DOCSLIB.ORG

Targeted Gene Knockout in Chickens Mediated by Talens

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Targeted Gene Knockout in Chickens Mediated by Talens Targeted gene knockout in chickens mediated by TALENs Tae Sub Parka,b, Hong Jo Leea, Ki Hyun Kima, Jin-Soo Kimc, and Jae Yong Hana,1 aDepartment of Agricultural Biotechnology and Research Institute of Agriculture and Life Sciences, College of Agriculture and Life Sciences, Seoul National University, Seoul 151-921, Korea; bInstitute of Green-Bio Science and Technology, Seoul National University, Pyeongchang-gun, Gangwon-do 232-916, Korea; and cDepartment of Chemistry, College of Natural Science, Seoul National University, Seoul 151-921, Korea Edited by James E. Womack, Texas A&M University, College Station, TX, and approved July 30, 2014 (received for review June 7, 2014) Genetically modified animals are used for industrial applications as the mRNA that encodes TALENs or ZFNs was injected to well as scientific research, and studies on these animals contribute generate target gene-modified animals. However, programmable to a better understanding of biological mechanisms. Gene target- gene-edited poultry have not yet been reported. Unfortunately, ing techniques have been developed to edit specific gene loci in the one-cell-stage injection method cannot be used to generate the genome, but the conventional strategy of homologous recom- gene knockout chickens because the accessibility and manipu- bination with a gene-targeted vector has low efficiency and many lation of single-cell-stage embryos are very difficult and hatch- technical complications. Here, we generated specific gene knockout ability is too low. chickens through the use of transcription activator-like effector nuclease (TALEN)-mediated gene targeting. In this study, we accom- Results ovalbumin OV plished targeted knockout of the ( ) gene in the chicken TALEN Validation for Chicken Genome Editing. To verify TALEN primordial germ cells, and OV gene mutant offspring were generated activity in the chicken genome, effective TALEN expression through test-cross analysis. TALENs successfully induced nucleotide constructs for three different genes [DsRed reporter, β1,4-gal- OV deletion mutations of ORF shifts, resulting in loss of chicken gene actosyltransferase 1 (B4GALT1), and β-actin] were designed and function. Our results demonstrate that the TALEN technique used in synthesized (Fig. S1). After each TALEN plasmid set was the chicken primordial germ cell line is a powerful strategy to create transfected into a regular or DsRed-expressing DF1 chicken cell SCIENCES specific genome-edited chickens safely for practical applications. AGRICULTURAL line, we analyzed induced mutations in a targeted locus with a T7 endonuclease I (T7E1) assay and DNA sequencing (Fig. 1A and genetic modification | programmable genome editing | germ-line Fig. S2). The mutation ratios in DsRed-negative cells were chimera | poultry | egg protein 55.6% and 54.5% in DsRed TALEN 1 and DsRed TALEN 2, respectively (Fig. S2A). TALENs induced deletion/insertion ince knockout mice were generated using target locus dis- – mutants in the DsRed gene, which resulted in DsRed gene fra- Sruption by homologous recombination (1 4), the knockout meshifts (Fig. S2A). Next, to verify TALEN activity for genetic system has revolutionized the research field of functional modification of chicken genes, TALENs targeted specifically to genomics by allowing the analysis of specific gene functions in chicken B4GALT1 and β-actin genes were constructed. To select vivo (5). In avian species, however, germ-line-competent em- for TALEN-transfected DF1 cells after transfection, we in- bryonic stem cells are lacking, and adapting somatic cell nuclear troduced a CMV-GFP expression reporter plasmid along with transfer and cloning are technically difficult; thus, targeted ge- the TALENs in which the DNA molecular weight ratio was 1:1:1 nome editing by homologous recombination is very difficult. (CMV GFP:TALEN R:TALEN L). One day after transfection, Furthermore, birds have many evolutionary differences com- pared with mammals in terms of physiological characteristics and developmental processes (6). Therefore, conventional gene tar- Significance geting techniques established in experimental animals are not easily applied to avian species. However, Schusser and col- Targeted gene knockout by editing specific loci in genome has leagues (7) reported gene-targeted chickens through the use of revolutionized the field of functional genomics. Transcription homologous recombination. activator-like effector nucleases (TALENs) are representative Novel approaches have been recently designed to efficiently next-generation platforms for customized genomic editing in produce animals that are genetically altered in specific genomic transgenic animals, as well as cultured cells in vitro. In this sequences; zinc-finger nuclease (ZFN) (8–10) and transcription study, in combination with chicken primordial germ cell line oval- activator-like effector nuclease (TALEN) (11–16) are represen- with germ-line transmission capacity, we generated the bumin tative next-generation platforms for customized genomic editing gene knockout chickens by TALEN-mediated gene tar- in transgenic animals, as well as in cultured cells in vitro. ZFNs geting. Our results extended the application of state-of-the-art and TALENs containing a DNA-binding domain and Fok I nu- TALEN technology from experimental animals to farm animals. clease domain are currently crucial tools to dissect individual As TALEN-mediated knockout chickens are genetically modified gene function in complicated biological systems with targeted but nontransgenic, without genomic integration of any exog- genetic deletions and alterations. The targeted gene becomes enous transgenes, specific genomic editing with TALENs could expedite the generation of genetically engineered chickens for inoperative by generating a double-strand DNA break and agriculturally practical applications as well as for model animals. a frameshift-induced mutation during the repair process (11, 17). To date, these versatile engineered hybrid proteins have been Author contributions: T.S.P., J.-S.K., and J.Y.H. designed research; T.S.P., H.J.L., and K.H.K. applied to various animal species, including human embryonic performed research; T.S.P., H.J.L., and K.H.K. analyzed data; and T.S.P., J.-S.K., and J.Y.H. stem cells (17). ZFN-mediated genomic modifications have been wrote the paper. used to mutate specific genes in vertebrates such as mice, rats, The authors declare no conflict of interest. and pigs (8, 9). TALENs were first adapted to human cells (11), This article is a PNAS Direct Submission. and a heritable mutant mouse was efficiently generated after 1To whom correspondence should be addressed. Email: [email protected]. microinjection of specific locus-targeted TALENs into fertilized This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. one-cell embryos (15). In one-cell-stage embryos of mammals, 1073/pnas.1410555111/-/DCSupplemental. www.pnas.org/cgi/doi/10.1073/pnas.1410555111 PNAS Early Edition | 1of6 Downloaded by guest on September 25, 2021 A &U4GF 6#.'0 &U4GF 6#.'0 TGIWNCT&( )CN66#.'0 )CN66#.'0 TGIWNCT&( ƅCEVKP 6#.'0 ƅCEVKP6#.'0 TGIWNCT&( 6' 6' 6' ߨ ߨ ߨ ߨ ߨ ߨ ߨ ߨ ߨ ߨ ߨ ߨ OWVCPV OWVCPV OWVCPV B 186#.'0. 0VGTO 4GRGCVFQOCKP (QM + ---TGCTGTTTGCTCTAGACAACTCAGAGTTCACCATGGGCTCCATCGGTGCAGCAAGCA--- ---ACGACAAACGAGATCTGTTGAGTCTCAAGTGGTACCCGAGGTAGCCACGTCGTTCGT--- Q + (QM 4GRGCVFQOCKP 0VGTO 186#.'04 186#.'0 186#.'0 TGIWNCT&( TGIWNCT 186#.'0 6' 6' ߨ ߨ ߨ ߨ &(OWVCPV 2)%OWVCPV C 186#.'0 OWVCPVKP2)%U M G S I G A A S amino acids TGCTGTTTGCTCTAGACAACTCAGAGTTCACC ATG GGC TCC ATC GGT GCA GCA AGC A wild (8x) TGCTGTTTGCTCTAGACAACTCAGAGTT---- --G GGC TCC ATC GGT GCA GCA AGC A 6nt del (1x) TGCTGTTTGCTCTAGACAACTCA-------CC ATG GGC TCC ATC GGT GCA GCA AGC A 7nt del (1x) TGCTGTTTGCTCTAGACAACTCAGAGTTC--- --- --- --- -TC GGT GCA GCA AGC A 13nt del (1x) -----------------------------ACC ATG GGC TCC ATC GGT GCA GCA AGC A 29nt del (1x) Fig. 1. Genomic mutation analysis after TALEN introduction into chickens. (A) T7E1 assay of TALEN target sites for DsRed, B4GALT1, and β-actin in the chicken DF1 cell line. (B) Schematic TALEN design for the chicken OV gene. DNA-binding (left in red or right in blue) and spacer sequences (in black) are presented for OV TALEN 2. T7E1 assay of chicken DF1 cells mutated with OV TALEN 1 or 2 (Left), and chicken PGCs (SNUhp26) mutated with OV TALEN 2 (Right). (C) Mutated target DNA sequences of chicken PGCs with OV TALEN 2. A dash in the DNA sequences denotes the deleted nucleotides, and bold ATG indicates the translational initiation codon in the second exon of the OV gene. GFP-positive cells were sorted by FACS, as it was expected that Mutation Induction of OV Gene in Chicken PGCs by TALENs. Genetic GFP-expressing cells were also delivered with both right and left engineering techniques, such as stem cell-based and somatic cell TALEN constructs. After 10–14 d of in vitro culture, we exam- nuclear transfer-mediated modifications, are difficult to apply in ined mutations in chicken B4GALT1 and β-actin genes with avian species because of technical difficulties associated with a T7E1 assay (Fig. S2 B and C). TALEN-induced mutated manipulating avian oocytes and accessing the oocyte nucleus. To frameshift efficiency was 36.4–60.0% in B4GALT1 and 8.3–9.1% overcome the technical obstacles of genomic modification in chickens, we recently established chicken primordial germ cell in β-actin (Fig. S2 B and C). Various mutant genotypes and (PGC) lines with germ-line transmission capacity (18). We ap- lengths were induced by TALENs in each gene: 1–33 nucleotide – plied the same combination of techniques to the PGC line, using deletions and one additional nucleotide insertion (Fig. S2 A C). fluorescence-positive separation 1 d after cotransfection with the Thus, the combination of cotransfection and FACS sorting with GFP vector and OV TALEN 2 set. PGC transient transfection GFP expression was an effective and practical approach to efficiency was relatively low compared with DF1 cells; in general, selecting chicken cells with TALEN-mediated mutants of en- GFP-expressing PGCs were sorted at less than 5% compared dogenous genes in the chicken genome.
Load more

Recommended publications
  • Research Article Gene Knockout Identification Using an Extension of Bees Hill Flux Balance Analysis
    Hindawi Publishing Corporation BioMed Research International Volume 2015, Article ID 124537, 10 pages http://dx.doi.org/10.1155/2015/124537 Research Article Gene Knockout Identification Using an Extension of Bees Hill Flux Balance Analysis Yee Wen Choon,1 Mohd Saberi Mohamad,1 Safaai Deris,1 Chuii Khim Chong,1 Sigeru Omatu,2 and Juan Manuel Corchado3 1 Artificial Intelligence and Bioinformatics Research Group, Faculty of Computing, Universiti Teknologi Malaysia, 81310 Skudai, Johor, Malaysia 2 Department of Electronics, Information and Communication Engineering, Osaka Institute of Technology, Osaka 535-8585, Japan 3 Biomedical Research Institute of Salamanca/BISITE Research Group, University of Salamanca, 37008 Salamanca, Spain Correspondence should be addressed to Mohd Saberi Mohamad; [email protected] Received 21 August 2014; Revised 22 October 2014; Accepted 31 October 2014 Academic Editor: Juan F. De Paz Copyright © 2015 Yee Wen Choon et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Microbial strain optimisation for the overproduction of a desired phenotype has been a popular topic in recent years. Gene knockout is a genetic engineering technique that can modify the metabolism of microbial cells to obtain desirable phenotypes. Optimisation algorithms have been developed to identify the effects of gene knockout. However, the complexities of metabolic networks have made the process of identifying the effects of genetic modification on desirable phenotypes challenging. Furthermore, a vast number of reactions in cellular metabolism often lead to a combinatorial problem in obtaining optimal gene knockout.
    [Show full text]
  • Gene Editing of Microalgae: Scientific Progress and Regulatory
    biology Review Gene Editing of Microalgae: Scientific Progress and Regulatory Challenges in Europe Andrew Spicer 1,* and Attila Molnar 2 ID 1 Algenuity, Eden Laboratory, Bedfordshire MK43 9ND, UK 2 Institute of Molecular Plant Sciences, University of Edinburgh, Edinburgh EH9 3BF, UK; [email protected] * Correspondence: [email protected]; Tel.: +44-1234-765773 Received: 22 December 2017; Accepted: 1 March 2018; Published: 6 March 2018 Abstract: It is abundantly clear that the development of gene editing technologies, represents a potentially powerful force for good with regard to human and animal health and addressing the challenges we continue to face in a growing global population. This now includes the development of approaches to modify microalgal strains for potential improvements in productivity, robustness, harvestability, processability, nutritional composition, and application. The rapid emergence and ongoing developments in this area demand a timely review and revision of the current definitions and regulations around genetically modified organisms (GMOs), particularly within Europe. Current practices within the EU provide exemptions from the GMO directives for organisms, including crop plants and micro-organisms that are produced through chemical or UV/radiation mutagenesis. However, organisms generated through gene editing, including microalgae, where only genetic changes in native genes are made, remain currently under the GMO umbrella; they are, as such, excluded from practical and commercial opportunities in the EU. In this review, we will review the advances that are being made in the area of gene editing in microalgae and the impact of regulation on commercial advances in this area with consideration to the current regulatory framework as it relates to GMOs including GM microalgae in Europe.
    [Show full text]
  • What Are Knockout Mice?
    Lecture 37 Knockout mice Lecture 29 Cloning and Expression vectors Lecture 30 Eukaryotic Protein Expression Systems –I Lecture 31 Eukaryotic Protein Expression Systems –II Lecture 32 Eukaryotic Protein Expression Systems –III Lecture 33 Human Gene Therapy Lecture 34 DNA Vaccines Lecture 35 Transgenic Animals Lecture 36 Transgenic Plants Lecture 37 Knockout Mice What are knockout mice? A knockout mouse is a mouse in which a specific gene has been inactivated or “knocked out” by replacing it or disrupting it with an artificial piece of DNA. The loss of gene activity often causes changes in a mouse's phenotype and thus provides valuable information on the function of the gene. Researchers who developed the technology for the creation of knockout mice won Nobel Prize in the year 2007 The Nobel Prize in Physiology or Medicine 2007 was awarded jointly to Mario R. Capecchi, Sir Martin J. Evans and Oliver Smithies "for their discoveries of principles for introducing specific gene modifications in mice by the use of embryonic stem cells". Mario R. Capecchi Sir Martin J. Evans Oliver Smithies The ability to delete or mutate any gene of interest in mice has transformed the landscape of mammalian biology research. Cultivation of embryonic stem (ES) cells – Martin Evans • Gene targeting – Oliver Smithies • Gene knockout – Mario Capecchi Gene correction by Oliver Smithies Targeted correction of a mutant HPRT gene in mouse ES cells. Nature 330:576-8, 1987 This modification of a chosen gene in pluripotent ES cells demonstrates the feasibility of this route to manipulating mammalian genomes in predetermined ways. -------------------------------------------------------------------------------------- Nature. 1985 Sep 19-25;317(6034):230-4.
    [Show full text]
  • Step-By-Step Knockout (Dsdna) Protocol.Pdf
    Court Lab Protocol 3/21/11 Recombineering: Using Drug Cassettes to Knock out Genes in vivo James A. Sawitzke1, Lynn C. Thomason2, Mikhail Bubunenko1,2, Xintian Li1, Nina Costantino1, and Donald L. Court1 1Molecular Control and Genetics Section, Gene Regulation and Chromosome Biology Laboratory, Center for Cancer Research, National Cancer Institute at Frederick, Frederick, MD 21702 2Gene Regulation and Chromosome Biology Laboratory, Basic Science Program, SAIC-Frederick, Inc., National Cancer Institute at Frederick, Frederick, MD 21702 Purpose A “gene knockout” or “knockout” is a mutation that inactivates a gene function. These mutations are very useful for classical genetic studies as well as for modern techniques including functional genomics. In the past, knockouts of bacterial genes were often made by transposon mutagenesis. In this case, laborious screens are required to find a knockout in the gene of interest. Knockouts of other organisms have traditionally been made by first using in vitro genetic engineering to modify genes contained on plasmids or Bacterial Artificial Chromosomes (BACs) and later moving these modified constructs to the organism of interest by cell culture techniques. Other methods utilizing a combination of genetic engineering and in vivo homologous recombination were inefficient at best. Recombineering provides a new way to generate knockout mutations directly on the bacterial chromosome or to modify any plasmid or BAC in vivo as a prelude to making knockouts in other organisms. The constructs are designed to the base pair and are not dependent on suitable restriction sites. A drug cassette can be placed anywhere within a gene or the open reading of the gene can be replaced with the drug cassette.
    [Show full text]
  • Generation of Mouse Conditional Knockout Alleles in One Step Using the I-GONAD Method
    Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press Method Generation of mouse conditional knockout alleles in one step using the i-GONAD method Renjie Shang,1,2 Haifeng Zhang,1 and Pengpeng Bi1,2 1Center for Molecular Medicine, University of Georgia, Athens, Georgia 30602, USA; 2Department of Genetics, University of Georgia, Athens, Georgia 30602, USA The Cre/loxP system is a powerful tool for gene function study in vivo. Regulated expression of Cre recombinase mediates precise deletion of genetic elements in a spatially– and temporally–controlled manner. Despite the robustness of this system, it requires a great amount of effort to create a conditional knockout model for each individual gene of interest where two loxP sites must be simultaneously inserted in cis. The current undertaking involves labor-intensive embryonic stem (ES) cell– based gene targeting and tedious micromanipulations of mouse embryos. The complexity of this workflow poses formida- ble technical challenges, thus limiting wider applications of conditional genetics. Here, we report an alternative approach to generate mouse loxP alleles by integrating a unique design of CRISPR donor with the new oviduct electroporation technique i-GONAD. Showing the potential and simplicity of this method, we created floxed alleles for five genes in one attempt with relatively low costs and a minimal equipment setup. In addition to the conditional alleles, constitutive knockout alleles were also obtained as byproducts of these experiments. Therefore, the wider applications of i-GONAD may promote gene func- tion studies using novel murine models. [Supplemental material is available for this article.] Our understanding of the genetic mechanisms of human diseases strains are readily available, generation of the loxP-flanked (floxed) has been largely expanded by loss-of-function studies using engi- alleles is challenging and labor-intensive due to the lack of an effi- neered mouse models.
    [Show full text]
  • Prospects of Gene Knockouts in the Functional Study of MAMP-Triggered Immunity: a Review
    International Journal of Molecular Sciences Review Prospects of Gene Knockouts in the Functional Study of MAMP-Triggered Immunity: A Review Benedict C. Offor , Ian A. Dubery and Lizelle A. Piater * Department of Biochemistry, University of Johannesburg, Auckland Park 2006, South Africa; benedictoff[email protected] (B.C.O.); [email protected] (I.A.D.) * Correspondence: [email protected]; Tel.: +27-11-559-2403 Received: 5 March 2020; Accepted: 1 April 2020; Published: 6 April 2020 Abstract: Plants depend on both preformed and inducible defence responses to defend themselves against biotic stresses stemming from pathogen attacks. In this regard, plants perceive pathogenic threats from the environment through pattern recognition receptors (PRRs) that recognise microbe-associated molecular patterns (MAMPs), and so induce plant defence responses against invading pathogens. Close to thirty PRR proteins have been identified in plants, however, the molecular mechanisms underlying MAMP perception by these receptors/receptor complexes are not fully understood. As such, knockout (KO) of genes that code for PRRs and co-receptors/defence-associated proteins is a valuable tool to study plant immunity. The loss of gene activity often causes changes in the phenotype of the model plant, allowing in vivo studies of gene function and associated biological mechanisms. Here, we review the functions of selected PRRs, brassinosteroid insensitive 1 (BRI1) associated receptor kinase 1 (BAK1) and other associated defence proteins that have been identified in plants, and also outline KO lines generated by T-DNA insertional mutagenesis as well as the effect on MAMP perception—and triggered immunity (MTI). In addition, we further review the role of membrane raft domains in flg22-induced MTI in Arabidopsis, due to the vital role in the activation of several proteins that are part of the membrane raft domain theory in this regard.
    [Show full text]
  • CRISPR-Based Editing Techniques for Genetic Manipulation of Primary T Cells
    Review CRISPR-Based Editing Techniques for Genetic Manipulation of Primary T Cells Mateusz Kotowski and Sumana Sharma * MRC Human Immunology Unit, John Radcliffe Hospital, University of Oxford, Oxford OX3 9DS, UK; [email protected] * Correspondence: [email protected] Received: 15 October 2020; Accepted: 14 November 2020; Published: 18 November 2020 Abstract: While clustered regularly interspaced short palindromic repeats (CRISPR)-based genome editing techniques have been widely adapted for use in immortalised immune cells, efficient manipulation of primary T cells has proved to be more challenging. Nonetheless, the rapid expansion of the CRISPR toolbox accompanied by the development of techniques for delivery of CRISPR components into primary T cells now affords the possibility to genetically manipulate primary T cells both with precision and at scale. Here, we review the key features of the techniques for primary T cell editing and discuss how the new generation of CRISPR-based tools may advance genetic engineering of these immune cells. This improved ability to genetically manipulate primary T cells will further enhance our fundamental understanding of cellular signalling and transcriptional networks in T cells and more importantly has the potential to revolutionise T cell-based therapies. Keywords: primary T cells; CRISPR/Cas9; genome-editing; CAR-T cells 1. Introduction In recent years, clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR- associated protein 9 (Cas9)-based techniques have transformed our ability to genetically manipulate mammalian genomes. Among the many fields within biomedical research to benefit from the ease of genetic manipulation using the CRISPR/Cas9 system is the study of the immune system and especially T cells.
    [Show full text]
  • Generating Mouse Models for Biomedical Research: Technological Advances Channabasavaiah B
    © 2019. Published by The Company of Biologists Ltd | Disease Models & Mechanisms (2019) 12, dmm029462. doi:10.1242/dmm.029462 AT A GLANCE Generating mouse models for biomedical research: technological advances Channabasavaiah B. Gurumurthy1,2 and Kevin C. Kent Lloyd3,4,* ABSTRACT recombination in embryonic stem cells has given way to more refined Over the past decade, new methods and procedures have been methods that enable allele-specific manipulation in zygotes. We also developed to generate geneticallyengineered mouse models of human highlight advances in the use of programmable endonucleases that disease. This At a Glance article highlights several recent technical have greatly increased the feasibility and ease of editing the mouse advances in mouse genome manipulation that have transformed genome. Together, these and other technologies provide researchers our ability to manipulate and study gene expression in the mouse. with the molecular tools to functionally annotate the mouse genome We discuss how conventional gene targeting by homologous with greater fidelity and specificity, as well as to generate new mouse models using faster, simpler and less costly techniques. 1Developmental Neuroscience, Munroe Meyer Institute for Genetics and KEY WORDS: CRISPR, Genome editing, Mouse, Mutagenesis Rehabilitation, University of Nebraska Medical Center, Omaha, NE 68106-5915, USA. 2Mouse Genome Engineering Core Facility, Vice Chancellor for Research Office, University of Nebraska Medical Center, Omaha, NE 68106-5915, USA. Introduction 3Department
    [Show full text]
  • Cutting Eugenics out of CRISPR-Cas9
    Ethics in Biology, Engineering & Medicine - An International Journal, 6(3–4): 263–279 (2015) Cutting Eugenics Out of CRISPR-Cas9 Carolyn Brokowski,a,* Marya Pollack,b & Robert Pollackc aBioethics (Medical Ethics) Department, Columbia University School of Professional Studies, New York, New York; bDepartment of Psychiatry, Columbia University College of Physicians and Surgeons, Inwood Clinic, New York, New York; cBiological Sciences Department, Columbia University School of the Arts, New York, New York *Address all correspondence to: Carolyn Brokowski, M.S. Candidate; Bioethics (Medical Ethics) Department, Columbia University School of Professional Studies, 203 Lewisohn Hall, 2970 Broadway, MC 4119, New York, NY 10027; E-mail: [email protected] ABSTRACT: The use of clustered regularly interspaced short palindromic repeats (CRISPR) and their associated (Cas) proteins (the CRISPR-Cas system) in genomic engineering is among the most promising biomedical innovations to occur in the last few decades. One of this system’s most profound features is its ability to edit genomes with impressive specificity, which may cause significant alterations of cellular, tissue, and organismal phenotypes at the near instance of the editing, over the lifespan of the organism and potentially into any number of future genera- tions. We argue that the use of the CRISPR-Cas9 system to edit the human germline should be legally prohibited on account of the system’s potential for generating an unjust eugenic future. Its use in nongermline experimentation and applications, however, should not be constrained on eugenic grounds. Such a blanket legal prohibition might limit the progress gleaned from this technology. Allowing experimentation in human subjects more broadly might expose par- ticipants to considerable risk and potentially harmful outcomes, and the system might prove unable to realize tangible therapeutic outcomes that seem likely ex ante.
    [Show full text]
  • Gene Knockout: the Technology of Gene Targeting
    Gene Knockout: the Technology of Gene Targeting Petar Tomev Mitrikeski Institute for Research and Development of Sustainable Ecosystems FSB-CTT, Ivana Lučića 5, HR-10000 Zagreb, Croatia [email protected] Abstract The technology of gene knockout is based on gene targeting, a useful technique that utilizes homologous recombination to modify the genome of a living organism primordially developed in yeast Saccharomyces cerevisiae. During this process an in vitro engineered exogenous DNA fragment is transformed into a cell in order to permanently modify targeted genomic counterpart creating a selectable and heritable genomic change. This property allows extensive utilization of such a technological approach in both basic and applied research. Introduction Genomes of living organisms could be altered by gene targeting technology (targeted insertion mutagenesis) utilizing homologous recombination and producing a selectable and heritable genomic change that pursues a specific scientific or technological purpose. During this process an in vitro engineered exogenous DNA sequence (i.e. plasmid, altered gene or engineered disruption cassette) is transformed into a cell in order to recombine with the targeted genomic counterpart leading to an anticipated genetic rearrangement. As a result, the targeted genomic sequence is either modified or entirely replaced by the transforming sequence although other less- or un-desired outcomes are possible. Both basic and applied scientific studies extensively utilize such a technological approach in their research strategies. Organisms altered in this way are known by various designations but, however, the most accepted is the term genetically modified organisms, although labels such as knockout organisms or simply knockouts are equally accepted. To date, this technology has been successfully applied in many organisms starting from unicellular eukaryotes and ending with mammalians including even human cells.
    [Show full text]
  • Altogen Transfection Protocol
    Altogen Biosystems 848 Rainbow Blvd Suite 823 Las Vegas, NV 89107 USA Tel. (702) 349-6103 Fax. (702) 989-0841 E-mail: [email protected] Web: www.altogen.com HEK-293 CRISPR Transfection Kit (for Epithelial Kidney Cells, CRL-1573) Catalog No. 2149 Size: 1.5 ml Contents and Shipping: HEK-293 CRISPR Transfection Kit includes HEK-293 CRISPR Transfection Reagent (1.5 ml), Transfection Enhancer (0.5 ml), and Complex Condenser (0.5 ml). HEK-293 CRISPR Transfection Reagent is supplied in liquid form at a concentration of 1 mg/ml, shipped at ambient temperature. Description: Proprietary formulation reagent optimized for CRISPR/Cas9 genetic modification procedures. HEK-293 Cell Line Description: The HEK-293 cell line was isolated in 1977 from human embryonic kidney cells exposed to DNA of sheared adenovirus type 5. HEK-293 is also known as HEK (Human Embryonic Kidney) and originates from a healthy aborted human fetus. During the transformation of HEK cells, 4.5 kilobases of the viral genome have been incorporated into chromosome 19. HEK-293 cells have been known as a cellular test tube and are commonly employed for a variety of biomedical applications. Also, HEK 293 is widely used in biotechnology and pharmaceutical studies, supporting vaccine production. Storage: Store reagent at 4ºC upon receipt. If stored properly, reagent is stable for 6 months. Intended Use: For in vitro use only. Required materials (not included in the kit): Cas9 NLS protein crRNA and tracrRNA (for manual sgRNA formation) sgRNA * Altogen Biosystems do not provide Cas9 protein, tracrRNA, or crRNA. **These components of CRISPR/Cas9 gene editing systems must be obtained separately.
    [Show full text]
  • Application of Genome Editing Technology in Human Gene Therapy
    Translat Regulat Sci. 2(3): 100–106, 2020; doi: 10.33611/trs.2020-007 REVIEW Genome/Epigenome Application of genome editing technology in human gene therapy Kohnosuke MITANI1* 1 Division of Gene Therapy and Genome Editing, Research Center for Genomic Medicine, Saitama Medical University, 1397-1 Yamane, Hidaka, Saitama 350-1241, Japan Abstract. In recent years, gene therapy drugs have finally been approved in Europe, the U.S., and Japan. In parallel with this, advances in genome editing technologies have enabled therapeutic strategies by gene knockout and gene repair, which were difficult with conventional so-called gene addition therapy. Worldwide, over 30 clinical trials of genome editing therapy have already been conducted, and some protocols have shown not only safety but also therapeutic efficacy. In the clinical application of genome editing, in addition to the technical hurdles of conventional gene therapy, there are problems specific to genome editing technology, such as the risk of introducing DNA mutations due to off-target activity of enzymes and the immune response to the artificial nucleases. It is necessary to consider the objective risk and benefit in comparison to existing therapeutic protocols. It is also essential to further develop technologies for therapeutic application in a wider range of diseases. Key words: gene knockout, gene repair, gene therapy, genome editing Highlights In recent years, genome editing has quickly become a popular biological tool. The applications range from basic science to therapeutic drugs, in medicine and other biological fields. The therapeutic application of genome editing can be considered a form of gene therapy, which has also been drawing increased attention.
    [Show full text]