Targeted Gene Knockout in Chickens Mediated by Talens

Targeted gene knockout in chickens mediated by TALENs

Tae Sub Parka,b, Hong Jo Leea, Ki Hyun Kima, Jin-Soo Kimc, and Jae Yong Hana,1

aDepartment of Agricultural Biotechnology and Research Institute of Agriculture and Life Sciences, College of Agriculture and Life Sciences, Seoul National University, Seoul 151-921, Korea; bInstitute of Green-Bio Science and Technology, Seoul National University, Pyeongchang-gun, Gangwon-do 232-916, Korea; and cDepartment of Chemistry, College of Natural Science, Seoul National University, Seoul 151-921, Korea

Edited by James E. Womack, Texas A&M University, College Station, TX, and approved July 30, 2014 (received for review June 7, 2014) Genetically modified animals are used for industrial applications as the mRNA that encodes TALENs or ZFNs was injected to well as scientific research, and studies on these animals contribute generate target gene-modified animals. However, programmable to a better understanding of biological mechanisms. Gene target- gene-edited poultry have not yet been reported. Unfortunately, ing techniques have been developed to edit specific gene loci in the one-cell-stage injection method cannot be used to generate the genome, but the conventional strategy of homologous recom- gene knockout chickens because the accessibility and manipu- bination with a gene-targeted vector has low efficiency and many lation of single-cell-stage embryos are very difficult and hatch- technical complications. Here, we generated specific gene knockout ability is too low. chickens through the use of transcription activator-like effector nuclease (TALEN)-mediated gene targeting. In this study, we accom- Results ovalbumin OV plished targeted knockout of the ( ) gene in the chicken TALEN Validation for Chicken Genome Editing. To verify TALEN primordial germ cells, and OV gene mutant offspring were generated activity in the chicken genome, effective TALEN expression through test-cross analysis. TALENs successfully induced nucleotide constructs for three different genes [DsRed reporter, β1,4-gal- OV deletion mutations of ORF shifts, resulting in loss of chicken gene actosyltransferase 1 (B4GALT1), and β-actin] were designed and function. Our results demonstrate that the TALEN technique used in synthesized (Fig. S1). After each TALEN plasmid set was the chicken primordial germ cell line is a powerful strategy to create transfected into a regular or DsRed-expressing DF1 chicken cell SCIENCES specific genome-edited chickens safely for practical applications. AGRICULTURAL line, we analyzed induced mutations in a targeted locus with a T7 endonuclease I (T7E1) assay and DNA sequencing (Fig. 1A and genetic modification | programmable genome editing | germ-line Fig. S2). The mutation ratios in DsRed-negative cells were chimera | poultry | egg protein 55.6% and 54.5% in DsRed TALEN 1 and DsRed TALEN 2, respectively (Fig. S2A). TALENs induced deletion/insertion ince knockout mice were generated using target locus dis- – mutants in the DsRed gene, which resulted in DsRed gene fra- Sruption by homologous recombination (1 4), the knockout meshifts (Fig. S2A). Next, to verify TALEN activity for genetic system has revolutionized the research field of functional modification of chicken genes, TALENs targeted specifically to genomics by allowing the analysis of specific gene functions in chicken B4GALT1 and β-actin genes were constructed. To select vivo (5). In avian species, however, germ-line-competent em- for TALEN-transfected DF1 cells after transfection, we in- bryonic stem cells are lacking, and adapting somatic cell nuclear troduced a CMV-GFP expression reporter plasmid along with transfer and cloning are technically difficult; thus, targeted ge- the TALENs in which the DNA molecular weight ratio was 1:1:1 nome editing by homologous recombination is very difficult. (CMV GFP:TALEN R:TALEN L). One day after transfection, Furthermore, birds have many evolutionary differences compared with mammals in terms of physiological characteristics and developmental processes (6). Therefore, conventional gene tar- Significance geting techniques established in experimental animals are not easily applied to avian species. However, Schusser and col- Targeted gene knockout by editing specific loci in genome has leagues (7) reported gene-targeted chickens through the use of revolutionized the field of functional genomics. Transcription homologous recombination. activator-like effector nucleases (TALENs) are representative Novel approaches have been recently designed to efficiently next-generation platforms for customized genomic editing in produce animals that are genetically altered in specific genomic transgenic animals, as well as cultured cells in vitro. In this sequences; zinc-finger nuclease (ZFN) (8–10) and transcription study, in combination with chicken primordial germ cell line oval- activator-like effector nuclease (TALEN) (11–16) are represen- with germ-line transmission capacity, we generated the bumin tative next-generation platforms for customized genomic editing gene knockout chickens by TALEN-mediated gene tar- in transgenic animals, as well as in cultured cells in vitro. ZFNs geting. Our results extended the application of state-of-the-art and TALENs containing a DNA-binding domain and Fok I nu- TALEN technology from experimental animals to farm animals. clease domain are currently crucial tools to dissect individual As TALEN-mediated knockout chickens are genetically modified gene function in complicated biological systems with targeted but nontransgenic, without genomic integration of any exog- genetic deletions and alterations. The targeted gene becomes enous transgenes, specific genomic editing with TALENs could expedite the generation of genetically engineered chickens for inoperative by generating a double-strand DNA break and agriculturally practical applications as well as for model animals. a frameshift-induced mutation during the repair process (11, 17).

To date, these versatile engineered hybrid proteins have been Author contributions: T.S.P., J.-S.K., and J.Y.H. designed research; T.S.P., H.J.L., and K.H.K. applied to various animal species, including human embryonic performed research; T.S.P., H.J.L., and K.H.K. analyzed data; and T.S.P., J.-S.K., and J.Y.H. stem cells (17). ZFN-mediated genomic modifications have been wrote the paper. used to mutate specific genes in vertebrates such as mice, rats, The authors declare no conflict of interest. and pigs (8, 9). TALENs were first adapted to human cells (11), This article is a PNAS Direct Submission. and a heritable mutant mouse was efficiently generated after 1To whom correspondence should be addressed. Email: [email protected]. microinjection of specific locus-targeted TALENs into fertilized This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. one-cell embryos (15). In one-cell-stage embryos of mammals, 1073/pnas.1410555111/-/DCSupplemental.

www.pnas.org/cgi/doi/10.1073/pnas.1410555111 PNAS Early Edition | 1of6 Downloaded by guest on September 25, 2021 A &U4GF 6#.'0 &U4GF 6#.'0 TGIWNCT&( )CN66#.'0 )CN66#.'0 TGIWNCT&( ƅCEVKP 6#.'0 ƅCEVKP6#.'0 TGIWNCT&( 6' 6' 6'

ߨ ߨ ߨ ߨ ߨ ߨ ߨ ߨ ߨ ߨ ߨ ߨ

OWVCPV OWVCPV OWVCPV

B 186#.'0. 0VGTO 4GRGCVFQOCKP (QM + ---TGCTGTTTGCTCTAGACAACTCAGAGTTCACCATGGGCTCCATCGGTGCAGCAAGCA---

---ACGACAAACGAGATCTGTTGAGTCTCAAGTGGTACCCGAGGTAGCCACGTCGTTCGT--- Q + (QM 4GRGCVFQOCKP 0VGTO 186#.'04

186#.'0 186#.'0 TGIWNCT&( TGIWNCT 186#.'0 6' 6'

ߨ ߨ ߨ ߨ &(OWVCPV 2)%OWVCPV

C 186#.'0 OWVCPVKP2)%U M G S I G A A S amino acids TGCTGTTTGCTCTAGACAACTCAGAGTTCACC ATG GGC TCC ATC GGT GCA GCA AGC A wild (8x) TGCTGTTTGCTCTAGACAACTCAGAGTT------G GGC TCC ATC GGT GCA GCA AGC A 6nt del (1x) TGCTGTTTGCTCTAGACAACTCA------CC ATG GGC TCC ATC GGT GCA GCA AGC A 7nt del (1x) TGCTGTTTGCTCTAGACAACTCAGAGTTC------TC GGT GCA GCA AGC A 13nt del (1x) ------ACC ATG GGC TCC ATC GGT GCA GCA AGC A 29nt del (1x)

Fig. 1. Genomic mutation analysis after TALEN introduction into chickens. (A) T7E1 assay of TALEN target sites for DsRed, B4GALT1, and β-actin in the chicken DF1 cell line. (B) Schematic TALEN design for the chicken OV gene. DNA-binding (left in red or right in blue) and spacer sequences (in black) are presented for OV TALEN 2. T7E1 assay of chicken DF1 cells mutated with OV TALEN 1 or 2 (Left), and chicken PGCs (SNUhp26) mutated with OV TALEN 2 (Right). (C) Mutated target DNA sequences of chicken PGCs with OV TALEN 2. A dash in the DNA sequences denotes the deleted nucleotides, and bold ATG indicates the translational initiation codon in the second exon of the OV gene.

GFP-positive cells were sorted by FACS, as it was expected that Mutation Induction of OV Gene in Chicken PGCs by TALENs. Genetic GFP-expressing cells were also delivered with both right and left engineering techniques, such as stem cell-based and somatic cell TALEN constructs. After 10–14 d of in vitro culture, we exam- nuclear transfer-mediated modifications, are difficult to apply in ined mutations in chicken B4GALT1 and β-actin genes with avian species because of technical difficulties associated with a T7E1 assay (Fig. S2 B and C). TALEN-induced mutated manipulating avian oocytes and accessing the oocyte nucleus. To frameshift efficiency was 36.4–60.0% in B4GALT1 and 8.3–9.1% overcome the technical obstacles of genomic modification in chickens, we recently established chicken primordial germ cell in β-actin (Fig. S2 B and C). Various mutant genotypes and (PGC) lines with germ-line transmission capacity (18). We ap- lengths were induced by TALENs in each gene: 1–33 nucleotide – plied the same combination of techniques to the PGC line, using deletions and one additional nucleotide insertion (Fig. S2 A C). fluorescence-positive separation 1 d after cotransfection with the Thus, the combination of cotransfection and FACS sorting with GFP vector and OV TALEN 2 set. PGC transient transfection GFP expression was an effective and practical approach to efficiency was relatively low compared with DF1 cells; in general, selecting chicken cells with TALEN-mediated mutants of en- GFP-expressing PGCs were sorted at less than 5% compared dogenous genes in the chicken genome. with 30–40% in DF1 cells 1 d after cotransfection with GFP and Next, to investigate whether specific gene-targeted chickens TALEN plasmids (Figs. S2 B and C and S4). When the OV could be generated by a TALEN-mediated approach through TALEN 2 set was introduced into the SNUhp26 male PGC line germ-line transmission, we synthesized TALEN plasmid con- (Fig. S4), we found that OV TALEN 2 effectively induced nu- structs specific to the chicken ovalbumin (OV) gene, which cleotide deletions at the targeted locus (Fig. 1 B and C). TALEN- encodes a major protein in hen egg white. Two OV TALENs mediated mutations in chicken PGCs were 6–29 nucleotide dele- designed to disrupt the translational initiation codon (i.e., ATG) tions that induced frameshifts as well as in-frame mutations (Fig. in chicken OV gene exon 2 (Fig. 1B and Fig. S3A) were trans- 1C). In some mutations, nucleotides were deleted before the ATG fected into chicken DF1 cells to measure the chicken genomic start codon without any ORF shift, whereas mutations in the ATG site caused complete substitution in amino acid sequences, likely modification efficacy. Through T7E1 assay and DNA sequencing resulting in abolishment of the ovalbumin protein (Fig. 1C). analysis, we observed that OV TALEN 2 actively mutated the Notably, DF1 cells had more various mutant genotypes com- ovalbumin target locus (Fig. 1B and Fig. S3B). However, OV pared with chicken PGCs (Fig. 1C and Fig. S3B). Furthermore, TALEN 1 constructs did not induce mutation at the target site additional nucleotide insertion mutants were found in DF1 cells, (Fig. 1B). The frequency of mutations was 36.7% with OV although no insertion mutant was detected in chicken PGCs. TALEN 2 in the DF1 cell line (Fig. S3B). Thus, the effective OV However, no significant difference in mutation efficiency was TALEN 2 set was applied to chicken germ cells for the pro- observed between DF1 cells and PGCs (36.7% versus 33.3% with duction of mutant chickens. OV TALEN 2).

2of6 | www.pnas.org/cgi/doi/10.1073/pnas.1410555111 Park et al. Downloaded by guest on September 25, 2021 A B &QPQT2)%FGTKXGFEJKEMU ,,

ߨ ߨ ߨ ߨ ߨ ߨ *[DTKFEJKEM ,L

M G S I G A A S amino acids C ID#648 TGCTGTTTGCTCTAGACAACTCAGAGTTCACC ATG GGC TCC ATC GGT GCA GCA AGC A wild ------GTTCACC ATG GGC TCC ATC GGT GCA GCA AGC A 29nt del

ID#704 TGCTGTTTGCTCTAGACAACTCAGAGTTCACC ATG GGC TCC ATC GGT GCA GCA AGC A wild TGCTGTTTGCTCTAGACAACTCAGAGT------CA GCA AGC A 21nt del frameshift ID#736 TGCTGTTTGCTCTAGACAACTCAGAGTTCACC ATG GGC TCC ATC GGT GCA GCA AGC A wild TGCTGTTTGCTCTAGACAACTCAGAGTT------G GGC TCC ATC GGT GCA GCA AGC A 6nt del frameshift ID#781 TGCTGTTTGCTCTAGACAACTCAGAGTTCACC ATG GGC TCC ATC GGT GCA GCA AGC A wild TGCTGTTTGCTCTAGACAACTCAGAGTT------G GGC TCC ATC GGT GCA GCA AGC A 6nt del frameshift

ID#784 TGCTGTTTGCTCTAGACAACTCAGAGTTCACC ATG GGC TCC ATC GGT GCA GCA AGC A wild TGCTGTTTGCTCTAGACAACTCAGAGTT------G GGC TCC ATC GGT GCA GCA AGC A 6nt del frameshift

ID#787 TGCTGTTTGCTCTAGACAACTCAGAGTTCACC ATG GGC TCC ATC GGT GCA GCA AGC A wild TGCTGTTTGCTCTAGACAACTCAGAGTT------G GGC TCC ATC GGT GCA GCA AGC A 6nt del frameshift ID#803 TGCTGTTTGCTCTAGACAACTCAGAGTTCACC ATG GGC TCC ATC GGT GCA GCA AGC A wild TGCTGTTTGCTCTAGACA------TG GGC TCC ATC GGT GCA GCA AGC A 15nt del frameshift SCIENCES AGRICULTURAL D 18OWVCPV 186#.'0EQPUVTWEVRNCUOKF RTQIGPKGU

RI RI RI HI HI YKNF

Fig. 2. (A) A germ-line chimeric male KOC founder (#4312) artificially inseminated a female WL. (B) The hatched chicks produced from the founder through test-cross and T7E1 assay of the offspring. Feather color of the donor WL (I/I)-derived chick was white, whereas the hybrid (I/i) chick produced from the recipient founder KOC had black spots. OV mutant chicks were identified by T7E1 assay. (C) Targeted DNA sequences in the OV gene were analyzed in the OV mutant donor PGC-derived offspring. A dash in the DNA sequences denotes deleted nucleotides, and bold ATG indicates the translational initiation codon in the second exon of the OV gene. (D) Detection of the OV TALEN 2 construct in mutant offspring by genomic PCR. OV TALEN 2 expression vector concentration was used as a series of 10-fold dilutions from 100 pg to 10 fg. Wild-type chicken genomic DNA was used as a negative control.

Production of Ovalbumin Mutant Chicks Through Germ-Line Chimeras. existence of two different genotypes (Fig. S5C). Through test-cross Subsequently, OV knockout White Leghorn (WL) chicken PGCs analysis, OV gene-targeted mutant offspring were successfully were transplanted into recipient Korean Oge chicken (KOC) produced from mutated donor chicken PGCs, yielding an 8.0% embryos to generate mutant offspring through germ-line trans- mutant rate on average in the chicken progenies (Fig. 2B and mission. After sexual maturation of the hatched founders (Fig. 2A Table 1). All mutant chickens had a monoallelic mutation because and Table S1), sperm from founder roosters was analyzed, using of mating between the germ-line chimeric rooster and wild-type WL or KOC strain-specific primers to detect PGC-differentiated hens (Fig. 2C). Similar to the founder sperm, four mutated alleles donor sperm from the founder roosters before test-cross. The were found in the targeted ovalbumin of knockout chickens (Fig. founders produced WL sperm as well as KOC sperm (Fig. S5A). 2C). This result indicated that chicken PGCs genetically edited Subsequently, the mutant sperm with TALEN-induced deletions with TALENs were germ-line-transmittable to the next generation were also detected by the T7E1 assay (Fig. S5B). DNA sequencing through proliferation and differentiation processes into fertile analysis with founder #4312 rooster sperm was conducted, and gametes. The hatched monoallelic knockout chicks were normal the mutant sperm rate was 18.8% (3/16), which demonstrated the and healthy without any phenotypic deformity (Fig. 2B).

Table 1. Efficiency of germ-line transmission derived from the founders and frequency of OV gene mutants in the offspring Number of Number of donor Number of OV mutant Founder ID hatched chicks PGC-derived chicks, %* chicks, %†

4309 87 20 (22.3) 0 (0.0) 4312 126 67 (53.2) 7 (10.4) Total 213 87 (40.8) 7 (8.0)

*Chicks derived from transplanted donor-PGCs in the recipient chickens. †Mutation was determined by T7E1 assay and targeted DNA sequencing.

Park et al. PNAS Early Edition | 3of6 Downloaded by guest on September 25, 2021 To assay TALEN-induced toxicity resulting from nonspecific modifying the genomes of various organisms because of its double-strand DNA breaks, potential off-targets were analyzed simple, practical use and robust cutting activity (27–30). CRISPR in OV TALEN 2-transfected PGCs and the knockout chicks by is an immune system that was discovered in bacteria (31). sequencing analysis. We detected no off-target mutations in- CRISPR RNA specifically recognizes complementary target duced by OV TALEN 2 in the genome of the hatched chicks or sequences of foreign DNA, and CRISPR-Cas nuclease generates in chicken PGCs (Table S2 and Fig. S6A). In addition, in the a double-strand break that induces nucleotide sequence muta- knockout chicks, we screened OV TALEN construct plasmids tions. Therefore, the feasibility and applicability of the CRISPR- that were transferred into PGCs to examine whether they con- Cas platform need to be examined for editing the avian genome. tained foreign transgenes in their genomic content. The designed The chicken as a classic model has unexcelled and valuable primer sets were highly sensitive and could detect 100-fg trans- advantages for gaining insights into biological processes and gene plasmid DNAs, which amounted to less than 0.3 copies in their significance. At this time, chicken PGCs can be successfully the chicken genome (Fig. 2D). However, no transgene sequence maintained in vitro without the loss of germ cell integrity (32, was detected in the ovalbumin-knockout chicks (Fig. 2D). No 33), and generating transgenic chickens is feasible using trans- GFP expression was observed in either of the mutant PGCs or poson elements in cultured chicken PGCs (18, 34). This study donor-derived chicks, indicating that the transgene was not demonstrated the creation of specific knockout chickens using randomly integrated into the chicken genome during trans- TALENs. Our results extended the application of state-of-the- fection or sorting procedures. In our previous report, the CMV art TALEN technology from experimental animals to farm ani- promoter-controlled GFP gene was strongly expressed in trans- mals. Tailored genome editing in chicken will open a new era to genic chicks as well as in PGCs that contained a single transgene advance knowledge not only for comprehensive understanding of copy in their genome (18). avian biology but also for agricultural applications. To generate economically important genetic resources, the conventional selec- Discussion tive breeding system based on individual or population crossbreeds Chickens have a diploid number of 78 chromosomes (2n = 78), is an expensive, time-consuming, and laborious process. Because which are classified into five pairs of macrochromosomes, five TALEN-mediated knockout chickens are genetically modified but pairs of intermediate chromosomes, and 28 pairs of micro- nontransgenic, because of the lack of genomic integration of ex- chromosomes and sex chromosomes (19). Chicken microch- ogenous transgenes (Fig. 2D), specific genomic editing with romosomes represent approximately one-third of the total TALENs could expedite the generation of genetically engineered genome size, and the majority of genes were assumed to be located chickens for agriculturally practical applications as well as for on microchromosomes (20). However, because of the small ar- model animals and embryo development studies. To our knowl- chitectural size of microchromosomes, genetic modification of edge, this is the first description of genetic knockout chickens specific microchromosome target loci could be difficult. In this through germ-line transmission of TALEN-edited PGCs. study, we validated TALEN accessibility and activity on the chicken B4GALT1 gene, which is located on the Z chromosome, and the Materials and Methods β-actin gene on microchromosome 14. Our results indicated that Experimental Animal Care. The care and experimental use of chickens were the TALEN system can be efficiently applied to modify specific approved by the Institute of Laboratory Animal Resources, Seoul National loci on chicken genome microchromosomes, albeit with various University (SNU-070823-5). All experimental birds, including WL and KOCs, efficiency depending on the target genes and sites. were maintained according to a standard management program at the The next steps should involve generating biallelic mutant hens University Animal Farm, Seoul National University, Korea. The procedures for through mating and breeding selection, as well as validating animal management, reproduction, and embryo manipulation adhered to ovalbumin protein deposition in mutant chicken egg white. Hen the standard operating protocols of our laboratory. egg white and egg white proteins occupy about 60% and 11%, TALEN Construction. To construct TALEN plasmids for DsRed, B4GALT1,and respectively, of the whole egg weight (21). Ovalbumin is a major β ∼ -actin genes, TALEN expression plasmids were assembled via the one-step protein and constitutes 54% of total egg white proteins (21). In Golden Gate cloning system, as described previously (16). Chicken OV TALENs an ovalbumin knockout hen, the percentages of each egg white were assembled using methods described in Sanjana and colleagues (35). Briefly, component could be changed, and it is necessary to examine three 18-mer tandem repeat hexamers were assembled individually by Golden whether the amount of small-quantity, high-value biofunctional Gate cloning, using the amplified monomers, and then treated with an exo- proteins such as cystatin could be increased or not. Because of nuclease to remove all linear DNA regions, leaving only the properly assembled the massive deposition of proteins, hen egg is considered to be tandem hexamers. Subsequently, each tandem hexamer was amplified, and the best animal model for bioactive material production (22, 23). after purification, the hexamers corresponding to 1–6, 7–12, and 13–18 were However, the excessive amount of ovalbumin hinders the puri- ligated into the TALEN cloning backbone. Finally, the TALEN constructs were fication processes of a small amount of biofunctional proteins. verified by DNA sequencing. Thus, egg white component modification provides a powerful DF1 Culture and Transfection for Fluorescence-Activated Cell Sorting. The tool for wide-ranging agricultural and industrial applications. chicken DF1 cell line was maintained and subpassaged in DMEM (Invitrogen, Using egg white composition-controlled eggs, a small quantity of Carlsbad, CA), supplemented with 10% FBS (Invitrogen) and 1× antibiotic– therapeutic proteins in transgenic chicken bioreactors could be antimycotic (Invitrogen). DF1 cells were cultured in an incubator at 37 °C in

efficiently separated and isolated. In addition, we need to further an atmosphere of 5% CO2 and 60–70% relative humidity. To generate the examine the economic traits, such as egg production, egg size, DsRed-expressing DF1 subline, plasmid DNA with the DsRed gene expressed and chicken embryo development, in the ovalbumin knockout by CMV immediate-early enhancer/promoter and neomycin-resistance gene chickens with the different mutant genotypes. Other egg white with Simian vacuolating virus 40 promoter was transfected into chicken DF1 proteins, such as ovomucoid and ovotransferrin, are well-known cells using Lipofectamine reagent (Invitrogen), according to the manu- ’ μ major allergy-inducing components. Such allergy-inducing com- facturer s protocol. One day after transfection, 300 g/mL G418 was added ponents can be eliminated by gene knockout with TALENs, and to the culture media, and DsRed-expressing cells were completely selected after 2 wk. these allergen-reduced eggs could be used for vaccine production For DsRed gene knockout, 10 μL Lipofectamine reagent and 2.5 μgof or even food consumption. each DsRed TALEN plasmid set were incubated in 250 μL OPTI-MEM (Invi- A new genome editing tool platform was recently reported: trogen) at room temperature. After 5 min incubation, Lipofectamine and Clustered Regularly Interspaced Short Palindromic Repeats- DsRed TALENs were combined and incubated for an additional 20 min. The CRISPR-associated (CRISPR-Cas) (24–26). Compared with complex mixture was gently pipetted and dropped into a well of a 6-well TALENs, CRISPR-Cas is a fast and cost-effective system for plate at 70–80% DF1 cell confluency. For chicken B4GALT1, β-actin, and OV

4of6 | www.pnas.org/cgi/doi/10.1073/pnas.1410555111 Park et al. Downloaded by guest on September 25, 2021 gene knockout, CMV GFP expression plasmid vector and each TALEN set of value between the two TAL effectors was set from 10 to 30 bp. The target genes were cotransfected at a ratio of 1:1:1 (2.5 μg:2.5 μg:2.5 μg = remaining setting values: “Score Cutoff,”“Upstream Base, ” and “Dimer

CMV GFP:TALEN R:TALEN L). After incubation at 37 °C in 5% CO2 for 6 h, Types to Find” were set to “3.0,”“T only,” and “Both,” respectively, as cells were gently washed with PBS three times, and new culture medium was recommended by the tool. For analysis, three target sites that had the best added. One day after lipofection, GFP-expressing cells were sorted using scores (i.e., the sum of two TAL scores) were chosen. The genomic sequences a FACSAria III cell sorter (Becton, Dickinson and Company, Franklin Lakes, of three sites were amplified by PCR, using primer sets for off-targets on NJ). After total cells were harvested using 0.05% trypsin-EDTA (Invitrogen), chromosome 9 (forward: 5′-AGG GAA GGG ACA AAG AGC CT-3′ and reverse: cells were resuspended in PBS containing 1% BSA and strained through 5′-GGT GGC TGT GGT ATG GTT CT-3′), chromosome 3 (forward: 5′-CAG CCA μ a cell strainer for FACS separation (40 m; BD Falcon; Becton, Dickinson AAG AGA CCC AGA GG-3′ and reverse: 5′-TCC AGG GAG TTC TGA GAG GG-3′), and Company). and chromosome 4 (forward: 5′-GTT TTG GTT CCA GCA GTG GC-3′ and reverse: 5′-CTA CCT GAG CAA CAG GGC TC-3′), cloned into the pGEM-T easy vector PGC Culture and Transfection for FACS Sorting. In a previous report (18), we (Promega) and sequenced. established a male chicken PGC line (SNUhp26) from WL embryonic gonads at day 6 (stage 28). The SNUhp26 PGC line was maintained and subpassaged Microinjection of Chicken Ovalbumin Mutant PGCs into Recipients. To inject OV with knockout DMEM (Invitrogen) supplemented with 20% FBS (Invitrogen), mutant PGCs into recipient embryos, a small window was made on the × 2% chicken serum (Sigma-Aldrich, St. Louis, MO), 1 nucleosides (Millipore, pointed end of the recipient KOC egg, and a 2-μL aliquot containing more × β Temecula, CA), 2 mM L-glutamine, 1 nonessential amino acids, -mercap- than 3,000 PGCs was microinjected with a micropipette into the dorsal aorta toethanol, 10 mM sodium pyruvate, 1× antibiotic–antimycotic (Invitrogen), of the recipient embryo. The egg window of the recipient embryo was and human basic fibroblast growth factor (10 ng/mL; Koma Biotech, Seoul, sealed with paraffin film, and the egg was incubated with the pointed end Korea). Chicken PGCs were cultured in an incubator at 37 °C with an at- down until hatching. We determined the sex of hatched chicks using W mosphere of 5% CO and 60–70% relative humidity. The cultured PGCs were 2 chromosome-specific primers (forward: 5′-CTA TGC CTA CCA CAT TCC TAT subcultured onto mitomycin-inactivated mouse embryonic fibroblasts (MEFs) TTG C-3′ and reverse: 5′-AGC TGG ACT TCA GAC CAT CTT CT-3′), and only in 5–6-d intervals by gentle pipetting without any enzyme treatment. male chicks were used for test-cross analysis after sexual maturation. PCR Similar to DF1 cells, the CMV GFP expression plasmid vector and each OV was performed with an initial incubation at 94 °C for 5 min, followed by 35 TALEN were cotransfected at a ratio of 1:1:1 (2.5 μg:2.5 μg:2.5 μg = CMV GFP: cycles at 94 °C for 30 s, 66 °C for 30 s, and 72 °C for 30 s. The reaction was TALEN R:TALEN L). One day after lipofection, GFP-expressing PGCs were sorted using a FACSAria III cell sorter (Becton, Dickinson and Company). terminated by a final incubation at 72 °C for 7 min. After harvesting, PGCs were resuspended in PBS containing 1% BSA and strained through a cell strainer for FACS separation (40 μm; BD Falcon; Test-Cross Analysis and Detection of Mutant Chickens. WLs with a dominant pigmentation inhibitor gene (I/I) and KOCs with a recessive pigmentation Becton, Dickinson and Company). SCIENCES

inhibitor gene (i/i) were used for the donor PGCs and the recipient embryos, AGRICULTURAL T7E1 Assay and DNA Sequencing Analysis. Genomic DNA was extracted from respectively. Through test-cross analysis by mating with WL hens (I/I), the DF1 cells or chicken PGCs after transfection of each TALEN set and FACS germ-line chimeras were identified by offspring phenotype. Endogenous sorting. For the T7E1 assay (36), the genomic region encompassing the TALEN germ cells in the KOC recipient males (i/i) produced hybrid chicks (I/i) with target site was amplified with a specific primer set for DsRed, chicken black spots, whereas WL donor-derived germ cells (I/I) produced white chicks B4GALT1, β-actin,orOV gene (Table S3). We found the single nucleotide with I/I. Offspring derived from the transplanted mutant PGCs were sc- polymorphism of the first PCR amplicon of the OV gene in PGC line, and the reened using T7E1 assay, and the mutant genotype of individual chicks was nested products after second PCR were used for T7E1 assay (Table S3). The subsequently identified by DNA sequencing (Fig. S6B). amplicons were reannealed to form a heteroduplex DNA structure after denaturation. Subsequently, the heteroduplex amplicons were treated with Transgene Detection in Mutant Offspring. To investigate whether any trans- 5 units T7E1 (New England Biolabs, Ipswich, MA) for 15 min at 37 °C and gene was integrated into the mutant chicken genome, genomic PCR was then analyzed by agarose gel electrophoresis. T7E1 assay for founder sperm conducted. OV TALEN 2 expression vector-specific primer sets were used and offspring was also conducted using the same protocol. To confirm tar- (forward: 5′-GTG GGG AGC CCG ATT GAT TA-3′ and reverse: 5′-TTC AAC CGT get locus mutation, PCR amplicons were cloned into a pGEM-T easy vector GTG AGC TGG GC-3′). PCR was performed with an initial incubation at 94 °C (Promega, Madison, WI) and sequenced with an ABI 3730XL DNA Analyzer for 5 min, followed by 35 cycles at 94 °C for 30 s and 68 °C and 72 °C for 30 s. (Applied Biosystems, Foster City, CA). The reaction was terminated by a final incubation at 72 °C for 7 min. OV TALEN 2 expression vector concentration was used as a series of 10-fold dilu- Off-Target Prediction and Analysis. Potential chicken OV TALEN 2 off-targets tions from 100 pg to 10 fg. Wild-type chicken genomic DNA was used as a were predicted using the web-based software program TAL Effector Nu- negative control. cleotide Targeter 2.0 (37) in the chicken genome. The chicken genome sequence was submitted by providing the latest GenBank Assembly ID ACKNOWLEDGMENTS. This work was supported by the Next-Generation (GCA_000002315.2). Two OV TALEN 2 repeat-variable di-residue sequences BioGreen 21 Program Grant PJ008142, Rural Development Administration, were submitted in the form required by the tool, and the spacer length Republic of Korea.

1. Thompson S, Clarke AR, Pow AM, Hooper ML, Melton DW (1989) Germ line trans- 11. Miller JC, et al. (2011) A TALE nuclease architecture for efficient genome editing. Nat mission and expression of a corrected HPRT gene produced by gene targeting in Biotechnol 29(2):143–148. embryonic stem cells. Cell 56(2):313–321. 12. Sander JD, et al. (2011) Targeted gene disruption in somatic zebrafish cells using 2. Koller BH, et al. (1989) Germ-line transmission of a planned alteration made in a hy- engineered TALENs. Nat Biotechnol 29(8):697–698. poxanthine phosphoribosyltransferase gene by homologous recombination in em- 13. Huang P, et al. (2011) Heritable gene targeting in zebrafish using customized TALENs. bryonic stem cells. Proc Natl Acad Sci USA 86(22):8927–8931. Nat Biotechnol 29(8):699–700. 3. Zijlstra M, Li E, Sajjadi F, Subramani S, Jaenisch R (1989) Germ-line transmission of 14. Zu Y, et al. (2013) TALEN-mediated precise genome modification by homologous a disrupted beta 2-microglobulin gene produced by homologous recombination in recombination in zebrafish. Nat Methods 10(4):329–331. embryonic stem cells. Nature 342(6248):435–438. 15. Sung YH, et al. (2013) Knockout mice created by TALEN-mediated gene targeting. Nat 4. Schwartzberg PL, Goff SP, Robertson EJ (1989) Germ-line transmission of a c-abl mu- Biotechnol 31(1):23–24. tation produced by targeted gene disruption in ES cells. Science 246(4931):799–803. 16. Kim Y, et al. (2013) A library of TAL effector nucleases spanning the human genome. 5. Capecchi MR (2005) Gene targeting in mice: Functional analysis of the mammalian Nat Biotechnol 31(3):251–258. genome for the twenty-first century. Nat Rev Genet 6(6):507–512. 17. Porteus MH, Carroll D (2005) Gene targeting using zinc finger nucleases. Nat Bio- 6. Brown WR, Hubbard SJ, Tickle C, Wilson SA (2003) The chicken as a model for large- technol 23(8):967–973. scale analysis of vertebrate gene function. Nat Rev Genet 4(2):87–98. 18. Park TS, Han JY (2012) piggyBac transposition into primordial germ cells is an efficient 7. Schusser B, et al. (2013) Immunoglobulin knockout chickens via efficient homologous tool for transgenesis in chickens. Proc Natl Acad Sci USA 109(24):9337–9341. recombination in primordial germ cells. Proc Natl Acad Sci USA 110(50):20170–20175. 19. Wong GK, et al.; International Chicken Polymorphism Map Consortium (2004) A ge- 8. Cui X, et al. (2011) Targeted integration in rat and mouse embryos with zinc-finger netic variation map for chicken with 2.8 million single-nucleotide polymorphisms. nucleases. Nat Biotechnol 29(1):64–67. Nature 432(7018):717–722. 9. Hauschild J, et al. (2011) Efficient generation of a biallelic knockout in pigs using zinc- 20. Burt DW (2002) Origin and evolution of avian microchromosomes. Cytogenet Ge- finger nucleases. Proc Natl Acad Sci USA 108(29):12013–12017. nome Res 96(1-4):97–112. 10. Kim S, Lee MJ, Kim H, Kang M, Kim JS (2011) Preassembled zinc-finger arrays for rapid 21. Yamamoto T, Juneja LR, Hatta H, Kim M (1997) Hen Eggs: Their Basic and Applied construction of ZFNs. Nat Methods 8(1):7. Science (CRC press, Boca Raton), pp 13–24.

Park et al. PNAS Early Edition | 5of6 Downloaded by guest on September 25, 2021 22. Zhu L, et al. (2005) Production of human monoclonal antibody in eggs of chimeric 31. Barrangou R, et al. (2007) CRISPR provides acquired resistance against viruses in chickens. Nat Biotechnol 23(9):1159–1169. prokaryotes. Science 315(5819):1709–1712. 23. Lillico SG, et al. (2007) Oviduct-specific expression of two therapeutic proteins in 32. Choi JW, et al. (2010) Basic fibroblast growth factor activates MEK/ERK cell signaling transgenic hens. Proc Natl Acad Sci USA 104(6):1771–1776. pathway and stimulates the proliferation of chicken primordial germ cells. PLoS ONE 24. Cong L, et al. (2013) Multiplex genome engineering using CRISPR/Cas systems. Science 5(9):e12968. 339(6121):819–823. 33. Macdonald J, Glover JD, Taylor L, Sang HM, McGrew MJ (2010) Characterisation and 25. Mali P, et al. (2013) RNA-guided human genome engineering via Cas9. Science 339(6121): germline transmission of cultured avian primordial germ cells. PLoS ONE 5(11): e15518. 823–826. 34. Macdonald J, et al. (2012) Efficient genetic modification and germ-line transmission 26. Cho SW, Kim S, Kim JM, Kim JS (2013) Targeted genome engineering in human cells of primordial germ cells using piggyBac and Tol2 transposons. Proc Natl Acad Sci USA with the Cas9 RNA-guided endonuclease. Nat Biotechnol 31(3):230–232. 109(23):E1466–E1472. 27. Hwang WY, et al. (2013) Efficient genome editing in zebrafish using a CRISPR-Cas 35. Sanjana NE, et al. (2012) A transcription activator-like effector toolbox for genome – system. Nat Biotechnol 31(3):227 229. engineering. Nat Protoc 7(1):171–192. 28. Wang H, et al. (2013) One-step generation of mice carrying mutations in multiple 36. Kim HJ, Lee HJ, Kim H, Cho SW, Kim JS (2009) Targeted genome editing in human cells – genes by CRISPR/Cas-mediated genome engineering. Cell 153(4):910 918. with zinc finger nucleases constructed via modular assembly. Genome Res 19(7): 29. Cho SW, Lee J, Carroll D, Kim JS, Lee J (2013) Heritable gene knockout in Caenorhabditis 1279–1288. elegans by direct injection of Cas9-sgRNA ribonucleoproteins. Genetics 195(3):1177–1180. 37. Doyle EL, et al. (2012) TAL Effector-Nucleotide Targeter (TALE-NT) 2.0: Tools for 30. Sung YH, et al. (2014) Highly efficient gene knockout in mice and zebrafish with RNA- TAL effector design and target prediction. Nucleic Acids Res 40(Web Server issue): guided endonucleases. Genome Res 24(1):125–131. W117-22.

6of6 | www.pnas.org/cgi/doi/10.1073/pnas.1410555111 Park et al. Downloaded by guest on September 25, 2021