. K. & Reinhart, T. A. Increased expression of TLR3 in lymph nodes during simian immunodeficiency virus infection: implications for inflammation and immunodeficiency. J Immunol 175, 5314-23 (2005). 70. Tanabe, M. et al. Mechanism of up-regulation of human Toll-like receptor 3 secondary to infection of measles virus-attenuated strains. Biochem Biophys Res Commun 311, 39-48 (2003). 71. Hewson, C. A., Jardine, A., Edwards, M. R., Laza-Stanca, V. & Johnston, S. L. Toll-like receptor 3 is induced by and mediates antiviral activity against rhinovirus infection of human bronchial epithelial cells. J Virol 79, 12273-9 (2005).
207
72. Wornle, M. et al. Novel role of toll-like receptor 3 in hepatitis C-associated glomerulonephritis. Am J Pathol 168, 370-85 (2006). 73. Kawai, T. & Akira, S. SnapShot: Pattern-recognition receptors. Cell 129, 1024 (2007). 74. So, E. Y., Kang, M. H. & Kim, B. S. Induction of chemokine and cytokine genes in astrocytes following infection with Theiler's murine encephalomyelitis virus is mediated by the Toll-like receptor 3. Glia 53, 858-67 (2006). 75. Herbst-Kralovetz, M. & Pyles, R. Toll-like receptors, innate immunity and HSV pathogenesis. Herpes 13, 37-41 (2006). 76. Naka, K., Dansako, H., Kobayashi, N., Ikeda, M. & Kato, N. Hepatitis C virus NS5B delays cell cycle progression by inducing interferon-beta via Toll-like receptor 3 signaling pathway without replicating viral genomes. Virology 346, 348-62 (2006). 77. Edelmann, K. H. et al. Does Toll-like receptor 3 play a biological role in virus infections? Virology 322, 231-8 (2004). 78. Rudd, B. D. et al. Deletion of TLR3 alters the pulmonary immune environment and mucus production during respiratory syncytial virus infection. J Immunol 176, 1937-42 (2006). 79. Schulz, O. et al. Toll-like receptor 3 promotes cross-priming to virus-infected cells. Nature 433, 887-92 (2005). 80. Hardarson, H. S. et al. Toll-like receptor 3 is an essential component of the innate stress response in virus-induced cardiac injury. Am J Physiol Heart Circ Physiol 292, H251-8 (2007). 81. Tabeta, K. et al. Toll-like receptors 9 and 3 as essential components of innate immune defense against mouse cytomegalovirus infection. Proc Natl Acad Sci U S A 101, 3516-21 (2004). 82. Bsibsi, M. et al. Toll-like receptor 3 on adult human astrocytes triggers production of neuroprotective mediators. Glia 53, 688-95 (2006). 83. Touil, T., Fitzgerald, D., Zhang, G. X., Rostami, A. & Gran, B. Cutting Edge: TLR3 stimulation suppresses experimental autoimmune encephalomyelitis by inducing endogenous IFN-beta. J Immunol 177, 7505-9 (2006). 84. Zhang, S. Y. et al. TLR3 deficiency in patients with herpes simplex encephalitis. Science 317, 1522-7 (2007). 85. Casrouge, A. et al. Herpes simplex virus encephalitis in human UNC-93B deficiency. Science 314, 308-12 (2006). 86. Hidaka, F. et al. A missense mutation of the Toll-like receptor 3 gene in a patient with influenza-associated encephalopathy. Clin Immunol 119, 188-94 (2006). 87. Le Goffic, R. et al. Detrimental contribution of the Toll-like receptor (TLR)3 to influenza A virus-induced acute pneumonia. PLoS Pathog 2, e53 (2006). 88. Wen, L., Peng, J., Li, Z. & Wong, F. S. The effect of innate immunity on autoimmune diabetes and the expression of Toll-like receptors on pancreatic islets. J Immunol 172, 3173-80 (2004). 89. Patole, P. S. et al. Viral double-stranded RNA aggravates lupus nephritis through Toll-like receptor 3 on glomerular mesangial cells and antigen-presenting cells. J Am Soc Nephrol 16, 1326-38 (2005).
208
90. Gowen, B. B. et al. TLR3 deletion limits mortality and disease severity due to Phlebovirus infection. J Immunol 177, 6301-7 (2006). 91. Wang, T. et al. Toll-like receptor 3 mediates West Nile virus entry into the brain causing lethal encephalitis. Nat Med 10, 1366-73 (2004). 92. Ashkar, A. A. et al. Toll-like receptor (TLR)-3, but not TLR4, agonist protects against genital herpes infection in the absence of inflammation seen with CpG DNA. J Infect Dis 190, 1841-9 (2004). 93. Ichinohe, T. et al. Synthetic double-stranded RNA poly(I:C) combined with mucosal vaccine protects against influenza virus infection. J Virol 79, 2910-9 (2005). 94. Zaks, K. et al. Efficient immunization and cross-priming by vaccine adjuvants containing TLR3 or TLR9 agonists complexed to cationic liposomes. J Immunol 176, 7335-45 (2006). 95. Kanzler, H., Barrat, F. J., Hessel, E. M. & Coffman, R. L. Therapeutic targeting of innate immunity with Toll-like receptor agonists and antagonists. Nat Med 13, 552-9 (2007). 96. Takahasi, K. et al. Nonself RNA-sensing mechanism of RIG-I helicase and activation of antiviral immune responses. Mol Cell 29, 428-40 (2008). 97. Gack, M. U. et al. TRIM25 RING-finger E3 ubiquitin ligase is essential for RIG- I-mediated antiviral activity. Nature 446, 916-920 (2007). 98. Li, X. D., Sun, L., Seth, R. B., Pineda, G. & Chen, Z. J. Hepatitis C virus protease NS3/4A cleaves mitochondrial antiviral signaling protein off the mitochondria to evade innate immunity. Proc Natl Acad Sci U S A 102, 17717-22 (2005). 99. Hiscott, J. et al. in Innate Immunity: Signaling Mechanisms (Keystone, Colerado, 2008). 100. Lin, R. et al. Dissociation of a MAVS/IPS-1/VISA/Cardif-IKKepsilon molecular complex from the mitochondrial outer membrane by hepatitis C virus NS3-4A proteolytic cleavage. J Virol 80, 6072-83 (2006). 101. Sasai, M. et al. NAK-associated protein 1 participates in both the TLR3 and the cytoplasmic pathways in type I IFN induction. J Immunol 177, 8676-83 (2006). 102. Zhao, T. et al. The NEMO adaptor bridges the nuclear factor-kappaB and interferon regulatory factor signaling pathways. Nat Immunol 8, 592-600 (2007). 103. Saito, T. et al. Regulation of innate antiviral defenses through a shared repressor domain in RIG-I and LGP2. Proc Natl Acad Sci U S A 104, 582-7 (2007). 104. Kang, D. C. et al. Expression analysis and genomic characterization of human melanoma differentiation associated gene-5, mda-5: a novel type I interferon- responsive apoptosis-inducing gene. Oncogene 23, 1789-800 (2004). 105. Bowie, A. G. & Fitzgerald, K. A. RIG-I: tri-ing to discriminate between self and non-self RNA. Trends Immunol 28, 147-50 (2007). 106. Hornung, V. et al. 5'-Triphosphate RNA is the ligand for RIG-I. Science 314, 994-7 (2006). 107. Pichlmair, A. et al. RIG-I-mediated antiviral responses to single-stranded RNA bearing 5'-phosphates. Science 314, 997-1001 (2006). 108. Kato, H. et al. Differential roles of MDA5 and RIG-I helicases in the recognition of RNA viruses. Nature 441, 101-5 (2006).
209
109. Loo, Y. M. et al. Distinct RIG-I and MDA5 signaling by RNA viruses in innate immunity. J Virol 82, 335-45 (2008). 110. Cheng, G., Zhong, J., Chung, J. & Chisari, F. V. Double-stranded DNA and double-stranded RNA induce a common antiviral signaling pathway in human cells. Proc Natl Acad Sci U S A 104, 9035-40 (2007). 111. Samanta, M., Iwakiri, D., Kanda, T., Imaizumi, T. & Takada, K. EB virus- encoded RNAs are recognized by RIG-I and activate signaling to induce type I IFN. Embo J 25, 4207-14 (2006). 112. Honda, K. & Taniguchi, T. IRFs: master regulators of signalling by Toll-like receptors and cytosolic pattern-recognition receptors. Nat Rev Immunol 6, 644-58 (2006). 113. Lin, R., Mamane, Y. & Hiscott, J. Structural and functional analysis of interferon regulatory factor 3: localization of the transactivation and autoinhibitory domains. Mol Cell Biol 19, 2465-74 (1999). 114. Qin, B. Y. et al. Crystal structure of IRF-3 reveals mechanism of autoinhibition and virus-induced phosphoactivation. Nat Struct Biol 10, 913-21 (2003). 115. Severa, M., Coccia, E. M. & Fitzgerald, K. A. Toll-like receptor-dependent and - independent viperin gene expression and counter-regulation by PRDI-binding factor-1/BLIMP1. J Biol Chem 281, 26188-95 (2006). 116. Tenoever, B. R. et al. Multiple functions of the IKK-related kinase IKKepsilon in interferon-mediated antiviral immunity. Science 315, 1274-8 (2007). 117. Bluyssen, H. A. et al. Structure, chromosome localization, and regulation of expression of the interferon-regulated mouse Ifi54/Ifi56 gene family. Genomics 24, 137-48 (1994). 118. Bluyssen, H. A., Vlietstra, R. J., van der Made, A. & Trapman, J. The interferon- stimulated gene 54 K promoter contains two adjacent functional interferon- stimulated response elements of different strength, which act synergistically for maximal interferon-alpha inducibility. Eur J Biochem 220, 395-402 (1994). 119. Wathelet, M. G., Clauss, I. M., Nols, C. B., Content, J. & Huez, G. A. New inducers revealed by the promoter sequence analysis of two interferon-activated human genes. Eur J Biochem 169, 313-21 (1987). 120. Wathelet, M. G., Clauss, I. M., Content, J. & Huez, G. A. The IFI-56K and IFI- 54K interferon-inducible human genes belong to the same gene family. FEBS Lett 231, 164-71 (1988). 121. Chebath, J., Merlin, G., Metz, R., Benech, P. & Revel, M. Interferon-induced 56,000 Mr protein and its mRNA in human cells: molecular cloning and partial sequence of the cDNA. Nucleic Acids Res 11, 1213-26 (1983). 122. Larner, A. C. et al. Transcriptional induction of two genes in human cells by beta interferon. Proc Natl Acad Sci U S A 81, 6733-7 (1984). 123. Guo, J., Peters, K. L. & Sen, G. C. Induction of the human protein P56 by interferon, double-stranded RNA, or virus infection. Virology 267, 209-19 (2000). 124. Peters, K. L., Smith, H. L., Stark, G. R. & Sen, G. C. IRF-3-dependent, NFkappa B- and JNK-independent activation of the 561 and IFN-beta genes in response to double-stranded RNA. Proc Natl Acad Sci U S A 99, 6322-7 (2002).
210
125. Terenzi, F., Hui, D. J., Merrick, W. C. & Sen, G. C. Distinct induction patterns and functions of two closely related interferon-inducible human genes, ISG54 and ISG56. J Biol Chem 281, 34064-71 (2006). 126. Terenzi, F., Pal, S. & Sen, G. C. Induction and mode of action of the viral stress- inducible murine proteins, P56 and P54. Virology 340, 116-24 (2005). 127. Ovstebo, R. et al. Identification of particularly lipopolysaccharide sensitive genes in human monocytes induced by wild type versus LPS-deficient Neisseria meningitidis. Infect Immun (2008). 128. Levy, D., Larner, A., Chaudhuri, A., Babiss, L. E. & Darnell, J. E., Jr. Interferon- stimulated transcription: isolation of an inducible gene and identification of its regulatory region. Proc Natl Acad Sci U S A 83, 8929-33 (1986). 129. Kim, S., Choi, Y., Bazer, F. W. & Spencer, T. E. Identification of genes in the ovine endometrium regulated by interferon tau independent of signal transducer and activator of transcription 1. Endocrinology 144, 5203-14 (2003). 130. Gray, C. A. et al. Identification of endometrial genes regulated by early pregnancy, progesterone, and interferon tau in the ovine uterus. Biol Reprod 74, 383-94 (2006). 131. Lafage, M. et al. The interferon- and virus-inducible IFI-56K and IFI-54K genes are located on human chromosome 10 at bands q23-q24. Genomics 13, 458-60 (1992). 132. Hui, D. J., Terenzi, F., Merrick, W. C. & Sen, G. C. Mouse p56 blocks a distinct function of eukaryotic initiation factor 3 in translation initiation. J Biol Chem 280, 3433-40 (2005). 133. Guo, J., Hui, D. J., Merrick, W. C. & Sen, G. C. A new pathway of translational regulation mediated by eukaryotic initiation factor 3. Embo J 19, 6891-9 (2000). 134. Sarkar, S. N. & Sen, G. C. Novel functions of proteins encoded by viral stress- inducible genes. Pharmacol Ther 103, 245-59 (2004). 135. Kash, J. C. et al. Genomic analysis of increased host immune and cell death responses induced by 1918 influenza virus. Nature 443, 578-81 (2006). 136. Liew, F. Y., Xu, D., Brint, E. K. & O'Neill, L. A. Negative regulation of toll-like receptor-mediated immune responses. Nat Rev Immunol 5, 446-58 (2005). 137. Diao, F. et al. Negative regulation of MDA5- but not RIG-I-mediated innate antiviral signaling by the dihydroxyacetone kinase. Proc Natl Acad Sci U S A 104, 11706-11 (2007). 138. Carty, M. et al. The human adaptor SARM negatively regulates adaptor protein TRIF-dependent Toll-like receptor signaling. Nat Immunol 7, 1074-81 (2006). 139. Moore, C. B. et al. NLRX1 is a regulator of mitochondrial antiviral immunity. Nature 451, 573-7 (2008). 140. Arimoto, K. et al. Negative regulation of the RIG-I signaling by the ubiquitin ligase RNF125. Proc Natl Acad Sci U S A 104, 7500-5 (2007). 141. Kayagaki, N. et al. DUBA: a deubiquitinase that regulates type I interferon production. Science 318, 1628-32 (2007). 142. Huang, J. et al. SIKE is an IKK epsilon/TBK1-associated suppressor of TLR3- and virus-triggered IRF-3 activation pathways. Embo J 24, 4018-28 (2005).
211
143. An, H. et al. SHP-2 phosphatase negatively regulates the TRIF adaptor protein- dependent type I interferon and proinflammatory cytokine production. Immunity 25, 919-28 (2006). 144. Zha, J. et al. The Ret finger protein inhibits signaling mediated by the noncanonical and canonical IkappaB kinase family members. J Immunol 176, 1072-80 (2006). 145. Saitoh, T. et al. A20 is a negative regulator of IFN regulatory factor 3 signaling. J Immunol 174, 1507-12 (2005). 146. Boone, D. L. et al. The ubiquitin-modifying enzyme A20 is required for termination of Toll-like receptor responses. Nat Immunol 5, 1052-60 (2004). 147. Wertz, I. E. et al. De-ubiquitination and ubiquitin ligase domains of A20 downregulate NF-kappaB signalling. Nature 430, 694-9 (2004). 148. Saitoh, T. et al. Negative regulation of interferon-regulatory factor 3-dependent innate antiviral response by the prolyl isomerase Pin1. Nat Immunol 7, 598-605 (2006). 149. Diehl, G. E. et al. TRAIL-R as a negative regulator of innate immune cell responses. Immunity 21, 877-89 (2004). 150. Pahl, H. L. Activators and target genes of Rel/NF-kappaB transcription factors. Oncogene 18, 6853-66 (1999). 151. Bour, S., Perrin, C., Akari, H. & Strebel, K. The human immunodeficiency virus type 1 Vpu protein inhibits NF-kappa B activation by interfering with beta TrCP- mediated degradation of Ikappa B. J Biol Chem 276, 15920-8 (2001). 152. Oie, K. L. & Pickup, D. J. Cowpox virus and other members of the orthopoxvirus genus interfere with the regulation of NF-kappaB activation. Virology 288, 175- 87 (2001). 153. Bode, J. G. et al. IFN-alpha antagonistic activity of HCV core protein involves induction of suppressor of cytokine signaling-3. Faseb J 17, 488-90 (2003). 154. Yokota, S. et al. Induction of suppressor of cytokine signaling-3 by herpes simplex virus type 1 contributes to inhibition of the interferon signaling pathway. J Virol 78, 6282-6 (2004). 155. Coscoy, L. Immune evasion by Kaposi's sarcoma-associated herpesvirus. Nat Rev Immunol 7, 391-401 (2007). 156. Bowie, A. et al. A46R and A52R from vaccinia virus are antagonists of host IL-1 and toll-like receptor signaling. Proc Natl Acad Sci U S A 97, 10162-7 (2000). 157. Stack, J. et al. Vaccinia virus protein A46R targets multiple Toll-like-interleukin- 1 receptor adaptors and contributes to virulence. J Exp Med 201, 1007-18 (2005). 158. Alcami, A. & Smith, G. L. Cytokine receptors encoded by poxviruses: a lesson in cytokine biology. Immunol Today 16, 474-8 (1995). 159. Wang, D., Bresnahan, W. & Shenk, T. Human cytomegalovirus encodes a highly specific RANTES decoy receptor. Proc Natl Acad Sci U S A 101, 16642-7 (2004). 160. Mocarski, E. S., Jr. Immunomodulation by cytomegaloviruses: manipulative strategies beyond evasion. Trends Microbiol 10, 332-9 (2002). 161. Garcia-Sastre, A. Identification and characterization of viral antagonists of type I interferon in negative-strand RNA viruses. Curr Top Microbiol Immunol 283, 249-80 (2004).
212
162. DiPerna, G. et al. Poxvirus Protein N1L Targets the I-{kappa}B Kinase Complex, Inhibits Signaling to NF-{kappa}B by the Tumor Necrosis Factor Superfamily of Receptors, and Inhibits NF-{kappa}B and IRF3 Signaling by Toll-like Receptors. J Biol Chem 279, 36570-36578 (2004). 163. Brzozka, K., Finke, S. & Conzelmann, K. K. Identification of the rabies virus alpha/beta interferon antagonist: phosphoprotein P interferes with phosphorylation of interferon regulatory factor 3. J Virol 79, 7673-81 (2005). 164. Basler, C. F. et al. The Ebola virus VP35 protein inhibits activation of interferon regulatory factor 3. J Virol 77, 7945-56 (2003). 165. Unterstab, G. et al. Viral targeting of the interferon-{beta}-inducing Traf family member-associated NF-{kappa}B activator (TANK)-binding kinase-1. Proc Natl Acad Sci U S A 102, 13640-5 (2005). 166. Devaraj, S. G. et al. Regulation of IRF-3-dependent innate immunity by the papain-like protease domain of the severe acute respiratory syndrome coronavirus. J Biol Chem 282, 32208-21 (2007). 167. Zhu, F. X., King, S. M., Smith, E. J., Levy, D. E. & Yuan, Y. A Kaposi's sarcoma-associated herpesviral protein inhibits virus-mediated induction of type I interferon by blocking IRF-7 phosphorylation and nuclear accumulation. Proc Natl Acad Sci U S A 99, 5573-8 (2002). 168. Ronco, L. V., Karpova, A. Y., Vidal, M. & Howley, P. M. Human papillomavirus 16 E6 oncoprotein binds to interferon regulatory factor-3 and inhibits its transcriptional activity. Genes Dev 12, 2061-72 (1998). 169. Hahn, A. M., Huye, L. E., Ning, S., Webster-Cyriaque, J. & Pagano, J. S. Interferon Regulatory Factor 7 Is Negatively Regulated by the Epstein-Barr Virus Immediate-Early Gene, BZLF-1. J. Virol. 79, 10040-10052 (2005). 170. La Rocca, S. A. et al. Loss of interferon regulatory factor 3 in cells infected with classical swine fever virus involves the N-terminal protease, Npro. J Virol 79, 7239-47 (2005). 171. Barro, M. & Patton, J. T. Rotavirus NSP1 inhibits expression of type I interferon by antagonizing the function of interferon regulatory factors IRF3, IRF5, and IRF7. J Virol 81, 4473-81 (2007). 172. Yu, Y., Wang, S. E. & Hayward, G. S. The KSHV immediate-early transcription factor RTA encodes ubiquitin E3 ligase activity that targets IRF7 for proteosome- mediated degradation. Immunity 22, 59-70 (2005). 173. de Los Santos, T., Diaz-San Segundo, F. & Grubman, M. J. Degradation of nuclear factor kappa B during foot-and-mouth disease virus infection. J Virol 81, 12803-15 (2007). 174. Revilla, Y. et al. Inhibition of nuclear factor kappaB activation by a virus-encoded IkappaB-like protein. J Biol Chem 273, 5405-11 (1998). 175. Roy, C. R. & Mocarski, E. S. Pathogen subversion of cell-intrinsic innate immunity. Nat Immunol 8, 1179-87 (2007). 176. Lu, Y., Wambach, M., Katze, M. G. & Krug, R. M. Binding of the influenza virus NS1 protein to double-stranded RNA inhibits the activation of the protein kinase that phosphorylates the elF-2 translation initiation factor. Virology 214, 222-8 (1995).
213
177. Lee, T. G., Tomita, J., Hovanessian, A. G. & Katze, M. G. Purification and partial characterization of a cellular inhibitor of the interferon-induced protein kinase of Mr 68,000 from influenza virus-infected cells. Proc Natl Acad Sci U S A 87, 6208-12 (1990). 178. Mibayashi, M. et al. Inhibition of retinoic acid-inducible gene I-mediated induction of beta interferon by the NS1 protein of influenza A virus. J Virol 81, 514-24 (2007). 179. Satterly, N. et al. Influenza virus targets the mRNA export machinery and the nuclear pore complex. Proc Natl Acad Sci U S A 104, 1853-8 (2007). 180. Li, K. et al. Immune evasion by hepatitis C virus NS3/4A protease-mediated cleavage of the Toll-like receptor 3 adaptor protein TRIF. Proc Natl Acad Sci U S A 102, 2992-7 (2005). 181. Loo, Y. M. et al. Viral and therapeutic control of IFN-beta promoter stimulator 1 during hepatitis C virus infection. Proc Natl Acad Sci U S A 103, 6001-6 (2006). 182. Cardenas, W. B. et al. Ebola virus VP35 protein binds double-stranded RNA and inhibits alpha/beta interferon production induced by RIG-I signaling. J Virol 80, 5168-78 (2006). 183. He, B. et al. Recovery of paramyxovirus simian virus 5 with a V protein lacking the conserved cysteine-rich domain: the multifunctional V protein blocks both interferon-beta induction and interferon signaling. Virology 303, 15-32 (2002). 184. Paterson, R. G. & Lamb, R. A. in Molecular virology: a practical approach (eds. Davison, A. J. & Elliott, R. M.) xxii, 315 p. (IRL Press, Oxford ; New York, 1993). 185. Parisien, J. P., Lau, J. F., Rodriguez, J. J., Ulane, C. M. & Horvath, C. M. Selective STAT protein degradation induced by paramyxoviruses requires both STAT1 and STAT2 but is independent of alpha/beta interferon signal transduction. J Virol 76, 4190-8 (2002). 186. Sarkar, S. N., Smith, H. L., Rowe, T. M. & Sen, G. C. Double-stranded RNA signaling by Toll-like receptor 3 requires specific tyrosine residues in its cytoplasmic domain. J Biol Chem 278, 4393-6 (2003). 187. Li, X. et al. Mutant cells that do not respond to interleukin-1 (IL-1) reveal a novel role for IL-1 receptor-associated kinase. Mol Cell Biol 19, 4643-52 (1999). 188. Rodriguez, J. J., Wang, L. F. & Horvath, C. M. Hendra virus V protein inhibits interferon signaling by preventing STAT1 and STAT2 nuclear accumulation. J Virol 77, 11842-5 (2003). 189. Ulane, C. M. et al. Composition and assembly of STAT-targeting ubiquitin ligase complexes: paramyxovirus V protein carboxyl terminus is an oligomerization domain. J Virol 79, 10180-9 (2005). 190. Fitzgerald, K. A. et al. IKKepsilon and TBK1 are essential components of the IRF3 signaling pathway. Nat Immunol 4, 491-6 (2003). 191. Chariot, A. et al. Association of the adaptor TANK with the I kappa B kinase (IKK) regulator NEMO connects IKK complexes with IKK epsilon and TBK1 kinases. J Biol Chem 277, 37029-36 (2002). 192. Lin, R., Heylbroeck, C., Pitha, P. M. & Hiscott, J. Virus-dependent phosphorylation of the IRF-3 transcription factor regulates nuclear translocation,
214
transactivation potential, and proteasome-mediated degradation. Mol Cell Biol 18, 2986-96 (1998). 193. Elco, C. P. in MSTP / Molecular Virology Program 207 (Case Western Reserve University, Cleveland, 2006). 194. Kumar, K. G., Krolewski, J. J. & Fuchs, S. Y. Phosphorylation and specific ubiquitin acceptor sites are required for ubiquitination and degradation of the IFNAR1 subunit of type I interferon receptor. J Biol Chem 279, 46614-20 (2004). 195. Navarro, L. & David, M. p38-dependent activation of interferon regulatory factor 3 by lipopolysaccharide. J Biol Chem 274, 35535-8 (1999). 196. Guo, J. & Sen, G. C. Characterization of the interaction between the interferon- induced protein P56 and the Int6 protein encoded by a locus of insertion of the mouse mammary tumor virus. J Virol 74, 1892-9 (2000). 197. Patel, R. C. et al. DRBP76, a double-stranded RNA-binding nuclear protein, is phosphorylated by the interferon-induced protein kinase, PKR. J Biol Chem 274, 20432-7 (1999). 198. tenOever, B. R. et al. Activation of TBK1 and IKKvarepsilon kinases by vesicular stomatitis virus infection and the role of viral ribonucleoprotein in the development of interferon antiviral immunity. J Virol 78, 10636-49 (2004). 199. Bandyopadhyay, S. K., Leonard, G. T., Jr., Bandyopadhyay, T., Stark, G. R. & Sen, G. C. Transcriptional induction by double-stranded RNA is mediated by interferon-stimulated response elements without activation of interferon- stimulated gene factor 3. J Biol Chem 270, 19624-9 (1995). 200. Tiwari, R. K., Kusari, J. & Sen, G. C. Functional equivalents of interferon- mediated signals needed for induction of an mRNA can be generated by double- stranded RNA and growth factors. Embo J 6, 3373-8 (1987). 201. Wacher, C. et al. Coordinated regulation and widespread cellular expression of interferon-stimulated genes (ISG) ISG-49, ISG-54, and ISG-56 in the central nervous system after infection with distinct viruses. J Virol 81, 860-71 (2007). 202. Daffis, S., Samuel, M. A., Keller, B. C., Gale, M., Jr. & Diamond, M. S. Cell- specific IRF-3 responses protect against West Nile virus infection by interferon- dependent and -independent mechanisms. PLoS Pathog 3, e106 (2007). 203. Terenzi, F., White, C., Pal, S., Williams, B. R. & Sen, G. C. Tissue-specific and inducer-specific differential induction of ISG56 and ISG54 in mice. J Virol 81, 8656-65 (2007). 204. Verma, S. et al. JC virus induces altered patterns of cellular gene expression: interferon-inducible genes as major transcriptional targets. Virology 345, 457-67 (2006). 205. Dorn, A. et al. Identification of specific cellular genes up-regulated late in adenovirus type 12 infection. J Virol 79, 2404-12 (2005). 206. Cervantes-Barragan, L. et al. Control of coronavirus infection through plasmacytoid dendritic-cell-derived type I interferon. Blood 109, 1131-7 (2007). 207. Su, A. I. et al. Genomic analysis of the host response to hepatitis C virus infection. Proc Natl Acad Sci U S A 99, 15669-74 (2002). 208. Kanda, T., Steele, R., Ray, R. & Ray, R. B. Hepatitis C virus infection induces the beta interferon signaling pathway in immortalized human hepatocytes. J Virol 81, 12375-81 (2007).
215
209. Chang, K. S. et al. Replication of hepatitis C virus (HCV) RNA in mouse embryonic fibroblasts: protein kinase R (PKR)-dependent and PKR-independent mechanisms for controlling HCV RNA replication and mediating interferon activities. J Virol 80, 7364-74 (2006). 210. Wang, C. et al. Alpha interferon induces distinct translational control programs to suppress hepatitis C virus RNA replication. J Virol 77, 3898-912 (2003). 211. Sumpter, R., Jr., Wang, C., Foy, E., Loo, Y. M. & Gale, M., Jr. Viral evolution and interferon resistance of hepatitis C virus RNA replication in a cell culture model. J Virol 78, 11591-604 (2004). 212. Foy, E. et al. Control of antiviral defenses through hepatitis C virus disruption of retinoic acid-inducible gene-I signaling. Proc Natl Acad Sci U S A 102, 2986-91 (2005). 213. Terenzi, F. (2008). 214. Nagy, A. Cre recombinase: the universal reagent for genome tailoring. Genesis 26, 99-109 (2000). 215. Rodriguez, C. I. et al. High-efficiency deleter mice show that FLPe is an alternative to Cre-loxP. Nat Genet 25, 139-40 (2000). 216. Gossen, J. A., de Leeuw, W. J. & Vijg, J. LacZ transgenic mouse models: their application in genetic toxicology. Mutat Res 307, 451-9 (1994). 217. Elco, C. P. (2008). 218. Browne, E. P., Wing, B., Coleman, D. & Shenk, T. Altered cellular mRNA levels in human cytomegalovirus-infected fibroblasts: viral block to the accumulation of antiviral mRNAs. J Virol 75, 12319-30 (2001). 219. Kunz, S. et al. Altered central nervous system gene expression caused by congenitally acquired persistent infection with lymphocytic choriomeningitis virus. J Virol 80, 9082-92 (2006). 220. Nielsen, J. A., Maric, D., Lau, P., Barker, J. L. & Hudson, L. D. Identification of a novel oligodendrocyte cell adhesion protein using gene expression profiling. J Neurosci 26, 9881-91 (2006). 221. Hoshino, K., Kaisho, T., Iwabe, T., Takeuchi, O. & Akira, S. Differential involvement of IFN-beta in Toll-like receptor-stimulated dendritic cell activation. Int Immunol 14, 1225-31 (2002). 222. Hua, J., Kirou, K., Lee, C. & Crow, M. K. Functional assay of type I interferon in systemic lupus erythematosus plasma and association with anti-RNA binding protein autoantibodies. Arthritis Rheum 54, 1906-16 (2006). 223. Pellagatti, A. et al. Gene expression profiles of CD34+ cells in myelodysplastic syndromes: involvement of interferon-stimulated genes and correlation to FAB subtype and karyotype. Blood 108, 337-45 (2006). 224. Urosevic, M. et al. Disease-independent skin recruitment and activation of plasmacytoid predendritic cells following imiquimod treatment. J Natl Cancer Inst 97, 1143-53 (2005). 225. Barrett, T. et al. NCBI GEO: mining tens of millions of expression profiles-- database and tools update. Nucleic Acids Res 35, D760-5 (2007). 226. Talbi, S. et al. Molecular phenotyping of human endometrium distinguishes menstrual cycle phases and underlying biological processes in normo-ovulatory women. Endocrinology 147, 1097-121 (2006).
216
227. Takahasi, K. et al. X-ray crystal structure of IRF-3 and its functional implications. Nat Struct Biol 10, 922-7 (2003). 228. Sato, M. et al. Distinct and essential roles of transcription factors IRF-3 and IRF-7 in response to viruses for IFN-alpha/beta gene induction. Immunity 13, 539-48 (2000). 229. Kumar, K. P., McBride, K. M., Weaver, B. K., Dingwall, C. & Reich, N. C. Regulated nuclear-cytoplasmic localization of interferon regulatory factor 3, a subunit of double-stranded RNA-activated factor 1. Mol Cell Biol 20, 4159-68 (2000). 230. Weaver, B. K., Kumar, K. P. & Reich, N. C. Interferon regulatory factor 3 and CREB-binding protein/p300 are subunits of double-stranded RNA-activated transcription factor DRAF1. Mol Cell Biol 18, 1359-68 (1998). 231. Elco, C. P., Guenther, J. M., Williams, B. R. & Sen, G. C. Analysis of genes induced by Sendai virus infection of mutant cell lines reveals essential roles of interferon regulatory factor 3, NF-kappaB, and interferon but not toll-like receptor 3. J Virol 79, 3920-9 (2005). 232. Yoneyama, M. et al. Direct triggering of the type I interferon system by virus infection: activation of a transcription factor complex containing IRF-3 and CBP/p300. Embo J 17, 1087-95 (1998). 233. Holm, G. H. et al. Retinoic acid-inducible gene-I and interferon-beta promoter stimulator-1 augment proapoptotic responses following mammalian reovirus infection via interferon regulatory factor-3. J Biol Chem 282, 21953-61 (2007). 234. tenOever, B. R., Servant, M. J., Grandvaux, N., Lin, R. & Hiscott, J. Recognition of the measles virus nucleocapsid as a mechanism of IRF-3 activation. J Virol 76, 3659-69 (2002). 235. Samanta, M., Iwakiri, D. & Takada, K. Epstein-Barr virus-encoded small RNA induces IL-10 through RIG-I-mediated IRF-3 signaling. Oncogene (2008). 236. Compton, T. et al. Human cytomegalovirus activates inflammatory cytokine responses via CD14 and Toll-like receptor 2. J Virol 77, 4588-96 (2003). 237. Preston, C. M., Harman, A. N. & Nicholl, M. J. Activation of interferon response factor-3 in human cells infected with herpes simplex virus type 1 or human cytomegalovirus. J Virol 75, 8909-16 (2001). 238. Lubyova, B., Kellum, M. J., Frisancho, A. J. & Pitha, P. M. Kaposi's sarcoma- associated herpesvirus-encoded vIRF-3 stimulates the transcriptional activity of cellular IRF-3 and IRF-7. J Biol Chem 279, 7643-54 (2004). 239. Sanchez, D. J. et al. A repetitive region of gammaherpesvirus genomic DNA is a ligand for induction of type I interferon. J Virol 82, 2208-17 (2008). 240. Kawai, T. et al. Lipopolysaccharide stimulates the MyD88-independent pathway and results in activation of IFN-regulatory factor 3 and the expression of a subset of lipopolysaccharide-inducible genes. J Immunol 167, 5887-94 (2001). 241. Remoli, M. E. et al. Selective expression of type I IFN genes in human dendritic cells infected with Mycobacterium tuberculosis. J Immunol 169, 366-74 (2002). 242. Derbigny, W. A., Hong, S. C., Kerr, M. S., Temkit, M. & Johnson, R. M. Chlamydia muridarum infection elicits a beta interferon response in murine oviduct epithelial cells dependent on interferon regulatory factor 3 and TRIF. Infect Immun 75, 1280-90 (2007).
217
243. Stetson, D. B. & Medzhitov, R. Recognition of cytosolic DNA activates an IRF3- dependent innate immune response. Immunity 24, 93-103 (2006). 244. Grandvaux, N. et al. Transcriptional profiling of interferon regulatory factor 3 target genes: direct involvement in the regulation of interferon-stimulated genes. J Virol 76, 5532-9 (2002). 245. Field, A. K. et al. 9-([2-hydroxy-1-(hydroxymethyl)ethoxy]methyl)guanine: a selective inhibitor of herpes group virus replication. Proc Natl Acad Sci U S A 80, 4139-43 (1983). 246. Li, S. et al. The human papilloma virus (HPV)-18 E6 oncoprotein physically associates with Tyk2 and impairs Jak-STAT activation by interferon-alpha. Oncogene 18, 5727-37 (1999). 247. Stark, G. R. & Gudkov, A. V. Forward genetics in mammalian cells: functional approaches to gene discovery. Hum Mol Genet 8, 1925-38 (1999). 248. Kandel, E. S. et al. Mutagenesis by reversible promoter insertion to study the activation of NF-kappaB. Proc Natl Acad Sci U S A 102, 6425-30 (2005). 249. Grimm, S. The art and design of genetic screens: mammalian culture cells. Nat Rev Genet 5, 179-89 (2004). 250. Moffat, J. et al. A lentiviral RNAi library for human and mouse genes applied to an arrayed viral high-content screen. Cell 124, 1283-98 (2006). 251. Nociari, M., Ocheretina, O., Schoggins, J. W. & Falck-Pedersen, E. Sensing infection by adenovirus: Toll-like receptor-independent viral DNA recognition signals activation of the interferon regulatory factor 3 master regulator. J Virol 81, 4145-57 (2007). 252. Zhai, Y. et al. Cutting edge: TLR4 activation mediates liver ischemia/reperfusion inflammatory response via IFN regulatory factor 3-dependent MyD88- independent pathway. J Immunol 173, 7115-9 (2004). 253. Kim, T. et al. Activation of interferon regulatory factor 3 in response to DNA- damaging agents. J Biol Chem 274, 30686-9 (1999). 254. Roberts, Z. J. et al. The chemotherapeutic agent DMXAA potently and specifically activates the TBK1-IRF-3 signaling axis. J Exp Med 204, 1559-69 (2007). 255. Levy, D. E. in Innate Immunity: Signaling mechanisms (Keystone, Colerado, 2008). 256. Lamb, R. A. & Parks, G. D. in Fields' virology (eds. Knipe, D. M. & Howley, P. M.) 1449-1496 (Wolters Kluwer Health/Lippincott Williams & Wilkins, Philadelphia, 2007). 257. Karron, R. A. & Collins, P. L. in Fields' virology (eds. Knipe, D. M. & Howley, P. M.) 1497-1526 (Wolters Kluwer Health/Lippincott Williams & Wilkins, Philadelphia, 2007). 258. Hviid, A., Rubin, S. & Muhlemann, K. Mumps. Lancet 371, 932-44 (2008). 259. Hall, C. B., Douglas, R. G., Jr., Simons, R. L. & Geiman, J. M. Interferon production in children with respiratory syncytial, influenza, and parainfluenza virus infections. J Pediatr 93, 28-32 (1978). 260. Didcock, L., Young, D. F., Goodbourn, S. & Randall, R. E. The V protein of simian virus 5 inhibits interferon signalling by targeting STAT1 for proteasome- mediated degradation. J Virol 73, 9928-33 (1999).
218
261. Didcock, L., Young, D. F., Goodbourn, S. & Randall, R. E. Sendai virus and simian virus 5 block activation of interferon-responsive genes: importance for virus pathogenesis. J Virol 73, 3125-33 (1999). 262. Wansley, E. K. & Parks, G. D. Naturally occurring substitutions in the P/V gene convert the noncytopathic paramyxovirus simian virus 5 into a virus that induces alpha/beta interferon synthesis and cell death. J Virol 76, 10109-21 (2002). 263. Nagai, Y. & Kato, A. Accessory genes of the Paramyxoviridae, a large family of nonsegmented negative-strand RNA viruses, as a focus of active investigation by reverse genetics. Curr Top Microbiol Immunol 283, 197-248 (2004). 264. Koyama, A. H., Irie, H., Kato, A., Nagai, Y. & Adachi, A. Virus multiplication and induction of apoptosis by Sendai virus: role of the C proteins. Microbes Infect 5, 373-8 (2003). 265. Sun, M. et al. Akt plays a critical role in replication of non-segmented negative stranded RNA viruses. J. Virol., JVI.01520-07 (2007). 266. Horikami, S. M., Smallwood, S. & Moyer, S. A. The Sendai virus V protein interacts with the NP protein to regulate viral genome RNA replication. Virology 222, 383-90 (1996). 267. Lin, Y., Horvath, F., Aligo, J. A., Wilson, R. & He, B. The role of simian virus 5 V protein on viral RNA synthesis. Virology 338, 270-80 (2005). 268. Tober, C. et al. Expression of measles virus V protein is associated with pathogenicity and control of viral RNA synthesis. J Virol 72, 8124-32 (1998). 269. Nishio, M., Ohtsuka, J., Tsurudome, M., Nosaka, T. & Kolakofsky, D. Human parainfluenza virus type 2 V protein inhibits genome replication by binding to the L protein; a possible role in promoting viral fitness. J Virol (2008). 270. Lin, G. Y., Paterson, R. G. & Lamb, R. A. The RNA binding region of the paramyxovirus SV5 V and P proteins. Virology 238, 460-9 (1997). 271. Horvath, C. M. Silencing STATs: lessons from paramyxovirus interferon evasion. Cytokine Growth Factor Rev 15, 117-27 (2004). 272. Komatsu, T., Takeuchi, K., Yokoo, J. & Gotoh, B. C and V proteins of Sendai virus target signaling pathways leading to IRF-3 activation for the negative regulation of interferon-beta production. Virology 325, 137-48 (2004). 273. Park, M. S. et al. Newcastle disease virus (NDV)-based assay demonstrates interferon-antagonist activity for the NDV V protein and the Nipah virus V, W, and C proteins. J Virol 77, 1501-11 (2003). 274. Shaw, M. L., Cardenas, W. B., Zamarin, D., Palese, P. & Basler, C. F. Nuclear localization of the Nipah virus W protein allows for inhibition of both virus- and toll-like receptor 3-triggered signaling pathways. J Virol 79, 6078-88 (2005). 275. Shaffer, J. A., Bellini, W. J. & Rota, P. A. The C protein of measles virus inhibits the type I interferon response. Virology 315, 389-97 (2003). 276. Palosaari, H., Parisien, J. P., Rodriguez, J. J., Ulane, C. M. & Horvath, C. M. STAT protein interference and suppression of cytokine signal transduction by measles virus V protein. J Virol 77, 7635-44 (2003). 277. Yokota, S. et al. Measles virus suppresses interferon-alpha signaling pathway: suppression of Jak1 phosphorylation and association of viral accessory proteins, C and V, with interferon-alpha receptor complex. Virology 306, 135-46 (2003).
219
278. Parisien, J. P. et al. The V protein of human parainfluenza virus 2 antagonizes type I interferon responses by destabilizing signal transducer and activator of transcription 2. Virology 283, 230-9 (2001). 279. Ulane, C. M., Rodriguez, J. J., Parisien, J. P. & Horvath, C. M. STAT3 ubiquitylation and degradation by mumps virus suppress cytokine and oncogene signaling. J Virol 77, 6385-93 (2003). 280. Ulane, C. M. & Horvath, C. M. Paramyxoviruses SV5 and HPIV2 assemble STAT protein ubiquitin ligase complexes from cellular components. Virology 304, 160-6 (2002). 281. Andrejeva, J. et al. The V proteins of paramyxoviruses bind the IFN-inducible RNA helicase, mda-5, and inhibit its activation of the IFN-beta promoter. Proc Natl Acad Sci U S A 101, 17264-9 (2004). 282. Childs, K. et al. mda-5, but not RIG-I, is a common target for paramyxovirus V proteins. Virology 359, 190-200 (2007). 283. Gainey, M. D., Dillon, P. J., Clark, K. M., Manuse, M. J. & Parks, G. D. Paramyxovirus-Induced Shut Off of Host and Viral Protein Synthesis: Role of the P and V Proteins in Limiting PKR Activation. J Virol (2007). 284. Cheng, G., Zhong, J. & Chisari, F. V. Inhibition of dsRNA-induced signaling in hepatitis C virus-infected cells by NS3 protease-dependent and -independent mechanisms. Proc Natl Acad Sci U S A 103, 8499-504 (2006). 285. Mohamadzadeh, M., Chen, L. & Schmaljohn, A. L. How Ebola and Marburg viruses battle the immune system. Nat Rev Immunol 7, 556-67 (2007). 286. Poole, E., He, B., Lamb, R. A., Randall, R. E. & Goodbourn, S. The V proteins of simian virus 5 and other paramyxoviruses inhibit induction of interferon-beta. Virology 303, 33-46 (2002). 287. Jiang, D. et al. Identification of three interferon-inducible cellular enzymes that inhibit the replication of hepatitis C virus. J Virol 82, 1665-78 (2008). 288. Chin, K. C. & Cresswell, P. Viperin (cig5), an IFN-inducible antiviral protein directly induced by human cytomegalovirus. Proc Natl Acad Sci U S A 98, 15125-30 (2001). 289. Hiscott, J. Triggering the innate antiviral response through IRF-3 activation. J Biol Chem 282, 15325-9 (2007). 290. Hu, A. et al. The mumps virus V protein is unstable in virus infected cells. Arch Virol 133, 201-9 (1993). 291. Muller, M. et al. Complementation of a mutant cell line: central role of the 91 kDa polypeptide of ISGF3 in the interferon-alpha and -gamma signal transduction pathways. Embo J 12, 4221-8 (1993). 292. Lin, G. Y., Paterson, R. G., Richardson, C. D. & Lamb, R. A. The V protein of the paramyxovirus SV5 interacts with damage-specific DNA binding protein. Virology 249, 189-200 (1998). 293. Nishio, M., Garcin, D., Simonet, V. & Kolakofsky, D. The carboxyl segment of the mumps virus V protein associates with Stat proteins in vitro via a tryptophan- rich motif. Virology 300, 92-9 (2002). 294. Puri, M. (2007).
220
295. Li, T., Chen, X., Garbutt, K. C., Zhou, P. & Zheng, N. Structure of DDB1 in complex with a paramyxovirus V protein: viral hijack of a propeller cluster in ubiquitin ligase. Cell 124, 105-17 (2006). 296. Lin, R., Heylbroeck, C., Genin, P., Pitha, P. M. & Hiscott, J. Essential role of interferon regulatory factor 3 in direct activation of RANTES chemokine transcription. Mol Cell Biol 19, 959-66 (1999). 297. Servant, M. J. et al. Identification of the minimal phosphoacceptor site required for in vivo activation of interferon regulatory factor 3 in response to virus and double-stranded RNA. J Biol Chem 278, 9441-7 (2003). 298. Mori, M. et al. Identification of Ser-386 of interferon regulatory factor 3 as critical target for inducible phosphorylation that determines activation. J Biol Chem 279, 9698-702 (2004). 299. Pellett, P. E. & Roizman, B. in Fields' virology (eds. Knipe, D. M. & Howley, P. M.) 249-278 (Wolters Kluwer Health/Lippincott Williams & Wilkins, Philadelphia, 2007). 300. Dai, W. et al. Unique structures in a tumor herpesvirus revealed by cryo-electron tomography and microscopy. J Struct Biol 161, 428-38 (2008). 301. Gandhi, M. K. & Khanna, R. Human cytomegalovirus: clinical aspects, immune regulation, and emerging treatments. Lancet Infect Dis 4, 725-38 (2004). 302. Krmpotic, A., Bubic, I., Polic, B., Lucin, P. & Jonjic, S. Pathogenesis of murine cytomegalovirus infection. Microbes Infect 5, 1263-77 (2003). 303. Scalzo, A. A. et al. The effect of the Cmv-1 resistance gene, which is linked to the natural killer cell gene complex, is mediated by natural killer cells. J Immunol 149, 581-9 (1992). 304. Brown, M. G. et al. Localization on a physical map of the NKC-linked Cmv1 locus between Ly49b and the Prp gene cluster on mouse chromosome 6. J Immunol 163, 1991-9 (1999). 305. Biron, C. A., Byron, K. S. & Sullivan, J. L. Severe herpesvirus infections in an adolescent without natural killer cells. N Engl J Med 320, 1731-5 (1989). 306. Eidenschenk, C. et al. A novel primary immunodeficiency with specific natural- killer cell deficiency maps to the centromeric region of chromosome 8. Am J Hum Genet 78, 721-7 (2006). 307. Arase, H., Mocarski, E. S., Campbell, A. E., Hill, A. B. & Lanier, L. L. Direct recognition of cytomegalovirus by activating and inhibitory NK cell receptors. Science 296, 1323-6 (2002). 308. Wilkinson, G. W. et al. Modulation of natural killer cells by human cytomegalovirus. J Clin Virol 41, 206-12 (2008). 309. Cosman, D. et al. ULBPs, novel MHC class I-related molecules, bind to CMV glycoprotein UL16 and stimulate NK cytotoxicity through the NKG2D receptor. Immunity 14, 123-33 (2001). 310. Krmpotic, A. et al. MCMV glycoprotein gp40 confers virus resistance to CD8+ T cells and NK cells in vivo. Nat Immunol 3, 529-35 (2002). 311. Holtappels, R. et al. The putative natural killer decoy early gene m04 (gp34) of murine cytomegalovirus encodes an antigenic peptide recognized by protective antiviral CD8 T cells. J Virol 74, 1871-84 (2000).
221
312. Riddell, S. R. et al. Restoration of viral immunity in immunodeficient humans by the adoptive transfer of T cell clones. Science 257, 238-41 (1992). 313. Jonjic, S., Pavic, I., Lucin, P., Rukavina, D. & Koszinowski, U. H. Efficacious control of cytomegalovirus infection after long-term depletion of CD8+ T lymphocytes. J Virol 64, 5457-64 (1990). 314. Jonjic, S., Mutter, W., Weiland, F., Reddehase, M. J. & Koszinowski, U. H. Site- restricted persistent cytomegalovirus infection after selective long-term depletion of CD4+ T lymphocytes. J Exp Med 169, 1199-212 (1989). 315. Holtappels, R. et al. Experimental preemptive immunotherapy of murine cytomegalovirus disease with CD8 T-cell lines specific for ppM83 and pM84, the two homologs of human cytomegalovirus tegument protein ppUL83 (pp65). J Virol 75, 6584-600 (2001). 316. Holtappels, R., Thomas, D., Podlech, J. & Reddehase, M. J. Two antigenic peptides from genes m123 and m164 of murine cytomegalovirus quantitatively dominate CD8 T-cell memory in the H-2d haplotype. J Virol 76, 151-64 (2002). 317. Basta, S. & Bennink, J. R. A survival game of hide and seek: cytomegaloviruses and MHC class I antigen presentation pathways. Viral Immunol 16, 231-42 (2003). 318. Park, B. et al. The MHC class I homolog of human cytomegalovirus is resistant to down-regulation mediated by the unique short region protein (US)2, US3, US6, and US11 gene products. J Immunol 168, 3464-9 (2002). 319. Kavanagh, D. G., Gold, M. C., Wagner, M., Koszinowski, U. H. & Hill, A. B. The multiple immune-evasion genes of murine cytomegalovirus are not redundant: m4 and m152 inhibit antigen presentation in a complementary and cooperative fashion. J Exp Med 194, 967-78 (2001). 320. Lucin, P. et al. Late phase inhibition of murine cytomegalovirus replication by synergistic action of interferon-gamma and tumour necrosis factor. J Gen Virol 75 ( Pt 1), 101-10 (1994). 321. Gil, M. P. et al. Biologic consequences of Stat1-independent IFN signaling. Proc Natl Acad Sci U S A 98, 6680-5 (2001). 322. Presti, R. M., Pollock, J. L., Dal Canto, A. J., O'Guin, A. K. & Virgin, H. W. t. Interferon gamma regulates acute and latent murine cytomegalovirus infection and chronic disease of the great vessels. J Exp Med 188, 577-88 (1998). 323. Child, S. J., Hakki, M., De Niro, K. L. & Geballe, A. P. Evasion of cellular antiviral responses by human cytomegalovirus TRS1 and IRS1. J Virol 78, 197- 205 (2004). 324. Child, S. J., Hanson, L. K., Brown, C. E., Janzen, D. M. & Geballe, A. P. Double- stranded RNA binding by a heterodimeric complex of murine cytomegalovirus m142 and m143 proteins. J Virol 80, 10173-80 (2006). 325. Hakki, M. & Geballe, A. P. Double-stranded RNA binding by human cytomegalovirus pTRS1. J Virol 79, 7311-8 (2005). 326. Hakki, M., Marshall, E. E., De Niro, K. L. & Geballe, A. P. Binding and nuclear relocalization of protein kinase R by human cytomegalovirus TRS1. J Virol 80, 11817-26 (2006).
222
327. Mack, C., Sickmann, A., Lembo, D. & Brune, W. Inhibition of proinflammatory and innate immune signaling pathways by a cytomegalovirus RIP1-interacting protein. Proc Natl Acad Sci U S A 105, 3094-9 (2008). 328. Browne, E. P. & Shenk, T. Human cytomegalovirus UL83-coded pp65 virion protein inhibits antiviral gene expression in infected cells. Proc Natl Acad Sci U S A 100, 11439-44 (2003). 329. Abate, D. A., Watanabe, S. & Mocarski, E. S. Major human cytomegalovirus structural protein pp65 (ppUL83) prevents interferon response factor 3 activation in the interferon response. J Virol 78, 10995-1006 (2004). 330. Chang, W. L., Baumgarth, N., Yu, D. & Barry, P. A. Human cytomegalovirus- encoded interleukin-10 homolog inhibits maturation of dendritic cells and alters their functionality. J Virol 78, 8720-31 (2004). 331. Liang, X., Shin, Y. C., Means, R. E. & Jung, J. U. Inhibition of interferon- mediated antiviral activity by murine gammaherpesvirus 68 latency-associated M2 protein. J Virol 78, 12416-27 (2004). 332. Paulus, C., Krauss, S. & Nevels, M. A human cytomegalovirus antagonist of type I IFN-dependent signal transducer and activator of transcription signaling. Proc Natl Acad Sci U S A 103, 3840-5 (2006). 333. Penfold, M. E. et al. Cytomegalovirus encodes a potent alpha chemokine. Proc Natl Acad Sci U S A 96, 9839-44 (1999). 334. Saederup, N., Aguirre, S. A., Sparer, T. E., Bouley, D. M. & Mocarski, E. S. Murine cytomegalovirus CC chemokine homolog MCK-2 (m131-129) is a determinant of dissemination that increases inflammation at initial sites of infection. J Virol 75, 9966-76 (2001). 335. Melnychuk, R. M. et al. Mouse cytomegalovirus M33 is necessary and sufficient in virus-induced vascular smooth muscle cell migration. J Virol 79, 10788-95 (2005). 336. Waldhoer, M., Kledal, T. N., Farrell, H. & Schwartz, T. W. Murine cytomegalovirus (CMV) M33 and human CMV US28 receptors exhibit similar constitutive signaling activities. J Virol 76, 8161-8 (2002). 337. Nash, A. A., Dutia, B. M., Stewart, J. P. & Davison, A. J. Natural history of murine gamma-herpesvirus infection. Philos Trans R Soc Lond B Biol Sci 356, 569-79 (2001). 338. Yarilin, D. A., Valiando, J. & Posnett, D. N. A mouse herpesvirus induces relapse of experimental autoimmune arthritis by infection of the inflammatory target tissue. J Immunol 173, 5238-46 (2004). 339. Weck, K. E. et al. Murine gamma-herpesvirus 68 causes severe large-vessel arteritis in mice lacking interferon-gamma responsiveness: a new model for virus- induced vascular disease. Nat Med 3, 1346-53 (1997). 340. Virgin, H. W. t. et al. Complete sequence and genomic analysis of murine gammaherpesvirus 68. J Virol 71, 5894-904 (1997). 341. Nair, V. & Zavolan, M. Virus-encoded microRNAs: novel regulators of gene expression. Trends Microbiol 14, 169-75 (2006). 342. Pfeffer, S. et al. Identification of microRNAs of the herpesvirus family. Nat Methods 2, 269-76 (2005).
223
343. Clambey, E. T., Virgin, H. W. t. & Speck, S. H. Characterization of a spontaneous 9.5-kilobase-deletion mutant of murine gammaherpesvirus 68 reveals tissue- specific genetic requirements for latency. J Virol 76, 6532-44 (2002). 344. Gillet, L. & Stevenson, P. G. Evidence for a multiprotein gamma-2 herpesvirus entry complex. J Virol 81, 13082-91 (2007). 345. Hair, J. R., Lyons, P. A., Smith, K. G. & Efstathiou, S. Control of Rta expression critically determines transcription of viral and cellular genes following gammaherpesvirus infection. J Gen Virol 88, 1689-97 (2007). 346. Pepper, S. D., Stewart, J. P., Arrand, J. R. & Mackett, M. Murine gammaherpesvirus-68 encodes homologues of thymidine kinase and glycoprotein H: sequence, expression, and characterization of pyrimidine kinase activity. Virology 219, 475-9 (1996). 347. Lee, B. J., Koszinowski, U. H., Sarawar, S. R. & Adler, H. A gammaherpesvirus G protein-coupled receptor homologue is required for increased viral replication in response to chemokines and efficient reactivation from latency. J Immunol 170, 243-51 (2003). 348. Wakeling, M. N., Roy, D. J., Nash, A. A. & Stewart, J. P. Characterization of the murine gammaherpesvirus 68 ORF74 product: a novel oncogenic G protein- coupled receptor. J Gen Virol 82, 1187-97 (2001). 349. de Lima, B. D., May, J. S., Marques, S., Simas, J. P. & Stevenson, P. G. Murine gammaherpesvirus 68 bcl-2 homologue contributes to latency establishment in vivo. J Gen Virol 86, 31-40 (2005). 350. Moorman, N. J., Willer, D. O. & Speck, S. H. The gammaherpesvirus 68 latency- associated nuclear antigen homolog is critical for the establishment of splenic latency. J Virol 77, 10295-303 (2003). 351. Usherwood, E. J., Stewart, J. P., Robertson, K., Allen, D. J. & Nash, A. A. Absence of splenic latency in murine gammaherpesvirus 68-infected B cell- deficient mice. J Gen Virol 77 ( Pt 11), 2819-25 (1996). 352. Thomson, R. C., Petrik, J., Nash, A. A. & Dutia, B. M. Expansion and activation of NK cell populations in a gammaherpesvirus infection. Scand J Immunol 67, 489-95 (2008). 353. Ehtisham, S., Sunil-Chandra, N. P. & Nash, A. A. Pathogenesis of murine gammaherpesvirus infection in mice deficient in CD4 and CD8 T cells. J Virol 67, 5247-52 (1993). 354. Dutia, B. M., Allen, D. J., Dyson, H. & Nash, A. A. Type I interferons and IRF-1 play a critical role in the control of a gammaherpesvirus infection. Virology 261, 173-9 (1999). 355. Barton, E. S., Lutzke, M. L., Rochford, R. & Virgin, H. W. t. Alpha/beta interferons regulate murine gammaherpesvirus latent gene expression and reactivation from latency. J Virol 79, 14149-60 (2005). 356. Liu, B. et al. PIAS1 selectively inhibits interferon-inducible genes and is important in innate immunity. Nat Immunol 5, 891-8 (2004). 357. Dutia, B. M., Clarke, C. J., Allen, D. J. & Nash, A. A. Pathological changes in the spleens of gamma interferon receptor-deficient mice infected with murine gammaherpesvirus: a role for CD8 T cells. J Virol 71, 4278-83 (1997).
224
358. Gasper-Smith, N. & Bost, K. L. Initiation of the host response against murine gammaherpesvirus infection in immunocompetent mice. Viral Immunol 17, 473- 80 (2004). 359. Yu, Y. Y. et al. Physical association of the K3 protein of gamma-2 herpesvirus 68 with major histocompatibility complex class I molecules with impaired peptide and beta(2)-microglobulin assembly. J Virol 76, 2796-803 (2002). 360. Bennett, N. J., May, J. S. & Stevenson, P. G. Gamma-herpesvirus latency requires T cell evasion during episome maintenance. PLoS Biol 3, e120 (2005). 361. Jensen, K. K. et al. Disruption of CCL21-induced chemotaxis in vitro and in vivo by M3, a chemokine-binding protein encoded by murine gammaherpesvirus 68. J Virol 77, 624-30 (2003). 362. Jia, Q. et al. Murine gammaherpesvirus 68 open reading frame 45 plays an essential role during the immediate-early phase of viral replication. J Virol 79, 5129-41 (2005). 363. Kapadia, S. B., Molina, H., van Berkel, V., Speck, S. H. & Virgin, H. W. t. Murine gammaherpesvirus 68 encodes a functional regulator of complement activation. J Virol 73, 7658-70 (1999). 364. Terhune, S. S., Schroer, J. & Shenk, T. RNAs are packaged into human cytomegalovirus virions in proportion to their intracellular concentration. J Virol 78, 10390-8 (2004). 365. Sciortino, M. T., Suzuki, M., Taddeo, B. & Roizman, B. RNAs extracted from herpes simplex virus 1 virions: apparent selectivity of viral but not cellular RNAs packaged in virions. J Virol 75, 8105-16 (2001). 366. Prichard, M. N. et al. Identification of persistent RNA-DNA hybrid structures within the origin of replication of human cytomegalovirus. J Virol 72, 6997-7004 (1998). 367. Simmen, K. A. et al. Global modulation of cellular transcription by human cytomegalovirus is initiated by viral glycoprotein B. Proc Natl Acad Sci U S A 98, 7140-5 (2001). 368. Juckem, L. K., Boehme, K. W., Feire, A. L. & Compton, T. Differential initiation of innate immune responses induced by human cytomegalovirus entry into fibroblast cells. J Immunol 180, 4965-77 (2008). 369. Delale, T. et al. MyD88-dependent and -independent murine cytomegalovirus sensing for IFN-alpha release and initiation of immune responses in vivo. J Immunol 175, 6723-32 (2005). 370. West, J. & Damania, B. Upregulation of the TLR3 pathway by Kaposi's sarcoma- associated herpesvirus during primary infection. J Virol 82, 5440-9 (2008). 371. Nanbo, A., Yoshiyama, H. & Takada, K. Epstein-Barr virus-encoded poly(A)- RNA confers resistance to apoptosis mediated through Fas by blocking the PKR pathway in human epithelial intestine 407 cells. J Virol 79, 12280-5 (2005). 372. Doyle, S. et al. IRF3 mediates a TLR3/TLR4-specific antiviral gene program. Immunity 17, 251-63 (2002). 373. Doyle, S. E. et al. Toll-like receptor 3 mediates a more potent antiviral response than Toll-like receptor 4. J Immunol 170, 3565-71 (2003).
225
374. van den Pol, A. N. et al. Cytomegalovirus induces interferon-stimulated gene expression and is attenuated by interferon in the developing brain. J Virol 81, 332-48 (2007). 375. DeFilippis, V. R. et al. Interferon regulatory factor 3 is necessary for induction of antiviral genes during human cytomegalovirus infection. J Virol 80, 1032-7 (2006). 376. Child, S. J., Jarrahian, S., Harper, V. M. & Geballe, A. P. Complementation of vaccinia virus lacking the double-stranded RNA-binding protein gene E3L by human cytomegalovirus. J Virol 76, 4912-8 (2002). 377. Brown, H. J. et al. NF-kappaB inhibits gammaherpesvirus lytic replication. J Virol 77, 8532-40 (2003). 378. Karabekian, Z. et al. Complex formation among murine cytomegalovirus US22 proteins encoded by genes M139, M140, and M141. J Virol 79, 3525-35 (2005). 379. Dolken, L. et al. Mouse cytomegalovirus microRNAs dominate the cellular small RNA profile during lytic infection and show features of posttranscriptional regulation. J Virol 81, 13771-82 (2007). 380. Yu, D., Silva, M. C. & Shenk, T. Functional map of human cytomegalovirus AD169 defined by global mutational analysis. Proc Natl Acad Sci U S A 100, 12396-401 (2003). 381. Pellegrini, S., John, J., Shearer, M., Kerr, I. M. & Stark, G. R. Use of a selectable marker regulated by alpha interferon to obtain mutations in the signaling pathway. Mol Cell Biol 9, 4605-12 (1989). 382. Kunsch, C. & Rosen, C. A. NF-kappa B subunit-specific regulation of the interleukin-8 promoter. Mol Cell Biol 13, 6137-46 (1993). 383. Mukaida, N. & Matsushima, K. Regulation of IL-8 production and the characteristics of the receptors for IL-8. Cytokines 4, 41-53 (1992). 384. Zhu, Y. M., Bradbury, D. A., Pang, L. & Knox, A. J. Transcriptional regulation of interleukin (IL)-8 by bradykinin in human airway smooth muscle cells involves prostanoid-dependent activation of AP-1 and nuclear factor (NF)-IL-6 and prostanoid-independent activation of NF-kappaB. J Biol Chem 278, 29366-75 (2003). 385. Martinez-Sobrido, L., Zuniga, E. I., Rosario, D., Garcia-Sastre, A. & de la Torre, J. C. Inhibition of the type I interferon response by the nucleoprotein of the prototypic arenavirus lymphocytic choriomeningitis virus. J Virol 80, 9192-9 (2006). 386. Xiang, Y. et al. Blockade of interferon induction and action by the E3L double- stranded RNA binding proteins of vaccinia virus. J Virol 76, 5251-9 (2002). 387. Smith, E. J., Marie, I., Prakash, A., Garcia-Sastre, A. & Levy, D. E. IRF3 and IRF7 phosphorylation in virus-infected cells does not require double-stranded RNA-dependent protein kinase R or Ikappa B kinase but is blocked by Vaccinia virus E3L protein. J Biol Chem 276, 8951-7 (2001). 388. Chang, H. W., Watson, J. C. & Jacobs, B. L. The E3L gene of vaccinia virus encodes an inhibitor of the interferon-induced, double-stranded RNA-dependent protein kinase. Proc Natl Acad Sci U S A 89, 4825-9 (1992).
226
389. Rivas, C., Gil, J., Melkova, Z., Esteban, M. & Diaz-Guerra, M. Vaccinia virus E3L protein is an inhibitor of the interferon (i.f.n.)-induced 2-5A synthetase enzyme. Virology 243, 406-14 (1998). 390. Zhang, P., Jacobs, B. L. & Samuel, C. E. Loss of protein kinase PKR expression in human HeLa cells complements the vaccinia virus E3L deletion mutant phenotype by restoration of viral protein synthesis. J Virol 82, 840-8 (2008). 391. Littler, E., Stuart, A. D. & Chee, M. S. Human cytomegalovirus UL97 open reading frame encodes a protein that phosphorylates the antiviral nucleoside analogue ganciclovir. Nature 358, 160-2 (1992). 392. Song, M. J. et al. Identification of viral genes essential for replication of murine gamma-herpesvirus 68 using signature-tagged mutagenesis. Proc Natl Acad Sci U S A 102, 3805-10 (2005). 393. Dunn, W. et al. Functional profiling of a human cytomegalovirus genome. Proc Natl Acad Sci U S A 100, 14223-8 (2003). 394. Hanson, L. K. et al. Characterization and regulation of essential murine cytomegalovirus genes m142 and m143. Virology 334, 166-77 (2005). 395. Hanson, L. K. et al. Transcriptional analysis of the murine cytomegalovirus HindIII-I region: identification of a novel immediate-early gene region. Virology 260, 156-64 (1999). 396. Menard, C. et al. Role of murine cytomegalovirus US22 gene family members in replication in macrophages. J Virol 77, 5557-70 (2003). 397. McCormick, A. L., Skaletskaya, A., Barry, P. A., Mocarski, E. S. & Goldmacher, V. S. Differential function and expression of the viral inhibitor of caspase 8- induced apoptosis (vICA) and the viral mitochondria-localized inhibitor of apoptosis (vMIA) cell death suppressors conserved in primate and rodent cytomegaloviruses. Virology 316, 221-33 (2003). 398. Skaletskaya, A. et al. A cytomegalovirus-encoded inhibitor of apoptosis that suppresses caspase-8 activation. Proc Natl Acad Sci U S A 98, 7829-34 (2001). 399. Beltinger, C. et al. Herpes simplex virus thymidine kinase/ganciclovir-induced apoptosis involves ligand-independent death receptor aggregation and activation of caspases. Proc Natl Acad Sci U S A 96, 8699-704 (1999). 400. Rawlinson, W. D., Farrell, H. E. & Barrell, B. G. Analysis of the complete DNA sequence of murine cytomegalovirus. J Virol 70, 8833-49 (1996). 401. Battista, M. C. et al. Expression and characterization of a novel structural protein of human cytomegalovirus, pUL25. J Virol 73, 3800-9 (1999). 402. Lazzarotto, T., Varani, S., Gabrielli, L., Pignatelli, S. & Landini, M. P. The tegument protein ppUL25 of human cytomegalovirus (CMV) is a major target antigen for the anti-CMV antibody response. J Gen Virol 82, 335-8 (2001). 403. Petrik, D. T., Schmitt, K. P. & Stinski, M. F. Inhibition of cellular DNA synthesis by the human cytomegalovirus IE86 protein is necessary for efficient virus replication. J Virol 80, 3872-83 (2006). 404. Taylor, R. T. & Bresnahan, W. A. Human cytomegalovirus immediate-early 2 protein IE86 blocks virus-induced chemokine expression. J Virol 80, 920-8 (2006).
227
405. Taylor, R. T. & Bresnahan, W. A. Human cytomegalovirus immediate-early 2 gene expression blocks virus-induced beta interferon production. J Virol 79, 3873-7 (2005). 406. Bortz, E. et al. Identification of proteins associated with murine gammaherpesvirus 68 virions. J Virol 77, 13425-32 (2003). 407. Ahn, J. W., Powell, K. L., Kellam, P. & Alber, D. G. Gammaherpesvirus lytic gene expression as characterized by DNA array. J Virol 76, 6244-56 (2002). 408. Glaunsinger, B. & Ganem, D. Lytic KSHV infection inhibits host gene expression by accelerating global mRNA turnover. Mol Cell 13, 713-23 (2004). 409. Rowe, M. et al. Host shutoff during productive Epstein-Barr virus infection is mediated by BGLF5 and may contribute to immune evasion. Proc Natl Acad Sci U S A 104, 3366-71 (2007). 410. May, J. S., de Lima, B. D., Colaco, S. & Stevenson, P. G. Intercellular gamma- herpesvirus dissemination involves co-ordinated intracellular membrane protein transport. Traffic 6, 780-93 (2005). 411. Horton, P. et al. WoLF PSORT: protein localization predictor. Nucleic Acids Res 35, W585-7 (2007). 412. Chien, Y. et al. RalB GTPase-mediated activation of the IkappaB family kinase TBK1 couples innate immune signaling to tumor cell survival. Cell 127, 157-70 (2006). 413. Majerciak, V., Yamanegi, K. & Zheng, Z. M. Gene structure and expression of Kaposi's sarcoma-associated herpesvirus ORF56, ORF57, ORF58, and ORF59. J Virol 80, 11968-81 (2006). 414. Gillet, L., Colaco, S. & Stevenson, P. G. The murid herpesvirus-4 gH/gL binds to glycosaminoglycans. PLoS ONE 3, e1669 (2008). 415. Gill, M. B., Edgar, R., May, J. S. & Stevenson, P. G. A gamma-herpesvirus glycoprotein complex manipulates actin to promote viral spread. PLoS ONE 3, e1808 (2008). 416. Ogawa, S. et al. Molecular determinants of crosstalk between nuclear receptors and toll-like receptors. Cell 122, 707-21 (2005). 417. Thornburg, N. J. et al. LMP1 signaling and activation of NF-kappaB in LMP1 transgenic mice. Oncogene 25, 288-97 (2006). 418. Wang, L. et al. Functional characterization of the M-type K15-encoded membrane protein of Kaposi's sarcoma-associated herpesvirus. J Gen Virol 88, 1698-707 (2007). 419. Harhaj, N. S., Sun, S. C. & Harhaj, E. W. Activation of NF-kappa B by the human T cell leukemia virus type I Tax oncoprotein is associated with ubiquitin- dependent relocalization of I kappa B kinase. J Biol Chem 282, 4185-92 (2007). 420. Zaragoza, C. et al. Viral protease cleavage of inhibitor of kappaBalpha triggers host cell apoptosis. Proc Natl Acad Sci U S A 103, 19051-6 (2006). 421. Hargett, D., Rice, S. & Bachenheimer, S. L. Herpes simplex virus type 1 ICP27- dependent activation of NF-kappaB. J Virol 80, 10565-78 (2006). 422. Polyak, S. J. et al. Hepatitis C virus nonstructural 5A protein induces interleukin- 8, leading to partial inhibition of the interferon-induced antiviral response. J Virol 75, 6095-106 (2001).
228
423. Mukaida, N., Harada, A., Yasumoto, K. & Matsushima, K. Properties of pro- inflammatory cell type-specific leukocyte chemotactic cytokines, interleukin 8 (IL-8) and monocyte chemotactic and activating factor (MCAF). Microbiol Immunol 36, 773-89 (1992). 424. James, M. A., Lee, J. H. & Klingelhutz, A. J. Human papillomavirus type 16 E6 activates NF-kappaB, induces cIAP-2 expression, and protects against apoptosis in a PDZ binding motif-dependent manner. J Virol 80, 5301-7 (2006). 425. Shen, C. H. & Stavnezer, J. Activation of the mouse Ig germline epsilon promoter by IL-4 is dependent on AP-1 transcription factors. J Immunol 166, 411-23 (2001). 426. Boehm, J. S. et al. Integrative genomic approaches identify IKBKE as a breast cancer oncogene. Cell 129, 1065-79 (2007). 427. Bonnard, M. et al. Deficiency of T2K leads to apoptotic liver degeneration and impaired NF-kappaB-dependent gene transcription. Embo J 19, 4976-85 (2000). 428. Hemmi, H. et al. The roles of two IkappaB kinase-related kinases in lipopolysaccharide and double stranded RNA signaling and viral infection. J Exp Med 199, 1641-50 (2004). 429. Shimada, T. et al. IKK-i, a novel lipopolysaccharide-inducible kinase that is related to IkappaB kinases. Int Immunol 11, 1357-62 (1999). 430. Tojima, Y. et al. NAK is an IkappaB kinase-activating kinase. Nature 404, 778-82 (2000). 431. . 432. . 433. Lu, Y., Wu, L. P. & Anderson, K. V. The antibacterial arm of the drosophila innate immune response requires an IkappaB kinase. Genes Dev 15, 104-10 (2001). 434. Shapiro, R. S. & Anderson, K. V. Drosophila Ik2, a member of the I kappa B kinase family, is required for mRNA localization during oogenesis. Development 133, 1467-75 (2006). 435. Gatot, J. S. et al. Lipopolysaccharide-mediated interferon regulatory factor activation involves TBK1-IKKepsilon-dependent Lys(63)-linked polyubiquitination and phosphorylation of TANK/I-TRAF. J Biol Chem 282, 31131-46 (2007). 436. Khabar, K. S. et al. The alpha chemokine, interleukin 8, inhibits the antiviral action of interferon alpha. J Exp Med 186, 1077-85 (1997). 437. Vyas, J., Elia, A. & Clemens, M. J. Inhibition of the protein kinase PKR by the internal ribosome entry site of hepatitis C virus genomic RNA. Rna 9, 858-70 (2003). 438. Pflugheber, J. et al. Regulation of PKR and IRF-1 during hepatitis C virus RNA replication. Proc Natl Acad Sci U S A 99, 4650-5 (2002). 439. Fernandez-Sesma, A. et al. Influenza virus evades innate and adaptive immunity via the NS1 protein. J Virol 80, 6295-304 (2006). 440. Jackson, D., Hossain, M. J., Hickman, D., Perez, D. R. & Lamb, R. A. A new influenza virus virulence determinant: the NS1 protein four C-terminal residues modulate pathogenicity. Proc Natl Acad Sci U S A 105, 4381-6 (2008).
229
441. Talon, J. et al. Influenza A and B viruses expressing altered NS1 proteins: A vaccine approach. Proc Natl Acad Sci U S A 97, 4309-14 (2000). 442. Barton, E. S. et al. Herpesvirus latency confers symbiotic protection from bacterial infection. Nature 447, 326-9 (2007). 443. Federici, B. A. & Bigot, Y. Origin and evolution of polydnaviruses by symbiogenesis of insect DNA viruses in endoparasitic wasps. J Insect Physiol 49, 419-32 (2003). 444. Dyall, S. D., Brown, M. T. & Johnson, P. J. Ancient invasions: from endosymbionts to organelles. Science 304, 253-7 (2004). 445. Agrawal, A., Eastman, Q. M. & Schatz, D. G. Transposition mediated by RAG1 and RAG2 and its implications for the evolution of the immune system. Nature 394, 744-51 (1998). 446. Bernstein, R. M., Schluter, S. F., Bernstein, H. & Marchalonis, J. J. Primordial emergence of the recombination activating gene 1 (RAG1): sequence of the complete shark gene indicates homology to microbial integrases. Proc Natl Acad Sci U S A 93, 9454-9 (1996). 447. Hiom, K., Melek, M. & Gellert, M. DNA transposition by the RAG1 and RAG2 proteins: a possible source of oncogenic translocations. Cell 94, 463-70 (1998).
230